CA1341604C - Dna sequences, recombinant dna molecules and processes for producing human fibroblast interferon-like polypeptides - Google Patents

Dna sequences, recombinant dna molecules and processes for producing human fibroblast interferon-like polypeptides

Info

Publication number
CA1341604C
CA1341604C CA374378A CA374378A CA1341604C CA 1341604 C CA1341604 C CA 1341604C CA 374378 A CA374378 A CA 374378A CA 374378 A CA374378 A CA 374378A CA 1341604 C CA1341604 C CA 1341604C
Authority
CA
Canada
Prior art keywords
leu
asn
glu
gln
arg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CA374378A
Other languages
French (fr)
Inventor
Walter Charles Fiers
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biogen MA Inc
Original Assignee
Biogen Idec MA Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=26275083&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CA1341604(C) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Biogen Idec MA Inc filed Critical Biogen Idec MA Inc
Application granted granted Critical
Publication of CA1341604C publication Critical patent/CA1341604C/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • C07K14/565IFN-beta
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • C12N15/73Expression systems using phage (lambda) regulatory sequences
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/40Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/22011Polyomaviridae, e.g. polyoma, SV40, JC
    • C12N2710/22022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Saccharide Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

DNA sequences, recombinant DNA molecules and hosts transformed with them which produce polypeptides displaying a biological or immunological activity of human fibroblast interferon, the genes coding for these polypeptides and methods of making and using these DNA sequences, molecules, hosts, genes and polypeptides. The DNA sequences are characterized by in that they code for a polypeptide displaying a biological or immunological activity of human fibroblast interferon. In appropriate hosts these DNA sequences and recombinant DNA molecules permit the production and identification of genes and polypeptides displaying a biological or immunological activity of human fibroblast interferon and their use in antiviral and antitumor or anitcancer agents.

Description

~

DNA SEQUENCES, RECOMBINANT DNA MOLECULES
AND PROCESSES FOR PRODUCING HUMAN
FIBROBLAST INTERFERON-LIKE POLYPEPTIDES

TECHNICAL FIELD OF INVENTION

This invention relates to DNA sequences, recombinant DNA molecules and process for producing human fibroblast interferon-like polypeptides. More particularly, the invention relates to DNA sequences expressed in apropriate host organism. The recombinant DNA molecules disclosed herein are characterized by DNA
sequences that code for polypeptides whose amino acid sequence and composition are substantially consistent with human fibroblast interferon and which have an immunological or biological activity of human fibroblast interferon. As will be appreciated from the disclosure to follow, the DNA sequences, recombinant DNA molecules and processes of this invention may be used in the production of polypeptides useful in antiviral and antitumor or anticancer agents and methods.

BACKGROUND ART

In this application the interferon nomenclature announced in Nature, 286, p. 2421 (July 10, 1980) will be used. This nomenclature replaces that used in our earlier applications from which this application claims priority. E.g., IF is now designated IFN and fibroblast interferon is now designated IFN-P.
Two classes of interferons ("IFN") are known to exist. Interferons of Class I are small, acid stable (glyco)-proteins that render cells resistant to viral infection (A. Isaacs and J. Lindenmann, "Virus Inter-ference I. The Interferon", Proc. Royal Soc. Ser. B., 147, pp. 258-67 (1957) and W. E. Stewart, II, The Interferon System, Springer-Verlag (1979) (hereinafter
-2- "The Interferon System")). Class II IFNs are acid labile. At present, they are poorly characterized.
Although to some extent cell specific (The Interferon System, pp. 135-45), IFNs are not virus specific.
Instead, IFNs protect cells against a wide spectrum of viruses.
Human interferon ("HuIFN") has been classified into three groups a, 0 and Y. HuIFN-P or fibroblast interferon is produced upon appropriate induction in diploid fibroblast cells. It is also produced in minor amounts, together with a major amount of HuIFN-a, in lymphoblastoid cells. IFN-P made from these cells has been extensively purified and characterized (E. Knight, Jr., "Interferon: Purification And Initial Characterization From Human Diploid Cells", Proc. Natl. Acad. Sci. USA, 73, pp. 520-23 (1976)). It is a glyco-protein of about 20,000 molecular weight (M. Wiranowska-Stewart, et al., "Contributions Of Carbohydrate Moieties To The Physical And Biological Properties Of Human Leukocyte, Lympho-blastoid And Fibroblast Interferons", Abst. Ann. Meeting Amer. Soc. Microbiol., p. 246 (1978)). It is also heterogeneous in regard to size presumably because of the carbohydrate moities.
The amino acid composition of authentic human fibroblast interferon has also been reported (E. Knight, Jr., et al., "Human Fibroblast Interferon: Amino Acid Analysis And Amino-Terminal Amino Acid Sequence", Science, 207, pp. 525-26 (1980)). And, elucidation of the amino acid sequence of authentic human fibroblast interferon is in progress. To date, the amino acid sequence of the NH2 terminus of the authentic mature protein has been reported for the first 13 amino acid residues: Met-Ser-Tyr-Asn-Leu-Leu-Gly-Phe-Leu-Gln-Arg-Ser-Ser... (E. Knight, Jr., et al., supra).
Two distinct genes, one located on chromosome 2, the other on chromosome 5, have been reported to code , ,.
-3- 1341604 for IFN-P (D. L. Slate and F. H. Ruddle, "Fibroblast Interferon In Man Is Coded By Two Loci On Separate Chromosomes", Cell, 16, pp. 171-80 (1979)). Other studies, however, indicate that the gene for IFN-P is located on chromosome 9 (A. Medger, et al., "Involvement Of A Gene On Chromosome 9 In Human Fibroblast Interferon Production", Nature, 280, pp. 493-95 (1979)).
Although authentic HuIFN-P is glycosylated, removal of the carbohydrate moiety (P. J. Bridgen, et al., "Human Lymphoblastoid Interferon", J. Biol. Chem., 252, pp. 6585-87 (1977)) or synthesis of IFN-0 in the presence of inhibitors which purport to preclude glyco-sylation (W. E. Stewart, II, et al., "Effect of Glyco-sylation Inhibitors On The Production And Properties Of Human Leukocyte Interferon", Virology, 97, pp. 473-76 (1979); J. Fujisawa, et al., "Nonglycosylated Mouse L
Cell Interferon Produced By The Action Of Tunicamycin", J. Biol. Chem., 253, pp. 8677-79 (1978); E. A. Havell, et al., "Altered Molecular Species Of Human Interferon Produced In The Presence Of Inhibitors of Glycosylation", J. Biol. Chem., 252, pp. 4425-27 (1977); The Interferon System, p. 181) yields a smaller form of IFN-P which still retains most or all of its IFN activity.
HuIFN-0, like many human proteins, may also be polymorphic. Therefore, cells of particular individuals may produce IFN-P species within the more general IFN-P
class which are physiologically similar but structurally slightly different from the prototype of the class of which it is a part. Therefore, while the protein structure of the IFN-P may be generally well-defined, particular individuals may produce IFN-ps that are slight variations thereof.
IFN-p is usually not detectable in normal or healthy cells (The Interferon System, pp. 55-57).
Instead, the protein is produced as a result of the cell's exposure to an IFN inducer. IFN inducers are Ift
-4- 93 4 1604 usually viruses but may also be non-viral in character, such as natural or synthetic double-stranded RNA, intra-cellular microbes, microbial products and various chemical agents. Numerous attempts have been made to take advan-tage of these non-viral inducers to render human cells resistant to viral infection (S. Baron and F. Dianzani (eds.), Texas Reports On Biology And Medicine, 35 ("Texas Reports"), pp. 528-40 (1977)). These attempts have not been very successful. Instead, use of exogenous HuIFN-0 itself is now preferred.
Interferon therapy against viruses and tumors or cancers has been conducted at varying dosage regimes and under several modes of administration (The Interferon System, pp. 305-321). For example, interferon has been effectively administered orally, by innoculation --intravenous, intramuscular, intranasal, intradermal and subcutaneous --, and in the form of eye drops, ointments and sprays. It is usually administered one to three times daily in dosages of 104 to 107 units. The extent of the therapy depends on the patient and the condition being treated. For example, virus infections are usually treated by daily or twice daily doses over several days to two weeks and tumors and cancers are usually treated by daily or multiple daily doses over several months or years. The most effective therapy for a given patient must of course be determined by the attending physician, who will consider such well known factors as the course of the disease, previous therapy, and the patient's response to interferon in selecting a mode of administra-tion and a dosage regime.
As an antiviral agent, HuIFN has been used to treat the following: respiratory infections (Texas Reports, pp. 486-96); herpes simplex keratitis (Texas Reports, pp. 497-500; R. Sundmacher, "Exogenous Interferon in Eye Diseases", International Virology IV, The Hague, Abstract nr. W2/11, p. 99 (1978)); acute hemorrhagic conjunctivitis
-5-(Texas Reports, pp. 501-10); adenovirus keratoconjunctivitis (A. Romano, et al., ISM Memo I-A8131 (October, 1979));
varicella zoster (Texas Reports, pp. 511-15); cytomegalo-virus infection (Texas Reports, pp. 523-27); and hepatitis B
(Texas Reports, pp. 516-22). See also The Interferon System, pp. 307-19. However, large-scale use of IFN as an antiviral agent requires larger amounts of IFN than heretofore have been available.
IFN has other effects in addition to its anti-viral action. For example, it antagonizes the effect of colony stimulating factor, inhibits the growth of hemo-poietic colony-forming cells and interferes with the normal differentiation of granulocyte and macrophage precursors (Texas Reports, pp. 343-49). It also inhibits erythroid differentiation in DMSO-treated Friend leukemia cells (Texas Reports, pp. 420-28). It is significant that some cell lines may be considerably more sensitive to HuIFN-0 than to HuIFN-a in these regards (S. Einhorn and H. Strander, "Is Interferon Tissue-Specific? -Effect Of Human Leukocyte And Fibroblast Interferons On The Growth Of Lymphoblastoid And Osteosarcoma Cell Lines", J. Gen. Virol., 35, pp. 573-77 (1977); T. Kuwata, et al., "Comparison Of The Suppression Of Cell And Virus Growth In Transformed Human Cells By Leukocyte And Fibroblast Interferon", J. Gen. Virol., 43, pp. 435-39 (1979)).
IFN may also play a role in regulation of the immune response. For example, depending upon the dose and time of application in relation to antigen, IFN can be both immunopotentiating and immunosuppressive in vivo and in vitro (Texas Reports, pp. 357-69). in addition, specifically sensitized lymphocytes have been observed to produce IFN after contact with antigen. Such antigen-induced IFN could therefore be a regulator of the immune response, affecting both circulating antigen levels and expression of cellular immunity (Texas Reports, pp. 370-74).
-6-IFN is also known to enhance the activity of killer lymphocytes and antibody-dependent cell-mediated cyto-toxicity (R. R. Herberman, et al., "Augmentation By Interferon Of Human Natural And Antibody-Dependent Cell-Mediated Cytotoxicity", Nature, 277, pp. 221-23 (1979); P. Beverley and D. Knight, "Killing Comes Natu-rally", Nature, 278, pp. 119-20 (1979); Texas Reports, pp. 375-80; J. R. Huddlestone, et, al., "Induction And Kinetics Of Natural Killer Cells in Humans Following Interferon Therapy", Nature, 282, pp. 417-19 (1979);
S. Einhorn, et al., "Interferon And Spontaneous Cytotox-icity In Man. II. Studies In Patients Receiving Exogenous Leukocyte Interferon", Acta Med. Scand., 204, pp. 477-83 (1978)). Both may be directly or indirectly involved in the immunological attack on tumor cells.
Therefore, in addition to its use as an antiviral agent, HuIFN has potential application in antitumor and anticancer therapy (The Interferon System, pp. 319-21 and 394-99). It is now known that IFNs affect the growth of many classes of tumors in many animals (The Interferon System, pp. 292-304). They, like other anti-tumor agents, seem most effective when directed against small tumors. The antitumor effects of animal IFN are dependent on dosage and time but have been demonstrated at concentrations below toxic levels.
Accordingly, numerous investigations and clinical trials have been and continue to be conducted into the antitumor and anticancer properties of HuIFNs. These include treatment of several malignant diseases such as osteosar-coma, acute myeloid leukemia, multiple myeloma and Hodgkin's disease (Texas Re op rts, pp. 429-35). In addition, HuIFN-P has recently been shown to cause local tumor regression when injected into subcutaneous tumoral nodules in melanoma and breast carcinoma-affected patients (T. Nemoto, et al., "Human Interferons And Intralesional Therapy Of Melanoma And Breast Carcinoma", Amer. Assoc.
-7-For Cancer Research, Abs nr. 993, p. 246 (1979)).
Although the results of these clinical tests are encourag-ing, the antitumor and anticancer applications of IFN-0 have been severely hampered by lack of an adequate supply of purified IFN-p.
Significantly some cell lines which resist the anticellular effects of IFN-a remain sensitive to IFN-0.
This differential effect suggests that IFN-S may be usefully employed against certain classes of resistant tumor cells which appear under selective pressure in patients treated with high doses of IFN-a (T. Kuwata, et al., supra; A. A. Creasy, et al., "The Role of GO-G1 Arrest In The Inhibition Of Tumor Cell Growth By Interferon", Abstracts, Conference On Regulatory Functions Of Interferons, N.Y. Acad. Sci., nr. 17 (October 23-26, 1979)).
At the biochemical level IFNs induce the formation of at least 3 proteins, a protein kinase (B. Lebleu, et al., "Interferon, Double-Stranded RNA And Protein Phosphorylation", Proc. Natl. Acad. Sci. USA, 73, pp. 3107-11 (1976); A. G. Hovanessian and I. M. Kerr, "The (2'-5') Oligoadenylate (ppp A2'-5A2'-5'A) Synthetase And Protein Kinase(s) From Interferon-Treated Cells", Eur. J. Biochem., 93, pp. 515-26 (1979)), a(2'-5')oligo(A) polymerase (A. G. Hovanessian, et al., "Synthesis Of Low-Molecular Weight Inhibitor Of Protein Synthesis With Enzyme From Interferon-Treated Cells", Nature, 268, pp. 537-39 (1977); A. G. Hovanessian and I. M. Kerr, Eur. J. Biochem, supra) and a phosphodiesterase (A. Schmidt, et al., "An Interferon-Induced Phosphodiesterase Degrading (2'-5')oligoisoadenylate And The C-C-A Terminus Of tRNA", Proc. Natl. Acad. Sci. USA, 76, pp. 4788-92 (1979)).
Both IFN-0 and IFN-a appear to trigger similar enzymatic pathways (C. Baglioni, "Interferon-Induced Enzymatic Activities And Their Role In The Antiviral State", Cell, 17, pp. 255-64 (1979)) and both may share _1341604
-8- = _ -a common active core because they both recognize a chromosome 21-coded cell receptor (M. Wiranowska-Stewart, "The Role Of Human Chromosome 21 In Sensitivity To Interferons", J. Gen. Virol., 37,. pp. 629-34 (1977)).
The appearance of one or more of these enzymes in cells treated with IFN should allow a further characterization of proteins with IFN-like activity.
Today, HuIFN-0 is produced by human cell lines grown in tissue culture. It is" a low yield, expensive process. One large producer makes only 40-50 x 108 units of crude IFN-P per year (V. G. Edy, et al., "Human Interferon: Large Scale Production In Embryo Fibroblast Cultures", in Human Interferon (W. R. Stinebring and P. J. Chapple, eds.), Plenum Publishing Corp., pp. 55-60 (1978)). On purification by adsorption to controlled pore glass beads, IFN-p of specific activity of about 106 units/mg may be recovered in 50% yield from the crude cell extracts (A. Billiau, et al., "Human Fibroblast Interferon For Clinical Trials: Production, Partial Purification And Characterization", Antimicrobial Agents And Chemotherapy, pp. 49-55 (1979)). Further purification to a specific activity of about 109 units/mg is accom-plished by zinc chelate affinity chromatography in about 100% yield (A. Billiau, et al., "Production, Purification And Properties Of Human Fibroblast Interferon", Abstracts, Conference On Regulatory Functions Of Interferons, N.Y.
Acad. Sci., nr 29 (October 23-26, 1979)). Because the specific activity of HuIFN-S is so high, the amount of IFN-0 required for commercial applications is low. For example, 100 g of pure IFN-0 would provide between 3 and 30 million doses.
Recent advances in molecular biology have made it possible to introduce the DNA coding for specific non-bacterial eukaryotic proteins into bacterial cells.
In general, with DNA other than that prepared via chemical synthesis, the construction of such recombinant DNA
-9-molecules comprises the steps of producing a single-stranded DNA copy (cDNA) of a purified messenger RNA
(mRNA) template for the desired protein; converting the cDNA to double-stranded DNA; linking the DNA to an appropriate site in an appropriate cloning vehicle to form a recombinant DNA molecule and transforming an appropriate host with that recombinant DNA molecule.
Such transformation may permit the host to produce the desired protein. Several non-bacterial genes and proteins have been obtained in E. coli using recombinant DNA
technology. These include, for example, IFN-a (S. Nagata, et al., "Synthesis In E. coli Of A Polypeptide With Human Leukocyte Interferon Activity", Nature, 284, pp. 316-20 (1980)). In addition, recombinant DNA tech-nology has been employed to produce a plasmid said to contain a gene sequence coding for IFN-0 (T. Taniguchi, et al., "Construction And Identification Of A Bacterial Plasmid Containing The Human Fibroblast Interferon Gene Sequence", Proc. Japan Acad. Ser. B, 55, pp. 464-69 (1979)).
However, in neither of the foregoing has the actual gene sequence of IFN-0 been described and in neither has that sequence been compared to the initial amino acid sequence or amino acid composition of authentic IFN-P. The former work is directed only to IFN-a, a distinct chemical, biological and immunological Class I
interferon from IFN-P (cf. supra). The latter report is based solely on hybridization data. These data alone do not enable one to determine if the selected clone contains the complete or actual gene sequence coding for IFN-P or if the cloned gene sequence will be able to express IFN-P in bacteria. Hybridization only establishes that a particular DNA insert is to some extent homologous with and complementary to a mRNA component of the poly(A) RNA that induces interferon activity when injected into
-10- 1341604_ oocytes. Moreover, the extent of any homology is dependent on the hybridization conditions chosen for the screening process. Therefore, hybridization to a mRNA component of poly(A) RNA alone does not demon-strate that the selected DNA sequence is a sequence which codes for HuIFN-S or a polypeptide which dis-plays the immunological or biological activity of HuIFN-S or that such sequence will be useful in pro-ducing such polypeptides in appropriate hosts.
At a seminar in Zurich on February 25, 1980, Taniguchi stated that he had determined the nucleotide sequence for one of his hybridizing clones.
He also stated that the first 13 amino acids coded for by that sequence were identical to that determined by Knight, et al., supra, for authentic HuIFN-S.
Taniguchi did not disclose the full nucleotide sequence for his clone or compare its amino acid composition with that determined for authentic HuIFN-S. Taniguichi has since reported the full nucleotide sequence for his hybridizing clone (T. Taniguichi et al., Gene, 10, pp. 11-15 (1980)). The sequence differs by one nucloetide from that described and claimed in this application. The amino acid sequence reported by Taniguichi is identical to that described and claimed in this application. At that time, Taniguichi had also not reported the expression in an appropriate host of polypeptides which display an immunological or biological activity of HuIFN-0. It is this expres-sion in a host of polypeptide(s) displaying an immuno-logical or biological activity of HuIFN-S and the methods, polypeptides, genes and recombinant DNA
molecules thereof, which characterize this inven-tion.
-11- 13 4 1 604 Nor is this invention addressed as is the apparent suggestion of Research Disclosure No. 18309, pp. 361-62 (1979) to prepare pure or substantially pure IFN-a mRNA before attempting to clone the IFN gene or to produce fibroblast interferon-like polypeptides in bacterial hosts.
Finally, it should be recognized that the selection of a DNA sequence or the construction of a recombinant DNA molecule which hybridizes to a mRNA from polyA RNA, that mRNA producing HuIFN activity in oocytes, is not sufficient to demonstrate that the DNA sequence or the hybrid insert of the recombinant DNA molecule corresponds to HuIFN. Instead, in the absence of a comparison of the amino acid sequence coded for by a particular DNA sequence and the amino acid sequence of the authentic protein, only the production of a polypep-tide that displays an immunological or biological activity of HuIFN can actually demonstrate that the selected DNA
sequence or constructed recombinant DNA molecule corresponds to HuIFN. More importantly, it is only after such HuIFN
activity is shown that the DNA sequence, recombinant DNA
molecule or sequences related to them may be usefully employed to select other sequences corresponding to HuIFN in accordance with this invention or to produce recombinant DNA molecules that may express products having an immunological or biological activity of HuIFN-P.
It will therefore be appreciated from the foregoing that the problem of producing HuIFN-P with the use of recombinant DNA technology is much different than any of the above described processes. Here, a particular DNA sequence of unknown structure -- that coding for the expression of HuIFN-S in an appropriate host -- must be found in and separated from a highly complex mixture of DNA sequences in order for it to be used in the production of HuIFN-P. Furthermore, this location and separation problem is exacerbated by the predicted exceedingly low
-12- 13 4 1 6 0 4-concentration of the desired DNA sequence in the complex mixture and the lack of an effective means for rapidly analyzing the many DNA sequences of the mixture to select and separate the desired sequence.

DISCLOSURE OF THE INVENTION

The present invention solves the problems referred to by locating and separating DNA sequences that code for the expression of HuIFN-0 in an appropriate host thereby providing DNA sequences, recombinant DNA
molecule and methods by means of which a host is trans-ferred to produce a polypeptide displaying an immuno-logical or biological activity of human fibroblast interferon.
By virtue of this invention, it is possible to obtain polypeptides displaying an immunological or biological activity of HuIFN-0 for use in antiviral, antitumor or anticancer agents and methods. This inven-tion allows the production of these polypeptides in amounts and by methods hitherto not available.
As will be appreciated from the disclosure to follow, the DNA sequences and recombinant DNA molecules of the invention are capable of directing the production, in an appropriate host, of polypeptides displaying an immunological or biological activity of HuIFN-0. Replica-tion of these DNA sequences and recombinant DNA molecules in an appropriate host also permits the production in large quantities of genes coding for these polypeptides.
The molecular structure and properties of these polypep-tides and genes may be readily determined. The polypep-tides and genes are useful, either as produced in the host or after appropriate derivatization or modification, in compositions and methods for detecting and improving the production of these products themselves and for use in antiviral and antitumor or anticancer agents and methods.
-13- 1341604_ This process is therefore distinguishable from the prior processes, above mentioned, in that this process, contrary to the noted prior processes, involves the preparation and selection of DNA sequences and recombinant DNA molecules which contain appropriate DNA
sequences which code for at least one polypeptide display-ing an immunological or biological activity of HuIFN-0.
It will be appreciated from the foregoing that a basic aspect of this invention is the provision of a DNA sequence which is characterized in that it codes for a polypeptide displaying an immunological or biological activity of HuIFN-P and is selected from the group consisting of the DNA inserts of G-pHFIF-1, G-pHFIF-3, G-pHFIF-6, G-pHFIF-7, G-pPla-HFIF-67-12, G-pPla-HFIF-67-12A19, G-pPlc-HFIF-67-8, G-pPla-HFIF-67-12A279T, G-pPla-HFIF-67-12A218M1, G-pPla-HFIF-67-12AM1, G-pPla-HFIF-67-12019BX-2, DNA sequences which hybridize to any of the foregoing DNA inserts, DNA sequences, from whatever source obtained, including natural, synthetic or semi-synthetic sources, related by mutation, including single or multiple, base substitutions, deletions, insertions and inversions to any of the foregoing DNA
sequences or inserts, and DNA sequences comprising sequences of codons which on expression code for a polypeptide displaying similar immunological or biological activity to a polypeptide coded for on expression of the codons of any of the foregoing DNA sequences. The sequences of this invention are further characterized in that they permit the production of HuIFN-P and HuIFN-p-like polypeptides in hosts.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a schematic outline of one embodi-ment of a process of this invention for preparing a mixture of recombinant DNA molecules, some of which are characterized by inserted DNA sequences that code for the polypeptides of this invention.
-14- 13 4 1 604 Figure 2 is a schematic outline of the initial clone screening process of this invention.
Figure 3 is a schematic outline of one embodiment of a clone screening process using DNA
sequences prepared in accordance with the invention.
Figure 4 displays the composite nucleotide sequence of the coding strand of HuIFN-~ DNA. The sequence is numbered from the beginning of the insert well into the untranslated area of the insert. Nucleo-tides 65-127 represent a signal sequence and nucleo-tides 128-625 represent the "mature" fibroblast inter-feron. The amino acid sequences of the signal poly-peptide are depicted above their respective nucleotide sequences; the amino acids of the signal polypeptide being numbered from -21 to -1 and the amino acids of mature interferon being numbered from 1 to 166. Review of the restriction and fragment analysis data of the HuIFN-0 DNA present in the cultures deposited by applicant on April 2, 1980, has resulted in two nucleotides being changed in Figure 4 of this appli-cation. These changes are in the untranslated sequence preceding the proposed signal sequence of HuIFN-S DNA. These changes do not effect the sequence of HuIFN-0 DNA or the amino acid sequence of its translation product and do not alter the sequence's use as an hydridization probe to screen clones for HuIFN-~ related DNA inserts.
Figure 5 displays the orientation and restriction maps of several plasmids in accordance with this invention.
Figure 6 is a comparison of the amino acid composition of human fibroblast interferon as deter-mined in accordance with this invention and that determined from authentic fibroblast interferon.

