CA1340184C - Cloning and characterizing omega-interferon and related genes - Google Patents

Abstract

The present invention provides new interferon polypeptides of Type 1 coded for by the cDNA inserts of plasmids P9A2 and E76E9 (deposited at the DSM within E.coli HB101 under the numbers DSM 3003 and 3004 respectively), further interferon polypeptides coded for by sequences which will hybridise with the sequences corresponding to the interferon-coding sequences of plasmids P9A2 and E76E9 or degenerate variations thereof under stringent hybridisation conditions suitable for detecting about 85% or higher homology, and N-glycosylated or other derivatives thereof with interferon activity. Such interferons have been designated omega interferons and are useful in treatments in which known interferons have been used, for example, herpes, rhinovirus and AIDS infections as well as certain cancers.

Description

13~0184 -- 1~--Improvements in or relating to interferons The present invention relates to new Type I
interferons as well as to recombinant DNA methods of producing these polypeptides and products required in these methods, for example, genetic sequences, recombinant DNA molecules, expression vehicles and organisms.
Interferon is a word coined to describe a variety of proteins endogenous to human cells character-ised by partly overlapping and partly divergingbiological activities. These proteins modify the body's immune response and are believed to contribute substantial protection against viruses. For example, interferons have been classified into three broad species, a-, ~, and ~ -Interferon. Furthermore, interferons are subdivided into two types: Type I
and Type II interferons. Type I interferons are further divided into o- and ~- interferons. They seem to have evolved from a common ancestor protein.
The Type II interferon is named y-interferon and is not related to Type I interferons.
Only one subspecies of ~- and ~-interferon is known in humans (see, for example, S. Ohno et al., Proc. Natl. Acad. Sci. 78, 5305-5309 (1981);
Gray et al., Nature 295, 503-508 (1982); Taya, et al., EMBO Journal ~, 953-958 (1982)). On the other hand, several subtypes of o-interferon have been described (See, for example, Phil. Trans.
R. Soc. Lond. 299, 7-28 (1982)). The mature o-interferons reveal a maximum divergence of 23%among each other and are 166 or 165 amino acids long. Of note is also a report of an o-interferon having an unusually high molecular weight (26,000 by SDS polyacrylamide gel electrophoresis, described ,.
~

._" .

13~01~4 by Goren, P. et al., Virology 130, 273-280 (1983) ).
This interferon is called IFN-~ 26K. It has been found to have the highest known specific anti-viral and anti-cellular activities.
The interferons known to date appear to be effective against various diseases, but demonstrate little or no efficacy in many others (see, for example, Powledge, Bio/Technology, March 1984, 215-228, "Interferon On Trial"). Interferons have also been plagued by side effects. For example, in trials of the anti-cancer properties of recombinant o-interferon, doses of around 50 million units, which had been believed to be safe on the basis of Phase I trials have been associated with acute confusional states, disabling arthragia, profound fatigue and anorexia, disorientation, seizures and hepatic toxicity. In 1982, the French government stopped trials with o-interferon after cancer patients receiving it suffered fatal heart attacks. At least two cardiac deaths have also been reported in recent American trials. It has become increasingly clear that at least some of the side effects, like fever and malaise, appear to be inherent in o-interferon itself and are not due to impurities.
Due to the great hopes elicited by the interferons, and spurred by the wish to discover yet new interferon-like molecules with decreased side effects, the present inventors set out to search for and produce such new substances.
The present invention therefore relates to new interferons, and active derivatives thereof, e.g. glycosylated derivatives; to genetic sequences coding therefor, as well as to recombinant DNA
molecules containing such sequences. Included within the scope of the present invention are expression vectors containing a coding sequence for a novel interferon according to the invention at an appropriate ..... .. ... ....

site for expression and microorganisms and tissue culture hosts transformed by such vectors which are capable of producing the encoded interferon.
According to one aspect, the present invention provides new Type 1 interferon polypeptides of 168 to 174, preferably 172, amino acids, which have a divergence of 30 to 50%, preferably 40-48%, compared to o-interferons, and a divergence of at least 70% compared to ~-interferon, optionally further comprising a leader peptide, and N-glycosylated or other derivatives thereof with interferon activity.
Such interferons are hereinafter referred to as omega-interferon or IFN-omega.
According to a further aspect, the present invention provides polydeoxyribonucleotides comprising a coding sequence for an omega-interferon or comprising a pseudo gene sequence capable of hybridizing with a sequence corresponding to an omega-interferon-coding sequence under stringent hybridization conditions, suitable for detecting about 85% or higher homology with the chosen omega-interferon coding sequence.
To carry out such stringent hybridization tests, appropriate single-stranded polydeoxyribonucleo-tides are hybridized in the presence of 6 x SSC
(1 x SSC corresponds to 0.15 M NaCl, 0.015 M trisodium citrate, pH 7.0), 5 x Denhardt's solution (1 x Denhardt's solution corresponds to 0.02% polyvinyl-pyrrolidone, 0.02% ficoll (m.w. 40,000), 0.02%
bovine serum albumin) and 0.1% sodium dodecylsulphate at 65~C. The degree of stringency is determined in the washing step. Thus, for selection to DNA
sequences with about 85% homology or more, the conditions 0.2 x SSC/0.01% SDS/65~C are suitable and for selection to DNA sequences with about 90%
homology or more, the conditions 0.1 x SSC/0.01%
SDS/65~C are suitable.

~ . . .. . ..

As preferred embodiments, the present invention provides an omega-interferon (hereinafter referred to as omega (Gly)-interferon) having the following amino acid sequence:

Cys Asp Leu Pro Gln Asn His Gly Leu Leu Ser Arg Asn Thr Leu TGT GAT CTG CCT CAG AAC CAT GGC CTA CTT AGC AGG AAC ACC TTG

Val Leu Leu His Gln Met Arg Arg Ile Ser Pro Phe Leu Cys Leu GTG CTT CTG CAC CAA ATG AGG AGA ATC TCC CCT TTC TTG TGT CTC

Lys Asp Arg Arg Asp Phe Arg Phe Pro Gln Glu Met Val Lys Gly AAG GAC AGA AGA GAC TTC AGG TTC CCC CAG GAG ATG GTA AAA GGG

Ser Gln Leu Gln Lys Ala His Val Met Ser Val Leu His Glu Met AGC CAG TTG CAG AAG GCC CAT GTC ATG TCT GTC CTC CAT GAG ATG

Leu Gln Gln Ile Phe Ser Leu Phe His Thr Glu Arg Ser Ser Ala CTG CAG CAG ATC TTC AGC CTC TTC CAC ACA GAG CGC TCC TCT GCT

Ala Trp Asn Met Thr Leu Leu Asp Gln Leu His Thr Gly Leu His GCC TGG AAC ATG ACC CTC CTA GAC CAA CTC CAC ACT GGA CTT CAT

Gln Gln Leu Gln His Leu Glu Thr Cys Leu Leu Gln Val Val Gly Glu Gly Glu Ser Ala Gly Ala Ile Ser Ser Pro Ala Leu Thr Leu GAA GGA GAA TCT GCT GGG GCA ATT AGC AGC CCT GCA CTG ACC TTG

30 Arg Arg Tyr Phe Gln Gly Ile Arg Val Tyr Leu Lys Glu Lys Lys AGG AGG TAC TTC CAG GGA ATC CGT GTC TAC CTG AAA GAG AAG AAA

Tyr Ser Asp Cys Ala Trp Glu Val Val Arg Met Glu Ile Met Lys TAC AGC GAC TGT GCC TGG GAA GTT GTC AGA ATG GAA ATC ATG AAA

Ser Leu Phe Leu Ser Thr Asn Met Gln Glu Arg Leu Arg Ser Lys TCC TTG TTC TTA TCA ACA AAC ATG CAA GAA AGA CTG AGA AGT AAA

Asp Arg Asp Leu Gly Ser Ser GAT AGA GAC CTG GGC TCA TCT

, .. .. .

a second omega-interferon (hereinafter referred to as omega (Glu)-interferon), which has the same amino acid sequence as omega (Gly)-interferon except that amino acid residue lll is glutamic acid rather than glycine, and derivatives thereof which are N-glycosylated at amino acid position 78.
The omega-interferons mentioned above may be fused with a leader peptide, for example, the leader peptide having the amino acid sequence:

Met Ala Leu Leu Phe Pro Leu Leu Ala Ala Leu Val Met Thr Ser Tyr Ser Pro Val Gly Ser Leu Gly.