-i5- 13 4 1 fi 0 4 Figure 7 displays a restriction map of the HuIFN-p gene of this invention and the sequencing strategy used in sequencing pHFIF3, pHFIF6, and pHFIF7.
Figure 8 is a schematic outline of the construc-tion of recombinant DNA molecule pPLa-HFIF-67-1 of this invention.
Figure 9 is a schematic outline of the construc-tion of recombinant DNA molecule pPLa-HFIF-67-12 and pPLa-HFIF-67-12A19 of this invention.
Figure 10 is a schematic outline of the con-struction of recombinant DNA molecule pPLc-HFIF-67-8 of this invention.
Figure 11 is a schematic outline of the orien-tation and partial restriction map of pPLa-HFIF-67-12 of this invention.
Figure 12 is a schematic outline of the orien-tation and partial restriction map of pPLa-HFIF-67-12Al9 of this invention.
Figure 13 is a schematic outline of the orien-tation and partial restriction map of pPLc-HFIF-67-8 of this invention.

BEST MODE OF CARRYING OUT THE INVENTION

In order that the invention herein described may be more fully understood, the following detailed description is set forth.
In the description the following terms are employed:
Nucleotide--A monomeric unit of DNA or RNA
consisting of a sugar moiety (pentose), a phosphate, and a nitrogenous heterocyclic base. The base is linked to the sugar moiety via the glycosidic carbon (1' carbon of the pentose) and that combination of base and sugar is called a nucleoside. The base characterizes the nucle-otide. The four DNA bases are adenine ("A"), guanine ("G"), cytosine ("C"), and thymine ("T"). The four bases are A, G, C and uracil ("U").
DNA Sequence--A linear array of nucleotides connected one to the other by phosphodiester bonds between the 3' and 5' carbons of adjacent pentoses.
Codon--A DNA sequence of three nucleotides (a triplet) which encodes through mRNA an amino acid, a translation start signal or a translation termination signal. For example, the nucleotide triplets TTA, TTG, CTT, CTC, CTA and CTG encode for the amino acid leucine ("Leu"), TAG, TAA and TGA are translation stop signals and ATG is a translation start signal.
Reading Frame--The grouping of codons during translation-of mRNA into amino acid-sequences. During translation the proper reading frame must be maintained.
For example, the DNA sequence GCTGGTTGTAAG may be expressed in three reading frames or phases, each of which affords a different amino acid sequence:
GCT GGT TGT AAG--Ala-Gly-Cys-Lys G CTG GTT GTA AG--Leu-Val-Val GC TGG TTG TAA G--Trp-Leu-(STOP) Polypeptide--A linear array of amino acids connected one to the other by peptide bonds between the a-amino and carboxy groups of adjacent amino acids.
Genome--The entire DNA of a cell or a virus.
It includes inter alia the structural genes coding for the polypeptides of the substance, as well as operator, promoter and ribosome binding and interaction sequences, including sequences such as the Shine-Dalgarno sequences.
Structural Gene--A DNA sequence which encodes through its template or messenger RNA ("mRNA") a sequence of amino acids characteristic of a specific polypeptide.
Transcription--The process of producing mRNA
from a structural gene.
Translation--The process of producing a polypep-tide from mRNA.

Expression--The process undergone by a struc-tural gene to produce a polypeptide. It is a combina-tion of transcription and translation.
Plasmid--A nonchromosomal double-stranded DNA
sequence comprising an intact "replicon" such that the plasmid is replicated in a host cell. When the plasmid is placed within a unicellular organism, the charac-teristics of that organism may be changed or transformed as a result of the DNA of the plasmid. For example, a plasmid carrying the gene for tetracycline resistance (TetR) transforms a cell previously sensitive to tetra-cycline into one which is resistant to it. A cell transformed by a plasmid is called a "transformant".
Phage or Bacteriophage--Bacterial virus many of which consist of DNA sequences encapsidated in a protein envelope or coat ("capsid").
Cloning Vehicle--A plasmid, phage DNA or other DNA sequence which is able to replicate in a host cell, characterized by one or a small number of endonuclease recognition sites at which such DNA sequences may be cut in a determinable fashion without attendant loss of an essential biological function of the DNA, e.g., replica-tion, production of coat proteins or loss of promoter or binding sites, and which contain a marker suitable for use in the identification of transformed cells, e.g., tetracycline resistance or ampicillin resistance. A
cloning vehicle is often called a vector.
Cloning--The process of obtaining a population of organisms or DNA sequences derived from one such organism or sequence by asexual reproduction.
Recombinant DNA Molecule or Hybrid DNA--A
molecule consisting of segments of DNA from different genomes which have been joined end-to-end outside of living cells and have the capacity to infect some host cell and be maintained therein.

-18- 13 4 1 6 0 4_ Expression Control Sequence--A sequence of nucleotides that controls and regulates expression of structural genes when operatively linked to those genes.
They include the lac system, major operator and promoter regions of phage X, the control region of fd coat protein and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells and their viruses.
Referring now to Figure 1, we have shown therein a schematic outline of one embodiment of a process for preparing a mixture of recombinant DNA
molecules, some of which include inserted DNA sequences that characterize this invention.

PREPARATION OF POLY(A)RNA CONTAINING HUMAN
FIBROBLAST INTERFERON mRNA (IFN-S mRNA) The RNA used in this invention was extracted from human VGS cells, a diploid fibroblast cell line which can be propagated in monolayer cultures at 37 C.
IFN-0 is produced in these cells on induction with poly(I,C) in the presence of cycloheximide.
For a typical RNA isolation, each of 20 roller bottles of diploid VGS cells in confluent monolayer was "primed" overnight with 100 units/ml IFN-0 and the cultures induced for 1 h with 100 Ng/ml poly(I,C) and 50 pg/mi cycloheximide, incubated with cycloheximide (50 pg/ml) for 4 h, harvested by scraping into phosphate-buffered saline and spun down. The cells were lysed for
15 min at O C to remove the intact nuclei containing the DNA and to isolate the cytoplasmic RNA by suspending them in hypotonic buffer (10 mM Tris-HC1 (pH 7.4), 10 mM NaCl and 1.5 mM MgC12) and adding NP40 to 1%.
Nuclei were removed by pelleting in a Sorvall SS-34 rotor for 5 min at 3000 rpm. Sodium dodecyl sulphate ("SDS") and EDTA were added to the supernatant to 1% and 10 mM, respectively, and the mixture extracted 5 times with 2x vol of 1:1 redistilled phenol and chloroform-isoamyl alcohol (25:1), the aqueous phases containing the RNA
being separated by centrifugation in a Sorvall SS-34 rotor at 8000 rpm for 10 min after each extraction. The RNA was precipitated from the aqueous phase'by addition of 1/10 vol of 2 M sodium acetate (pH 5.1) and 2.5 vol ethanol. Usually, 60 to 90 pg of total cytoplasmic RNA
were obtained per roller bottle.
Other procedures to extract the cytoplasmic RNA have also been used. For example, the cells were totally lysed after homogenization in 0.2 M Tris-HC1 (pH 9.0), 50 mM NaCl, 20 mM EDTA and 0.5% SDS and extracted with phenol-chloroform as above (F. H. Reynolds, et al., "Interferon Activity Produced By Translation Of Human Interferon Messenger RNA In Cell-Free Ribosomal Systems And In Xenopus Oocytes", Proc. Natl. Acad. Sci. USA, 72, pp. 4881-87 (1975)) or the washed cells were suspended in 400 p1 0.1 M NaCl, 0.01 M Tris-HC1 (pH 7.5), and 0.001 M EDTA ("NTE buffer") and 2.5 ml 4 M guanidinium-isothiocyanate and 1 MP-mercaptoethanol in 20 mM sodium acetate (pH 5.0) were added and the cells homogenized.
The lysate was layered on a 1.3-m1 5.7 M CsCl cushion in a Beckman SW-60 Ti nitrocellulose tube, spun for 17 h at 39000 rpm to pellet the RNA and separate it from DNA, proteins and lipids and the RNA extracted once with phenol-chloroform (J. Morser, et al., "Characterization Of Interferon Messenger RNA From Human Lymphoblastoid Cells", J. Gen. Virol., 44, pp. 231-34 (1979)).
The total RNA was assayed for the presence of IFN-p mRNA by injection into the cytoplasm of Xenopus laevis oocytes and determination of the IFN-0 activity induced therein (Reynold, et al., supra). The assay was conducted by dissolving the RNA in water and injecting about 50 N1 into each oocyte. The oocytes were incubated overnight at room temperture in Barth medium (J. Gurdon, J. Embryol. Exper. Morphol., 20, pp. 401-14 (1968)), homogenized in part of the medium, the debris removed.by centrifugation, and the IFN-P activity of the supernatant determined. Detection of IFN-0 activity was by reduction of virus-induced cytopathic effect (W. E. Stewart and S. E. Sulkin, "Interferon Production In Hampsters Experi-mentally Infected With Rabies Virus", Proc. Soc. Exp.
Biol. Med., 123, pp. 650-53 (1966)). The challenge virus was vesicular stomatitis virus (Indiana strain) and the cells were human diploid fibroblasts trisomic for chromosome 21 to afford higher IFN-P sensitivity.
IFN-P activity is expressed relative to the IFN reference standard 69/19.
Poly(A) RNA containing IFN-P mRNA was isolated from the cytoplasmic RNA by adsorption to oligo(dT)-cellu-lose (type 7; P-L Biochemicals) in 0.4 M NaCl, 10 mM
Tris-HC1 (pH 7.8), 10 mM EDTA and 0.2% SDS for 10 min at room temperature. RNA aggregation was minimized by heating the RNA for 2 min at 70 C prior to adsorption.
After washing the cellulose with the above-mentioned buffer, the poly(A) RNA fraction was eluted with 10 mM
Tris-HC1 (pH 7.8), 1 mM EDTA and 0.2% SDS. It usually comprised 4-5% of the total RNA, as measured by optical density at 260 nm.
A further purification to enrich the poly(A)RNA
in IFN-P mRNA was effected by formamide-sucrose gradients (T. Pawson, et al., "The Size of Rous Sarcoma Virus mRNAs Active In Cell-Free Translation", Nature, 268, pp. 416-20 (1977)). These gradients gave much higher resolution than non-denaturing sucrose gradients.
Usually about 80 pg poly(A) RNA was dissolved in 50% formamide, 100 mM LiCI, 5 mM EDTA, 0.2% SDS and 10 mM Tris-HC1 (pH 7.4), heated at 37 C for 2 min to prevent aggregation and loaded on a 5-20% sucrose gradient in a Beckman SW-60 Ti polyallomer tube. After centrifu=
gation at 20 C for 4 1/2 h at 60000 rpm in the Beckman SW-60 Ti rotor with total 14C-labeled eukaryotic RNA
serving as size markers, the gradient was fractionated and the optical density of the fractions determined.
All RNA fractions were precipitated twice with 0.5 M
NaCl and 2.5 vol ethanol and assayed for interferon mRNA
activity as described above. These purification processes result in about a 40-fold enrichment in the IFN-P mRNA
content of the poly(a) RNA.
Alternatively, the oligo(dT)-adsorbed mRNA
(60 pg) was fractionated by electrophoresis in a 4% polyacrylamide gel in 7 M urea, 0.1% SDS, 50 mM
Tris-borate (pH 8.3), and 1 mM EDTA, the mRNA being dissolved in this buffer and heated 1 min at 55 C before application to the gel. After electrophoresis, sections of 2 mm width were cut from the gel and the RNA eluted from each homogenized gel section, further freed from impurities by adsorption to oligo(dT)-cellulose and assayed for IFN-0 mRNA as before.
At this point it should be recognized that even the poly(A) RNA product obtained from the formamide-sucrose gradients nor the polyacrylamide gel fractionation contains a very large number of different mRNA's.
Except for the mRNA specific for IFN-P, the other mRNAs are undesirable contaminants (Figure 1). Unfortunately, these contaminant RNAs behave similarly to HuIFN-0 mRNA
throughout the remainder of the cloning process of this invention. Therefore, their presence in the poly(A) RNA
will result in the ultimate preparation of a large number of unwanted bacterial clones which contain genes that may code for polypeptides other than IFN-0. This contamination presents complex screening problems in the isolation of the desired IFN-0 hybrid clones. In the case of IFN-P, the screening problem is further exacerbated by the lack of a sufficiently purified sample of HuIFN-S mRNA
or DNA or portion thereof to act as a screening probe for the identification of the desired clones. Therefore, the screening process for the IFN-p clones is very time-consuming and difficult. Further, because only a very small percentage of IFN-0 clones themselves are expected to express IFN-0 in a biologically or immunologi-cally active form, the isolation of an active clone is a "needle in a haystack" screening process.
Advantageously, we may use recombinant DNA
technology to provide a purified sample of HuIFN-S mRNA
or cDNA or a portion thereof. This purified mRNA or cDNA can then be used to screen rapidly very large numbers of bacterial clones and thereby markedly increase the probability of isolating a clone which expresses IFN-P in an active form.

SYNTHESIS OF DOUBLE-STRANDED
cDNA CONTAINING IFN-S cDNA

Poly(A) RNA enriched in IFN-P mRNA was used as a template to prepare complementary DNA ("cDNA"), essen-tially as described by R. Devos, et al., "Construction And Characterization Of A Plasmid Containing A Nearly Full-Size DNA Copy Of Bacteriophage MS2 RNA", J. Mol. Biol., 128, pp. 595-619 (1979) for the construction of a plasmid containing a DNA copy of bacteriophage MS2 RNA.
Single-stranded cDNA was prepared from the poly(A) RNA by RNA-dependent DNA polymerase (25 units) from avian myeloblastosis virus ("AMV") reverse trans-criptase (a gift from Dr. J. Beard, Life Sciences, Gulfport, Florida), initiated by a(dT)10 primer (6 pg, Miles) hybridized to the poly(A) tail of the RNA, in 50 N1 50 mM Tris-HC1 (pH 8.3), 10 mM MqC12, 30 mM
P-mercaptoethanol, 4 mM Na4P2O7, 2.5 pg/pl inactivated bovine serum albumin, dTTP, dATP, dCTP and dGTP, each at 0.5 mM and a-32P-dATP (20 pCi, Amersham). After 30 min at 41 C, the reaction was terminated by the addition of EDTA to 10 mM, the reaction mixture extracted with equal vol of phenol:chloroform:isoamyl alcohol (25:24:1) and the aqueous phase layered on a Sephadex G50 column and eluted in TE buffer (10 mM Tris-HC1 (pH 7.5) 1 mM EDTA).
The void fractions displaying radioactivity were precipi-tated by the addition of 10 pg E. coli transfer RNA, potassium acetate (pH 5.1) to 0.2 M and 2.5 vol ethanol.
The cDNA population synthesized above is in fact a complex mixture of cDNAs originating from the different mRNAs which were present in the enriched poly(A) mRNA (Figure 1). In addition, because of premature termination by AMV reverse transcriptase, many of the cDNAs are incomplete copies of the various mRNAs in the poly(A) RNA (not shown in Figure 1).
Before rendering the cDNA double-stranded, it is removed from its association to the complementary template RNA by precipitation with ethanol and incubation in TE buffer (10 mM Tris-HC1 (pH 7.5), 1 mM EDTA) with ribonuclease T 1 (10 units, Sankyo Co., Ltd) and pancreatic ribonuclease A (10 pg, Sigma) to 10 N1 for 30 min at 37 C (the ribonucleases being free of single-strand-specific endo- and exo-deoxyribonucleases). The removal of the template strand by ribonuclease instead of with alkali avoids possible cDNA mutation by alkali-catalyzed deamination.
The cDNA strand may be rendered double-stranded by DNA polymerase I (A. Efstratiadis, et al., "Enzymatic In Vitro Synthesis Of Globin Genes", Cell, 7, pp. 279-88 (1976)). The 10 p1 ribonuclease/cDNA mixture from above was diluted to 20 N1 with MgC12 to 10 mM, DTT to 10 mM, potassium phosphate (pH 6.9) to 100 mM, dATP, dCTP, dTTP, and dGTP each to 0.3 mM, a-32P-dATP (20 pCi, Amersham) and DNA polymerase I(40 units, Biolabs).
After 6 h at 15 C, EDTA to 10 mM and SDS to 0.1% were added and the double-stranded cDNA isolated by extraction (phenol:chloroform:isoamyl alcohol), chromatography 4 1 6~~0 ~4 (3,ephade~~G50) and precipitation of void fractions ag"
befor.e..
To open the single-stranded hairpin loop vhich remains on the double stranded cDNA structure, the precipitated cDNA was dissolved in 100 N1 0.2 M NaCl,,.550 mM sodium acetate (pH 4.5), 10 mM zinc acetate and 2 Ng heat-denatured calf thymus DNA and reacted with 51 nuclease (5 units, Sigma) for 30 min at 37 C. Addition of EDTA to 10 mM, extraction with phenol:chloroform.:isoatnyl alcohol and precipitation of the aqueous phase by the addition of 10 Ng E. coli transfer,RNA as carrier, 0.2 M
sodium acetate (pH 5.1).and 2.5 vol ethanol yielded a blunt-ended doubl'e, stranded cDNA mixture. This mixture is heterogeneous both as a.con$equtnce of the hetero-geneity of the poly(A) RNA used as a template to prepare it (Figure 1) dnd of the premature,'termination, of . , . , ... ._ .
oDNA transcripts by theAMv reverse transcriptase (not shown in Figure 1).
To lessen the effect of the latter hetero-geneity, the double stranded cDNA was sized by electro-phoresis on a 4%.polyacrylamide gel.in 50 mM Tris-borate buffer (pH 8.3) and 1 mM EDTA, 51-S2P-labelled restric-tion fragments (aX174 (RF)-DNA) serving as size markers.
DNA bands of appropriate size I.S;q., size classes 800-900 bp, 700-800 bp, 650-7M.'bp and 550-650 bp) were gelected. Because the double-stranded cDNA prepared from the polyacrylamide gel elesctxctphoresed poly(A) RNA
displayed a prominent band about bp, tfiis band was considered to represent the full-3e.hqith DNA. The bande were eluted by crushing the gel in. 4.5 M amraonium acetate and 0.1% SDS and stirring overnight. After the debris had been removed-by centrifugation, the DNA was adsorbed to hydroxylapatite powder, loaded on a Sephadex G50 column in 5 mM sodium phosphate (pH 7.5), washed extensively with buffer, eluted with 0.45 M sodium phosphate (pH 7.5) *is a trademark .

-2S- 13 4 1 6 0:4 and immediately desa3.ted by the sieving effect of the.
Sephadex*G50 matrix. The fracti.iomi-= containing the. ,'.;
~2P-radioactivit eluted DNA, as monitored by the .
y, yere precipitated by the addition cf 10 pg E. ec 1f transfer RHA, sodium acetate to 0.2' M and 2.5 vol ethanol.
The efficiency of the cDNA preparation, described above, is exemplified by a typical experiment where about 2 pg poly(A) RNA after formamide-suarose gradient yi.elded about 16 ng double-stranded cDNA having a size range of 800 to 900 bp.
Again, it must be recognized that this double-stranded CDNA i.s.a mixture-of a large number of cDNAs, only a very few 'n~~~~"uhich are I FN- ,$,:'. cDNA (Figure 1). ..;:

CLONING OF DOUBL,E-S'DED DNA

A wide variety.af *host/~:lo'ning vehicle combina-tions may.be employed in cloniriq''"V'ie double-stranded cDNA prepared in accordance with this invention. For example, useful cloniti.i~' vehicles may consist of sagments of chromosomal, non-chrcmosoteal and synthetic DNA sequences, such as various known derivatives of SV40 and ksiowzi .
bacterial plasmi.ds, e. ., plasmids from E. colx including col El, pCR1, pBR322, pMB9 and their derivatives, wider host range plasmids, e. .., RP4, phage DNAs, e 9., the e. ., NM 989, and other numerous derivatives of phage A, DNA phages, e.g., M13 and Fi,lameateous single stranded DNA phaqes and vectors 4erived fraii combinations of plasmids and phage DNAs such as pl.atmids which have,been modified to employ phago DNA or other expression control sequences or yeast pl,asmids suchas the 2 p plasmid or derivatives thereof.', Useful hosta may include bacterial hosts such as E. coli HB 101, E. ~'901 X1776, ' E. co1 wseudoriaonas, 8ae~ i31'~
X2282, E. co l i NtRCZ and. strains df; I
subtilis, Bacilluv'lit.bikiQ'~ 1,~s and other bacill'i.
.,. ~~. .
yeasts and other fungi.,^animal or plant hosts such as animal (including han) or plant cells in culture or * is a trademark -26- - other hosts. Of course, not all host/vector combinations may be equally efficient. The particular selection of host/cloning vehicle combination may be made by those of skill in the art after due consideration of the principles set forth without departing from the scope of this invention.
Furthermore, within each specific cloning vehicle, various sites may be selected for insertion of the double-stranded DNA. These sites are usually desig-nated by the restriction endonuclease which cuts them.
For example, in pBR322 the PstI site is located in the gene for p-lactamase, between the nucleotide triplets that code for amino acids 181 and 182 of that protein.
This site was initially employed by S. Nagata et al., supra, in their synthesis of polypeptides displaying an immunological or biological activity of IFN-a. One of the two HindII endonuclease recognition sites is between the triplets coding for amino acids 101 and 102 and one of the several Tag sites at the triplet coding for amino acid 45 of P-lactamase in pBR322. In similar fashion, the EcoRI site and the PvuII site in this plasmid lie outside of any coding region, the EcoRI site being located between the genes coding for resistance to tetracycline and ampicillin, respectively. This site was employed by T. Taniguchi et al., supra, in their recombinant synthetic scheme. These sites are well recognized by those of skill in the art. It is, of course, to be understood that a cloning vehicle useful in this invention need not have a restriction endonuclease site for insertion of the chosen DNA fragment. Instead, the vehicle could be joined to the fragment by alternative means.
The vector or cloning vehicle and in particular the site chosen therein for attachment of a selected DNA
fragment to form a recombinant DNA molecule is determined by a variety of factors, e.g., number of sites susceptible to a particular restriction enzyme, size of the protein to be expressed, susceptibility of the desired protein to proteolytic degradation by host cell enzymes, contami-nation or binding of the protein to be expressed by host cell proteins difficult to remove during purification, expression characteristics, such as the location of start and stop codons relative to the vector sequences, and other factors recognized by those of skill in the art. The choice of a vector and an insertion site for a particular gene is determined by a balance of these factors, not all selections being equally effective for a given case.
Although several methods are known in the art for inserting foreign DNA into a cloning vehicle or vector to form a recombinant DNA molecule, the method preferred for initial cloning in accordance with this invention-is digesting the plasmid (in particular pBR322) with that restriction enzyme specific to the site chosen for the insertion (in particular PstI) and adding dA tails to the 3' termini by terminal transferase. In similar fashion, the double-stranded cDNA is elongated by the addition of dT tails to the 3' termini to allow joining to the tailed plasmid. The tailed plasmid and cDNA are then annealed to insert the cDNA in the appropriate site of the plasmid and to circularize the hybrid DNA, the complementary character of the tails permitting their cohesion (Figure 1). The resulting recombinant DNA
molecule now carries an inserted gene at the chosen PstI
restriction site (Figure 1). This method of dA-dT
tailing for insertion is described by D. A. Jackson, et al., "Biochemical Methods For Inserting New Genetic Information Into DNA Of Simian Virus 40: Circular SV40 DNA Molecules Containing Lambda Phage Genes And The Galactose Operon Of Escherichia coli", Proc. Natl. Acad.
Sci. USA, 69, pp. 2904-909 (1972) and R. Devos, et al., -28- -13 4 1 6 4 4~.

supra. It results in about 3 times as many recombinant DNA plasmids as dG-dC tailing.
Of course, other known methods of inserting DNA sequences into cloning vehicles to form recombinant DNA molecules are equally useful in this invention.
These include, for example, dG-dC tailing, direct liga-tion, synthetic linkers, exonuclease and polymerase-linked repair reactions followed by ligation, or extension of the DNA strand with DNA polymerase and an appropriate single-stranded template followed by ligation.
It should, of course, be understood that the nucleotide sequences or cDNA fragments inserted at the selected site of the cloning vehicle may include nucleo-tides which are not part of the actual structural gene for the desired polypeptide or may include only a fragment of the complete structural gene for the desired protein.
It is only required that whatever DNA sequence is inserted, a transformed host will produce a polypeptide having a biological or immunological activity of HuIFN-0 or that the DNA sequence itself is of use as a hybridization probe to select clones which contain DNA sequences useful in the production of polypeptides having an immunological or biological activity of HuIFN-0.
The cloning vehicle or vector containing the foreign gene is employed to transform a host so as to permit that host to express polypeptides displaying an immunological or biological activity of HuIFN-P for which the hybrid gene codes. The selection of an appro-priate host is also controlled by a number of factors recognized by the art. These include, for example, compatibility with the chosen vector, toxicity of proteins encoded by the hybrid plasmid, ease of recovery of the desired protein, expression characteristics, bio-safety and costs. A balance of these factors must be struck with the understanding that not all hosts may be equally -29- = _ effective for expression of a particular recombinant DNA
molecule.
In the present synthesis, the preferred initial cloning vehicle is the bacterial plasmid pBR322 and the preferred initial restriction endonuclease site therein is the PstI site (Figure 1). The plasmid is a small (molecular weight approx. 2.6 megadaltons) plasmid carrying resistance genes to the antibiotics ampicillin (Amp) and tetracycline (Tet). The plasmid has been fully characterized (F. Bolivar, et al., "Construction And Characterization Of New Cloning Vehicles II. A
Multi-Purpose Cloning System", Gene, pp. 95-113 (1977);
J. G. Sutcliffe, "pBR322 Restriction Map Derived From The DNA Sequence: Accurate DNA Size Markers Up To 4361 Nucleotide Pairs Long", Nucleic Acids Research, 5, pp. 2721-28 (1978); J. G. Sutcliffe, "Complete Nucleotide Sequence Of The Escherichia coli Plasmid pBR322", Cold Spring Harbor Symposium, 43, I, pp. 77-90 (1978)).
Insertion of the DNA product in this site provides a large number of bacterial clones each of which contains one of the DNA genes or fragments thereof present in the cDNA product previously prepared. Again, only a very few of these clones will contain the gene for IFN-P or fragments thereof (Figure 1) and none of them may permit the expression of polypeptides displaying an immunolog-ical or biological activity of IFN-P. The preferred initial host in accordance with this invention is E.
coli HB 101.