These omega interferons show similar effective-ness to ~-interferons without many of the known therapeutic disadvantages.
As further preferred embodiments, the present invention provides polydeoxyribonucleotides comprising the omega (Gly)-interferon coding sequence shown above, the equivalent sequence coding for omega (Glu)-interferon which differs only in that codon lll is GAG (coding for glutamic acid) rather than GGG (coding for glycine) and degenerate variations thereof.
The above-mentioned sequences may be fused with a leader peptide-coding sequence, for example, the leader peptide-coding sequence shown below:
ATG GCC CTC CTG TTC CCT CTA CTG
GCA GCC CTA GTG ATG ACC AGC TAT AGC CCT GTT GGA TCT CTG GGC

DESCRIPTION OF THE FIGURES
Figure 1: Restriction map for clone E76E69.
Figure 2: Restriction map for clone P9A2.
Figures 3a, 3b: DNA sequence of the cDNA
insert of clone P9A2.
Figures 4a, 4b: DNA sequence of the cDNA
insert of clone E76E9.
Figure 5: Genomic Southern Blot Analysis 13~0181 using DNA derived from the cDNA insert of clone P9A2 as a probe.
Figure 6: Construction of the expression vector pRHW12.
Figure 7: Amino acid and nucleotide differences between Type I interferons.
Figure 8a: Identification of the unique nucleotide positions of the IFN-aA gene.
Figure 8b: Identification of the unique nucleotide positions of the IFN-omega 1 gene.
Figure 8c: Identification of the unique nucleotide positions of the IFN-~D gene.
Figure 9: Schematic representation of the synthesis of a specific hybridization probe for 15 ~omega-l-mRNA.
Figure 10: Detection of interferon-subtype of specific mRNAs.
Figures lla, llb: DNA sequence of the IFN-omegal gene.
Figures 12a, 12b: DNA sequence of the IFN-pseudo-omega2 gene.
Figure 13: DNA sequence of the IFN-pseudo-omega3 gene.
Figures 14a, 14b, 14c: DNA sequence of the IFN-pseudo-omega4 gene.
Figure 15: Corrected list of the IFN-omega gene sequences.
Figure 16: Homologies of the signal sequences.
Figure 17: Homologies of the "mature" protein sequences.
Figure 18: Homologies of the 4 DNA sequences relative to one another.
Figure 19: Antiproliferative activity of IFN-omegal on human Burkitt's lymphoma cells.
Figure 20: Antiproliferative activity of IFN-omegal on human cervical carcinoma cells.
The new omega interferons omega (Gly)-interferon and omega-(Glu) interferon and polydeoxyribonucleotides .. _. . . ....

comprising sequences coding for them may be obtained as follows:
A human B-cell lymphoid line, for example, Namalwa cells (see G. Klein et al., Int. J. Cancer 10, 44 (1972)) can be stimulated for the simultaneous production of ~- and ~-interferons through treatment with a virus, for example, Sendai Virus. The mRNA formed is isolated from the stimulated Namalwa cells, and this can then be used as a template for cDNA synthesis. In order to increase the yield of interferon-specific sequences during the cloning process, the mRNApreparation is separated in a sucrose density gradient into mRNA molecules of different lengths.
Preferably, mRNAs of around 12S (about 800-1,000 bases) are collected. These will include mRNAs which are specific for ~-interferons and ~-interferons. The mRNA
collected from the gradient is concentrated through precipitation and dissolution in water and a cDNA library is then prepared.
The preparation of cDNA library essentially involves the use of methods known in the literature (see, for example, E. Dworkin-Rastl, M.B. Dworkin and P. Swetly, Journal of Interferon Research 2/4, 575-585 (1982)). The mRNA is primed through the addition of oligo-dT. After that, by adding the four deoxynucleosidetriphosphates (dATP, dGTP, dCTP, dTTP) and the enzyme reverse transcriptase in an appropriately buffered solution, cDNA is synthesized at 45~C for 1 hour. Through ' X

.~ ,. . . .

13~0181 - 7a -chloroform extraction and chromatography via a gel column, for example, via Sephadex G50*, the cDNA/mRNA hybrid is purified.
The RNA is hydrolysed by means of alkali treatment (0.3 M NaOH
at 50~C for 1 hour), and the cDNA is precipitated with ethanol after neutralising with acid sodium acetate solution.

* Trade-mark -134018~

Double strand synthesis is performed after addition of the four deoxynucleosidetriphosphates and E.coli DNA-polymerase I in an appropriately buffered solution.
The cDNA is used both as a template and as a primer through hairpin structure formation at its 3' end (6 hours at 15~C) (see also A. Eftratiadis et al., Cell 7, 279 (1976)). Following phenol extraction, Sephadex G50 chromatography and ethanol precipitation, the DNA is subjected, in a suitable solution, to treatment with endonuclease Sl, which is specific for single strands. The hairpin structure as well as any cDNA that was not converted into double stranded is degraded. After chloroform extraction and precipitation with ethanol, the double-stranded DNA (dsDNA) is separated on the basis of size on a sucrose density gradient. In the subsequent steps of cloning, it is preferred to use only dsDNA
of at least 600 bp in length in order to increase the probability of obtaining clones which contain the complete coding sequence for omega (Gly) or omega (Glu)-interferon. dsDNA with a length of more than 600 bp is concentrated out of the gradient through precipitation with ethanol and dissolution in water.
In order to increase the number of dsDNA
molecules that have been obtained, they are first placed in an appropriate vector, e.g. an E.coli vector, and then introduced into an appropriate host, e.g. the bacterium E. coli. The vector used is preferably the plasmid pBR322 (F. Bolivar et al., Gene 2, 95 (1977)). This plasmid essentially consists of a replicon and two selectable marker genes. The selectable marker genes confer on hosts resistance against the antibiotics ampicillin and tetracycline (Ap , Tc ). The gene for ~-lactamase, which confers resistance to ampicillin (Apr), contains the recognition sequence for the restriction endonuclease , ~ .

134018~
g PstI. pBR322 can thus be cut with PstI. The overlapp-ing 3'-ends are extended with terminal deoxynucleotide transferase (TdT) along with a premixed quantity of dGTP in an appropriately buffered solution.
At the same time, the selected dsDNA is likewise extended with the enzyme TdT, using dCTP at the 3'-ends. The homopolymer ends of the plasmid and dsDNA are complementary and will hybridize if plasmid DNA and dsDNA are mixed in the appropriate concentra-tion ratio and under suitable salt, buffer, and temperature conditions tT. Nelson et al., Methods in Enzymology 68, 41-50 (1980)).
E. coli HB101 strain ~genotype F-, hsdS20 (r - B, m - B) recA13, ara-14, proA2, lacYl, galK2, rpsL20 (Smr), xyl-5, mtl-l, supE44, lambda-] is prepared for transformation by the recombinant vector-dsDNA molecules by washing with a CaC12 solution. Competent E. coli HB101 are mixed with the previously ligated DNA and, after incubation at 0~C, transformation is achieved by heat shock at 42~C for 2 minutes (M. Dagert et al., Gene 6, 23-28 (1979)). The transformed bacteria are then spread on tetracycline-containing agar plates (10 ~ug per ml). Only E. coli HB101 cells which have received a vector or recombinant carrier molecule are resistant to tetracycline (Tcr) and can thus grow on this agar. Recombinant vector-dsDNA molecules give a host the genotype ApSTcr because the introduction of the dsDNA into the ~-lactamase gene destroys the information for ~-lactamase. Clones are then transferred to agar plates, containing 50 ug/ml ampicillin. Only about 3% grow, meaning that 97%
of the clones contain the insertion of a dsDNA
molecule. By the above process and starting with 0.5 jUg dsDNA, we obtained more than 30,000 clones;
28,600 clones thereof were individually transferred into the cups of microtiter plates which contained , . .. . . .. .. .

13~0184 nutrient medium, 10 ~g/ml tetracycline and glycerine.
After the clones had grown, the plates were kept at -70~C for storage (cDNA library).
In order to search the cDNA library for the new interferon gene-containing clones, the clones are transferred after thawing to nitrocellulose filters. These filters rest on tetracycline containing nutrient agar. The bacterial colonies are allowed to grow and then the DNA of the bacteria is fixed on the filter.
As a probe, one can advantageously use the insert of the clone pER33 (E. Rastl et al., Gene 21, 237-248 (1983) - see also European Patent applica-tion No. 0.115.613) which contains the gene for IFN-o2-Arg. By means of nick translation using DNA-polymerase I, dATP, dGTP, dTTP and a-3 P-dCTP, this portion of DNA is radioactively labelled.
The nitrocellulose filters are first pretreated under relaxed hybridisation conditions, without the addition of the radioactive probe, and subsequently they are hybridised for about 16 hours with the addition of the radioactive probe. The filters are then washed under relaxed conditions. Due to the low stringency of hybridisation and washing, not only are clones obtained that contain the interferon o2-Arg gene, but also other clones containing interferon coding sequences which may differ considerably from that of the interferon o2-Arg gene. After drying, the filters are exposed on an x-ray film.
A blackening effect, which is substantially above the level of background, shows the presence of clones with interferon-specific sequences.
Because the radioactivity signals are of differing quality, the positive clones or the clones that react in a manner leading to a suspicion of positive results are then cultured on a small scale.
The plasmid DNA molecules are isolated, digested 134018~

with the restriction endonuclease PstI, and separated electrophoretically on an agarose gel according to size (Birnboim et al., Nucl. Acid. Res. 7, 1513 (1979)). The DNA in the agarose gel is transferred S to a nitrocellulose filter according to the method of Southern (E. M. Southern, J. Mol. Biol. 98, 503-517 (1975)). The DNA in this filter is hybridised with the radioactive, IFN o2-Arg gene-containing, denatured probe. As a positive control, the plasmid lF7 (deposited at the DSM under the DSM no. 2362) may be used, which also contains the gene for interferon o2- Arg.
By the above procedure, we obtained an autoradio-gram which clearly showed that two clones, E76E9 and P9A2, contain a sequence that hybridises with the interferon ~2-Arg gene under nonstringent, relaxed conditions. In order to be able to characterise more fully the dsDNA inserts of the clones E76E9 and P9A2, the plasmids of these clones were prepared on a larger scale. The DNA was digested with various restriction endonucleases, for example, with AluI, Sau3A, BglII, HinfI, PstI, and HaeIII and the resulting fragments were separated on an agarose gel. Through comparison with size markers, for example the fragments which result from digestion of pBR322 with the restriction endonuclease HinfI or HaeIII, the sizes of the restriction fragments derived from the plasmids E76E9 and P9A2 were determined. By means of mapping according to Smith and Birnsteil (H. O. Smith et al., Nucl. Acid. Res. 3, 2387-2398 (1967)), the arrangement of these fragments within E76E9 and P9A2 was determined. From the restriction enzyme maps thus obtained (see Figures 1 and 2), the surpri-sing finding was made that the inserts of the clones E76E9 and P9A2 involve a hitherto unknown interferon gene, that is, the omega-interferon gene.
This information was used in order to digest the cDNA inserts of E76E9 and P9A2 with suitable _. . . ~ , . .

13~018~

restriction endonucleases. The fragments were ligated into the dsDNA form (replicative form) of the bacteriophage M13 mp9 (J. Messing et al., Gene 19, 269-276 (1982)) and were sequenced with the help of Sanger's dideoxy method (F. Sanger et al., Proc. Natl. Acad. Sci. USA 74, 5463-5467 (1977)). This sequencing method, which is well known to those skilled in the art of recombinant DNA technology, may be summarized as follow: The single-strand DNA of recombinant M13 phages is isolated. After the binding of a synthetic oligomer, second-strand syntheses are performed in four separate preparations, using the large fragment of E. coli DNA-polymerase I (Klenow fragment). For each of the four partial reactions, one of the four didexoy-nucleosidetriphosphates (ddATP, ddGTP, ddCTP, ddTTP) are added. This leads to statistically distributed chain breaks at those places where a base that is complementary to the particular dideoxynucleosidetri-phosphate in the reaction mixture happens to bein the template-DNA. Radioactively labelled dATP
is also used. After termination of the synthesis reactions, the products are denatured and the single-strand DNA fragments are separated according to size in a denaturing polyacrylamide gel (F. Sanger et al., FEBS Letters 87, 107-111 (1978)). The gel is then exposed to x-ray film. From the autoradio-gram one can read off the DNA sequence of the recombi-nant M13 phage. The sequences of the inserts of the various recombinant phages are processed by means of suitable computer programs (R. Staden, Nucl. Acid. Res. _ , 4731-4751 (1982)).
Figures 1 and 2 reveal the strategy of sequen-cing. Figure 3 shows the DNA sequence of the insert of the clone P9A2; Figure 4 shows that of the clone E76E9. The noncoding DNA strand is shown in the 5' 3' direction, together with the amino acid sequence derived therefrom.

A comparison of the cDNA inserts of the clones E76E9 and P9A2 shows one important difference.
The triplet in clone E76E9 which codes for amino acid 111 is GAG and codes for glutamic acid. This triplet in clone P9A2 is GGG and codes for glycine.
DNA sequences that code for mature omega tGlu)-interferon and mature omega (Gly)-interferon are completely contained in the clones E76E9 and P9A2 respectively. Both mature omega (Glu) interferon and mature omega (Gly) interferon start at the N-terminal end with the amino acids cysteine-aspartic acid-leucine. Quite surprisingly, these two mature omega-interferons are 172 amino acids long this clearly deviates from the hitherto known length of other known interferons, that is, 166 (or 165) amino acids for ~-interferons. Also somewhat surpri-singly, the two omega-interferons have a potential N-glycosylation site at amino acid position 78, an asparagine residue.
The isolated cDNA of the clone E76E9 which codes for omega(Glu)-interferon is 858 base pairs long and has a 3' nontranslated region. The region which codes for mature omega(Glu)-interferon extends from nucleotide 9 to nucleotide 524. The isolated cDNA of the clone P9A2 is 877 base pairs long, the sequence which codes for mature omega (Gly) interferon extending from nucleotide 8 to nucleotide 523. The 3' nontranslated region in the case of P9A2 extends to the poly-A segment.
A comparison of the two specific omega-interferons mentioned above with the hitherto known human ~-interferon subtypes gives the following picture:

... . , ,.. . .. . , . ~.. . .....

134018~

omega alpha Length of protein in amino acids 172 166*
5 Potential N-glycosylation site at position 78 - **

* Interferon alpha A has only 165 amino acids.
** Interferon alpha H has a potential N-glycosylation site at position 75 (D. Goeddel et al., Nature 2 , 20-26 (1981)).