1. Preparation of PstI-Cleaved, dA-elongated pBR322 Plasmid pBR322 was digested completely at 37 C
with PstI endonuclease (New England Biolabs) in 10 mM
Tris-HC1 (pH 7.6), 7 mM MgCl21 7 mM 2-mercaptoethanol.
The mixture was extracted with 1 vol phenol and 10 vol ether and precipitated with 2.5 vol ethano1:0.2 M sodium acetate solution.

Addition of homopolymeric dA tails (Figure 1) by terminal deoxynucleotidyl transferase (TdT) (purified according to L. Chang and F. J. Bollum, "Deoxynucleotide-Polymerizing Enzymes Of Calf Thymus Gland", J. Biol. Chem., 246, pp. 909-16 (1971)) was done in a 50-pl reaction volume containing 0.14 M potassium cacodylate, 30 mM
Tris-HC1 (pH 6.8), 1 mM CoSO4, 0.2 pg/pl heat-inactivated bovine serum albumin, 0.8 mM DTT, 0.2 mM dATP and some a-32P-dATP. Incubation was at 37 C for 5 min before EDTA was added to 10 mM and SDS to 0.1% and the mixture extracted with phenol and chromatographed on Sephadex G50 in TE buffer. The void fractions, containing the line-arized and elongated pBR322, were further purified by adsorption in 10 rnLM Tris-HC1 (pH 7.8), 1 mM EDTA and 0.4 M NaCl to oligo(dT) cellulose. After extensive washing, the desired fractions were eluted with 10 mM
Tris-HC1 (pH 7.8) and 1 mM EDTA.

2. Preparation of dT-elongated DNA
Double-stranded DNA was elongated with dTMP
residues in similar fashion to that described above for dA tailing of pBR322, except that dTTP and some 3H-dTTP
replaced the dATP and a-32P-ATP. Purification on oligo(dT) cellulose was, of course, omitted. As before, the dT-elongated DNA is a mixture of different species, only a very few of which are HuIFN-0-related (Figure 1).
3. Preparation of Ca++-Treated E. coli HB101 Ca++-treated E. coli HB101 was prepared by the method of E. M. Lederberg and S. N. Cohen, "Transformation Of Salmonella Typhimurium By Plasmid Deoxyribonucleic Acid", J. Bacteriol., 119, pp. 1072-74 (1974) by inoculat-ing the E. coli HB101 (a gift from H. Boyer) into 5 ml LB medium (10 parts bactotryptone, 5 parts yeast extract and 5 parts NaCl per liter) and cultures grown overnight at 37 C. The fresh cultures were diluted 1/100 in 20 ml M

LB medium and grown to a density of about 2 x 108 bacteria per ml, quickly chilled in ice and pelleted at 6000 rpm for 5 min in a Sorvall SS34 rotor at 4 C. The cells, kept at 0-4 C, were washed with 20 ml 100 mM CaC12.
After 20 min in ice, the cells were repelleted and resuspended in 2 ml 100 mM CaCl2 and maintained at 0 C
for 15 min. Aliquots (200 pl), supplemented with glycerol to 11%, could be stored for several months at -80 C
without loss of activity (D. A. Morrison, "Transformation In Escherichia coli: Cryogenic Preservation Of Competent Cells", J. Bacteriol., 132, pp. 349-51 (1977)).

4. Annealing of dA-elongated pBR322 and dT-elongated DNA

The vector's and DNA insert's complementary dA-and dT-tails permit annealing to form the initially desired hybrid plasmid or recombinant DNA molecule. For this purpose, the dA-tailed PstI-cleaved pBR322 vector and the mixture of sized dT-tailed cDNAs were dissolved in TSE buffer (10 mM Tris-HC1 (pH 7.6), 1 mM EDTA, 100 mM NaCl) to 1.5 pg/ml plasmid and to a molar ratio of plasmid to DNA insert of 1.5 to 2Ø After heating to 65 C for 10 min, the mixture was cooled slowly to room temperature over 4 h.
The product is, of course, a large mixture of different recombinant DNA molecules and some cloning vehicles without inserted DNA sequences. However, each recombinant DNA molecule contains a cDNA segment at the PstI site. Each such cDNA segment may comprise a gene or a fragment thereof. Only a very few of the cDNA
fragments code for HuIFN-P or a portion thereof (Figure 1).
The vast majority code for one of the other proteins or portions thereof whose mRNAs were part of the poly(A) RNA used in the process of this invention (Figure 1).
It should also be understood that none of the clones of the above-prepared library may permit the expression of polypeptides displaying an immunological or biological activity of IFN-p.

5. Transfection Of E. coli HB101 With The Annealed Hybrid Plasmids P3 containment facilities were used as necessary for the transfection process and all subsequent steps in which the resulting transformed bacteria were handled.
Aliquots (90 N1 or less) of the above mixture were cooled to 0 C and 1 M CaC12 added to 0.1 M. Aliquots (100 Nl or less) of this solution were added to 200 N1 Ca++-treated E. coli HB101 in ice and after standing at 0 C for 30 min, the cells were heat-shocked for 5 min at 37 C and cooled again at 0 C for 15 min. After addition of 2 ml LB-medium, the cells were incubated at 37 C in a shaking water bath for 30 to 45 min and the bacterial suspension plated out onto 1.2% agar plates, containing LB medium supplemented with 10 Ng/ml tetracycline.
Since plasmid pBR322 includes the gene for tetracycline resistance, E. coli hosts which have been transformed with a plasmid having that gene intact will grow in cultures containing that antibiotic to the exclusion of those bacteria not so transformed. There-fore, growth in tetracycline-containing culture permits selection of hosts transformed with a recombinant DNA
molecule or recyclized vector.
After 24 h at 37 C, individual colonies were picked and suspended in 100 N1 LB medium (supplemented as above) in the wells of microtiter plates (Dynatech).
After incubation at 37 C overnight, 11 N1 dimethyl-sulfoxide were mixed into each well and the trays sealed with adhesive tape. The plates were stored at -20 C and a library of 17,000 individual clones of transformed E.
coli HB101 was prepared. This library was derived from 270 fmoles (128 ng) dT-tailed cDNA inserts, which in turn were synthesized from 4.4 pg gradient purified - =w ~
poly(A) RNA. About 98% of the clones of this library were sensitive to carbenicillin (a more stable ampicillin derivative). Therefore, about 98% of the library contained a plasmid having an insert in the PstI-site of the P-lactamase gene of pBR322 and only about 2% contained a recyclized vector without insert.
These 17,000clones contain a variety of recombinant DNA molecules representing complete or partial copies of the mixture of mRNAs in the poly(A) RNA preparation from HuIFN-p-producing cells (Figure 2).
The majority of these will contain only a single recombi-nant DNA molecule. Only a very few of these recombinant DNA molecules are related to HuIFN-P. Accordingly, the clones must be screened to separate the HuIFN-p-related clones from the others.

SCREENING FOR A CLONE CONTAINING HuIFN-0 cDNA
There are several approaches to screen for bacterial clones containing HuIFN-PcDNA. These include, for example, RNA selection hybridization (Alwine, et al., infra), differential hybridization (T. P. St. John and R. W. Davis, "Isolation Of Galactose-Inducible DNA
Sequences From Saccharomyces Cerevisiae By Differential Plaque Filter Hybridization", Cell, 16, pp. 443-452 (1979)); hybridization with a synthetic probe (B. Noyes, et al., "Detection And Partial Sequence Analysis Of Gastrin mRNA By Using An Oligodeoxynucleotide Probe", Proc. Natl. Acad. Sci. USA, 76, pp. 1770-74 (1979)) or screening for clones that produce the desired protein by immunological (L. Villa-Komaroff, et al., "A Bacterial Clone Synthesizing Proinsulin", Proc. Natl. Acad. Sci. USA, 75, pp. 3727-31 (1978)) or biological (A.C.Y. Chang, et al., "Phenotypic Expression In E. coli Of A DNA
Sequence Coding For Mouse Dihydrofolate Reductase", Nature, 275, pp. 617-24 (1978)) assays. We have chosen RNA selection hybridization as being the most convenient and promising method for primary screening.

A. RNA Selection Hybridization Assay 1. Overview Of The Initial Assay Referring now to Figure 2, the recombinant DNA
molecules were isolated from individual cultures of about 46 clones sensitive to carbenicillin and resistant to tetracycline from the above library of clones (two mixtures of 2 clones shown in Figure 2) (Step A). The recombinant DNA molecules were cleaved and hybridized to total RNA containing HuIFN-P mRNA prepared as before (Step B). All recombinant DNA molecule-total RNA hybrids were separated from the non-hybridized total RNA (Step C).
The hybridized total RNA was recovered from the hybrids and purified (Step D). The recovered RNA was assayed for HuIFN-0 mRNA activity as above (Step E). If, and only if, the mixture of recombinant DNA molecules contains a recombinant DNA molecule having an inserted nucleotide sequence capable of hybridizing to the HuIFN-P mRNA in the total RNA, under stringent hybridization conditions, will the mRNA released from that hybrid cause the forma-tion of HuIFN-P in oocytes, because mRNA released from any other recombinant DNA molecule-total RNA hybrid will not be IFN-p-related. If a group of 46 clones gave a positive response, the clones were regrouped into 6 sub-groups (4 subgroups of 8 and 2 subgroups of 7) and each subgroup assayed as before. This process was continued until a single clone responding to this assay was identified.
There is no assurance that the recombinant DNA
molecules and bacterial cultures transformed therewith, which are thus identified, contain the complete IFN-0 cDNA
sequence or even that the DNA sequence actually codes for IFN-p or will permit the clone to express polypeptides displaying an immunological or biological activity of IFN-0. However, the recombinant DNA molecules will certainly contain extensive nucleotide sequences comple-mentary to the IFN-P mRNA coding sequence. Therefore, the recombinant DNA molecule may at least be used as a source of a probe to screen rapidly other recombinant DNA molecules and clones transformed with them to identify further sets of clones which may contain an authentic or complete IFN-P nucleotide coding sequence. These clones may then be analyzed for possible expression of polypeptides displaying a biological or immunological activity of IFN-P. And, the nucleotide sequence of the inserted DNA
fragment of these hybrid plasmids and its amino acid translation product may be determined and correlated, if possible, to the amino acid composition and initial sequence reported for authentic IFN-P (supra).
2. Execution Of The Initial Assay Step A - Preparation Of The Recombinant DNA Molecule Mixture Replicas of a microtiter plate containing 96 clones from the above library of clones were made on LB-agar plates, one containing 10 Ng/ml tetracycline and the other supplemented with 100 Ng/ml carbenicillin. In this manner, two sets of about 45-46 clones, resistant to tetracycline and sensitive to carbenicillin, were picked and grown separately overnight at 37 C in 100 ml LB medium, containing 10 Ng/ml tetracycline. These cultures were pooled, spun down in a Sorvall GS-3 rotor at 8000 rpm for 10 min, washed twice with TES buffer (50 mM Tris-HC1 (pH 8), 5 mM EDTA, 5 mM NaCl) and resus-pended in 40 ml TES per 1 of initial culture volume.
The cells were lysed with lysozyme-Triton X-100 (M.
Kahn, et al., "Plasmid Cloning Vehicles Derived From Plasmids Col El, F, R6K And RK2" in Methods In Enzymology, 68: Recombinant DNA (R. Wu, ed.) (1980) (in press)).

. . . . . .._ . . . . . . . .. . , , .

Forty ml of the TES suspended cells were combined with 20 ml 10% sucrose in 50 mM Tris-HC1 (pH 8) and lysozyme to 1.3 mg/ml and allowed to stand at room temperature for 20 min. To this suspension were added 1 ml 0.5 M
EDTA-NaOH (pH 8), 8 ml 0.2% Triton X-100, 25 mM EDTA, 50 mM Tris-HC1 (pH 8) and the lysis completed at room temperature for 30 min. Cellular debris and most of the chromosomal DNA were removed by pelleting in a Beckman SW27 rotor at 24000 rpm for 45 min. The supernatant was cooled in ice, combined with 1/3 vol 40% polyethylene glycol 6000-2 M NaCl and allowed to stand overnight at 0 C. The resulting precipitate was collected in a Sorvall HB4 rotor at 5000 rpm for 10 min at 4 C and dissolved in TES buffer. The solution, with 0.2 vol 10 mg/ml ethidium bromide (Serva) and CsCl to 1 g/ml, was centrifuged in a Beckmann R60 Ti-rotor at 40000 rpm for at least 48 h, one polyallomer tube usually being sufficient for the lysate from 1-2 1 of original culture volume. Two DNA bands could be visualized in the tube under UV-illumination. The band of highest density corresponds to plasmid form I DNA, the second band corresponds to form II and form III plasmid DNAs and some chromosomal DNA. The first band was collected from the tube, ethidium bromide removed by six isoamyl alcohol extractions, and the aqueous phase diluted with 3 vol water-supplemented with up to 0.2 M sodium acetate (pH 5.1) before DNA precipitation with 2.5 vol ethanol.
The DNA was redissolved, extracted with phenol and again precipitated with ethanol. The quality of the DNA was monitored by electrophoresis on a 1% agarose gel in mM Tris-HOAc (pH 7.8), 20 mM sodium acetate, 2 mM
EDTA, followed by ethidium bromide staining. If the DNA
was contaminated with too much RNA, it was further purified by neutral sucrose-gradient centrifugation:
35 300 pg DNA in 10 mM Tris-HC1 (pH 7.6) and 1 mM EDTA were loaded on a 36-mi 5-20% sucrose gradient in 10 mM Tris-HC1 . . . .. .. .. . . . . . . .. .. . . . ., r -~" 1 i ' 13416 04 (pH 7.6), 1 mM EDTA, 1 M NaCl, centrifuged in polyallomer tubes for 16 h at 24000 rpm in a Beckmann SW27 rotor at 18 C and the DNA containing fractions (OD260) pooled and precipitated with sodium acetate-ethariol.

Step B - Hybridization Of The DNA
With Total RNA

About 150 pg DNA, thus prepared, were combined with some uniformly labelled 32P-marker DNA and 2 pg pSTNV-1 DNA (a recombinant plasmid containing a full size cDNA copy of satellite tobacco necrosis virus ("STNV")-RNA; J. Van Emmelo, et al., "Construction And Characterization Of A Plasmid Containing A Nearly Full-Size DNA Copy Of Satellite Tobacco Necrosis Virus RNA", J. Mol. Biol., (in press) as internal control, sheared by sonication in an MSE sonicator and precipitated with sodium acetate-ethanol.
A diazobenzyloxymethyl (DBM)-cellulose solid matrix (Cf., J. C. Alwine, et al., "Method For Detection Of Specific RNAs In Agarose Gels By Transfer To Diazobenzyl Oxymethyl Paper And Hybridizing With DNA Probes", Proc.
Natl. Acad. Sci. USA, 74, pp. 5350-54 (1977)) was prepared according to the method of J. C. Alwine, et al., "Detection Of Specific RNAs Or Specific Fragments Of DNA Fractionation In Gels And Transfer To Diazobenzyloxymethyl Paper", Methods-Enzymology, 68:Recombinant DNA (R. Wu, ed.) (1980). For a paper matrix, a sheet of Whatman 540 paper was evenly soaked in a solution containing 2-3 mg 1-(m-nitrobenzyloxy)me-thyl pyridinium chloride (NBPC/BDH
and 0.7 ml sodium acetate trihydrate in 28.5 N1 water per cm2, incubated at 60 C until dry and for further 10 min, and baked at 130-135 C for 30-40 min. After washing several times with water (about 20 min), 3 times with acetone (about 20 min), and drying it was stored. The paper was incubated at 60 C for 30 min in 0.4 ml 20%
sodium dithionite-water per cm2 with occasional shaking.

The paper was again washed four times with water, once with 30% acetic acid for 5 min and four times with water, transferred to 0.3 ml per cm2 ice-cold 1.2 M HC1 to which 10 mg/ml fresh NaNO 2 had been added immediately before use for 30 min at 0 C, and washed twice quickly with ice-cold water and once with 80% dimethyl sulfoxide (spectrophotometric grade, Merck)-20% 25 mM sodium phosphate (pH 6.0). For a powder matrix essentially the same procedure was followed using microgranular cellulose powder (Whatman CC31), the quantities being expressed against the corresponding weight of the cellulose matrix.
Initially, we used a powder matrix because the capacity for binding was higher, so relatively smaller volumes for hybridization, washes and elution could be used. Subsequently, we used a paper matrix for indivi-dual clone screening. Use of paper permits efficient elution with water which proved superior for the later assay of IFN-OmRNA.
The DNA prepared above was dissolved in 25 mM
sodium phosphate (pH 6.0) heated for 1 min, chilled and four vol DMSO added. Coupling to the matrix (50 mg (powder) or a paper disc (10 mm dia.)) usually proceeded over a weekend at 4 C with continuous mixing. The volume of the DNA was kept rather small to allow close contact with the matrix and thereby enhance efficient coupling of the DNA to the matrix. After coupling, the matrix was washed four times with water and four times with 0.4 N NaOH at 37 C for 10 min each, again four times with water at room temperature and finally twice with hybridization buffer (50% formamide (deionized, Baker), 40 mM piperazine-N,N'-bis(2-ethane sulfonic acid) (pH 6.4) ("PIPES, Sigma), 1 mM EDTA, 0.6 M NaCl and 0.1% SDS) at 4 C. Coupling efficiencies were meas-ured by 32P-radioactivity.
Twenty pg total RNA, prepared as before, and 50 ng STNV-RNA were dissolved in 250 Nl (50 N1 for paper matrix) hybridization buffer and added to the DNA coupled matrix. The matrix was heated to 70 C for 2 min and held at 37 C overnight with gentle mixing.

Step C - Separation Of Hybridized Total RNA-DNA
From Non-Hybridized Total RNA

After centrifugation of the powder matrix, the unhybridized RNAs were removed and the matrix washed seven times with a total 2 ml 50% formamide, 10 mM PIPES
(pH 6.4), 1 mM EDTA, 0.3 M NaCl and 0.1% SDS, the lower salt content of these washes destabilizing non-specific RNA-DNA binding. Each wash was followed by centrifuga-tion and resuspension of the matrix in the buffer. For subsequent assay, the first wash was pooled with the unhybridized RNA ("Fraction 1") and washes 2-4 ("Fraction 2") and washes 5-7 ("Fraction 3") were pooled.
In hybridizations to a paper matrix, a similar procedure was utilized except that the total wash volume was limited 1 ml.

Step D - Purification Of Hybridized Total RNA
The hybridized total RNA-DNA was eluted from a powder matrix with 3 elutions of a total 900 N1 99% forma-mide, 0.2% SDS at 70 C for 2 min and chilled in ice.
The total hybridization procedure and elution with formamide were essentially as described by A. G. Smith (personal communication). The hybridized total RNA-DNA
was eluted from a paper matrix by first washing with 100 N1 of ice cold water and following that with two water elutions (total 300 N1) at 80 C for 2 min. For subsequent assay these elutions and the 100 N1 wash were pooled ("Fraction 4").
To one-half of each of the 4 fractions, 0.1 pg calf liver tRNA or ribosomal RNA were added (Fractions 1A, 2A, 3A and 4A) and to the other half 8 pg eukaryotic poly(A) RNA or ribosomal RNA were added (Fractions 1B, . . .. .. . .. ... . . . . . .. ... . r i . . ..i....r ..... . I r. . i I I .
i r . .

2B, 3B, 4B). The fractions were purified by precipita-tion by the addition of 0.5 M NaCl and 2.5 vol ethanol to removal traces of formamide and other impurities.

Step E - Determination Of IFN-P mRNA Activity Fractions 1A, 2A, 3A and 4A were translated in 25 p1 nuclease-treated rabbit reticulocyte lysate (pre-pared according to the procedure of R. B. Pelham and R. J. Jackson, "An Efficient mRNA-Dependent Translation System For Reticulocyte Lysates", Eur. J. Biochem., 7, pp. 247-56 (1976)) by the procedure of B. LeBleu, et al., "Translation Of Mouse Interferon mRNA In Xenopus Laevis Oocytes And In Rabbit Reticulocyte Lysates", Biochem.
Biophys. Res. Commun., 82, pp. 665-673 (1978) except that 250 mM spermidine-HC1, 1 mM fructose-1,6-diphosphate were added in the presence of 35S-methionine (0.5 mCi/ml, Amersham). After incubation, 25 N1 reticulocyte lysate, from above, were combined with 1 N1 10% deoxycholate-10%
Triton X100 and 2 N1 antiserum-PBS (1:9) and heated at 37 C for 1 h. Twenty p1 Staphylococcus aureus Cowan I
(freshly washed, S. W. Kessler, et al., "Rapid Isolation Of Antigens From Cells With A Staphylococcal Protein A-Antibody Adsorbent: Parameters Of The Interaction Of Antibody-Antigen Complexes With Protein A", J. Immunology, 115, pp. 1617-1624 (1975)) in 10% 100 mM NaCl, 10 mM
Tris-HC1 (pH 7.4), 1 mM EDTA, 0.05% NP40 were added and the mixture maintained at 20 C for 30 min and centri-fuged in an Eppendorf 5412 centrifuge for 2 min. The pellet was washed and centrifuged twice with PBS and the final pellet dissolved in sample buffer and electro-phoresed in 13% polyacrylamide gel as described by U. K.
Laemmli, et al., "Cleavage Of Structural Proteins During The Assembly Of The Head Of Bacteriophage T4", Nature, 227, pp. 680-85 (1970), and autoradiographed. Comparison of the STNV-RNA translation products in Fractions 1A and . . .... . .... .. ....r., r..... ,...._.-... i. . I i r _ . . .

134~604 4A provide an indication of the efficiency of hybridiza-tion and RNA degradation in the process.
Fractions 1B, 2B, 3B and 4B were dissolved in 2 N1 water and assayed in oocytes for IFN-P mRNA content as described above.

3. Subsequent Assay - Hybridization To Nitrocellulose Sheets Some subsequent assays of individual clones were done on nitrocellulose sheets (M. Cochet, et al., "Cloning Of An Almost Full-Length Chicken Conalbumin Double-Stranded cDNA", Nucleic Acids Research, 6, pp. 2435-2452 (1979)). The DNA was dissolved in 2M NaCl and 0.2 M NaOH, heated at 100 C for 1 min, chilled, and spotted on detergent free Millipore filters (pore size 0.45 um; 7 mm dia.). The filters were baked for 2 h at 80 C, washed in 0.3 M NaCl, 2 mM EDTA, 0.1% SDS, 10 mM
Tris-HC1 (pH 7.5) and dried at room temperature. The RNA was hybridized for 3 h at 47 C in 30% formamide, 0.5 M NaCl, 0.4% SDS, 2 mM EDTA, 50 mM PIPES (pH 7.5).
Hybridization was stopped by dilution with 10 vol 0.1 M
NaCl and the filters were washed several times in 15 ml 0.3 M NaCl, 0.1% SDS, 2 mM EDTA, 10 mM Tris-HC1 (pH 7.5) by shaking at 45 C and several times in the same solution without SDS at 4 C. Elution of the hybridized RNA-DNA
was effected in 30 N1 5 mM potassium chloride at 100 C
for 1 min.

4. Results Of The RNA Selection Hybridization Assay Sixteen groups of about 46 clones were screened (Groups A-P). In six of the groups, Fraction 1B contained the only IFN-P mRNA activity, in eight of the groups no IFN-P mRNA was detected and in two groups (Groups C and 0) IFN-P mRNA was observed in Fraction 4B. The group C
and 0 assays are reported in the following format:
logarithm of IFN-p units (calibrated against reference .. . . . . . , . .. . ii . I . .

standard = - -69/19), detected in the assay of Fraction 1B
(non-hybridized) and in the assay of Fraction 4B (hybridized).
The limit of detection was 0.1.

Group Fraction 1B Fraction 4B
C 1.0 0 0.5 0.5 0 0.2 0.2 0.5 Group 0 was subdivided into 6 subgroups (Subgroups 01 to 06; four of eight clones and two of seven clones) and hybridized and assayed as before, except that a 400 ml culture per clone was used. The subgroups gave the following results, presented in the same format as above. Hybridization was carried out on DMB-cellulose powder except as otherwise indicated.

Subgroup Fraction 1B Fraction 4B
01 0 1.2 0 1.5 0 0.5 0 0.5 0.2 0.5 0 1.2*
02 0.7 0 03 0.7 0 0.5 0 * DBM cellulose paper method.