E. coli HB 101 with the plasmid E76E9 and E. coli 101 with the plasmid P9A2 were deposited at the German Collection for Microorganisms (DSM
Gottigen) under the numbers DSM 3003 and 3004, respectively on 3 July 1984.
To prove that the newly discovered clones produce an activity resembling interferon, a 100 ml culture of clone E76E9 was further cultured in L-broth at 37~C up to an optical density of A600 = 0.8, the bacteria were lysed and the resulting supernatant was then tested in a plaque reduction test. As expected, the supernatant tested was found to have interferon-like activity (see Example 3).
To prove that omega (Gly)- and omega (Glu)-interferon are members of a new interferon family, all the DNA was isolated from Namalwa cells and digested with various restriction endonucleases.
In this way, it was possible to assess the number of genes which correspond to the cDNAs of the clones P9A2 and E76E9. For this purpose, the DNA fragments obtained were separated on agarose gel using the method of Southern (E.M. Southern et al., J. Mol. Biol. 98, 503-517 (1975)), placed on nitrocellulose filters and hybridised under 13~018~

relatively stringent conditions with radioactively labelled specific DNA of the clone P9A2.
Figure 5b illustrates the cDNA of the clone P9A2 and the fragment used for hybridisation.
The points of recognition sites of some restriction enzymes are shown (P=PstI, S=Sau3A, A=AluI). The probe employed included only two of the three possible PstI fragments (see Example 4(d)).
In addition to the omega interferon gene probe, an interferon o2-Arg gene probe was used derived from the plasmid PER33. The results which were obtained are shown in Figure 5a.
The individual lanes are marked with letters to indicate the various restriction enzymes used to diqest the Namalwa cell DNA samples (E=EcoRI, H=HindIII, B=BamHI, S=SphI, P=PstI, C=ClaI). The left-hand half of the filter was hybridised with the o-interferon gene probe ("A") and the right-hand half was hybridised with the omega interferon gene probe derived from the clone P9A2 ("O").
The DNA bands which hybridised with the o-interferon gene probe were different than those which hybridized with the new interferon gene probe. No cross-hybridisation could be detected with the two different probes by assessing the corresponding lanes.
The hybridisation pattern obtained with the probe derived from the cDNA insert of clone P9A2 shows only one hybridising fragment with approximately 1300 base pairs (bp), which belongs to the homologous gene. The shorter fragment, 120 bp long, had run out of the gel. The band belonging to the 5' part of the gene cannot be observed since the probe does not contain this region. At least 6 different bands can be seen in the PstI lane. This indicates that some other genes which are related to the sequences for omega (Gly)-interferon and omega (Glu)-interferon must be present in the human genome.

134018~

From these results, one can deduce that if one or more PstI recognition sites are present in these genes, one can expect to be able to isolate at least three more additional genes. These genes may preferably be isolated by hybridisation from a human gene library contained in a plasmid vector, phage vector or cosmid vector (see Example 4e).
Thus, it will be understood in view of the foregoing that the present invention provides the omega-interferon polypeptides of Type 1 coded for by the cDNA inserts of plasmids P9A2 and E76E9, further interferon polypeptides coded for by sequences which will hybridise with the sequences corresponding to the interferon-coding sequences of plasmids P9A2 and E76E9 or degenerate variations thereof under stringent hybridisation conditions suitable for detecting about 85% or higher homology, and N-glycosylated or other derivatives thereof with interferon activity.
The omega-interferons according to the invention do not only encompass the mature interferons which are specifically described but also any modifications of these polypeptides which leave IFN-omega activity.
These modifications comprise shortening of the molecules at the N- or C-termini thereof, exchanging amino acid residues for other residues without substantially affecting activity, or chemically or biochemically attaching the molecules to other molecules, which may be inert or otherwise. Among the latter can be mentioned hybrid molecules made from one or more omega interferons and/or known o- or ~-interferons.
In order to be able to compare the differences between the amino acid and nucleotide sequences of the new interferons, particularly of the omega(Gly) and omega(Glu)-interferon, with the amino acid and nucleotide sequences which have already been 134018'1 published for o-interferons and ~-interferon (C.
Weissmann et al., Philo Trans. R. Soc. London 299, 7-28 (1982); A. Ullrich et al., J. Molec. Biol.
156, 467-486 (1982);, T.Taniguchi et al., Proc.
Nat. Acad. Sci. 77, 4003-4006 (1980); K. Tokodoro et al., EMBO J. 3, 669-670 (1984)), the corresponding sequences are arranged in pairs and the differences at individual positions are counted.
The results shown in Figure 7 demonstrate that the interferon coding nucleotide sequences of the clones P9A2 and E76E9 are related to the sequences of the Type I interferons (o and ~-interferons).
It is also shown that the differences in the amino acid sequences between the individual o-interferons and the new sequences are between 41.6% and 47.0%.
The differences between both the new sequences and those of the individual o-interferons to the one of ~-interferon are about 70%. Taking into account the results of Example 4 in which the existence of a whole set of related genes is demonstrated, and also taking into account the proposed nomenclature for interferons (J. Vilceck et al., J. Gen. Virol.
65, 669-670 (1984)), it is assumed that the cDNA
inserts of the clones P9A2 and E76E9 code for a new class of Type I interferon, interferon-omega.
It has also been shown that omega-interferon gene expression occurs analogously to that of a Type I interferon gene. Transcription of the individual members of the multi gene families coding for the o- and omega-interferons may be investigated using the Sl mapping method (A.J. Berk et al., Cell 12, 721 (1977)). By means of this technique, it has been demonstrated that the expression of mRNA
corresponding to the omega (Glu)- and omega (Gly)-interferon genes (hereinafter referred to as omega-l-mRNA) is virus-inducible. Since the transcripts of a gene family of this kind differ by only a few bases out of approximately 1000, hybridisation alone is not a sufficiently sensitive criterion to distinguish between the various IFN mRNAs.
To overcome this problem, the mRNA sequences of 9 o-interferons, omega (Gly)-interferon/omega (Glu)-interferon (hereinafter referred to as interferon-omega 1) and ~-interferon were aligned and capital letters were used to designate those bases which are specific to the top sequence (see Figures 8(a), (b) and (c)). Such specific sites can easily be found using a simple computer programme. A hybridi-sation probe complementary to the top sequence which starts from such a specific site can only hybridise perfectly with the mRNA of the selected subtype. All other mRNAs are unable to hybridise at the specific site of the subtype. If the hybridi-sation probe is radioactively labelled at its specific 5'-end, only those radioactive labels which are protected from digestion with a single strand-specific nuclease (preferably Sl nuclease) are those which have hybridised with the interferon subtype mRNA
for which the probe was designed.
This principle is not restricted to interferon-coding mRNAs but may be applied to any group of known sequences which have the specific sites described in Figure 8.
The above-mentioned specific sites of the subtypes are not restriction sites, in most cases, which means that the cutting of the corresponding cDNAs with restriction endonucleases is not capable of producing subtype-specific hybridisation probes.
A specific probe for omega-l-mRNA was therefore produced by extending an oligonucleotide radioactively labelled at the 5' end which is complementary to the mRNA of interferon-omegal above its specific site (see Example 7(a) and Figure 9).
Figure 10 shows that, as expected, omega-l-mRNA can be induced in Namalwa and NC37 cells 13~018i (see Example 7(c)).
It should be understood that the present invention encompasses not only the genetic sequences specifically coding for the omega interferons mentioned, but also modifications obtained readily and routineLy by mutation, deletion, transposition or addition.
Any sequence which codes for an omega-interferon (i.e. a polypeptide having a spectrum of biological activities as indicated herein) and which is degenerate to those actually shown is included. Means for preparing such a sequence are well known to those skilled in the art of recombinant DNA technology.
Also, any sequence coding for a polypeptide having the spectrum of activities shown herein for IFN-omega, and which hybridises with the sequences (or portions thereof) shown herein under stringent hybridisation conditions (i.e., selecting for better than about 85%, preferably better than about 90 homology) is also covered.
By screening a cosmid human DNA library using an IFN omegal gene probe and stringent hybridization conditions suitable for detecting about 85% or higher homology, one will find a number of cosmids which hybridise. Sequence analysis of restriction enzyme fragments isolated therefrom will give theauthentic IFN-omegal gene (see Figure 11) and three other related genes which have been designated the IFN-pseudo-omega2 gene, the IFN-pseudo-omega3 gene and the IFN-pseudo-omega4 gene (see Figures 12-14). The invention also relates to these and to the encoded peptides.
DNA comparisons give an approximately 85~
homology of the pseudo genes with the IFN-omegal gene.
Moreover, the IFN-omegal gene shows that upon transcription the mRNA contains the information for a functional interferon protein. A signal peptide 23 amino acids long, of the formula Met Ala Leu Leu Phe Pro Leu Leu Ala Ala Leu Val Met Thr Ser Tyr Ser Pro Val Gly Ser Leu Gly is coded, fused to the mature IFN-omega which is 172 amino acids long.
Interferon-omega genes may be introduced into any organism under conditions which result in high yields. Suitable hosts and vectors are well known to anyone skilled in the art; by way of example, reference is made to EP-A-0.093.619, published on November 9, 1983, inventors D.V.N. Goeddel et al.
In particular, prokaryotes are preferred for expression.
For example, E.coli K12 strain 294 (ATCC No. 31446) is particularly useful. Other microbial strains which may b~ used include E.coli X1776 ~ATCC No. 31.537). The aforementioned strains, as well as E. coli W3110 (F , lamba , prototrophlc, ATCC
No. 27325), bacilli such as Bacillus subtilis, and other enterobacteria such as Salmonella typhimurium or Serratia marcesens, and various pseudomonad species may be used.
In general, plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as marking sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli is typlcally transformed using pBR322, a plasmid derived from an E. coli strain (Bolivar, et al., Gene 2 95 (1977)). pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for r '' ~'1 . ., ~

20a identifying transformed cells. The pBR322 plasmid or other plasmids must also contain, or be modified to contain, prc~oters ~¢~

134Q18~
,~

which can be used by the microbial organism for expression. Those promoters most commonly used in recombinant DNA construction include the beta-lactamase (penicillinase) and lactose promoter systems (Chang et al., Nature 275, 615 (1978);
Itakura et al., Science 198. 1056 (1977); Goeddel et al., Nature 281, 544 (1979)) and tryptophan (trp) promoter system (Goeddel et al., Nucleic Acids Res. 8, 4057 (1980); EP-A-0.036.776). While these are the most commonly used, other microbial promoters have been discovered and utilized. For example, the genetic sequence for IFN-omega can be placed under the control of the leftward promoter of bacteriophage Lambda (PL). This promoter is one of the strongest known promoters which can be controlled. Control is exerted by the lambda repressor, and adjacent restriction sites are known.
A temperature sensitive allele of this repressor gene can be placed on the vector that contains the complete IFN-omega sequence. When the temperature is raised to 42~C, the repressor is inactivated, and the promoter will be expressed at its maximum level. The amount of mRNA produced under these conditions should be sufficient to result in a cell which contains about 10% newly synthesised RNA originating from the PL promoter. In this way, it is possible to establish a bank of clones in which a functional IFN-omega sequence is placed adjacent to a ribosome binding sequence, and at varying distances from the lambda PL promoter.
These clones can then be screened and the one giving the highest yield selected.
The expression and translation of an IFN-omega sequence can also be placed under control of other regulons which may be "homologous" to the organism in its untransformed state. For example, lactose dependent E. coli chromosomal DNA comprises a lactose or lac operon which permits lactose digestion by expressing the enzyme beta-galactosidase.
The lac control elements may be obtained from bacteriophage lambda placS, which is infective for E. coli. The phage's lac operon can be derived by transduction from the same bacterial species.
Regulons suitable for use in the process of the invention can be derived from plasmid DNA native to the organism. The lac promoter-operator system can be induced by isopropyl-~-D-thiogalacto-pyranoside (IPTG).
Other promoter-operator systems or portions thereof can be employed as well: for example, the arabinose-operator, Colicine El-operator, galactose-15 -operator, alkaline phosphatase-operator, trp-operator, xylose A-operator and tac-promoter/operator.
In addition to prokaryotes, eukaryotic microbes, such as yeast cultures may also be used. Saccharomyces cerevisiae is the most commonly used among eukaryotic microorganisms, although a number of other species are commonly available. For expression in Saccharomyces, plasmid YRp7 (Stinchcomb, et al., Nature 282, 39 (1979); Kingsman et al., Gene 7, 141 (1979); Tschumper, et al., Gene _ , 157 (1980)) and plasmid YEpl3 (Bwach et al., Gene 8, 121-133 (1979)) are, for example, commonly used. The plasmid YRp7 contains the TRPl gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076.
The presence of the TRPl lesion as a characteri-stic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan. Similarly, the plasmid YEpl3 contains the yeast LEU2 gene which can be used to complement a LEU2 minus mutant strain.

- ~ 13401~4 Suitable promoting sequences for yeast vectors include the 5'-flanking regions of the genes for ADH I
(Ammerer, G., Methods of Enzymology 101, 192-201 (19B3)), 3-phosphoglycerate kinase (Hitzeman, et al., J.
Biol. Chem. 255, 2073 (1980)) and other glycolytic enzymes (Kawasaki and Fraenkel, BBRC 108, 1107-1112 (1982)), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate, decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, phosphoglucose isomerase, and glucokinase.
In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector at the 3' end of the sequences to be expressed, to provide polyadenylation of the mRNA and termination.
Other suitable promoters, which like the aforementioned promoter region of the glyceraldehyde--3-phosphate gene have the additional advantage of enabling transcription control by growth conditions, are the promoter regions of the genes for alcohol dehydrogenase-2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism and enzymes responsible for maltose and galactose utilisation. Promoters which are regulated by the yeast mating type locus, such as the promoters of the genes BARI, MFol, STE2, STE3, STE5 can be used for temperature regulated systems by using temperature dependent siv mutations (Rhine, Ph.D.
Thesis, University of Oregon, Eugene, Oregon (1979), Herskowitz and Oshima, The Molecular Biology of the Yeast Saccharomyces, part I, 181-209 (1981), Cold Spring Harbor Laboratory). These mutations directly influence the expressions of the silent mating type cassettes of yeast, and therefore indirec-tly the mating type dependent promoters. Generally,however, any plasmid vector containing a yeast-compatible promoter, originating replication and termination sequences is suitable.

.

13~0181 In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts. In principle, any such cell culture may be employed, whether from vertebrate or invertebrate culture. However, interest has been greatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years (Tissue Culture, Academic Press, Kruse and Patterson, Editors (1973)). Examples of such useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, BHK, COS-7 and MDCK cell lines. Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located in front of the gene to be expressed, along with any necessary ribosome binding sites, RNA splice sites, polyadeny-lation site, and transcriptional terminator sequences.
For use in mammalian cells, the control functions on the expression vectors are often provided by viral material. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and most frequently Simian Virus 40 (SV40). The early and late end promoters of SV40 are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature 273, 1123 (1978)). Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the Hind III site toward the Bgl I site location in the viral origin of replication. Further, it is also possible, and often desirable, to utilise promoter or control sequences normally associated with the desired gene sequence, provided such control sequences are compatible with the host cell systems.

. , , . ~, .

134018~

An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or another viral source (e.g., Polyoma, Adeno, VSV, BPV, etc.) or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
The genes may, however, preferably be expressed in the expression plasmid pER103 (E. Rastl-Dworkin et al., Gene 21, 237-248 (1983) and EP-A-0.115-613 - deposited at the DSM under the number DSM
2773 on 20th December 1983), since this vector contains all the regulons necessary for a high expression rate of the cloned genes in E. coli.
According to a preferred embodiment of the present invention, therefore, we provide an expression vector derived from plasmid PBR322 wherein the shorter EcoRI/BamHI fragment belonging to plasmid pBR322 is replaced by a polydeoxyribonucleotide comprising the sequence:

EcoRI Sau3A
gaattcacgctGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTCGCGA 59~5 mRNA-Start Met RBS HindIII
Cys Asp TGT GAT C IFN-omega-coding sequence~
Sau3A

In order to construct an expression vector of this type, the following procedure may, for example, be used, which is illustrated in Figure 6.

. . . . .... . .. .....