-43- ' -Subgroup Fraction 1B Fraction 4B
05 0.5 0 Subgroup 01 was subdivided into its individual clones (designated clones O1/1 - O1/8) and hybridized and assayed as before, except that a 700 ml culture per clone was used. The hybridization was again carried out on DBM-cellulose powder except as otherwise indicated Clone Fraction 1B Fraction 4B
01/1 0.2 0 0.7 0 0.7 0*
1.0 0**
01/2 1.2 0 0.2 0*
0.7 0**
01/3 1.2 0 1.0 0.2*
1.2 1.0(?)*
1.2 0**
01/4 1.2 0 1.2 0 1.0 0*
1.2 0**
O1/5 0.7 0 0.7 ~50.2*
1.0 0 01/6 0.7 0 1.0 ~0.2*
0.5 0**
* DBM cellulose paper method.

** Nitrocellulose sheets.

_44_ 13 4 1 fi 0 4 Clcfne Fraction 1B Fraction 4B
01/7 0.5 0 1.2 0*
<0.2 0.5**
O1/8 0 1.7*
<0.2 1.2*
0 0.7**
0 1.0**
Therefore, clone 01/8 contains a recombinant DNA molecule capable of hybridizing IFN-0 mRNA from total RNA containing IFN-S mRNA.
Non-specific RNA-DNA binding is highly unlikely, because a comparison of Fractions 1A and 4A revealed substantially no non-specific binding of STNV DNA in these same experiments. E.g., as monitored by translation in a rabbit reticulocyte lysate in the presence of 35S-methionine, followed by gel electrophoresis, as described above. Clone 01/8 was designated E. coli HB101(G-pBR322(Pst)/HFIF1 ("G-HB101-pHFIFl"), its recombi-nant DNA molecule G-pBR322(Pst)/HFIF1("pHFIFl") and its hybrid insert "pHFIFl fragment". This nomenclature indi-cates that the clone and recombinant DNA molecule originated in Gent ("G") and comprises plasmid pBR322 containing, at the PstI site HuIFN-P cDNA ("HFIF"), the pa=ticular molecule being the first located ("1").
IDENTIFICATION OF CLONES CONTAINING RECOMBINANT
DNA-MOLECULES CROSS-HYBRIDIZING TO pHFIF1 pHFIF1, isolated above, was used to screen the library of clones, prepared previously, for bacterial clones containing recombinant DNA molecules having related hybrid DNA inserts, by colony hybridization * DBM cellulose paper method ** Nitrocellulose sheets (M. Grunstein and D. S. Hogness, "A Method For The Isolation Of Cloned DNA's That Contain A Specific Gene", Proc. Natl. Acad. Sci. USA, 72, pp. 3961-3965 (1975)).
This method allows rapid identification of related clones by hybridization of a radioactive probe made from pHFIF1 to the DNA of lysed bacterial colonies fixed in nitrocellulose filters.
The library of clones stored in microtiter plates, as described above, was replicated on similar size nitrocellulose sheets (0.45 pm pore diameter, Schleicher and Schuel or-Millipore), which had been previously boiled to remove detergent, and the sheets placed on LB-agar plates, containing tetracycline (10 Ng/ml). Bacterial colonies were grown overnight at 37 C. Lysis and fixation of the bacteria on the nitrocel-lulose sheets took place by washing consecutively in 0.5 N NaOH (twice for 7 min), 1 M Tris-HC1 (pH 7.5) (7 min), 0.5 M Tris-HC1 (pH 7.5) and 1.5 M NaCl (7 min), 2 x SSC
(0.15 M NaCl, 0.015 M sodium citrate (pH 7.2) (7 min)).
After thorough rinsing with ethanol and air drying, the sheets were baked at 80 C for 2 h in vacuo and stored at room temperature.
A Hinf I restriction fragment specific for the pHFIF1 fragment (infra).served as the probe for colony hybridization, described infra. This fragment (-170 base pairs) was purified by electrophoresis of the Hinf digestion products of pHFIF1 in a 6% polyacrylamide gel.
After staining the DNA bands with ethidiumbromide, the specific fragment was eluted, reelectrophoresed and 32P-labelled by "nick translation" (P.W.J. Rigby et al., "Labeling Deoxyribonucleic Acid To High Specific Activity In Vitro By Nick Translation With DNA Polymerase I", J. Mol. Biol., 113, pp. 237-251 (1977)) by incubation in 50 1 50 mM Tris-HC1 (pH 7.4), 10 mM MqC12, 20 mM S-mercap-toethanol, containing 2.5 N1 each of dCTP, dTTP and dGTP
at 400 pM, 100 pmoles a-ATP (Amersham, 2000 Ci/mmole) and 2.5 units=of DNA-polymerase I (Boehringer) at 14 C
for 45 min. The unreacted deoxynucl.eoside trxphQsphates were removed by gel filtration over Sephadex G-50 in TE
buffer. The highly 3.2P=labelledDMA was precipitated with 0.1 vol of 2 M sodium acetate tpH 5.1) and 2.5 vol of ethanol at 20 C.
Hybridization of the above probe to the filter i.sipregnated DNA=was,carried out e4rsentially as described by D. Hanaban azid M. Meselgon (personal communication):
The filters, prepared above, were preincubated for 2.h at 68 C in 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.1%
bovine serum albumin, 0.15 M NaCI, 0.03 M Tris-HC1.
(pH 8), 1 mM EDTA, and rinsed wi-th 0.02% Ficoll, 0.02%
polyvinylpyrrolidone, 0.02% bov* serum albwain, 0.15...
'M NaCI, 0.15 N Tris-HCi (pH 8), S.mM EDTA andØ5% SDS.
The hybridization proceeded overnight at 68 C in a solution identical to the .:rinsinq.,.-eolution above using 'K;een denatured at"100 C
the P-labeiled probe wMich ha~-:
_ . ,: _ ,.,,;=:. .
for 5 min prior to e hX~iridized . filters. we~
washed twice with O...S..M NaCl,'0..06 M Tris-HC1 (pH 8), 2 mM EDTA for 2, h at 68 C before air drying and auto-, radiography.
About 1350 clones, originating from the,800;-900 DNA'=size class, were screened. Thirteen colonies, including pHFYF1, gave a positive result. These clones were designated-. G-HB-101-pHFIFl to 13 and their recombinant DNA molecules pHFIF1 to 13. One of the clones, pHFIF2, waa hybridized with poly(A) mFtNA..containing :IFN-P mili and assayed using DM=cellulose paper (su2r6). Because the tot.al I~'N-RNA actfvity was d~tected in the. hybriaixed fraction and the unhybzidized RNA did not contain,any.
detectable activ~tyt i$ cleak"rihat clones i&otified by colony hybrid~Z~~ibn to a part..? of the pHFI.F1 fragment also hybridized to=, ,t=FN-P mRNA.
It is, of course, evident+ that this method.. af clone screening using the HuIFN--A.:DNA insert of pHFIFI
* is a trademark ~-_,~.~

. , ... .._., ...., ...... .... ..... . ,t..:...,.. .. ........ . . .. ., . .
. . . . . . i . .

or another DNA insert of a clone identified using the DNA insert of pHFIF1, as described above, may be employed equally well on other clones containing DNA sequences arising from recombinant DNA technology, synthesis, natural sources or a combination thereof or clones containing DNA sequences related to any of the above DNA
sequences by mutation, including single or multiple, base substitutions, insertions, inversions, or deletions.
Therefore, such DNA sequences and their identification also fall within this invention. It is also to be understood that DNA sequences, which are not screened by the above DNA sequences, yet which as a result of their arrangement of nucleotides code for those polypeptides coded for by the above DNA sequences also fall within this invention.

CHARACTERIZATION OF THE
IFN-R-RELATED RECOMBINANT PLASMIDS

The thirteen clones (pHFIFl-13) which were detected by colony hybridization were further characterized.
A physical map of the inserts of these clones was contructed and the orientation of the inserts in the various clones was determined.
The physical maps of the plasmids were con-structed by digestion with various restriction enzymes (New England Biolabs) in 10 mM Tris-HCl (pH 7.6), 7 mM
MgC12 and 7 mM ¾-mercaptoethanol at 37 C by well-known procedures. The products of digestion were electrophoresed in 2.2% agarose or 6% polyacrylamide gels in 40 mM
Tris-HOAc (pH 7.8), 20 mM EDTA. They were analyzed after visualization by staining with ethidiumbromide and compared with the detailed physical map of pBR322 (J.G. Sutcliffe, supra). Restriction maps of the different plasmids were contructed on the basis of these digestion patterns. These were refined by sequencing the DNA
inserts in various of the plasmids, substantially by the . , . .. , ...... .. ... .. :... .-.... . .. _w.._..- ..-._ ., ir . _.. .. ..
.. . I i 1341604 _ -48- = - procedure of A.M. Maxam and W. Gilbert, "A New Method For Sequencing DNA", Proc. Natl. Acad. Sci. USA, 74, pp. 560-564 (1977).
Plasmid DNA was prepared from various of the pHFIFl-13 in accordance with this invention by the method of Kahn et al. (supra), employed previously herein to isolate the DNA from the sets of clones for screening. The isolated form I DNA was purified by neutral sucrose-gradient centrifugation as before and restricted by various restriction enzymes, essentially as recommended by the supplier (New England Biolabs).
Restricted DNA was dephosphorylated for 30 min at 65 C in the presence of 4 units bacterial alkaline phosphatase and 0.1% SDS. Following two phenol extrac-tions and ethanol precipitation, the DNA was 5'-terminally labelled with Y-32P-ATP (N 3000 Ci/mmole) and polynucleo-tide kinase (P-L Biochemicals, Inc.).
For sequencing, labelled fragments were handled in two ways. Some were purified on a polyacrylamide gel prior to cleavage with a second restriction enzyme.
Others were immediately cleaved with a second restriction enzyme. In both cases the desired fragments were sepa-rated on a polyacrylamide gel in Tris-borate-EDTA buffer.
Figure 7 displays the various restriction fragments (the circles indicating the label and the arrow the direction of sequencing) and the sequencing strategy employed using pHFIF1, pHFIF3, pHFIF6 and pHFIF7.
The fragments were degraded according to the method of A.M. Maxam and W. Gilbert (supra). The products were fractionated on polyacrylamide gels of various concentrations and lengths in 50 mM Tris-borate, 1 mM
EDTA (pH 8.3) at 900 V to 2000 V.
Each stretch of cDNA insert was sequenced from both strands and each restriction site which served as labelled terminus was sequenced using a fragment spanning it. The composite nucleotide sequence thus obtained for . ._, ._. ,-- -=+,..... . ... ... , the coding strand of IFN-P DNA or gene and its correspond-ing amino acid sequence is depicted in Fig. 4. Because none of plasmids pHFIFl-13 contained the complete gene for HuIFN-P, Fig. 4 results from a combination of the data from at least two such plasmids. In this regard, Fig. 5 displays the relationship of inserts pHFIF1, pHFIF3, pHFIF6 and pHFIF7, the solid arrows or chevrons indicating the orientation of the various parts of the inserts.
Referring now to Fig. 4, the heteropolymeric part of the insert is flanked on one end by a segment rich in T's and by a string of A's (probably reflecting the polyA terminus of the mRNA). For reference the insert is numbered from first nucleotide of the composite insert to a nucleotide well into the untranslated section of the insert. An ATG initiation triplet at position 65-67 and a TGA termination triplet at position 626-628 define a reading frame uninterrupted by nonsense codons.
Any other translatable sequence, i.e., in different reading frames, flanked by an ATG or a GTG and a termina-tion signal is too short to code for a polypeptide of the expected size of. IFN-P. Therefore, the region between nucleotides 65 and 625 most likely includes the nucleotide sequence for the composite DNA sequence that codes for IFN-P in accordance with this invention.
This sequence does not exclude the possibility that modifications to the gene such as mutations, includ-ing single or multiple, base substitutions, deletions, insertions, or inversions may not have already occurred in the gene or may not be employed subsequently to modify its properties or the properties of the polypep-tides translated therefrom. Nor does it exclude any polymorphism which may result in physiologically similar but structurally slightly different genes or polypeptides than that reported in Figure 4 (supra, p. 3). For example, another clone identified in accordance with - =

this invention has a"T" instead of a'C" at nucleotide 90 of the nucleotide sequence coding for IFN-0. This change in the third nucleotide of the codon does not change the amino acid coded therefrom. The amino acid sequence coded for by the DNA sequence of Figure 4 is identical to the amino acid sequence reported by Taniguichi et al., supra.
It should of course be understood that cloned cDNA from polyA RNA by the usual procedures (A. Efstratiadis et al, supra) may lack 5'-terminal nucleotides and may even contain artifactual sequences (R.I. Richards et al., "Molecular Cloning And Sequence Analysis Of Adult Chicken P-Globin cDNA", Nucleic Acids Research, 7, pp. 1137-46 (1979)). Therefore, it is not certain that the ATG
located at nucleotides 65-67 is in fact the first ATG of authentic IFN-P coding sequence. However, for the purposes of the following description, it is assumed that the ATG at nucleotides 65-67 is the first ATG of authentic IFN-0 mRNA.
By comparing the polypeptide coded by this region of the insert with that sequence of 13 amino-terminal amino acids of authentic human fibroblast interferon -- MetSerTyrAsnLeuLeuGlyPheLeuGlnArgSerSer --determined by Knight et al. (supra), it appears that the chosen reading frame is correct and that nucleotides 65-127 may code for a signal peptide which precedes the nucleotide sequence coding for the "mature" polypeptide.
In addition, in eukaryotic mRNAs the first AUG
triplet from the 5' terminus is usually the initiation site for protein synthesis (M. Kozak, "!How Do Eukaryotic Ribosomes Select Initiation Regions In Messenger RNA?", Cell, 15, pp. 1109-25 (1978)). Here, the codoA in the composite fragment corresponding to the first amino acid of fibroblast interferon is 22 codons from the first ATG. This again suggests that the DNA sequence coding for fibroblast interferon may be preceded by a sequence t341604 determining = - =
a signal polypeptide of 21 amino acids. The presumptive signal sequence contains a series of hydro-phobic amino acids. Such accumulation of hydrophobic .residues is, of course, characteristic of signal sequences (c.f., B.D. Davis and P.C. Tai, "The Mechanism Of Protein Secretion Across Membranes", Nature, 283, pp. 433-38 (1980)).
The nucleotide sequence apparently corresponding to "mature" HuIFN-P comprises 498 nucleotides, which code for 166 amino acids. Assuming that there is no carboxyterminal processing, the molecular weight of the interferon polypeptide is 20085. The base composition of the coding sequence is 45% G+C. The codon usage within the interferon coding sequences is in reasonable agreement with that complied for mammalian mRNAs in general (R. Grantham et al., "Coding Catalog Usage And The Genome Hypothesis", Nucleic Acids Research, 8, pp. 49-62 (1980)). Any deviations observed may be ascribed to the small numbers involved.
The structure of the polypeptide depicted in Fig. 4 for the composite fragment, of course, does not take into account any modifications to the polypeptide caused by its interaction with in vivo enzymes, e.g., glycosylation. Therefore, it must be understood that the amino acid sequence depicted in Figure 4 may not be identical with HuIFN-P produced in vivo.
The comparison of the first 13 amino acids of authentic fibroblast interferon (Knight et al., su ra) and the sequence deduced from the composite gene of Fig. 4 shows no differences. The amino acid compositions determined directly for authentic fibroblast interferon on the one hand and that deduced from the sequence of the composite gene of this invention on the other also show substantial similarities. Fig. 6 displays a compar-ison of these compositions.

Although none of the recombinant DNA molecules = initially prepated in accordance with this invention contain the complete DNA sequence for fibroblast inter-feron, they do provide a useful probe to screen eollections of DNA sequences for those sequences which are related to HuIFN-P. Furthermore, a combination of portions of the inserts of these recombinant DNA molacule8 to afford the complete IFN-0 coding sequence is, as is demonstrated below, within the skill of the art. For example, by 1o reference to Fig. 5, it can xeadily be seen that the Pst-Bgii fragment of pHFIF6 may be joined with the PstI-HaeiI fragment of pHFIF7 or the EcoRI-Pet2 fragment of pHFIF6 may be joined with the Pst~II fragment of pHFIF7 or the BQ.1I1-PstI fragment of pHFIF6 may be joined with the P tI-BcjlII fragment of clone 7 to form a composite HuIFN-S coding sequence. The joining of these fragments may, of course, be done before or after inser-.tion of the cloned fragment into a desired plasmid.

SEQUENCE CODING FOR HuIFN-0 FOR THE PURPOSE OF
EXPRESSINa POLYPEPTIDES-DISPLAYING HuIFN-5 ACTIVITY
r~Y~~=s~~~/~\..~~~~~.~.~~r~~Y~~
BacteYiophaqe X contains two strong promoters, PL and PR, whose activity is under the control of a repressor protein, the product of the phage gene cI. In the presence of repressor, transcription from these promoters is fully repressed. Removal of repressor turns on strong transcription from PL and PR (for review, see H. Saybalski and W. SZybaisKi "A Comprehensive Molecular Map Df Bacteriophage X", Cene, 7, 217-270 (1979)).
Derivatives of the multicopy plasmid pBR322 (F. Bolivar et a."Construction And Characterization Of New Cloning Vehicles. II. A Multiple Cloninq System", aene, 2, 9S-113 (1977)) were constructed to incorporate the PL promoter.

~
. ' -= = 13 4 1 604 A. Structure Of Plaimida Containing The PL Promoter Pliimid n La _..~.
Plasmid pPLa23ll (shown in Fig. 8) consists of three HaeIi fragments. The largest fragment, about 1940 base pairs, contains the PLOL region from bacteriophage X and the P-lactamase qene region from pBR322 (J. Sutcliffe, "Complete Nucleotide Sequence Of The Escherichia coli Plasmid pBA322", Cold Spring Harbor Sympo, 49, 77-90, (1978)). Adjacent to this fragment is a 370-base pair HaeII fragment derived from plasmid Col E1. The = origin of replication spans the junction between these two fragments (A. Oka et al., "Nucleotide Sequence Of Small ColE1 Derivatives. Structure Of The Regions Essential For Autonomous Replication And Colicin E
Immunity", Mol. Gen. Genet., 172, 151-159 (1979)). The third HaeII fragment, about 1600 base pairs in length, codes for resistance to kanamycin. This fragment was originally derived from plasmid pCR1 (C. Covey et al. "A
Method For The Detection Of Restriction Sites In Bacterial Plasmid DNA", Mol. Gen. Genet., 145, 155-158 (1976)).
The direction of transcription from the PL promoter, runs in the same sense as the p-lactamasa gene. Pla$mid pPLa2311 confers resistance to 100 g/ml carbenicillin and 50 Ng/ml kanamycin. 25 Piagmid G-12PL&8 Plasmid G-pPLaB (shown in Fig. 9) was derived from pPLa2311 by converting the PetI site in the A-lacta-mase gene to a aHI site. This was accomplished by S1 nuclease treatment of Psti-opened pPLa2311 followed by blunt-end ligation to a BamAi linker fragment (obtained from Collaborative Research Inc.t Waltham, Mass.) and recircularization of the molecule after B&MRI cleavage.
' '..*

Plasmid pPLa8 no longer specifies for resistance to carbenicillin, but it still confers resistance to kanamycin.

Plasmid G-pPLc24 Plasmid G-pPLc24 (shown in Fig. 10) contains the P-lactamase gene and the origin of replication from pBR322. A 290 base pair HaeII-EcoRI fragment contains the PLOL region from bacteriophage X. The direction of transcription from the PL promoter is towards the EcoRI
site. A 431 base pair EcoRI-BamHI fragment codes for the ribosome binding site and the first 98 amino acid residues of the bacteriophage MS2 replicase gene, obtained from plasmid pMS2-7 (R. Devos et al. "Construction And Characterization Of A Plasmid Containing A Nearly Full-size DNA Copy Of Bacteriophage MS2 RNA", J. Mol. Biol., 128, 595-619 (1979)). Translation of the MS2 replicase protein fragment runs colinear with the transcription from the PL promoter.

B. Temperature-dependent Switch-On Of PL
Promoter Activity Transcription from the PL promoter -- present on plasmids pPLa2311, pPLa8 and pPLc24 -- is repressed by maintaining the plasmids in an E. coli strain that synthesizes the repressor protein. Due to its autoregu-lating mode of synthesis (M. Ptashne et al. "Autoregula-tion And Function Of A Repressor In Bacteriophage X", Science, 194, 156-161 (1976)), one copy of the ci gene on the chromosome of a lysogenic strain is able to repress fully the PL promoter present on a multicopy plasmid.
The strains employed in this invention were E. coli K12AHI (K12 M72 lacam AtrpEA2 SmR (11cI857 Nam?NamS~AxI bio); U. Bernard et al. !'Construction Of Plasmid Cloning Vehicles That Promote Gene Expression From The Bacteriophage X PL Promoter", Gene, 5, 59-76 ..... ....... .<...... ......r.. =.n......_.rP...,..k .. .. . II . .

- - -(1979)) and E. coli M5219 (K12 M72 1acamtrpamSmR (XcI857 OHI bio252); H. Greer, "The kil Gene Of Bacteriophage A", Virology, 66, 589-604 (1975)). Both strains harbor a defective, non-excisable A prophage carrying a mutant ci gene. The mutant gene codes for a temperature-sensitive repressor, thus allowing turn on of transcription from the PL promoter by shifting the temperature -- at 28 C
the repressor is active and represses transcription from the PL promoter but at 42 C the repressor is inactivated and transcription from the PL promoter is switched on.
The AHI deletion of the prophage removes part of the cro gene and all other genes further to the right of cro (M. Castellazzi et al. "Isolation And Characteri-zation Of Deletions In Bacteriophage X Residing As Prophage I E. coli K12", Mol. Gen. Genet., 117, 211-218 (1972)). The deletion of the cro gene is advantageous because accumulation of the cro protein is known to repress transcription from the PL promoter (A. Johnson et al. "Mechanism Of Action Of The cro Protein Of Bacterio-phage A", Proc. Natl. Acad. Sci. U.S.A., 75, 1783-1787 (1978)). Strain M5219 in addition contains the bio252 deletion which removes all genes to the left cIII, including kil.
Upon temperature induction strain M5219 expresses a functional N-gene product. Strain K12AHI on the other hand has two amber mutations in N rendering it functionally N_-negative. The product of the N gene is known to act as an anti-terminator in bacteriophage k (J. W. Roberts, "Transcription Termination And Late Control In Phage X", Proc. Natl. Acad. Sci. U.S.A., 72, 3300-3304 (1975)).
The anti-termination effect was equally observed with terminator sequences not naturally present on phage k DNA (e.g., the natural stop at the end of the tr~ operon), provided the RNA transcript starts at the PL promoter.
Furthermore, polarity effects, introduced by the presence of a nonsense codon in the PL transcript, were relieved . . . _ .x, ...,.w . . r+ n.e,.... vrvrvw.+n y: n, , . .. . . . , . . . :I .
. .. ....

under the action of the N-gene protein (for review see N. Franklin and C. Yanofsky, "The N Protein Of X:
Evidence bearing On Transcription Termination, Polarity And The Alteration Of E. coli RNA Polymerase" in RNA
Polymerase (Cold Spring Harbor Laboratory, 1976) pp. 693-706).
Therefore, having the aforementioned plasmids in a thermo-inducible bacterial cI background allows experimental switching on or off of the activity of PL
promoter. And, the'choice of K12AHI or M5219 allows transcription to proceed either in the absence or presence of the N-gene product. The latter could be advantageous, as described above, in instances where DNA regions are to be transcribed that contain transcription terminator-like sequences or slow-down sequences for the RNA
polymerase.

C. Construction Of Clones Which Have A DNA
Sequence Coding For HuIFN-P Inserted Into A Plasmid Containing The PL Promoter In the following description, isolation of plasmid DNA, restriction analysis of DNA and ligation of DNA fragments were performed as described above for the cloning of double-stranded DNA. The transformation step was also as described above except that, when strains K12AHI or M5219 were used as the host, heat shock was done at 34 C for 5 min and the transformed cells were incubated at 28 C.

1. Construction Of Plasmid G-pPLa-HFIF-67-1 The rationale for this construction was the observation that combination of appropriate restriction fragments from clones G-pBR322(Pst)/HFIF-6 and G-pBR322(Pst)/HFIF-7 allows the reconstruction of a complete, continuous coding sequence of IFN-P. The flow of the derived fragments through the several construction .

...._. ._ . _.:,.,, ... ..... ...; .,.- .....-,_,. .r ... ._. ......, .., i ,..... .. . ., . . .

steps is shown schematically in Fig. 8. Plasmid G-pBR322(Pst)/HFIF-6 was cleaved with EcoRI and PStI and ligated to plasmid G-pBR322(Pst)/HFIF-7 which had been cleaved with PstI and PvuI. Following ligation the mixture was digested with EcoRI and HaeII. A 4-fold molar excess of this mixture was then ligated to plasmid G-pPLa2311 which had been digested with HaeII and EcoRI.
Transformants were obtained in strain C600rKmK(X) (which was used because of its relatively high transformation capability and because it contains a wild-type cI gene) by selection for kanamycin resistance. Of 15 transformants screened, two had lost resistance to carbenicillin.
Restriction analysis of the DNA isolated from the plasmids of these transformants revealed that one had the desired structure of G-pPLa-HFIF-67-1 depicted in Fig. 8. This plasmid contained a unique EcoRI site and a unique PstI
site. Combined EcoRI-PstI digestion produced two frag-ments -- the smaller of which comigrated with a fragment obtained after EcoRI-PstI cleavage of G-pBR322(Pst)/HFIF-6.
Bg1II digestion cleaved out a small fragment of about 650 base pairs. The size of the latter fragment is consistent with the expected size after joining the proximal Bg1II-PstI fragment of clone G-pBR322(Pst)/HFIF-6 to the distal PstI-Bg1II part of G-pBR322(Pst)/HFIF-7.
HincII digestion produced three fragments as expected from the presence of the HinclI sites in the PL region, the amino-terminal part of the p-lactamase gene and the untranslated 5' end of the DNA sequence of HuIFN-0.
This plasmid was designated G-pPLa-HFIF-67-1.
Based on the aforementioned characterization by restriction enzyme analysis, plasmid G-pPLa-HFIF-67-1 should contain the complete coding sequence of for HuIFN-P. The direction of desired transcription runs colinear with that from the PL promoter. In between the PL and the HiIFN-p coding sequence gene the plasmid still retains the poly(A=T) tail and an inverted 3' end fragment as in G-pBR322(Pst)/HFIF-6.

i . . . .... ,. . r ........ ... . .. .. . . . 1 ..re._ . ,..w.^. .... .. .w .
..,. . . . . .. . . .. . I . . . . , .Z341644 -58- = _ , 2. Construction Of Plasmid G-pPLa-HFIF-67-12 The next step in the constructions was aimed at removing from G-pPLa-HFIF-67-1 the poly(A=T) tail and part of the inverted 3' end fragment (see Figure 9).
G-pPLa-HFIF-67-1 DNA was cleaved with B91II and HpaII.
Since the HuIFN-P coding sequence contains no HaII site this treatment results in the Bg1II fragment containing the entire coding sequence for IFN-P and at the same time inactivates the remaining part of the vector. The resultant Bg1II fragment was ligated to plasmid G-pPLa8 which had been digested with BamHI. The enzymes Bg1II
and BamHI make identical staggered ends such that BclII
ends can be ligated to an opened BamHI site and vice versa. Such a reconstructed site is no longer a substrate for BglII or BamHI but is recognized by the enzyme Sau3AI (MboI) (V. Pirotta, "Two Restriction Endonucleases From Bacillus globigii", Nucleic Acids Res., 3, 1747-1760 (1976)). Following ligation the mixture was again cleaved with BamHI to eliminate those G-pPLa8 molecules that had simply recircularized. Transformants were again obtained in C600rKmK(k) selecting for kanamycin resistance.
The transformants were screened by size determi-nation of uncleaved DNA on agarose gel, as described above, for characterization of the IFN-p-related recombi-nant plasmids. Clones which proved slightly larger than the G-pPLa8 parent were further subjected to restriction analysis with either PstI or. HincIi. One clone was found which contained a single PstI site and three HincII sites. One fragment of this clone comigrated with a HincIl fragment from pPLa8 derived from the PL to the P-lactamase region. Another small fragment of the clone measured about 400 base pairs -- consistent with insertion of the Bg1II fragment into G-pPLa8 in the sense orientation with respect to the PL promoter. This plasmid was designated G-pPLa-HFIF-67-12. The steps ... . ... .._,..-. ,,.. .m . . . . .. ...... .. , . ...... . , ., .. . . . . , _ . .. . . i ,. . .. , . .

used in the construction of this plasmid are shown schematically in Fig. 9. A more detailed map of this plasmid is shown in Fig. 11. The size of the plasmid (-4450 base pairs) was estimated by the size of its constituent fragments, which in turn had been estimated by their relative mobility upon electrophoresis in agarose gels.
E. coli K12AHI and M5219 were then transformed with the characterized plasmid G-pPLa-HFIF-67-12.
Inspection of the determined nucleotide sequence around the B91II/BamHI junction in G-pPLa-HFIF-67-12 revealed an interesting feature. The polypeptide initiated at the AUG of the P-lactamase coding sequence of that plasmid terminates at a double amber codon located within the untranslated 5'-end of the HuIFN-P coding sequence. These termination codons are located 23 nucleotides before the initiating AUG of the HuIFN-P signal peptide, i.e.:

Junction 181* BamHI/BcllI

CCC JCGG.AUC.UUC.AGU.UUC.GGA.GGC.AAC.CUU.UCG.AAG.CCU.
Pro Arg-Ile-Phe-Ser-Phe-Gly-Gly-Asn-Leu-Ser-Lys-Pro-UUG.CUC.UGG.CAC.AAC.AGG.UAG.UAG GCGACACUGUUCGUGUUGUCAAC
Leu-Leu-Trp-His-Asn-Arg am am AUG-(HuIFN-p signal peptide coding sequence)-AUG-(mature HuIFN-p coding sequence) The boxed figure refers to the number of the amino acid residue in the P-lactamase protein of pBR322 (J. Sutcliffe, supra). The asterisk (*) indicates that the CCU codon present at this position on pBR322 was changed to CCC as a consequence of the conversion of the PstI site in pPLa2311 to a BamHI site in pPLa8 (see above).
Therefore, this construction opens the possibil-ity of reinitiation at the AUG of the HuIFN-P signal .

... ............... ... ..... ...... ,........,~... .,., . .. . . . . .
. ..

peptide 13 4 1604 and and therefore the possible expression of IFN-P fused to its signal peptide, but not fused to a part of P-lactamase. Such internal reinitiation following premature termination has been observed in the repressor gene of the E. coli lactose operon (T. Platt et al.
"Translational Restarts: AUG Reinitiation Of A lac Repressor Fragment", Proc. Nati. Acad. Sci. U.S.A., 69, 897-901 (1972)). This construction might enable the excretion of mature IFN-p by correct bacterially recogni-tion of the HuIFN-P signal sequence.

3. Construction Of Plasmid G-pPLa-HFIF-67-12A19 From the known sequence of pBR322 and the HuIFN-p coding sequence it can be deduced that deletion from G-pPLa-HFIF-67-12 of the small HincIl fragment (from within p-lactamase up to 3 nucleotides in front of the HuIFN-P signal peptide initiating AUG) results in a continuous translational reading frame starting at the AUG of P-lactamase and terminating after the HuIFN-P
coding sequence. This construction is therefore predicted to code for a pol.ypeptide consisting of 82 amino acid residues from the P-lactamase coding sequence, one amino acid coded at the fused HincIi site, the HuIFN-P signal peptide and mature HUIFN-p, i.e.:

G AAC.AUG-(HuIFN-P signal peptide.coding sequence)-AUG-Val Asn-Met mature HuIFN-P coding sequence) The boxed figure refers to the number of the amino acid residue in the P-lactamase protein of.pBR322 (J. Sutcliffe, supra). Therefore, this construction may afford the expression of a fused polypeptide consisting of a portion of p-lactamase fused through one amino acid to the HuIFN-0 signal peptide which itself is fused to mature HuIFN-P. Such fusion protein'may be excreted from the cell.
G-pPLa-HFIF-67-12 was partially digested with HincII. Following ligation at a DNA concentration of about 0.01 Ng/ml, the DNA was cleaved with XorII, an isoschizomer of PvuI producing 3' protruding ends (R.
Wang et al., Biochim. Biophys. Acta, in press), and religated at low DNA concentration. Parent G-pPLa-HFIF-67-12 contains two XorII sites: one site inactivates the kanamycin gene and the other one is located in the HincII fragment to be deleted from the plasmid. The purpose of the XorII digestion-religation step is to eliminate parent"DNA molecules not cleaved by the HincII
enzyme. Such molecules possess two XorII sites and under conditions used for ligation, two fragments are highly unlikely to be rejoined. Transformants were obtained in C600r~(X), selecting for kanamycin, and screened by restriction analysis for the presence of a single PvuI site. Further analysis of the clones was performed using HincII digestion. One clone missing the smallest HincII fragment, but otherwise identical to G-pPLa-HFIF-67-12 was designated G-pPLa-HFIF-67-12019.
The steps used in the construction of this plasmid are shown schematically in Fig. 9. A more detailed map of this plasmid is shown in Fig. 12. The size of the plasmid (-4050 base pairs) was estimated by totaling the size of its constituent fragments, which in turn have been estimated by their relative mobility upon electro-phoresis in agarose gels. E. coli K120HI and M5219 were then transformed with the characterized plasmid G-pPLa-HFIF-67-12A19.

4. Construction Of Plasmid G-pPLc-HFIF-67-8 Plasmid G-pPLc24 offers another possibility for insertion of HuIFN-P sequences in such a way that another fusion polypeptide can potentially be synthesized.
Insertion of the Bg1II fragment fromG-pPLa-HFIF-67-1 in the BamHI site of G-pPLc24 results in a continuous reading frame coding for 98 amino acid residues from the MS2 replicase gene (W. Fiers et al. "Complete Nucleotide Sequence Of Bacteriophage MS2 RNA: Primary And Secondary Structure Of The Replicase Gene", Nature, 260, 500-507 (1976)), 27 amino acids coded by sequences between the BclII site and the initiating AUG of the signal sequence of HuIFN-0, followed by the HuIFN-P signal peptide and mature HuIFN-P, i.e.:

UGG GAU.CUU.CAG.UUU.CGG.AGG.CAA.CCU.UUC.GAA.GCC.UUU.GCU.
Trp Asp-Leu-Gln-Phe-Arg-Arg-Gln-Pro-Phe-Glu-Ala-Phe-Ala-CUG.GCA.CAA.CAG.GUA.GUA.GGC.GAC.ACU.GUU.CGU.GUU.GUC.AAC.
Leu-Ala-Gln-Gln-Val-Val-Gly-Asp-Thr-Val-Arg-Val-Val-Asn-AUG-(HuIFN-0 signal peptide coding sequence)-AUG-(mature Met HuIFN-P coding sequence) The boxed figure refers to the number of the amino acid residue in the MS2 replicase gene protein (R. Devos et al., supra; W. Fiers et al., supra). Therefore, this construction may afford the expression of a fused poly-peptide consisting of a portion of MS2 replicase, fused through 27 amino acids to the HuIFN-0 signal peptide which itself is fused to mature I3uIFN-P.
G-pPLa-HFIF-67-1 DNA was digested with Bc11II
and ligated with BamHI-cleaved pPLc24 DNA. The ligation mixture was recut with BamHI to eliminate parental pPLc24 molecules and transformed into C600r~(~.) selecting for resistance to carbenicillin. Transformants were analyzed by restriction with HincIl. From the known positions of restriction sites on pPLc24 one can predict that insertion of the BclII-IFN-P fragment in the sense . . . . . . . ~. i= I . --63- ' - -orientation with respect to PL should produce an extra HincIi fragment of about 650 base pairs. A representative clone exhibiting this configuration was designated pPLc-HFIF-67-8. The steps used in the construction of this plasmid are shown schematically in Fig. 10. A more detailed map of this plasmid is shown in Fig. 13. The size of the plasmid (-3850 base pairs) was estimated by totaling the size of its constituent fragments, which in turn had been estimated by their relative mobility upon electrophoresis in agarose gels. E. coli K12AHI and M5219 were transformed with the characterized plasmid G-pPLc-HFIF-67-8.

5. Construction Of Plasmid G-pPla-HFIF-67-12A279T
Plasmid pKT279 (a gift of K. Talmadge; pKT279 is a derivative of pBR322 having a portion of the gene for P-lactamase deleted and having a PstI site constructed at amino acid 4 of P-lactamase) was digested with PstI
and the 3' terminal extension removed and the fragment blunt-ended by treatment with E. coli DNA polymerase I
(Klenow-fragment) in the absence of deoxy-nucleotide-phosphates. The PstI linearized and 3' blunt-ended DNA
fragment of pKT279 was then digested with EcoRI to produce a fragment that inter alia codes for the signal sequence of P-lactamase and the first 4 amino acids of the mature protein.
This small fragment was then used to replace the HpaI-EcoRI fragment of pPLa-HFIF-67-12Al9 (the UpaI
site resulting as a consequence of the above-described deletion from G-pPLa-HFIF-67-12) by ligation of the HpaI-EcoRI restricted pPLa-HFIF-67-12019 with that fragment in the presence*of T4 DNA ligase.

The predicted sequence at the PstI (blunt-ended)-HpaI junction is:

(0-lactamase signal peptide coding sequence)-CAC.CGC.AAC.
His-Arg-Asn-AUG-(HuIFN-P signal peptide coding sequence)-AUG-(mature Met HuIFN-P coding sequence) Consequently, the construction results in IFN-0 preceded by two signal sequences in tandem -- a bacterial signal sequence (P-lactamase) and the IFN-P signal sequence --connected by several amino acids. Therefore, this construction may afford the expression of mature HuIFN-P
fused to two signal peptides or if the tandem combination of a bacterial signal sequence and HuIFN-P's signal sequence is recognized by the bacteria and correctly cleaved, the construction may afford the expression of mature HuIFN-P and its excretion from the cell.
E. coli M5219 was transformed with pPLa-HFIF-67-120279T.

6. Construction Of Plasmid G-pPLa-HFIF-67-12021$M1 Plasmid pKT218 (a gift of K. Talmadge; pKT218 is a derivative of pBR322 having a portion of the gene for P-lactamase and its signal sequence deleted and having a PstI site constructed at amino acid 4 of the signal sequence of P-lactamase) was digested with EcoRI
and AluI to produce a fragment coding inter alia for the initial part of the P-lactamase signal peptide. This fragment was ligated in the presence of T4 DNA ligase with a fragment prepared from pPLa-HFIF-67-12019 by AluI
digestion in the presence of actinomycin D (0.05 mM) (to restrict the plasmid at the AluI site in the IFN-P
signal peptide) and restriction with EcoRI.

-65- The resulting plasmid, designated pPLa-HFIF-67-12A218M1, contained the initial part of the gene coding for the P-lactamase signal peptide, a part of the gene coding the HuIFN-P signal peptide and the gene coding for mature HuIFN-0. The predicted sequence of the pertinent region of the plasmid is:

C GCU.CUU.UCC.AUG-(mature HuIFN-P coding sequence) G1 Ala-Leu-Ser-Met-The boxed figure refers to the number of the amino acid residue in the P-lactamase signal peptide of pKT218.
Therefore, this construction may permit the expression of mature HuIFN-P fused to portion of a bacterial signal sequence and a portion of its own signal sequence.
Again, if the bacterial host recognizes and correctly cleaves the tandem signal sequence, mature HuIFN-P could be expressed from this plasmid and excreted from the cell.
E. coli M5219 was transformed with pPLa-HFIF-67-120218M1.

7. Construction Of Plasmid G-pPLa-HFIF-67-120M1 Plasmid pPLa-HFIF-67-12019 was linearized as before with AluI in the presence of actinomycin D (0.05 mM) to generate a cut at the AluI site in the signal peptide of HuIFN-0. After digestion with HpaI, the DNA was recircularized in the presence of T4 DNA ligase. The resulting plasmid, designated pPLa-HFIF-67-120M1, had only a small part of the IFN-S signal sequence preceding the DNA sequence coding for mature IFN-P.
The predicted sequence of the junction is:

CUC.UUU.CCA.UGA.
Val Leu-Phe-P o-A UG-(mature HuIFN-0 coding sequence) . , .. ., . I .

-66- = - _ The vertical boxed figure refers to the number of the amino acid residue in P-lactamase. The horizontal boxed figure refers to the sequence in a second reading frame.
Therefore, the translation of the P-lactamase coding sequence and the remaining portion of the coding sequence for the signal peptide of IFN-P is arrested at the UGA-stop codon. However, the start-codon (AUG) for mature IFN-P is present at the same place, although in a different reading frame. Therefore, reinitiation of translation may take place at that point to produce mature HuIFN-0.
E. coli M5219 was transformed with pPLa-HFIF-67-120M1.

8. Construction Of Plasmid G-pPLa-HFIF-67-12a19 BX-2 Plasmid pPLa-HFIF-67-12019 was linearized with HpaI and treated with exonuclease BAL 31 to remove base pairs sequentially from the end of the linearized DNA
fragment (H. Gray et al., "Extracellular Nucleases Of Pseudomonas Bal 31" I. Characterization Of Single Strand-Specific Deoxyribendonuclease", Nucleic Acids Res., 2, pp. 1459-92 (1975)). By varying the time and condition of the exonuclease treatment a series of DNA fragments having various numbers of nucleotides from the coding sequence for the signal peptide of HuIFN-0, if any, preceding the AUG start codon of mature HuIFN-P are constructed. These fragments may then be manipulated to construct ribosomal binding sites at varying distances from that start codon and to afford the desired secondary structure near that codon to enhance expression of mature HuIFN-P.
The exonuclease-treated fragments were blunt ended with E. coli DNA polymerase I(Klenow fragment) in the presence of dATP and dGTP to fill in any 5' protruding ends. Subsequently, a double-stranded XhoI linker, having the sequence 5'-CCTCGAGG-3' (Collaborative Research), 1341644f -67- ' _ .
was ligated onto the blunted-ended DNA fragments. These fragments were then extended with a double-stranded EcoRI linker, having the sequence 5'-CCGAATTCGG-3' (Collaborative Research). After EcoRI digestion, the fragments having "sticky" EcoRI ends were recircularized with E. coli DNA ligase. The use of this ligase, instead of T4 DNA ligase, avoids the recircularization of blunt-ended fragments.
One plasmid was selected and designated pPLa-HFIF-67-12019 BX-2. It has an XhoI site about 25 base pairs in front of the AUG start codon of mature HuIFN-P. The XhoI site is also preceded by a EcoRI site generated by the ligation of the EcoRI linker of the HpaI fragment to the EcoRI site just'preceding the PL
promoter in pPLa-HFIF-67-12019. Therefore, the P-lacta-mase coding sequence has been deleted. Furthermore, because at least part of the HuIFN-0 signal sequence has been removed, only expression of mature HuIFN-P is possible.
E. coli K12AHI was transformed with pPLa-HFIF-67-12Al9 BX-2.

ISOLATION AND CHARACTERIZATION OF
HuIFN-S MADE BY BACTERIA

A. Preparation Of Bacterial Extracts 1. Induction Procedure An aliquot from stock cultures (frozen at -80 C in 50% glycerol-50% LB medium), including stock cultures of strains K12AHI and M5219 transformed with the plasmids containing the IFN-P fragments, described above, was inoculated into fresh LB medium with the desired antibiotic and grown to saturation at 28 C. Two 500 ml batches of LB medium without antibiotic were inoculated with 1 ml each of saturated cells and grown with rigorous shaking to 28 C to a cell density of -68- 1.541604.

2 x 108/ml. One batch was shifted to 42 C and continued to be shaken. Depending on the plasmid used, the culture was harvested at various times after the shift to 42 C.
The control culture remaining at 28 C was harvested at the same time as the 42 C culture. Cells were collected by centrifugation in the GSA rotor (Sorvall) at 8000 rpm for 10 minutes. The pellets were washed in 20 ml of 50 mM Tris HC1 (pH 7.4), 30 mM NaCl and repelleted in the SS34 rotor (Sorvall) for 10 minutes at 10,000 rpm.
The pellet was quickly frozen in dry ice-methanol and stored at -80 C. When it was desired to shock osmotically the harvested cells the freezing step was omitted.
Two different procedures for lysis and extrac-tion of the bacteria have been used.

2. Extraction Procedures L sy is A

Cells were resuspended in a final volume of 4 ml of the above described buffer and lysozyme (Sigma) was added to 1 mg/ml. The incubation was for 30 min at 0 C. The suspension underwent two freeze-thaw cycles by sequential dipping in an ethanol-CO2 mixture (-80 C) and a 37 C water bath. The S-100 fraction was prepared by ultracentrifugation of the lysed bacteria (4 ml) in a Beckman SW60 Tirotor for 1 hr at 60,000 rpm and 4 C, after which the supernatant was further used.
Lysis B

Lysis B was performed, as described above (lysis A), except that the solution of 50 mM Tris-HC1 (pH 8.0)-30 mM NaCl was replaced by 50 mM HEPES (Sigma)-NaOH (pH 7.0), 30 mM NaCl, 3 mM p-mercaptoethanol and 3%
newborn calf serum (Gibco).

-69- =

Osmotic Shock Immediately after harvesting and washing, the cell-pellet was resuspended in 20% sucrose, 100 mM EDTA, 100 mM Tris HC1 (pH 7.4) at a maximal cell density of 1 x 1010/ml. The suspension was kept on ice for 10 minutes and then centrifuged for 10 minutes at 10,000 rpm in the Sorvall SS34 rotor. The sucrose solution was carefully drained from the tube and the pellet was resuspended in an equal volume of water (cell density of 1 x 1010/ml). The resuspended cells remained on ice for 10 min and were then again subjected to a centrifugation at 10,000 rpm for 10 minutes in the SS34 rotor (Sorvall).
The supernatant was made 3% in fetal calf serum, 50 mM
in HEPES buffer (pH 7), 30 mM in NaCl and 3 mM in P-mer-captoethanol. This supernatant is referred to as "osmotic shock supernatant". It was stored at 0 C.

3. Ammonium Sulfate Precipitation 1 ml of an (NH4)2SO4 solution, saturated at room temperature, was added to 0.5 ml of control solution or an S-100 extract. This mixture was kept on ice for at least 30 min, after which the precipitate was pelleted in an Eppendorf centrifuge for 10 min at room temperature.
The pellet was redissolved in PBS (phosphate buffered saline).

B. Interferon Titrations 1. Direct Anti-viral assay HuIFN-P was assayed in microtiter trays (Sterilin) by a CPE (cytophatic effect)-inhibition technique in human fibroblasts trisomic for chromosome 21. The cells were seeded one day before use, incubated with serial dilutions (log10 = 0.5) of the sample for 24 h and challenged with vesicular stomatitis virus (Indiana strain) 10-3 dilutions of a stock containing -70- ' 106=9 mouse C-929 plaque forming units/ml. The CPE was recorded at 24 h after VSV challenge and the interferon endpoint was defined as the sample dilution causing 50%
reduction of viral CPE. All assays included an internal standard of HuIFN-~ which was itself calibrated against the NIH human fibroblast reference G023-902-527.
The cell line trisomic for chromosome 21 (henceforth referred to as T21) was derived from a skin biopsy of a female patient with Down's syndrome. Its karyotype has been established and showed diploidy for all chromosomes except for chromosome 21 (trisomic).
The sensitivity of this cell line to interferon appears to be comparable to the sensitivity of cell lines trisomic for chromosome 21 described by E. De Clercq et al., "Non-antiviral Activities Of Interferon Are Not Controlled By Chormosome 21", Nature, 256, pp. 132-134 (1975) and E. De Clercq et al., "Chromosome 21 Does Not Code For An Interferon Receptor", Nature, 264, 249-251 (1976).
In other assays the cell line E1SM (A. Billiau et al., "Human Fibroblast Interferon For Clinical Trials:
Production, Partial Purification And Characterization", Anti-microbial Agents And Chemotherapy, 16, 49-55 (1979)) has been used. This cell line is a diploid fibroblast disomic for chromosome 21 and derived from a two-month-old human fetus. Compared to the T21 cell line, E1SM is less sensitive to HuIFN-P by a factor of 10.

2. 2,5-A Synthetase Assay Another method for detecting the presence of interferon is by the use of a 2,5-A synthetase assay.
It has been shown that interferon induces this enzyme, which converts ATP into trimers (and to a lesser extent dimers, tetramers and multimers) of 2,5-A (A. Kimchi et al., "Kinetics Of The Induction Of Three Translation-Regulatory Enzymes By Interferon", Proc. Natl. Acad. Sci.
U.S.A., 76, 3208-3212 (1979).

. .,. . ,. .. i .

-7i-Confluent 25 cm2 flasks containing cultures of E1SM cells (A. Billiau et al., supra) were treated for 20 h with a 1:6 dilution of bacterial extracts or control interferon in MEM-10% fetal calf serum. The cultures were detached with trypsin (0.25%), EDTA (0.17%) and extensively washed with 140 mM NaC1 in 35 mM Tris buffer (pH 7.5). All subsequent operations were carried out at 4 C. Cells were homogenized in 1.5-2.0 vol of 20 mM
HEPES buffer (pH 7.4) containing 10 mM KC1, 1.5 mM
magnesium acetate and 0.5 mM dithiothreitol ("lysis buffer I") in a Dounce glass homogenizer. The homogenate was centrifuged for 20 min at 10,000 x g and the super-natant (S10) stored in liquid nitrogen when not used immediately.
Confluent 96-well microtiter plates (105 cells in 0.2 ml per 0.28 cm2 well) were treated with interferon or the respective bacterial extracts as above. After h treatment, plates were cooled on ice and washed three times with 140 mM NaC1 in 35 mM Tris buffer (pH
20 7.5). The cultures were then lysed by adding to each well 5 N1 of a solution containing 0.5% Nonidet P40 and 1 mM phenylmethane sulfonyl fluoride (PMSF) in lysis buffer I. After shaking vigorously for 20 min on ice, the cell lysates were collected and centrifuged for 20 min at 10,000 x g as above.
3.5 N1 of lysate, prepared as indicated above, (lysis A or lysis B) were incubated for 2 h at 31 C in 6 N1 of an incubation mixture containing 100 mM potassium acetate, 25 mM magnesium acetate, 10 mM HEPES/KOH (pH
7.4), 5 mM ATP, 4 mM fructose 1,6 bis-phosphate, 1 mM
dithiothreitol and 20 pg/ml poly(I)=poly(C) and 2 pCi of lyophilized (a-32P)-ATP (400 Ci/mmol, from the Radio-chemical Centre, Amersham, U.K.). After stopping the reaction by heating for 3 min at 95 C and clarification for 2 min at 9,000 x g, the samples were treated with 150 U/ml of alkaline phosphatase from calf intestine -72- 13 4 1 6 0 4_ (Boehringer, Mannheim, cat. nr. 405612) for 1 h at 37 C, clarified again and spotted (1 p1 per sample) on thin-layer plates of polyethyleneimine-cellulose (Polygram, cel 300 PEI 20 x 20 cm from Macherey-Nagel Co., Duren Germany).
The plates were washed two times in 2 1 of distilled water and dried under vacuum before chromatography in 1 M acetic acid for 2-3 h. After drying they were submitted to autoradiography for 1-24 h.