~ 134013~

(I). Preparation of the individual DNA fragments required:
Fragment (a) In order to produce fragment (a) a plasmid which contains an IFN-omega coding sequence, e.g.
the plasmid P9A2, is digested with the restriction endonuclease AvaII. After chromatography and purifi-cation of the resulting cDNA insert, the latter is twice redigested with the restriction endonucleases NcoI and AluI and then isolated by chromatography and electroelution. This fragment contains the majority of the corresponding omega-interferon gene. Thus, for example, the omega(Gly) interferon gene fragment derived from the clone P9A2 has the following sequence:

His Gly Leu Leu Ser Arg Asn Thr Leu c¦CAT GGC CTA CTT AGC AGG AAC ACC TTG 28 NcoI

Val Leu Leu His Gln Met Arg Arg Ile Ser Pro Phe Leu Cys Leu Lys Asp Arg Arg Asp Phe Arg Phe Pro Gln Glu Met Val Lys Gly 25 AAG GAC AGA AGA GAC TTC AGG TTC CCC CAG GAG ATG GTA A~A GGG 118 Ser Gln Leu Gln Lys Ala His Val Met Ser Val Leu His Glu Met 30Leu Gln Gln Ile Phe Ser Leu Phe His Thr Glu Arg Ser Ser Ala CTG CAG CAG ATC TTC AGC CTC TTC CAC ACA GAG CGC TCC TC'T GCT 208 Ala Trp Asn Met Thr Leu Leu Asp Gln Leu His Thr Gly Leu His 3' Gln Gln Leu Gln His Leu Glu Thr Cys Leu Leu Gln Val Val Gly , . . . ...... .. ~ . . . .

- 13~0181 Glu Gly Glu Ser Ala Gly Ala Ile Ser Ser Pro Ala Leu Thr Leu Arg Arg Tyr Phe Gln Gly Ile Arg Val Tyr Leu Lys Glu Lys Lys Tyr Ser Asp Cys Ala Trp Glu Val Val Arg Met Glu Ile Met Lys Ser Leu Phe Leu Ser Thr Asn Met Gln Glu Arg Leu Arg Ser Lys ..

1 Asp Arg Asp Leu Gly Ser Ser 2(AAAAGAcTTAGGTTcAGGGGcATcAGTcccTAAGATGTTATTTATTTTTAcTcArTTAT 707 TTTACATTGTATTAAGATAACAAAACATGTTCAG~t 802 AluI

Fragment (b) In order to isolate fragment (b) from the plasmid P9A2 or plasmid E76E9, the chosen plasmid is digested with the restriction endonuclease AvaII.
After chromatography and purification of the resulting cDNA insert, the latter is redigested with the restriction endonuclease Sau3A and the desired fragment of 189bp is isolated by chromatography and electroelution. It has the following sequence:

. .

- 28 1 3 1 0 1 8 i Asp Leu Pro Gln Asn His Gly Leu Leu Ser Arg Asn Thr Leu ¦GAT CTG CCT CAG AAC CAT GGC CTA CTT AGC AGG AAC ACC TTG 42 Sau3Al NcoI

Val Leu Leu His Gln Met Arg Arg Ile Ser Pro Phe Leu Cys Leu Lys Asp Arg Arg Asp Phe Arg Phe Pro Gln Glu Met Val Lys Gly AAG GAC AGA AGA GAC TTC AGG TTC CC~ CAG GAG ATG GTA AAA GGG 132 Ser Gln Leu Gln Lys Ala His Val Met Ser Val Leu His Glu Met Leu Gln Gln Ile 20CTG CAG C~ atc 189 Sau3A¦

Fragment (c) In order to prepare fragment (c), the plasmid pER33 (see E. Rastl-Dworkin et al., Gene 21, 237-24&
(1983) and EP-A-0.115.613) is digested twice with 30 the restriction enzymes EcoRI and PvuII. The 389bp fragment which is obtained after agarose gel fractic,nation and purification and which contains the Trp promotor, the ribosomal binding site and the starting codon, is subsequently digested with Sau3A. The desired 35 fragment of 108bp is obtained by agarose gel electro-., phoresis, electroelution and elutip column purificat:ion C (carried out with an Elutip~column available from f,~a6le ,~ a r lC

Messrs. Schleicher and Schuell). It has the following sequence:

EcoRI ¦Sau3A
gaattcacgct~ATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCC~'TCGCGA 59 ~mRNA-Start Met RBS HindII}
10 Cys Asp TGTIgat c 123 Sau3A

Ligation of fragments (b) and (c):
The fragments (b) and (c) are ligated with T4 ligase and, after destruction of the enzyme, cut with HindIII. This ligated fragment has the following structure:

20 HindIII Sau3A NcoI
a~GCTTAAAG ATGTGTGATC TGCCTCAGAA CCATGGCCTA CTTAGCAGGA 50 AGATCACACA TCTTTA~gct t Sau3A HindIIII

Alternatively, this DNA fragment necessary for the production of the plasmid pRHW10 may also be produced by using two synthetically produced oligonucleotides:
The oligonucleotide of formula 5'-AGCTTAAAGATGTGT-3' ,.

remains dephosphorylated at its 5' end.

The oligonucleotide of formula 5'-GATCACACATCTTTA-3' is phosphorylated at the 5' end by using T4 polynucleotide kinase and ATP.

When the two oligonucleotides are hybridised, the following short DNA fragment is obtained:

5'-AGCTTAAAGATGTGT 3' 3'- ATTTCTACACACTAGp 5' This produces at one end the 5' overlap typical of HindIII and at the other end the 5' overlap typical of Sau3A.
Fragment (b) is dephosphorylated using calves' intestine phosphatase. Fragment (b) and the fragment described above are combined and joined together by means of T4 ligase.
Since the ligase requires at least one end containing 5'-phosphate, only the synthetic piece of DNA can be joined to fragment (b) or 2 synthetic fragments may be connected at their Sau3A ends.
Since the two resulting fragments are of different lengths, they may be separated by selective isopropanol precipitation. The desired fragment thus purified is phosphorylated using T4 polynucleotide kinase and ATP.

(II). Preparation of the expression plasmids a) Preparation of plasmid pRHW10:
The expression plasmid pER103 (E. Rastl-Dworkin et al., Gene 21, 237-284 (1983) and EP-A-0.115.613, filed at the DSM under DSM Number 2773) is linearised with HindIII and then treated with calves' intestine , 13~0181 phosphatase. After isolation and purification of the DNA thus obtained, it is dephosphorylated and then ligated with the fragment obtainable by ligating fragments (b) and (c), followed by digestion with HindIII as described above. Then, E.coli HB 101 is transformed with the resulting ligation mixture and cultivated on LB agar plus 50 jug/ml of ampicillin. The resulting plasmid designated pRHW 10, (see Figure 6), after replication is used as an intermediate for preparing the desired expression plasmids.

b) Preparation of the expression plasmid pRHW12:
The Klenow fragment of DNA polymerase I and the 4 deoxynucleoside triphosphates are added to the plasmid pRHW10 cut with BamHI. The linearised blunt-ended plasmid obtained after incubation is purified and then cut with NcoI. The larger fragment, which is obtained using agarose gel electrophoresis, electroelution and elutip purification (carried out with an Elutip column available from Messrs.
Schleicher and Schuell), is ligated with fragment (a). E. coli HB 101 is then transformed with the ligation mixture and cultivated on LB agar plus 50 ,ug/ml of ampicillin. The resulting plasmid which expresses omega(Gly)-interferon has been designated pRHW12 (see Figure 6).
For example, 1 litre of the bacterial culture thus obtained (optical density: 0.6 at 600 nm) contains 1 x 10 International Units of interferon.

c) Preparation of the expression plasmid pRHWll:
The Klenow fragment of DNA polymerase I and the 4 deoxynucleoside triphosphates are added to the plasmid pRHW10 cut with BamHI. The linearised blunt-ended plasmid obtained after incubation is purified and then cut with NcoI. The larger fragment, which is obtained using agarose gel electrophoresis, ~ .. ...... . . . . .