C. Detection Of HuIFN-0 Activity In Bacterial Extracts 1. Control Experiments Two main problems were encountered in the performance of the above-described assays. Both are important in the interpretation of the assay data.
Bacterial extracts (including control extracts) resulting from lysis by the above described procedures seemed to include a non-interferon related factor which displayed anti-viral activity in the assay. It is unclear whether the factor itself was an anti-viral agent, or whether the factor induced an anti-viral substance, e.g., interferon, under the conditions of the assay. The presence of the factor was detected repeatedly in S100 extracts. The activity of the factor was, perhaps because of cell density, often higher in control extracts from E. coli HB101 than in similar control extracts of the K12AHI or M5219 host bacteria, where the activity of the factor was always less than about 0.7 logio/ml. For some reason, the anti-viral activity of the factor was reduced or sometimes even eliminated totally by precipitation with (NH4)2SO4 under'conditions which also precipitated interferon in control experiments.
Due to the anti-viral activity attributable to this contaminating factor, it is difficult to draw conclusions about the presence of trace amounts of interferon in bacterial extracts. However, it was possible to discriminate between the anti-viral activity -73- = _ .
of the factor and the activity of authentic interferon by the use of the diploid fibroblasts E1SM. These cells are less sensitive to HuIFN-S than the usual cells .trisomic for chromosome 21. But, the cells are much more sensitive to the factor, than they are to bona fide interferon. For example, using pMS2-7 (R. Devos et al.
"Construction And Characterization Of A Plasmid Containing A Nearly Full-size DNA Copy Of Bacteriophage MS2 RNA", J. Mol. Biol., 128, 595-619 (1979)) in E. coli HB101 (H.
Boyer and D. Rouland-Dussoix, "A Complementation Analysis Of Restriction And Modification Of DNA In Escherichia coli", J. Mol. Biol., 41, 459-472 (1969)) or K120HI-G-pPLa2311 as control lysates, data demonstrating this relative effect are shown in the following table, with anti-viral activity measured as logib units/ml.

HB101-pMS2-7 (lysis A) 0.7 HB101-pMS2-7 (lysis B, but no P-mercaptoethanol and no calf serum) <0.2 1.2 HB101-pMS2-7 (lysis B) not done 0.7 HB101-pMS2-7 (lysis B) 0.2 1.0 HB101-pMS2-7 (lysis B) 0.7 2.5 K12AHI-G-pPLa2311 (lysis B) 0.2 4.0 K12AHI-G-pPLa2311 (42 C; osmotic shockate) 0.5 >1.7 Furthermore, the presence of authentic HuIFN-0 is reflected by a different ratio of values on T21:E1SM and a high value on T21 as compared to that caused by the presence of the factor. This is shown in the following data:

osmotic K124HI-G-pPLa2311 (42 C) 0.5 2.5 shock K12AHI-G-pPLa2311 (42 C) 1.5 2.5 super- + BuIFN-p (authentic) natant -74- = - - - .

lysis B HB101-pMS2-7 0.2 2.5 after HB101-pMS2-7 + HuIFN-P 2.7 2.5 (NH4)2SO4 (authentic) precipi- (added before lysis) tation Therefore, a comparison of the activities T21:E1SM and a measurement of the absolute activity on T21 cells permits the use of the anti-viral assays, described above, to detect unambiguously the presence of HuIFN-P in a bacterial extract. Furthermore, it should be noted that for extracts of cultures of E. coli (either K12AHI or M5219) transformed with some plasmids of this invention, e.g., G-pPLa-HFIF-67-12, G-pPLa-HFIF-67-12019, G-pPLc-HFIF-67-8, G-pPLa-HFIF-67-12A279T, G-pPLa-HFIF-67-120218MI, G-pPLa-HFIF-67-12AMI or G-pPLa-HFIF-67-12A19 BX-2, such interference by the unknown factor in the anti-viral assays was less severe. In these assays, the non-highly concentrated extracts (for example, cells from 150-m1 cultures at 6 x 108 cells/ml were lysed and extracted in 4 ml) displayed a low or undetectable level of anti-viral activity attributable to the unknown factor.
The presence of this contaminating factor has also been shown to be detectable in the 2,5-A synthetase activity assay. Here, however, the factor can be elimi-nated completely by precipitation with (NH4)2SO4.
Therefore, the actual presence of HuIFN-P in a bacterial extract, as distinquished from the presence of the contaminating factor, can also be detected unambiguously in this assay.
However, extracts from E. coli HB101/G-pBR322 (Pst)/HFIF-6, which has an incomplete colinear coding sequence (only the last few base pairs are missing) and is thus unable to express a mature polypeptide, has repeatedly yielded a positive 2,5-A synthetase activity, but so far no discernable anti-viral activity. This demonstrates that the 2,5-A assay cannot be regarded as the only criterion for the presence of a complete bacteria-made interferon. It also demonstrates that less than the complete mature interferon may have useful activity.
2,5-A synthetase activity is measured by 32P
incorporation into the 2,5-A trimer as shown by auto-radiography. Results (repeated 3 times) are shown in the following table, with increasing positive values reflecting increased incorporation of 32P.

extract a/pHFIF-64 +++; after (1VH4)ZSO4 precipitation->++
extract b/pMS2-7 4 +++; after (NHg)ZSO4 precipitation-> -extract b/pMS2-7 ++++; after (NH4)ZSO4 precipitation+++
plus HuIFN-0 A second important problem in these assays is the low recovery,of HuIFN-p secreted by human fibroblasts during and after different experimental steps. A compar-ison of the recoveries of leukocyte interferon and fibroblast interferon added to an S-100 extract demonstrates that HuIFN-P is recovered with only 10% efficiency, in contrast to HuIFN-a's 100% recovery (anti-viral values are given as loglo units/ml; assayed on T21 cells).

IFN-a diluted in S-100-extract of HB101-pMS2-7 (lysis A) 2.5 IFN-a diulted in E-MEM plus 3% calf serum 2.7 IFN-P diluted in S-100-extract of HB101-pMS2-7 (lysis A) 0.7 IFN-0 diluted in E-MEM-plus 3% calf serum 1.7 Other experiments where IFN-0 was added to the cell pellet before lysis and extraction (even with calf serum added to 3% as a stabilizer) showed that only 10-30% IFN-0 was recovered.

1o910 units/mi HB101-pMS2-7 (lysis B, but no pH 8 0.7(10%) 1.7 plus IFN-0 S-mercaptoethanol pH 7 1.0(20%) 1.7 or calf serum) pH 6 0.7(10%) 1.7 IFN-~ (same treatment as pH 6 1.7(50%) 1.5 (no bacteria) in lysis B) Further experiments were carried out to test the stability and recovery of IFN-p activity. Precipita-tion with (1VH4)2SO4i as described above, either in the presence or absence of bacterial extracts, often caused a reduction of the titer in the anti-viral assay:

loglo units/ml Precipitation with (NH4)ZSO4 before after IFN-P 1.0 0.5 IFN-P 2.7 2.5 HB101-pMS2-7 + IFN-p (lysis B) 1.5 1.2 K12QHI-G-pPLa2311 (28 C) + IFN-p (lysis B) 1.7 1.5 K120HI-G-pPLa2311 (28 C) + IFN-P (lysis B) 2.2 3.0 Dialysis of IFN-p (overnight at 4 C against PBS) either in the presence or in the absence of bacterial extracts, also usually resulted in a decreased recovery of IFN-P
activity:

logio units/ml Dialysis before after IFN-P in PBS 1.0 0.5 IFN-P in PBS 2.7 2.5 K12AHI-G-pPLa8 (28 C) + IFN-P (lysis B) 1.2 <0.2 K120HI-G-pPLa8 + IFN-p (lysis B) 3.0 1.7 K12AHI-G-pPLa8 + IFN-P (lysis B) 2.5 1.0 K12aHI-G-pPLaB + IFN-P (lysis B) 1.5 0.5 Since IFN-P is a Type I interferon its activity should be acid-stable. This was tested by dialyzing IFN-0 samples in the presence or absence of bacterial 1341604~

extracts, overnight in 5 mM glycine-HC1 (pH 2.2) at 4 C.
This treatment caused the formation of a precipitate, which was pelleted in an Eppendorf centrifuge at 12,000 x g for 2 min. The supernatant was then tested for anti-viral activity. Although some of the anti-viral activity remained following this treatment, there was a substantial loss in the amount of interferon recovered.

loglo units/ml Dialysis before after HB101-pMS2-7 (lysis A) + IFN-S 0.7 0.5 K12AHI-G-pPLa231l (28 C) osmotic shockate + IFN-P 1.2 1.2 M5219-G-pPLa8 (42 C) (lysis B) + IFN-S 1.2 0.7 M5219-G-pPLaB (28 C) (lysis B) + IFN-P 3.0 2.0 The reductions in HuIFN-0 activity observed with these different treatments to the above described control extracts must be interpreted cautiously. The lower anti-viral titers do not necessarily mean that interferon is being degraded. The lower titers may be due to non-specific sticking of the HuIFN-P to dialysis membranes or to components in the bacterial extracts, e.g. membrane components. For example, it is well established that IFN-p is a hydrophobic protein (its hydrophobicity is also substantiated by its amino acid sequence) which can adhere non-specifically to tube walls or other surfaces. Furthermore, bacterial IFN-P, lacking glycosylation, may be even more hydrophobic.
Therefore, conclusions on the recovery of the glycosylated IFN-p secreted by human cells may not necessarily be extrapolated to IFN-P of bacterial origin.
2. Demonstration of IFN-S Activity a. Anti-viral Activity Bacterial extracts of E. coli M5219 or K120HI, containing the plasmids G-pPLa-HFIF-67-12, G-pPLa-HFIF-67-12019, G-pPLc-HFIF-67-8, G-pPLa-HFIF-67-120279T, G-pPLa-HFIF-67-12A218MI, G-pPLa-HFIF-67-12AMI, or G-pPLa-HFIF-67-12A19 BX-2 were analyzed for IFN-P anti-viral activity. The procedures for induction and prepara-tion of the S-100 extracts and the osmotic shock super-natants were substantially as described above. 150 ml of bacterial culture (3-6 x 108 cells/ml) were used per experiment. All biological titers are given in loglo units/ml.

G-pPLa-HFIF-67-12 G-pPLa-HFIF-67-12 was employed to transform E. coli M5219 and E. coli K12AHI and S-100 extracts were prepared by lysis B. All samples were precipitated with (NH4)2SO4 before testing for antiviral activity.

K12AHI-G-pPLa-HFIF-67-12 (28 C) < 0.2 < 1.0 K120HI-G-pPLa-HFIF-67-12 (42 C, 90 min) 0.2/0.5 < 1.0/< 1.0 M5219-G-pPLa-HFIF-67-12 (28 C) < 0.2 < 1.0 M5219-G-pPLa-HFIF-67-12 (42 C, 90 min) 0.7/0.7 < 1.0/< 1.2 The second figure in the above table is the titer deter-mined on reassay of the same sample. A control experiment where authentic IFN-P was added to E. coli HB101-pMS2-7 before lysis of the cells indicated an IFN-p recovery of 30% in the assay. Therefore, it is plain that upon induction IFN-P anti-viral activity is detected in the bacterial lysate. The titers, while below the detection level of E1SM cells, show clearly that the IFN-P activity is not due to a contaminating bacterial activity. Such a contaminating bacterial activity would give values of at least 2.0 on E1SM to correspond to the values of 0.5 or 0.7 on T21 cells (see control experiments above).

. . ... . . . . . .. .

G-pPLa-HFIF-67-12019 Plasmid G-pPLa-HFIF-67-12A19 was used to transform E. coli M5219 and S-100 extracts were prepared by lysis B. All samples were precipitated with (NH4)ZSO4, as described above, and assayed for anti-viral activity.
Again, the presence of HuIFN-P anti-viral activity in the extracts is plain. The value between brackets indicates the detection level, due to some toxicity of the particular samples for the human cells in tissue culture.

i) M5219-G-pPLa-HFIF-67-12019 (28 C) ii) M5219-G-pPLa-HFIF-67-12019 (42 C, 90 min, final cell density = 3 x 108/ml) on T21 on E1SM

i) < 0.5 2.2 (< 2.0) ii) 2.2 (< 0.5) 2.2 (< 2.0) A control experiment where authentic IFN-p was added to HB101-pMS2-7 before lysis of the cells displayed a 30%
recovery. Here, the high values on T21 cells and the ratio of activity on T21 over that on E1SM indicate that there was no significant contaminating bacterial activity (as discussed above) in the temperature induced samples.

G-pPLc-HFIF-67-8 Plasmid G-pPLc-HFIF-67-8 was used to transform E. coli M5219 and S-100 extracts were prepared by lysis B.
All samples were precipitated with (NH4)ZSO4 and assayed for anti-viral activity.

i) M5219-G-pPLc-HFIF-67-8 (28 C) ii) M5219-G-pPLc-HFIF-67-8 (42 C, 180 min, final cell density = 6 x 10$/ml) = = - r on T21 on E1SM

i) < 0.5 2.2 (< 2.0) ii) 2.2 (< 0.5) 2.2 (< 2.0) The value in the brackets indicates the detection level, due to toxicity. A control experiment where authentic IFN-0 was added to HB101-pMS2-7 before lysis of the cells displayed a 30% recovery. Again, it is plain that the bacterial extract displayed HuIFN-p anti-viral activity.
In another experiment the osmotic shock super-natant of these cells was assayed for IFN-0 antiviral activity:

i) control: M5219-G-pPLa-HFIF-67-12019 (28 C) ii) M5219-G-pPLc-HFIF-67-8 (28 C) iii) M5219-G-pPLc-HFIF-67-8 (42 C, 180 min, cell density = 6 x 108/ml).

The assays were performed on T21 cells, both before and after (NH4)2SO4 precipitation. The value between brackets indicates the limit of detection.

before precipitation after precipitation i) < 0.2 < 0.2 ii) < 0.2 < 0.2 iii) 1.5 (< 0.2) 0.7 (< 0.2) The recovery of IFN-P was about 10% in control experiments.
The control lysates did not show detectable activity on E1SM. The values obtained with the osmotic shock super-natants make plain that the temperature-induced M5219-G-pPLc-HFIF-67-8 extract has an anti-viral activity not present in the non-induced samples. Sample (iii) after precipitation with (NH4)ZSO4, having a titer of 0.7 loglo units per ml, was dialysed to pH 2.2, as described -8i-above, and showed no substantial decrease of activity.
This acid-stability is a particular property of type I
interferons, e.g. IFN-p.

G-pPLa-HFIF-67-12A279T
Plasmid G-pPLa-HFIF-67-12A279T was used to transform E. coli M5219 and S-100 extracts were prepared by lysis B. Samples were precipitated with (NH4)ZSO4 before assay by CPE on T21 cells. The extracts of cells induced at 42 C displayed an anti-viral titer of 1.5-1.7 loglb u/ml of extract.

G-pPLa-HFIF-67-120218MI
Plasmid G-pPLa-HFIF-67-12A218MI was used to transform E. coli M5219 and S-100 extracts were prepared by lysis B. Samples were precipitated with (NH¾)2SO4 before assay by CPE on T21 cells. The extracts of cells induced at 42 C displayed an anti-viral titer of 1.5 login u/ml of extract.

G-pPLa-HFIF-67-12AMI
Plasmid G-pPLa-HFIF-67-12AMI was used to transform E. coli M5219 and S-100 extracts were prepared by lysis B. Samples were precipitated with (NH4)2SO4 before assay by CPE on T21 cells. The extracts of cells induced at 42 C displayed an anti-viral titer of 2.0 loglo u/ml of extract.

G-pPLa-HFIF-67-12019 BX-2 Plasmid G-pPLa-HFIF-67-12A19 BX-2 was used to transform E. coli K12AHI and S-100 extracts were prepared by lysis B. Samples were precipitated with (NH4)ZSO4 before assay by CPE on T21 and FS-4 cells. The extracts of cells induced at 42 C displayed an anti-viral titer of 1.7-2.0 loglb u/ml of extract.

., . . . . , . , , . i i i b. Antibody Neutralization Of HuIFN-S Anti-Viral Activity Further evidence substantiating bacterial expression of IFN-p is given by antibody neutralization experiments. The anti-interferon antiserum was produced in goats, immunized with 107 units of authentic IFN-P
(secreted by human fibroblast cells), and purified on controlled pore glass beads (A Billiau et al., supra).
After bacterial extracts were assayed as above for antiviral activity, serial dilutions of the antiserum were added to similar samples, the mixtures incubated for 1 h at 37 C, applied to human diploid fibroblasts T21 and assayed for anti-viral activity as described before. The degree of neutralization by IFN-P antiserum ranges from +++ (complete neutralization to - (no neutral-ization). The value between brackets indicates the approximate antiserum dilution for 50% neutralization.

1) M5219-G-pPLc-HFIF-67-8 (42 C, 180 min; which gave 2.2 logio antiviral units/ml on T21 cells).

2) M5219-G-pPLa-8 (42 C, 180 min) to which IFN-0 (from human fibroblasts) was added before lysis (which gave 1.7 loglo antiviral units on T21 cells).

dilution of antiserum (1) (2) 10s +++ +++
10__4 =+ _ +++
105 (10 4=5) +++
10_6 - (10 g) Similar results were obtained with extracts from M5219-pPLa-HFIF-67-12A19 (42 C). The differences in neutrali-zation titer between the bacterial IFN-¾ of this invention and authentic IFN-P may be due to differences in antigen-icity or in the specific IFN activity of these bacterial proteins relative to authentic IFN-p caused by lack of glycosylation in the bacterial proteins.

, . , c. Stability Of HuIFN-0 Anti-Viral Activity (1) Heat Treatment IFN-P has, in contrast to IFN-a, the very unusual property that its anti-viral activity is recovered after lysis in boiling 1% SDS, 1% p-mercaptoethanol, 5 M
urea (Stewart, W.E. II et al., Distinct Molecular Species of Human Interferon, Requirements For Stabilization And Reactivation Of Human Leucocyte And Fibroblast Interferon, J. Gen. Virol., 26, 327-331, (1975)), although a 100%
recovery usually is not obtained. For this assay the bacterial cells of a 150 ml culture were resuspended in the buffer for lysis B and an equal volume of 2% SDS, 2%
P-mercaptoethanol and 10 M urea added, the mixture boiled for 2 min, and S-100 fractions prepared.

i) control: M5219-G-pPLa-HFIF-67-12A19 (28 C) ii) control: 3 logio units of HuIFN-P diluted in lysis B buffer iii) M5219-G-pPLc-HFIF-67-8 (42 C, 180 min, cell density = 6 x 10$/ml).

The assays were performed on T21-cells. The value in the brackets indicates the limit of detection, due to intrinsic toxicity.

Before boiling After boiling i) < 1.5 < 1.5 ii) 2.2 (< 1.5) 2.0 (< 0.5) iii) 3.0 (< 2.0) 2.2 (< 1.5) The control experiment showed a recovery of about 10% of the IFN-p activity. There was no detectable value in E1SM in parallel control lysates. These data make plain that although only about 10% of added IFN-P is recovered in the control experiment, that IFN-P anti-viral activity was present in the extract from the temperature induced . . ., . . . . . , ._ . , , M5219-G-pPL-c-HFIF-67-8 culture even after this severe treatment. In fact, a higher antiviral activity was found after this treatment as compared to the lysis B
procedure, indicating possible adherence of IFN-0 to cell components in the latter procedure.
(2) Dialysis The HuIFN-P anti-viral activity is also non-dialysable. For example, after dialysis against PBS for
16 h at neutral pH and 4 C the anti-viral activity (logio u/ml) of the bacterial extracts was maintained, albeit at a reduced titer:

i) M5219-pPLc-HFIF-67-8 (42 C) ii) M5219-pPLa-HFIF-67-12619 (42 C) iii) IFN-P in M5219-pPLa-8 (42 C) Before dialysis After dialysis i) 2.3 2.3 i) 3 2.3 i) 1.5 1.3 ii) 2.3 1.3 ii ) 2.3 2ii) 2.3 1 The observed decrease in activity after dialysis may be due to non-specific sticking of IFN-P to dialysis membranes, etc.

(3) Precipitation with (NH4)2SO4 The anti-viral activity (1og10 u/ml) of the bacterial extracts of this invention was maintained after precipitation with 67% saturated ammonium sulphate (2 vol (NH4)2SO4 solution to 1 vol extract), a concentra-tion known to precipitate HuIFN-p. After 30 min on ice, . . . . . ,.. ..... ._., . ...

the peilt was centrifuged at 12000 x g for 10 min and redissolved in PBS for assay:

i) M5219-pPLc-HFIF-67-8 (42 C) ii) M5219-pPLa-HFIF-67-12619 (42 C) iii) IFN-P in M5219-pPLa-8 (42 C) before precipitation after precipitation i) 2 2 i) 2 2.3 ii) 2 2 iii) 1.3 1.3 iii) 1.5 1.3 (4) pH 2 Treatment The anti-viral activity (login u/ml) of the bacterial extracts of this invention were also stable to acid. The extracts were either dialyzed for 15 h against 50 ml glycine-HC1 (pH 2.2), followed by dialysis against PBS for 3 h or acidified with HC1, followed by neutrali-zation with NaOH. After removal of the precipitate the assay was conducted:

i) M5219-pPLc-HFIF-67-8 (42 C) ii) M5219-pPLa-HFIF-67-12A19 (42 C) iii) IFN-0 in M5219-pPLa-8 (42 C) before acid after acid i) 2 1.3 i) 0.7 0.7 ii) 2 1 iii) 3 2 d. 2,5-A Synthetase Activity The osmotic shockates of M5219-G-pPLc-HFIF-67-8 (described above) were assayed for the presence of 2,5-A

synthetase, as described above, with microtiter plates, except that Hela cells were used instead of E1SM cells.
The following results were obtained:

i) M5219-G-pPLc-HFIF-67-8 (28 C) (see above) ii) M5219-G-pPLc-HFIF-67-8 (42 C) (see above) The values, reflecting the 2,5-A synthetase activity, indicate the 32P-radioactivity incorporated in the trimer form of 2,5-A.

(after substraction (measured of endogenous back-counts) ground) 1) non treated cells 3342 cpm 0 cpm 2) bacterial extract (i): dilution 1/6 1972 cpm -1370 cpm 3) bacterial extract (ii): dilution 1/6 6960 cpm 3618 cpm 4) bacterial extract (i) + IFN-p to 1.5 loglo units/ml 7037 cpm 3695 cpm 5) see 3 but incubated with anti-IFN-P
antiserum 3950 cpm 608 cpm 6) see 4 but incubated with anti-IFN-P
antiserum 2960 cpm -382 cpm 7) control IFN-0 0.5 logio units/ml 4463 cpm 1120 cpm 8) control IFN-0 1 loglo units/ml 7680 cpm 4338 cpm 9) control IFN-S
1.5 loglo units/ml 13615 cpm 10273 cpm 10) control IFN-¾
2 logio units/ml 25040 cpm 21698 cpm The results of the 2,5-A synthetase activity assay demonstrate that the osmotic shockate supernatant of the temperature induced M5219-G-pPLc-HFIF-67-8, which has anti-viral activity (see above), is also inducing 2,5-A
synthetase activity while the non-induced bacterial strain is not. This parallels the results of the anti-viral activity assay.

. . .. , . . . . . ._ . . . . . -87-i341604 The degree of stimulation of 2,5-A synthetase is equal to the activity of IFN-p added to the control lysate (compare samples (3) and (4)). Use of a concen-tration curve developed from samples (7) to (10)) shows that, taking into account thle dilution, an activity of loglo 1.7 units/ml can be estimated in both samples (3) and (4), which is compatible with the values in the direct antiviral assay, i.e. 1.5 loglo units for both samples. This series of experiments also demonstrates that the induction of 2,5-A synthetase can be neutralized by anti-IFN-0 antiserum, as is the case in the antiviral assay.

e. Anti-viral Activity On Other Cell Lines The extracts (i) and (ii) (M52l9-G-pPLc-HFIF-67-8, above) were also tested for antiviral activity on different cell lines of feline, mouse, monkey or rabbit origin. They did not show any detectable antiviral activity on these cells; neither did authentic IFN-P, made by human cells. Also no activity was found on a feline lung cell line which was sensitive to human leucocyte interferon. These results provide further substantiation that the IFN-P produced by the bacteria exhibits properties essentially identical to those of IFN-0 secreted by induced human fibroblast cells.
f. Sensitivity To Protease The sensitivity of IFN-p from the bacterial hosts of this invention was tested by treatment of diluted bacterial extracts with increasing amount of trypsin for 1 h at 37 C. The anti-viral activity of the IFN-p was abolished by the trypsin at a similar concentra-tion to that which abolished the activity of authentic IFN-P added to an inactive control lysate.