electroelution and elutip purification, is ligated with fragment (a) obtained analogously as in (I) above from the plasmid E76E9, the IFN-coding sequence of which differs from that of plasmid P9A2 only in that the GGG codon coding for the amino acid Gly is replaced by the GAG codon coding for the amino acid Glu at codon position 111. Subsequently the resulting ligation mixture is used to transform E. coli HB101 which is then cultivated on LB agar plus 50 lug/ml of ampicillin. The resulting plasmid which expresses omega(Glu)-interferon has been designated pRHWll.
Transformation of cells with vectors can be effected by a number of procedures. For example, the transformation procedure may comprise either washing cells in magnesium and adding DNA to the cells suspended in calcium or exposing the cells to a coprecipitate of DNA and calcium phosphate.
Following gene expression, the cells are plated on media which select for transformants.
After appropriate transformation of the host, expression of the gene therein and fermentation or cell culture under conditions where IFN-omega is expressed, the product can normally be extracted by means of well known chromatographic separation procedures to yield a material comprising IFN-omega with or without leading and trailing sequences.
The IFN-omega may be expressed with a leading sequence at the N-terminus thereof (to yield pre-IFN-omega), which may be removed in some of the host cells.
If not removed, it may be necessary to cleave the leading polypeptide (if any is present) to yield the mature IFN-omega. Alternatively, the IFN-omega clone can be modified in such a way that the mature protein will be directly produced in the microorganism instead of pre-IFN-omega. In this respect, the precursor sequence of the yeast mating pheromone MF-alpha-l can be used for precise maturation of .. . . ..

13401~'~

the fused protein, and for secretion of the products into the growth medium or periplasmic space. The DNA sequence corresponding to functional or mature IFN-omega can be connected to a portion of the leader sequence of the MF-alpha-l gene at the sequence coding for the cathepsin-like cleavage site (after lys-arg) at position 256 from the initiation codon ATG (Kurjan, Herskowitz, Cell 30, 933-943 (1982)).
On the basis of their biological actions, the new interferons according to the invention are suitable for the treatment of any condition for which the known interferons have been used.
These include conditions such as herpes, rhinovirus, AIDS infections and certain cancers. The new interferons of the present invention can be used by themselves c,r in combination with other known interferons or other biologically active products, such as IFN-alpha, IFN-gamma (see Example 12D), IL-2 and other immune modulators.
According to yet another aspect of the present invention, we therefore provide a pharmaceutical composition comprising at least one interferon polypeptide according to the present invention and/or at least one derivative of such an interferon polypeptide with interferon activity in association with a pharmaceutically acceptable carrier or excipient.
Suitable carriers and their formulation are described in Remington's Pharmaceutical Sciences by E. W. Martin, to which reference is expressly made. The chosen active ingredient comprising at least one IFN-omega and/or at least one IFN-omega derivative is mixed together with a suitable amount of vehicle in order to prepare pharmaceutically acceptable compositions suitable for effective administration to the patient. The preferred mode of administration is parenteral.
IFN-omega may be parenterally administered to subjects requiring antitumour or antiviral treat-ment, and to those exhibiting immunosuppressive 134018~

conditions. Dosage and dose rate may parallel those currently in use in clinical investigations of o-IFN materials, e.g. about (1-10) x 106 units daily, and in the case of materials of purity greater than 1%, up to e.g. 5 x 107 units daily.
As one example of an appropriate dosage form for essentially homogenous bacterial IFN-omega in parenteral form, 3 mg IFN-omega may be dissolved in 25 ml of 5 N human serum albumin, the solution is passed through a bacteriological filter and the filtered solution aseptically subdivided into 100 vials, each containing 6 x 106 units pure IFN-omega suitable for parenteral administration.
The vials are preferably stored in the cold (-20~C) prior to use.
The following Examples, which are not exhaustive, illustrate the present invention in greater detail.

134018~
Example 1 Finding IFN-sequence-specific clones a) Preparation of a cDNA Library mRNA from Sendai-virus-stimulated cells was used as starting material for the establishment of a cDNA library according to methods known in the literature (E. Dworkin-Rastl et al., Journal of Interferon Research Vol. 2/4, 575-585 (1982)).
The 30,000 clones obtained were individually transfer-red into the wells of microtiter plates. The following medium was used for growing and freezing the colonies:

10 9 trypton 5 9 Yeast Extract 5 9 NaCl 0.51 9 Na-Citrate x 2 H2O
7.5 9 K2HPO4 x 2 H2O
1.8 9 KH2PO4 0.09 9 MgSO4 x 7 H2O
0.9 9 (NH4)2SO4 44 9 glycerine 0.01 9 tetracycline x HCl ad 1 1 H2O

The microtiter plates with the individual clones were incubated overnight at 37~C and were then stored at -70~C.
b) Hybridisation test As the starting material for the hybridisation test was used the recombinant plasmid pER33 (E.
Dworkin-Rastl et. al., Gene 21, 237-248 (1983)).
This plasmid contains the coding region for the mature interferon IFN-o2 arg plus 190 bases of the 3' nontranslated region. 20 ug pER33 were incubated with 30 units of Hind III restriction endonuclease in 200 ul reaction solution (10 mM
Tris-HC1, pH-7.5, 10 mM MgC12, 1 mM Dithiothreitol . .

134018'1 (DTT), 50 mM NaCl) for 1 hour at 37~C. The reaction was terminated by the addition of 1/25 vol 0.5 M ethylenedinitrilotetraacetic acid (EDTA) and heating to a temperature of 70~C for 10 minutes.
After the addition of 1/4 vol 5 x buffer (80% glycerine, 40 mM Tris acetate, pH 7.8, 50 mM EDTA, 0.05% Sodium dodecylsulphate (SDS), 0.1% bromophenol blue), the resulting fragments were separated electrophoreti-cally according to size in a 1% agarose gel. [Gel and electrophoresis buffer (TBE): 10.8 9/1 trishydroxy-methylaminomethane (Tris-Base), 5.5 9/1 boric acid, 0.93 9/1 EDTA]. After the incubation of the gel in a 0.5 ~ug/ml ethidium bromide solution, the DNA
strips were made visible in W-light and the gel area, which contained the IFN-gene-containing DNA
piece (about 800 bp long), was cut. The DNA was electroeluted into 1/10 x TBE buffer. The DNA
solution was extracted once with phenol and four times with ether, and the DNA was precipitated by adding 1/10 vol 3 M sodium acetate (NaAc) pH
5.8 and 2.5 vol EtOH from the aqueous solution at -20~C. After centrifuging, the DNA was washed with 70% ethanol and was dried in a vacuum for 5 minutes. The DNA was dissolved in 50 ul of water (about 50 ,ug/ul). The DNA was marked radioactively by means of nick translation (modified according to T. Maniatis et al., Molecular Cloning, Ed. CSH).
Furthermore, 50 ul incubation solution contained the following:
50 mM Tris pH 7.8, 5 mM MgC12, 10 mM mercaptoethanol, 100 ng DNA insert from pER33, 16 pg DNaseI, 25 luM
dATP, 25 ~uM dGTP, 25 ~uM dTTP, 20 uCi o -32P-dCTP
(~ 3,000 Ci/mMol), as well as 3 units of DNA polymerase I (E.coli). Incubation was performed at 14~C for 45 minutes. The reaction was terminated through the addition of 1 vol 50 mM EDTA, 2% SDS, 10 mM
Tris pH=7.6 solution and heating to 70~C for 10 -134018~