Trypsin Endpoint ms ml M5219-pPLa-HFIF-67-12A19 (42 C) (1000 u/ml) 0.03 M5219-pPLc-HFIF-67-8 (42 C) (1000 u/ml) 0.03 IFN-P in M5219-pPLa-8 (42 C) (1000 u/ml) 0.03 M5219-pPLc-HFIF-67-8 (42 C) ( 30 u/ml) 0.03 IFN-P in M5219-pPLa-8 (42 C) ( 30 u/ml) 0.03 3. Identification of the Active IFN-s Product Various experiments have demonstrated that pre-HuIFN-0 is not active and is not processed by bacterial cells or under assay conditions to an active product.
Therefore, the IFN-P activity detected in the various bacterial extracts, described above, is probably due to processing of the expected fused proteins (e.g., HuIFN-P
fused to P-lactamase, MS2 or bacterial signal sequences) by the bacteria or under the conditions of the assay to an active product.
It is not certain that the active product in such extracts is mature HuIFN-0 (mature HuIFN-P is, of course, the product of G-pPLa-HFIF-67-12AM1 and G-pPLa-HFIF-67-12A19 BX-2). However, fractionation of the bacterial extracts by polyacrylamide gel electrophesis under denaturing conditions revealed the presence of two active products. The first of those products had an approximate size of 15000-18000 daltons and could correspond to mature IFN-P. The second product, which had a higher molecular weight, may be a fusion product or an incompletely processed product which has IFN-P activity or may be a product that is processed to mature IFN-P under the conditions of the assay. Amino acid sequencing of the various expression products, using well known techniques, will enable a determination of what protein products, if any, in addition to mature HuIFN-P, display the activity of HuIFN-S.

IMPROVING THE YIELD AND ACTIVITY OF
POLYPEPTIDES DISPLAYING HuIFN-0 ACTIVITY
PRODUCED IN ACCORDANCE WITH THIS INVENTION

The level of production of a protein is governed by three major factors: the number of copies of its gene within the cell, the efficiency with which those gene copies are transcribed and the efficiency with which they are translated. Efficiency of transcription and translation (which together comprise expression) is in turn dependent upon nucleotide sequences, normally situated ahead of the desired coding sequence. These nucleotide sequences or expression control sequences define, inter alia, the location at which RNA polymerase interacts to initiate transcription (the promoter sequence) and at which ribosomes bind and interact with the mRNA
(the product of transcription) to initiate translation.
Not all such expression control sequences function with equal efficiency. It is thus of advantage to separate the specific coding sequences for the desired protein from their adjacent nucleotide sequences and to fuse them instead to other known expression control sequences so as to favor higher levels of expression. This having been achieved, the newly engineered DNA fragment may be inserted into a higher copy number plasmid or a bacterio-phage derivative in order to increase the number of gene copies within the cell and thereby further improve the yield of expressed protein.
Several expression control sequences may be employed as described above. These include the operator, promoter and ribosome binding and interaction sequences (including sequences such as the Shine-Dalgarno sequences) of the lactose operon of E. coli ("the lac system"), the corresponding sequences of the tryptophan synthetase system of E. coli ("the tpr system"), the major operator and promoter regions of phage A(OLPL as described above and ORPR), a control region of Filamentous single-stranded -90- 1 3 4 1 fi 0 4 DNA phages, or other sequences which control the expression of genes of prokaryotic or eukaryotic cells and their viruses. Therefore, to improve the production of a particular polypeptide in an appropriate host, the gene coding for that polypeptide may be prepared as before and removed from a recombinant DNA molecule closer to its former expression control sequence or under the control of one of the above expression control sequences.
Such methods are known in the art.
Other methods to improve the efficiency of translation involve insertion of chemically or enzymati-cally prepared oligonucleotides in front of the initiat-ing codon. By this procedure a more optimal primary and secondary structure of the messenger RNA can be obtained.
More specifically, the sequence can be so designed that the initiating AUG codon occurs in a readily accessible position (i.e., not masked by secondary structure) either at the top of a hairpin or in other single-stranded regions. Also the position and sequence of the aforemen-tioned Shine-Dalgarno segment can likewise be optimized.
The importance of the general structure (folding) of the messenger RNA has been documented (D. Iserentant and W.
Fiers "Secondary Structure Of mRNA And Efficiency Of Translation Initiation", Gene, 9, 1-12 (1980).
Further increases in the cellular yield of the desired products depend upon an increase in the number of genes that can be utilized in the cell. This may be achieved by insertion of the HuIFN-p gene (with or without its transcription and translation control elements) in an even higher copy number plasmid or in a temperature-controlled copy number plasmid (i.e., a plasmid which 4ries a mutation such that the copy number of the plasmid increases after shifting up the temperature; B.
Uhlin et al. "Plasmids With Temperature-dependent Copy Number For Amplification Of Cloned Genes And Their Products", Gene, 6, 91-106 (1979)). Alternatively, an increase in gene dosage can be achieved for example by insertion of recombinant DNA molecules engineered in the way described previously into the temperate bacteriophage X, most simply by digestion of the plasmid with a restric-tion enzyme, to give a linear molecule which is then mixed with a restricted phage X cloning vehicle (e.g., of the type described by N. E. Murray et al., "Lambdoid Phages That Simplify The Recovery Of In Vitro Recombinants", Mol. Gen. Genet., 150, 53-61 (1977) and N. E. Murray et al., "Molecular Cloning Of The DNA Ligase Gene From Bacteriophage T4", J. Mol. Biol., 132, 493-505 (1979) and the recombinant DNA molecule produced by incubation with DNA ligase. The desired recombinant phage is then selected as before and used to lysogenize a host strain of E. coli.
Particularly useful x cloning vehicles contain a temperature-sensitive mutation in the repression gene ci and suppressible mutations in gene S, the product of which is necessary for lysis of the host cell, and gene E, the product which is the major capsid protein of the virus. With this system the lysogenic cells are grown at a relatively low temperature (e.g., 28 -32 C) and then heated to a higher temperature (e.g., 40 -45 C) to induce excision of the prophage. Prolonged growth at higher temperature leads to high levels of production of the protein, which is retained within the cells, since these are not lysed by phage gene products in the normal way, and since the phage gene insert is not encapsidated it remains available for further transcription. Artificial lysis of the cells then releases the desired product in high yield. As in this application we have also used the A repressor system to control expression, it may be necessary to control the excision of the prophage and hence the gene copy number by a heteroimmune control region, e.g., derived from the lambdoid phage 21.

. . ,. . . . . . .. . . . I .. r I

It should be understood that polypeptides displaying IFN-0 activity (prepared in accordance with this invention) may be prepared in the form of a fused protein (e.g., linked to a prokaryotic N-terminal segment directing excretion), or in the form of prointerferon (e.g., starting with the interferon signal sequence which could be cleaved off upon excretion) or as mature interferon (the latter is feasible because mature fibro-blast interferon starts with methionine, an amino acid used for initiation of translation). The yield of these different forms of polypeptide may be improved by any or a combination of the procedures discussed above. Also different codons for some or all of the codons used in the present DNA sequences could be substituted. These substituted codons may code for amino acids identical to those coded for by the codons replaced but result in higher yield of the polypeptide. Alternatively, the replacement of one or a combination of codons leading to amino acid replacement or to a longer or shorter HuIFN-0-related polypeptide may alter its properties in a useful way (e.g., increase the stability, increase the solubility, increase the antiviral activity, increase the 2,5-A
synthetase activity or increase the host specifically range).
Finally, the activity of the polypeptides produced by the recombinant DNA molecules of this inven-tion may be improved by fragmenting, modifying or deriva-tizing the DNA sequences or polypeptides of this invention by well-known means, without departing from the scope of this invention.

IDENTIFICATION OF A
CHROMOSOMAL GENE CODING FOR HuIFN-S

A collection of hybrid phage derived from fragments of fetal human chromosomal DNA which had been generated by partial cleavage with HaeIII and AluI, and joined with EcoRI linkers to X Charon 4A arms has been prepared by R. M. Lawn et al., Cell, 15, pp. 1157-74 (1978). This gene bank was screened by an "in situ"
procedure (W. D. Benton and R. W. Davis, Science, 196, pp. 180-82 (1977); T. Maniatis et al., Cell, 15, pp. 687-701 (1978)); using as a probe the 32P-labelled IFN-P
cDNA insert excised by Tca I-BglII restriction from pHFIF-21.* One hybridization-positive phage clone was isolated from 600,000 plaques by repeated plaque purifica-tion (T. Maniatis et al., supra). This plaque was designated XCH4A-gHFIF-1. Restriction analysis of this plaque demonstrated that it contains about 16.3 Kb of human DNA.
EcoRI digestion of XCH4A-gHFIF-1 generated, in addition to the two Charon 4A phage arms, eight insert fragments -- 4.6, 3.5, 2.4, 1.9, 1.3, 1.2, 0.8 and 0.6 Kb in length. After Southern blotting, only the 1.9 Kb fragment hybridized to the TaqI-Bg1II fragment of pHFIF-21.
The 1.9 Kb fragment was recloned directly into the EcoRI site of pBR325 (a derivative of pBR322 which also carries a chloramphenicol resistance marker containing a single EcoRI site). After ligation of 0.6 F,g EcoRI-digested JlCH4A-gHFIF-1 DNA to 100 ng pBR325 and transforma-tion into E.coli HB101, several clones were selected.
Only those clones containing the 1.9 Kb fragment hybridized to the IFN-0 cDNA probe. This clone was designated p(325)-gHFIF-4.
Comparison of the restriction fragment derived from pHFIF-21 and p(325)-gHFIF-4 demonstrated that there are no intervening sequences in the chromosomal clone * Plasmid pHFIF-21 was identified by the screening processes of this invention. The Tagl-BclII fragment of that plasmid contains nearly the total 5'-untranslated region and the total coding region of IFN-P.

. . ~.. , . . . . . ., , . . . . . . . .

and that the DNA information carried by that clone is identical to that of pHFIF-21.
The identification and isolation of the chromo-somal DNA coding for HuIFN-P enables the transformation of appropriate hosts with that DNA and the expression of HuIFN-P from it. Such expression is advantageous because the various signals associated with chromosomal DNA
sequences will be present in such clones. These signals will then be available to trigger higher yields on expression and perhaps post-expression processing of the polypeptide coded for by the coding region of the chromo-somal DNA.
Micro-organisms and recombinant DNA molecules prepared by the processes described herein are exemplified by cultures deposited in the culture collection Deutsche Sammlung von Mikroorganism in Gottingen, West Germany on April 2, 1980, and identified as HFIF-A to C:
A: E. coli HB101 (G-pBR322(Pst)/HFIF3) B: E. coli HB101 (G-pBR322(Pst)/HFIF6) C: E. coli HB101 (G-pBR322(Pst)/HFIF7) These cultures were assigned accession numbers DSM 1791-1793, respectively. They are also exemplified by cultures deposited in the culture collection Deutsche Sammlung von Mikroorganism in Gottingen, West Germany on June 5, 1980, and identified as HFIF-D to G:
D: E. coli M5219 (G-pPLa-HFIF-67-12) E: E. coli K12OHI (G-pPLa-HFIF-67-12) F: E. coli M5219 (G-pPLa-HFIF-67-12Al9) G: E. coli M5219 (G-pPLc-HFIF-67-8) These cultures were assigned accession numbers DSM 1851-1854, respectively. And, by cultures deposited in the America Type Culture Collection, Rockville, Maryland on February,~?6, 1981, and identified as HFIF H and I:
H: E. coli M5219 (pPLa-HFIF-67-12AMI) I: E. coli HB101 (p[325]-gHFIF-4) These cultures were assigned accession numbers ATCC 318.2i~
and 2~, respectively.
While we have herein before presented a number of embodiments of this invention, it is apparent that our basic construction can be altered to provide other embodiments which utilize the processes and compositions of this invention. Therefore, it will be appreciated that the scope of this invention is to be defined by the claims appended hereto rather than the specific embodi-ments which have been presented herein before by way of example.

Claims (46)

1. A recombinant DNA molecule comprising a DNA
sequence selected from:

(a) the DNA inserts of G-pPLa-HFIF-67-12 [HincII-Sau3AI], G-pPLa-HFIF-67-12.DELTA.19 [HincII-Sau3AI], and G-pPLc-HFIF-67-8 [HincII-Sau3AI], said DNA inserts being exemplified by the DNA inserts of the recombinant DNA
molecules carried by the microorganisms identified by accession numbers DSM
1851-1854, respectively, (b) DNA sequences which can hybridize to the non-coding strand of any one of the foregoing DNA inserts under hybridizing conditions of 0.75 M NaCl at 68°C and washing conditions of 0.3 M NaCl at 68°C, and which code on expression for a polypeptide displaying antiviral activity, (c) DNA sequences which are degenerate as a result of the genetic code to the DNA sequences and inserts defined in (a) and (b) and which code on expression for a polypeptide displaying antiviral activity, wherein said DNA sequence of (a), (b) and (c) is operatively linked to an expression control sequence in said recombinant DNA molecule.
2. A recombinant DNA molecule according to claim 1, wherein a DNA sequence selected from said DNA sequences (b) which can hybridize to said non-coding strand is the coding strand of the DNA insert of G-pPLa-HFIF-67-12M1 [BamHI-Sau3AI], said DNA insert being the DNA insert of the recombinant DNA molecule carried by the microorganism identified by accession number ATCC 31824.
3. A recombinant DNA molecule according to claim 1, wherein a DNA sequence selected from said DNA sequences (b) which can hybridize to said non-coding strand is the coding strand of the DNA insert of p[325]-gHFIF-4 [EcoRI], said DNA insert being the DNA insert of the recombinant DNA molecule carried by the microorganism identified by accession number ATCC 31825.
4. A recombinant DNA molecule according to claim 1, wherein said DNA sequence is selected from DNA sequences of the formulae:
ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTACAG
CTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCA
GTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGCAC
AGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAGG
AGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAG
ACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTGGCT
AATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAAAACTGGAGA
AAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAAAAGATATTA
TGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGTGCCTGGACC
ATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGACTTACAGGTT
ACCTCCGAAAC, and ATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAG
CAATTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGC
CTCAAGCACAGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGT
TCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGC
TATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAAC
CTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAA
AACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAA
AAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGT
GCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGAC
TTACAGGTTACCTCCGAAAC.
5. A recombinant DNA molecule according to claim 1, selected from G-pPLa-HFIF-67-12, G-pPLa-HFIF-67-12.DELTA.19, and G-pPLc-HFIF-67-8, said recombinant DNA molecules being carried by any microorganism identified by accession numbers DSM 1851-1854.
6. A recombinant DNA molecule according to claim 1, said recombinant DNA molecule being G-pPLa-HFIF-67-12M1, and being carried by the microorganism identified by accession number ATCC 31824.
7. A unicellular host transformed with at least one recombinant DNA molecule according to claim 1.
8. The transformed host according to claim 7, selected from E.coli M5219 (G-pPLa-HFIF-67-12) [DSM 1851], E.coli K12.DELTA.HI (G-pPLa-HFIF-67-12) [DSM 1852], E.coli M5219 (G-pPLa-HFIF-67-12.DELTA.19) [DSM 18531, E.coli M5219 (G-pPLc-HFIF-67-8) [DSM 1854] and E.coli K12.DELTA.HI (G-pPLc-HFIF-67-8).
9. The transformed host according to claim 7, selected from E.coli M5219 (pPLa-HFIF-67-12.DELTA.M1) [ATCC 31824].
10. A method for transforming a unicellular host, comprising introducing into said host a recombinant DNA molecule according to claim 1.
11. A method for producing a polypeptide displaying antiviral activity, comprising transforming a unicellular host with a recombinant DNA
molecule according to claim 1, and culturing the host.
12. A method for producing a polypeptide displaying antiviral activity, comprising culturing a unicellular host that is transformed by a recombinant DNA molecule according to claim 1.
13. The method according to claim 11 or 12, wherein the polypeptide displaying antiviral activity is a polypeptide having the formulae:
Met-Ser-Tyr-Asn-Leu-Leu-Gly-Phe-Leu-Gln-Arg-Ser-Ser-Asn-Phe-Gln-Cys-Gln-Lys-Leu-Leu-Trp-Gln-Leu-Asn-Gly-Arg-Leu-Glu-Tyr-Cys-Leu-Lys-Asp-Arg-Met-Asn-Phe-Asp-Ile-Pro-Glu-Glu-Ile-Lys-Gln-Leu-Gln-Gln-Phe-Gln-Lys-Glu-Asp-Ala-Ala-Leu-Thr-Ile-Tyr-Glu-Met-Leu-Gln-Asn-Ile-Phe-Ala-Ile-Phe-Arg-Gln-Asp-Ser-Ser-Ser-Thr-Gly-Trp-Asn-Glu-Thr-Ile-Val-Glu-Asn-Leu-Leu-Ala-Asn-Val-Tyr-His-Gln-Ile-Asn-His-Leu-Lys-Thr-Val-Leu-Glu-Glu-Lys-Leu-Glu-Lys-Glu-Asp-Phe-Thr-Arg-Gly-Lys-Leu-Met-Ser-Ser-Leu-His-Leu-Lys-Arg-Tyr-Tyr-Gly-Arg-Ile-Leu-His-Tyr-Leu-Lys-Ala-Lys-Glu-Tyr-Ser-His-Cys-Ala-Trp-Thr-Ile-Val-Arg-Val-Glu-Ile-Leu-Arg-Asn-Phe-Tyr-Phe-Ile-Asn-Arg-Leu-Thr-Gly-Tyr-Leu-Arg-Asn.
14. A method for producing a polypeptide displaying antiviral activity, comprising culturing a unicellular host transformed with a DNA
sequence selected from the DNA sequences of the formulae:
ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTACAG
CTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCA
GTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGCAC
AGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAGG
AGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAG
ACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTGGCT
AATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAAAACTGGAGA
AAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAAAAGATATTA
TGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGTGCCTGGACC
ATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGACTTACAGGTT
ACCTCCGAAAC, and ATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAG
CAATTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGC
CTCAAGCACAGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGT
TCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGC
TATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAAC
CTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAA
AACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAA
AAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGT
GCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGAC
TTACAGGTTACCTCCGAAAC, said DNA sequence being operatively linked to an expression control sequence in said unicellular host.
15. The method of claim 14, wherein the polypeptide displaying antiviral activity is a polypeptide having the formulae:
Met-Ser-Tyr-Asn-Leu-Leu-Gly-Phe-Leu-Gln-Arg-Ser-Ser-Asn-Phe-Gln-Cys-Gln-Lys-Leu-Leu-Trp-Gln-Leu-Asn-Gly-Arg-Leu-Glu-Tyr-Cys-Leu-Lys-Asp-Arg-Met-Asn-Phe-Asp-Ile-Pro-Glu-Glu-Ile-Lys-Gln-Leu-Gln-Gln-Phe-Gln-Lys-Glu-Asp-Ala-Ala-Leu-Thr-Ile-Tyr-Glu-Met-Leu-Gln-Asn-Ile-Phe-Ala-Ile-Phe-Arg-Gln-Asp-Ser-Ser-Ser-Thr-Gly-Trp-Asn-Glu-Thr-Ile-Val-Glu-Asn-Leu-Leu-Ala-Asn-Val-Tyr-His-Gln-Ile-Asn-His-Leu-Lys-Thr-Val-Leu-Glu-Glu-Lys-Leu-Glu-Lys-Glu-Asp-Phe-Thr-Arg-Gly-Lys-Leu-Met-Ser-Ser-Leu-His-Leu-Lys-Arg-Tyr-Tyr-Gly-Arg-Ile-Leu-His-Tyr-Leu-Lys-Ala-Lys-Glu-Tyr-Ser-His-Cys-Ala-Trp-Thr-Ile-Val-Arg-Val-Glu-Ile-Leu-Arg-Asn-Phe-Tyr-Phe-Ile-Asn-Arg-Leu-Thr-Gly-Tyr-Leu-Arg-Asn.
16. A composition for treating human viruses, for treating human cancers or tumors, or for immunomodulation which comprises at least one polypeptide selected from polypeptides whenever produced according to a method of any one of claims 11 to 15, in admixture with a pharmaceutically acceptable diluent or carrier.
17. The use of a polypeptide produced according to a method of any one of claims 11 to 15 for the manufacture of a composition for treating human viruses, for treating human cancers or tumors, or for immunomodulation.
18. An unglycosylated polypeptide characterized by the amino acid sequence Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn.
19. A recombinant vector comprising, in operative association, an expression control sequence and a nucleotide sequence which encodes a polypeptide characterized by the amino acid sequence of:

Met Thr Asn Lys Cys Leu Leu Gln Ile Ala Leu Leu Leu Cys Phe Ser Thr Thr Ala Leu Ser Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, or Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gin Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn.
20. E. coli transformed with a recombinant vector wherein said vector comprises, in operative association, an expression control sequence and a nucleotide sequence which encodes a polypeptide characterized by the amino acid sequence of:

Met Thr Asn Lys Cys Leu Leu Gln Ile Ala Leu Leu Leu Cys Phe Ser Thr Thr Ala Leu Ser Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, or Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn.
21. A process for preparing a recombinant vector wherein said vector comprises, in operative association, an expression control sequence and a nucleotide sequence which encodes a polypeptide characterized by the amino acid sequence of:
Met Thr Asn Lys Cys Leu Leu Gln Ile Ala Leu Leu Leu Cys Phe Ser Thr Thr Ala Leu Ser Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, or Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gin Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn.
22. A process for preparing E. coli containing a recombinant vector wherein said vector comprises, in operative association, an expression control sequence and a nucleotide sequence which encodes a polypeptide characterized by the amino acid sequence of:

Met Thr Asn Lys Cys Leu Leu Gln Ile Ala Leu Leu Leu Cys Phe Ser Thr Thr Ala Leu Ser Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, or Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn.
23. A process for preparing a polypeptide characterized by the amino acid sequence of:

Met Thr Asn Lys Cys Leu Leu Gln Ile Ala Leu Leu Leu Cys Phe Ser Thr Thr Ala Leu Ser Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gin Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, or Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gin Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, which process comprises (a) transforming E. coli with a recombinant vector wherein said vector comprises, in operative association, an expression control sequence and a nucleotide sequence which encodes said polypeptide, and (b) culturing the transformed E. coli to produce said polypeptide.
24. A process for producing a polypeptide which contains the amino acid sequence of an interferon-beta, which process comprises (a) obtaining mRNA from human fibroblasts, (b) preparing double-stranded cDNA from said mRNA, (c) inserting said cDNA into a plasmid, (d) transforming E. coli with said plasmid, (e) detecting and isolating a transformant which expresses said interferon, and (f) culturing the isolated transformant of step (e) to produce said interferon.
25. A composition comprising a polypeptide characterized by the amino acid sequence Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, in admixture with a pharmaceutical acceptable carrier or diluent.
26. Use of a polypeptide characterized by the amino acid sequence Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, for the preparation of a composition for treating human tumors and viruses.
27. A recombinant vector comprising, in operative association, a microbial expression control sequence and a nucleotide sequence which encodes a polypeptide characterized by the amino acid sequence of:

Met Thr Asn Lys Cys Leu Leu Gln Ile Ala Leu Leu Leu Cys Phe Ser Thr Thr Ala Leu Ser Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, or Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn.
28. A process for preparing a recombinant vector wherein said vector comprises, in operative association, a microbial expression control sequence and a nucleotide sequence which encodes a polypeptide characterized by the amino acid sequence of:

Met Thr Asn Lys Cys Leu Leu Gln Ile Ala Leu Leu Leu Cys Phe Ser Thr Thr Ala Leu Ser Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, or Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn.
29. A composition for treating human tumors and viruses comprising an unglycosylated polypeptide characterized by the amino acid sequence Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, in admixture with a pharmaceutically acceptable carrier or diluent.
30. Use of an unglycosylated polypeptide characterized by the amino acid sequence Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, for the preparation of a composition for treating human tumors and viruses.
31. Use of an unglycosylated polypeptide characterized by the amino acid sequence Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, for treating human tumors and viruses.
32. Use of a recombinant DNA molecule according to any one of claims 1 to 6 for the manufacture of a polypeptide medicament displaying antiviral activity for treating human cancers or tumors, or for immunomodulation.
33. Use of a recombinant DNA molecule according to any one of claims 1 to 6 for producing a polypeptide displaying antiviral activity for treatment of human cancers or tumors, or for immunomodulation.
34. The use according to claim 32 or 33, wherein the polypeptide displaying antiviral activity is a polypeptide having the formulae of:
Met-Ser-Tyr-Asn-Leu-Leu-Gly-Phe-Leu-Gln-Arg-Ser-Ser-Asn-Phe-Gln-Cys-Gln-Lys-Leu-Leu-Trp-Gln-Leu-Asn-Gly-Arg-Leu-Glu-Tyr-Cys-Leu-Lys-Asp-Arg-Met-Asn-Phe-Asp-Ile-Pro-Glu-Glu-Ile-Lys-Gln-Leu-Gln-Gln-Phe-Gln-Lys-Glu-Asp-Ala-Ala-Leu-Thr-Ile-Tyr-Glu-Met-Leu-Gln-Asn-Ile-Phe-Ala-Ile-Phe-Arg-Gln-Asp-Ser-Ser-Ser-Thr-Gly-Trp-Asn-Glu-Thr-Ile-Val-Glu-Asn-Leu-Leu-Ala-Asn-Val-Tyr-His-Gln-Ile-Asn-His-Leu-Lys-Thr-Val-Leu-Glu-Glu-Lys-Leu-Glu-Lys-Glu-Asp-Phe-Thr--Arg-Gly-Lys-Leu-Met-Ser-Ser-Leu-His-Leu-Lys-Arg-Tyr-Tyr-Gly-Arg-Ile-Leu-His-Tyr-Leu-Lys-Ala-Lys-Glu-Tyr-Ser-His-Cys-Ala-Trp-Thr-Ile-Val-Arg-Val-Glu-Ile-Leu-Arg-Asn-Phe-Tyr-Phe-Ile-Asn-Arg-Leu-Thr-Gly-Tyr-Leu-Arg-Asn.
35. Use of a host as defined in claim 7, 8 or 9 for producing a polypeptide for treating human cancers or tumors, or for immunomodulation.
36. Use of a host as defined in claim 7, 8 or 9 for the manufacture of a medicament for treating human cancers or tumors, or for immunomodulation.
37. Use of a composition as defined in claim 16, 25 or 29 for treating human cancers or tumors, or for immunomodulation.
38. Use of a composition as defined in claim 16, 25 or 29 for the manufacture of a medicament for treating human cancers or tumors, or for immunomodulation.
39. Use of a vector as defined in claim 19 or 27 for producing a polypeptide for treating human cancers or tumors, or for immunomodulation.
40. Use of a vector as defined in claim 19 or 27 for the manufacture of a medicament for treating human cancers or tumors, or for immunomodulation.
41. Use of a transformed E. coli as defined in claim 20 for producing a polypeptide for treating human cancers or tumors, or for immunomodulation.
42. Use of a transformed E. coli as defined in claim 20 for the manufacture of a medicament for treating human cancers or tumors, or for immunomodulation.
43. Use of a polypeptide produced according to a method of any one of claims 11 to 15 for treating human viruses, for treating human cancers or tumors, or for immunomodulation.
44. Use of a polypeptide characterized by the amino acid sequence Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, for treating human tumors.
45. Use of a polypeptide characterized by the amino acid sequence Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, for treating human viruses.
46. Use of a polypeptide characterized by the amino acid sequence Met Ser Tyr Asn Leu Leu Gly Phe Leu Gln Arg Ser Ser Asn Phe Gln Cys Gln Lys Leu Leu Trp Gln Leu Asn Gly Arg Leu Glu Tyr Cys Leu Lys Asp Arg Met Asn Phe Asp Ile Pro Glu Glu Ile Lys Gln Leu Gln Gln Phe Gln Lys Glu Asp Ala Ala Leu Thr Ile Tyr Glu Met Leu Gln Asn Ile Phe Ala Ile Phe Arg Gln Asp Ser Ser Ser Thr Gly Trp Asn Glu Thr Ile Val Glu Asn Leu Leu Ala Asn Val Tyr His Gln Ile Asn His Leu Lys Thr Val Leu Glu Glu Lys Leu Glu Lys Glu Asp Phe Thr Arg Gly Lys Leu Met Ser Ser Leu His Leu Lys Arg Tyr Tyr Gly Arg Ile Leu His Tyr Leu Lys Ala Lys Glu Tyr Ser His Cys Ala Trp Thr Ile Val Arg Val Glu Ile Leu Arg Asn Phe Tyr Phe Ile Asn Arg Leu Thr Gly Tyr Leu Arg Asn, for immunomodulation.
CA374378A 1980-04-03 1981-04-01 Dna sequences, recombinant dna molecules and processes for producing human fibroblast interferon-like polypeptides Active CA1341604C (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB8011306 1980-04-03
GB80.11306 1980-04-03
GB80.18701 1980-06-06
GB8018701 1980-06-06

Publications (1)

Publication Number Publication Date
CA1341604C true CA1341604C (en) 2010-05-04

Family

ID=26275083

Family Applications (1)

Application Number Title Priority Date Filing Date
CA374378A Active CA1341604C (en) 1980-04-03 1981-04-01 Dna sequences, recombinant dna molecules and processes for producing human fibroblast interferon-like polypeptides

Country Status (27)

Country Link
US (2) US7588755B1 (en)
EP (1) EP0041313B1 (en)
JP (1) JP2687995B2 (en)
KR (1) KR860001471B1 (en)
AT (1) ATE56471T1 (en)
AU (1) AU564690B2 (en)
BG (1) BG60441B2 (en)
CA (1) CA1341604C (en)
DD (1) DD160280A5 (en)
DE (1) DE3177213D1 (en)
DK (1) DK170476B1 (en)
ES (1) ES500966A0 (en)
FI (1) FI88175C (en)
GR (1) GR74498B (en)
HK (1) HK160095A (en)
HU (1) HU193507B (en)
IE (1) IE57069B1 (en)
IL (1) IL62552A0 (en)
IN (1) IN156128B (en)
LU (1) LU90131I2 (en)
MX (1) MX9202946A (en)
NL (2) NL970018I1 (en)
NO (3) NO811118L (en)
NZ (1) NZ196706A (en)
PL (1) PL149079B1 (en)
PT (1) PT72786B (en)
YU (1) YU45104B (en)

Families Citing this family (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5510472A (en) * 1979-11-21 1996-04-23 Yeda Research And Development Co. Ltd. Production of recombinant human interferon-beta2
US5554513A (en) * 1979-11-21 1996-09-10 Yeda Research & Development Co. Ltd. Production of recombinant human interferon-beta2
IL58765A (en) * 1979-11-21 1986-09-30 Yeda Res & Dev Process for the production of essentially pure messenger rna of human fibroblast interferon and process for the production of interferon beta
DK33181A (en) * 1980-02-06 1981-08-07 Searle & Co PROCEDURE FOR THE PREPARATION OF AN INTERFERONOUS PROTEIN
DE3005843A1 (en) * 1980-02-16 1981-09-10 Hoechst Ag, 6000 Frankfurt GENERAL PRODUCT OF A HIGHER ORGANISM FROM A MICROORGANISM CONTAINING THIS GENE
EP0041767B1 (en) * 1980-06-06 1993-03-03 Biogen, Inc. Improved vectors and methods for making such vectors and for expressing cloned genes
DE3176011D1 (en) * 1980-06-12 1987-04-23 Japan Found Cancer Plasmid
US4874702A (en) * 1980-09-08 1989-10-17 Biogen, Inc. Vectors and methods for making such vectors and for expressive cloned genes
NZ198445A (en) * 1980-09-25 1984-05-31 Genentech Inc Production of human fibroblast interferon by recombinant dna technology
ZA816621B (en) * 1980-09-25 1982-09-29 Genentech Inc Microbial production of human fibroblast interferon
IL63327A (en) * 1981-07-16 1985-11-29 Yeda Res & Dev Production of interferon beta1 and alpha-phage recombinants for its production in host bacteria
GB2108510B (en) * 1981-10-03 1984-12-12 Ciba Geigy Ag Dnas, recombinant dnas, hosts containing them, polypeptides and processes for the production thereof
JPS58110600A (en) * 1981-12-25 1983-07-01 Kyowa Hakko Kogyo Co Ltd Recombinant plasmid containing human beta-interferon gene
JPS58141796A (en) * 1982-02-18 1983-08-23 Kyowa Hakko Kogyo Co Ltd Peptide production method
US4582800A (en) * 1982-07-12 1986-04-15 Hoffmann-La Roche Inc. Novel vectors and method for controlling interferon expression
IL69382A (en) * 1982-08-05 1991-01-31 Carter William Alvin Method of protecting plants against viral pathogens by inserting into plant cells genes encoding polypeptides containing interferon domains
US4737462A (en) * 1982-10-19 1988-04-12 Cetus Corporation Structural genes, plasmids and transformed cells for producing cysteine depleted muteins of interferon-β
US4588585A (en) * 1982-10-19 1986-05-13 Cetus Corporation Human recombinant cysteine depleted interferon-β muteins
FI82266C (en) * 1982-10-19 1991-02-11 Cetus Corp FOERFARANDE FOER FRAMSTAELLNING AV IL-2 MUTEIN.
US4966843A (en) * 1982-11-01 1990-10-30 Cetus Corporation Expression of interferon genes in Chinese hamster ovary cells
GR79124B (en) * 1982-12-22 1984-10-02 Genentech Inc
GB8308235D0 (en) * 1983-03-25 1983-05-05 Celltech Ltd Polypeptides
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4518584A (en) * 1983-04-15 1985-05-21 Cetus Corporation Human recombinant interleukin-2 muteins
DE152483T1 (en) * 1983-08-22 1986-02-27 Kyowa Hakko Kogyo Co., Ltd., Tokio/Tokyo METHOD FOR PRODUCING PEPTIDES.
EP0226639B1 (en) * 1985-05-29 1990-11-14 The Green Cross Corporation Process for preparing heterogenic protein
DE3581412D1 (en) * 1985-07-16 1991-02-21 Green Cross Corp METHOD FOR PRODUCING HETEROPROTEINS.
FR2635113B1 (en) * 1988-08-05 1992-07-24 Sanofi Sa PROCESS FOR OBTAINING MATURE INTERLEUKIN-1 (BETA) FROM E CELLS. COLI TRANSFORMED
FR2686899B1 (en) 1992-01-31 1995-09-01 Rhone Poulenc Rorer Sa NOVEL BIOLOGICALLY ACTIVE POLYPEPTIDES, THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM.
US5545723A (en) * 1994-03-15 1996-08-13 Biogen Inc. Muteins of IFN-β
JP4293497B2 (en) 1997-09-23 2009-07-08 レントシュレール ビオテクノロジー ゲー・エム・ベー・ハー Interferon-β liquid composition
WO2001077137A1 (en) 2000-04-12 2001-10-18 Human Genome Sciences, Inc. Albumin fusion proteins
US7431921B2 (en) 1999-08-27 2008-10-07 Maxygen Aps Interferon beta-like molecules
US6531122B1 (en) 1999-08-27 2003-03-11 Maxygen Aps Interferon-β variants and conjugates
US7144574B2 (en) 1999-08-27 2006-12-05 Maxygen Aps Interferon β variants and conjugates
IL156059A0 (en) 2001-02-27 2003-12-23 Maxygen Aps NEW INTERFERON beta-LIKE MOLECULES
ES2545090T3 (en) 2001-12-21 2015-09-08 Human Genome Sciences, Inc. Albumin and GCSF fusion proteins
CA2513213C (en) 2003-01-22 2013-07-30 Human Genome Sciences, Inc. Albumin fusion proteins
BRPI0507159A (en) 2004-02-02 2007-06-26 Ambrx Inc modified human four-helix beam polypeptides and their uses
AU2008247815B2 (en) 2007-05-02 2012-09-06 Ambrx, Inc. Modified interferon beta polypeptides and their uses
DE102009032179A1 (en) 2009-07-07 2011-01-13 Biogenerix Ag Process for purifying interferon beta

Family Cites Families (82)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK1645C (en) 1898-06-20 Carl Christensen Pocket knife with a blade insertable into the shaft.
US3699222A (en) 1958-03-11 1972-10-17 Nat Res Dev Production of viral interfering substances
US4184917A (en) 1974-04-01 1980-01-22 Sandoz Ltd. Process for producing a structurally modified interferon
NL7404589A (en) 1974-04-03 1975-10-07 Stichting Rega V Z W PROCEDURE FOR STABILIZING INTERFERON.
GB1521032A (en) 1974-08-08 1978-08-09 Ici Ltd Biological treatment
US4237224A (en) 1974-11-04 1980-12-02 Board Of Trustees Of The Leland Stanford Jr. University Process for producing biologically functional molecular chimeras
FR2321298A1 (en) * 1975-08-01 1977-03-18 Anvar Compsns. with species-specific interferon activity - prepd. by incubating the appropriate messenger RNA in a cell-free medium
US4190495A (en) 1976-09-27 1980-02-26 Research Corporation Modified microorganisms and method of preparing and using same
US4264731A (en) 1977-05-27 1981-04-28 The Regents Of The University Of California DNA Joining method
DE2724918A1 (en) 1977-06-02 1978-12-14 Thomae Gmbh Dr K Antiviral and antitumour human interferon prodn. - by incubating virus-infected namalva cells on serum-free medium
CS215108B2 (en) 1977-07-15 1982-07-30 Wellcome Found Method of making the interferrone
ZA782933B (en) 1977-09-23 1979-05-30 Univ California Purification of nucleotide sequences suitable for expression in bacteria
US4283489A (en) 1977-09-23 1981-08-11 The Regents Of The University Of California Purification of nucleotide sequences suitable for expression in bacteria
SE7811458L (en) 1977-11-08 1979-05-09 Genentech Inc PROCEDURE AND MEANS OF POLYPEPTIDE EDUCATION THROUGH MICROBS
BG38165A3 (en) 1977-11-08 1985-10-15 Genentech, Inc. METHOD FOR OBTAINING A RECOMBINANT CLONING VECTOR SUITABLE FOR TRANSFORMING A MICROBIAL HOST
GR71687B (en) 1977-11-08 1983-06-21 Genentech Inc
DE2759053A1 (en) 1977-12-30 1979-07-12 Uhlin METHOD FOR MANUFACTURING GENE PRODUCTS FROM PLASMID DNA
FR2422956A1 (en) 1978-04-13 1979-11-09 Pasteur Institut METHOD OF DETECTION AND CHARACTERIZATION OF A NUCLEIC ACID OR OF A SEQUENCE OF THE SAME, AND ENZYMATIC REAGENT FOR THE IMPLEMENTATION OF THIS PROCESS
EP0005476B1 (en) 1978-05-17 1981-12-30 Dr. Karl Thomae GmbH Process for preparing human interferon
US4322497A (en) 1978-06-02 1982-03-30 Eli Lilly And Company Process for transducing Escherichia coli K12 χ1776
US4411994A (en) 1978-06-08 1983-10-25 The President And Fellows Of Harvard College Protein synthesis
US4307193A (en) 1978-06-09 1981-12-22 Toray Industries, Inc. Method of producing interferon
JPS5519239A (en) 1978-07-28 1980-02-09 Green Cross Corp:The Interferon-producing attractant
GR71912B (en) 1978-08-11 1983-08-16 Univ California
JPS5561798A (en) 1978-10-30 1980-05-09 Noda Sangyo Kagaku Kenkyusho Preparation of novel recombination dna
JPS5564799A (en) 1978-11-07 1980-05-15 Toray Ind Inc Multi-stage concentration and purification of interferon originated from human fibroblast
IN150740B (en) 1978-11-24 1982-12-04 Hoffmann La Roche
US4241174A (en) 1978-11-24 1980-12-23 Hoffmann-La Roche Inc. Interferon assay
NL8000127A (en) 1979-01-15 1980-07-17 Harvard College METHOD FOR FORMING PROKARYOTIC OR EUKARYOTIC PROTEINS AND A GENERALLY COUPLED GENE.
EP0014050A3 (en) 1979-01-16 1980-10-01 Beecham Group Plc Interferon production
JPS56131598A (en) 1980-03-19 1981-10-15 Japan Found Cancer Novel recombinant plasmid having gene of human fibroblastic interferon messenger rna
US5514567A (en) * 1979-01-30 1996-05-07 Juridical Foundation, Japanese Foundation For Cancer Research DNA and recombinant plasmid
US5326859A (en) * 1979-10-30 1994-07-05 Juridical Foundation, Japanese Foundation For Cancer Research DNA and recombinant plasmid
JPS5663996A (en) 1979-10-30 1981-05-30 Japan Found Cancer Novel recombinant having gene complementary to human interferon messenger rna
US4357421A (en) 1979-04-02 1982-11-02 G. D. Searle & Co. Synthetic gene coding for influenza hemagglutinin
FI77877C (en) 1979-04-20 1989-05-10 Technobiotic Ltd Process for the preparation and purification of human Le-shaped interferon protein.
IL57108A (en) 1979-04-22 1981-12-31 Yeda Res & Dev Assay for the quantitative determination of interferon and a kit therefor
US4293652A (en) 1979-05-25 1981-10-06 Cetus Corporation Method for synthesizing DNA sequentially
AU542264B2 (en) 1979-06-01 1985-02-14 G.D. Searle & Co. Plasmid vectors
US4262090A (en) 1979-06-04 1981-04-14 Cetus Corporation Interferon production
WO1981000116A1 (en) 1979-07-05 1981-01-22 United States Res Corp Method for the purification and analysis of interferon
CH648331A5 (en) 1979-07-31 1985-03-15 Hoffmann La Roche HOMOGENEOUS FIBROBLASTER INTERFERON AND THEIR PRODUCTION.
JPS5651995A (en) 1979-10-05 1981-05-09 Green Cross Corp:The Preparation of interferon
NL7907791A (en) 1979-10-23 1981-04-27 Stichting Rega V Z W METHOD FOR PURIFYING INTERFERON.
AU538665B2 (en) * 1979-10-30 1984-08-23 Juridical Foundation, Japanese Foundation For Cancer Research Human interferon dna
IL58765A (en) * 1979-11-21 1986-09-30 Yeda Res & Dev Process for the production of essentially pure messenger rna of human fibroblast interferon and process for the production of interferon beta
EP0030094A1 (en) 1979-11-30 1981-06-10 Beecham Group Plc Calcium enhanced interferon production process
NO164037C (en) 1980-01-08 1990-08-22 Biogen Inc PROCEDURE FOR PREPARING A POLYPEPTIDE OF INTERFERON ALFA (IFNALFA) TYPE.
GB2068970B (en) * 1980-02-06 1983-06-22 Searle & Co Recombinant dna technique for the preparation of a protein resembling human interferon
IE51030B1 (en) 1980-02-06 1986-09-17 Searle & Co Recombinant dna technique for the preparation of a protein resembling human interferon
DK33181A (en) 1980-02-06 1981-08-07 Searle & Co PROCEDURE FOR THE PREPARATION OF AN INTERFERONOUS PROTEIN
DE3005843A1 (en) * 1980-02-16 1981-09-10 Hoechst Ag, 6000 Frankfurt GENERAL PRODUCT OF A HIGHER ORGANISM FROM A MICROORGANISM CONTAINING THIS GENE
DE3005897A1 (en) 1980-02-16 1981-09-03 Hoechst Ag, 6000 Frankfurt GENERAL PRODUCT OF A HIGHER ORGANISM FROM A MICROORGANISM CONTAINING THIS GENE
US4399216A (en) 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
EP0046790A4 (en) 1980-02-25 1983-01-31 Richard Axel The use of eucaryotic promoter sequences in the production of proteinaceous materials.
ZA811368B (en) 1980-03-24 1982-04-28 Genentech Inc Bacterial polypedtide expression employing tryptophan promoter-operator
US4338397A (en) 1980-04-11 1982-07-06 President And Fellows Of Harvard College Mature protein synthesis
IL62903A0 (en) 1980-05-22 1981-07-31 Deutsches Krebsforsch Method for the production of interferon ii and stimulated clones for the carrying out of the method
DE3019621C2 (en) 1980-05-22 1982-08-19 Stiftung Deutsches Krebsforschungszentrum, 6900 Heidelberg Process for the production of interferon II.
JPS56167624A (en) 1980-05-29 1981-12-23 Toray Ind Inc Method of interferon production
JPS571237A (en) 1980-06-03 1982-01-06 Toshiba Corp Combined integrared circuit device
EP0041767B1 (en) 1980-06-06 1993-03-03 Biogen, Inc. Improved vectors and methods for making such vectors and for expressing cloned genes
DE3176011D1 (en) * 1980-06-12 1987-04-23 Japan Found Cancer Plasmid
JPS575158A (en) 1980-06-12 1982-01-11 Matsushita Electric Works Ltd Automatic resetting circuit for cpu function stopping phenomenon
CH657141A5 (en) 1980-07-01 1986-08-15 Hoffmann La Roche DNA SEQUENCES, RECOMBINANT EXPRESSION VECTORS FOR THE MICROBIAL PRODUCTION OF HUMAN LEUKOCYTE INTERFERON AND TRANSFORMED MICROORGANISMS.
US4357422A (en) 1980-08-14 1982-11-02 Massachusetts Institute Of Technology Method of enhancing interferon production
US4874702A (en) 1980-09-08 1989-10-17 Biogen, Inc. Vectors and methods for making such vectors and for expressive cloned genes
NZ198445A (en) 1980-09-25 1984-05-31 Genentech Inc Production of human fibroblast interferon by recombinant dna technology
US4315852A (en) 1980-11-26 1982-02-16 Schering Corporation Extraction of interferon from bacteria
JPS58201794A (en) 1982-05-17 1983-11-24 Toray Ind Inc Purification of human interferon through concentration
US4835256A (en) 1982-09-30 1989-05-30 New York University & Juridical Foundation Human gamma interferon polypeptide having glutamine as the ninth n-terminal amino acid
NZ210501A (en) 1983-12-13 1991-08-27 Kirin Amgen Inc Erythropoietin produced by procaryotic or eucaryotic expression of an exogenous dna sequence
AU594014B2 (en) 1984-03-21 1990-03-01 Research Corporation Technologies, Inc. Recombinant DNA molecules
NZ212207A (en) 1984-05-31 1991-07-26 Genentech Inc Recombinant lymphotoxin
IL78531A0 (en) 1985-04-22 1986-08-31 Lilly Co Eli Recombinant dna expression vectors and dna compounds which encode isopenicillin n synthetase
US4892819A (en) 1985-11-25 1990-01-09 Eli Lilly And Company Recombinant DNA expression vectors and DNA compounds that encode isopenicillin N synthetase from penicillium chrysogenum
EP0257994B1 (en) 1986-08-29 1992-09-16 Tonen Corporation Dna coding for rinderpest virus antigen, its preparation and use
DE3642096A1 (en) 1986-12-10 1988-06-16 Boehringer Ingelheim Int HORSE (GAMMA) INTERFERON
DE3888715T2 (en) 1987-04-09 1994-07-14 Shionogi Seiyaku Kk Reg gene and thus encoded protein.
ZA887773B (en) 1987-10-26 1989-07-26 Immunex Corp Interleukin-7
US5258287A (en) 1988-03-22 1993-11-02 Genentech, Inc. DNA encoding and methods of production of insulin-like growth factor binding protein BP53
JP3393180B2 (en) 1998-10-22 2003-04-07 シャープ株式会社 Method for manufacturing semiconductor device

Also Published As

Publication number Publication date
EP0041313B1 (en) 1990-09-12
DK148581A (en) 1981-10-04
NZ196706A (en) 1988-01-08
PT72786A (en) 1981-05-01
KR860001471B1 (en) 1986-09-26
AU6897981A (en) 1981-10-08
NO850735L (en) 1981-10-05
LU90131I2 (en) 1997-11-26
PL149079B1 (en) 1990-01-31
JP2687995B2 (en) 1997-12-08
ES8302096A1 (en) 1982-12-16
US7635466B1 (en) 2009-12-22
ES500966A0 (en) 1982-12-16
IL62552A0 (en) 1981-06-29
HK160095A (en) 1995-10-20
NL970018I1 (en) 1997-06-02
YU85981A (en) 1984-04-30
MX9202946A (en) 1992-07-01
NO811118L (en) 1981-10-05
FI88175B (en) 1992-12-31
ATE56471T1 (en) 1990-09-15
JPS56154499A (en) 1981-11-30
FI88175C (en) 1993-04-13
EP0041313A2 (en) 1981-12-09
NL970032I1 (en) 1997-10-01
KR830005354A (en) 1983-08-13
PT72786B (en) 1983-01-10
DD160280A5 (en) 1983-05-25
GR74498B (en) 1984-06-28
FI811008L (en) 1981-10-04
NO850734L (en) 1981-10-05
US7588755B1 (en) 2009-09-15
PL230484A1 (en) 1983-07-18
EP0041313A3 (en) 1982-08-18
DE3177213D1 (en) 1990-10-18
IN156128B (en) 1985-05-18
BG60441B2 (en) 1995-03-31
HU193507B (en) 1987-10-28
AU564690B2 (en) 1987-08-20
YU45104B (en) 1992-03-10
IE57069B1 (en) 1992-04-22
IE810756L (en) 1981-10-03
DK170476B1 (en) 1995-09-11
NL970032I2 (en) 1997-12-01

Similar Documents

Publication Publication Date Title
CA1341604C (en) Dna sequences, recombinant dna molecules and processes for producing human fibroblast interferon-like polypeptides
US4530901A (en) Recombinant DNA molecules and their use in producing human interferon-like polypeptides
JP2515308B2 (en) Human immune interferon
FI86558C (en) DNA sequences, recombinant DNA molecules and methods for producing human-type interferon and selection of the DNA sequence
US5460811A (en) Mature human fibroblast interferon
US4582800A (en) Novel vectors and method for controlling interferon expression
US5096705A (en) Human immune interferon
US5004689A (en) DNA sequences, recombinant DNA molecules and processes for producing human gamma interferon-like polypeptides in high yields
US5582824A (en) Recombinant DES-CYS-TYR-CYS human immune interferon
CA1340184C (en) Cloning and characterizing omega-interferon and related genes
EP0062971B1 (en) Genetically modified microorganisms
KR890001828B1 (en) Method for producing interferon-α polypeptide
PH26492A (en) Recombinant human immune interferon
HU204086B (en) Process for producing non-human mammal animal interferons, dna sequemces coding form them and pharmaceutical compositions comprising sand interferons
NO164664B (en) RECOMBINANT DNA MOLECULES COVERING A DNA SEQUENCE CODING FOR A POLYPEPTIDE OF INTERFERON ALPHA (IFN-ALFA) TYPE.