minutes. The DNA was separated by means of chromatography using Sephadex G-100* into TE buffer (10 mM Tris pH=8.0, 1 mM
EDTA) from non-incorporated radioactivity. The radioactively labelled sample had a specific radioactivity of about 4 x 107 cpm/~g-c) Screeninq the clones for IFN qene-containinq inserts The bacterial cultures, which were kept frozen in the wells of the microtiter plates, were thawed (a). A piece of nitrocellulose filter of corresponding size (Schleicher and Schull, BA 85, 0.45 ~m pore size) was placed on LB-agar (LB-agar: 10 g/l Trypton, 5 g/l yeast extract, 5 g/l NaCl, 15 g/l Bacto Agar, 20 mg/l tetracycline-HCl). By means of a plunger adapted to the microtiter plates, the individual clones were transferred to the nitrocellulose filter. The bacteria grew overnight at 37~C to form colonies with a diameter of about 5 mm. To destroy the bacteria and to denature the DNA, the nitrocellulose filters were, one after the other, placed on a stack of Whatman* 3MM Filter which had been soaked with the following solutions: (1) 8 minutes at 0.5 M NaOH, (2) 2 minutes at 1 M Tris pH=7.4, (3) 2 minutes at 1 M Tris pH=7.4 and (4) 4 minutes at 1.5 M NaCl, 0.5 M Tris pH=7.4. The filters were dried in air and were then kept at 80~C for 2 hours. The filters were pretreated for 4 hours at 65~C in the hybridisation solution, consisting of 6 x SSC (1 x SSC
corresponds to 0.15 M NaCl; 0.015 M trisodium citrate; pH =
7.0), 5 x Denhardt's solution (1 x Denhardt's solution * Trade-mark X

134018~

- 37a -corresponds to 0.02% PVP (polyvinylpyrrolidone); 0.02% ficoll*
(MW: 40,000D); 0.02% BSM (bovine serum albumin)) and 0.1% SDS
(sodium dodecylsulphate). About 1 x 106 cpm per filter of the sample made in (b) were denatured by boiling and added to the hybridisation solution. Hybridisation was performed at 65~C
for a period of 16 hours. The filters were washed four times * Trade-mark ~, 13~018~

1 hour at 65~C with 3 x SSC/0.1% SDS. The filters were dried in air, were covered with Saran Wra ~, and exposed on Kodak X-OmatS~ film.

Example 2 Southern Transfer to confirm IFN gene-containing recombinant plasmids 5 ml cultures of the positively reacting colonies or those colonies that were suspected of reacting positively, were grown in L-broth (10 9/1 trypton, 5 9/1 yeast extract, 5 9/1 NaCl, 20 mg/l tetracycline x HCl) at 37~C overnight. The plasmid-DNA was isolated using a modified protocol according to Birnboim and Doly (Nucl. Acid. Res. 7, 1513 (1979)). The cells in 1.5 ml suspension were centri-fuged (Eppendorf Centrifuge) and resuspended at 0~C in 100 ,ul lysozyme solution consisting of 50 mM
glucose, 10 mM EDTA, 25 mM Tris-HCl pH=8.0 and 4 mg/ml of lysozyme. After 5 minutes of incubation at room temperature, 2 vol of ice-cold 0.2 M NaOH, 1% SDS solution were added, and incubation continued for another 5 minutes. Then 150 ~1 of ice-cold sodium acetate solution pH=4.8 was added and incubated for 5 minutes. The precipitated cell components were centrifuged. The DNA solution was extracted with 1 vol phenol/CHC13 (1:1), and the ~NA was precipitated by the addition of 2 vol ethanol.
After centrifuging, the pellet was washed once with 70% ethanol, and dried in a vacuum for 5 minutes.
The DNA was dissolved in 50 ul (TE)-buffer. Of that amount, 10 ,ul were digested in 50 ul reaction solution (10 mM Tris-HCl pH=7.5, 10 mM MgC12, 50 mM
NaCl, 1 mM DTT) with 10 units PstI-restriction endonuclease for 1 hour at 37~C. After the addition of 1/25 vol 0.5 M EDTA as well as 1/4 vol 5 x buffer (see Example lb)), it was heated for 10 minutes and the DNA was then separated electrophoretically in a 1~ agarose gel (TBE-buffer). The DNA in the agarose gel was transferred to a nitrocellulose filter according to the method of Southern (E.
M. Southern, J. Mol. Biol. 98, 503-517 (1975)).
The DNA in the gel was denatured for 1 hour by incubating the gel in a 1.5 M NaCl/0.5 M NaOH solution.
This was followed by neutralisation for 1 hour with a 1 M Tris x HCl pH=8/1.5 M NaCl solution.
The DNA was transferred to the nitrocellulose filter with 10 x SSC (1.5 M NaCl, 0.15 M sodium citrate, pH=7.0). After completion of transfer (about 16 hours), the filter was briefly rinsed in 6 x SSC
buffer and then dried in air; it was finally baked at 80~C for 2 hours. The filter was pretreated for 4 hours with a 6 x SSC/5 x Denhardt's solution.
0.1% SDS (see Example lc) at 65~C. About 2 x 106 cpm of the hybridisation probe (see Example lb) were denatured by means of heating to a temperature of 100~C and were then added to the hybridisation solution. The duration of hybridisation was 16 hours at 65~C. Then the filter was washed 4 x 1 hours at 65~C with a 3 x SSC/0.1% SDS solution.
After air-drying, the filter was covered with Saran Wrap~ and was exposed on Kodak X-OmatS~ film.

Example 3 Detection of interferon activity in the clone E76E9 A 100-ml culture of clone E76E9 was cultured in L-broth (10 9/1 trypton, 5 9/1 yeast extract, 5 9/1 NaCl, 5 9/1 glucose, 20 mg tetracycline x HCl per 1) at 37~C up to an optical density of A6oo=0.8. The bacteria were centrifuged for 10 minutes at 7,000 rpm, they were washed once with a 50 mM Tris x HCl pH=8.0, 30 mM NaCl solution and then were resuspended in 1.5 ml washing solution.
After incubation with 1 mg/ml of lysozyme at 0~C for half an hour, the bacterial suspension was frozen and thawed five times. The cells were pelleted by means of centrifugation at 40,000 rpm for 1 .. . .... . .. ~ . ~, .

134018~

hour. The supernatant was sterile filtered and was tested for interferon activity. The test used was the Plaque Reduction Test with V3 cells and Vesicular Stomatitis Virus (G. R. Adolf et al., Arch. Virol. 72, 169-178 (1982)). Surprisingly, the clone produced up to 9,000 IU of interferon per litre of initial culture.

Example 4 Genomic Southern Blot for determining the number of genes associated with the new sequences a) Isolating the DNA from Namalwa cells 400 ml of a Namalwa cell culture are centrifuged at 1000 rpm in a JA21 centrifuge in order to pellet the cells. The resulting pellets are carefully washed by resuspending them in NP40 buffer (NP40 buffer: 140 mM NaCl, 1.5 mM MgC12, 10 mM Tris/Cl pH=7.4) and pelleting them again at 1000 rpm.
The pellets obtained are again suspended in 20 ml of NP40 buffer and mixed with 1 ml of a 10% NP40 solution in order to destroy the cell walls. After standing for 5 minutes in an ice bath the intact cell nuclei are pelleted by centrifuging at 1000 rpm and the supernatant is discarded. The cell nuclei are resuspended in a 10 ml of a solution consisting of 50 mM Tris/Cl pH=8.0, 10 mM EDTA and 200 mM
NaCl, and then 1 ml of 20% SDS are added to eliminate the proteins. The resulting viscous solution is extracted twice with the same quantity of phenol (saturated with 10 mM Tris/Cl pH=8.0) and twice with chloroform. The DNA is precipitated by the addition of ethanol and by centrifuging. Then the resulting DNA pellet is washed once with 70%
ethanol, dried for 5 minutes in vacuo and dissolved in 6 ml of TE buffer (TE buffer: 10 mM Tris/Cl pH=8.0, 1 mM EDTA). The concentration of the DNA
is 0.8 mg/ml.

13~018~

b) Restriction endonuclease digestion of the DNA
from Namalwa cells The restriction endonuclease digestion was carried out in accordance with the conditions specified by the manufacturer (New England Biolabs). 1 ,ug of DNA is digested with 2 units of the suitable restriction endonuclease in a volume of 10 ul at 37~C for 2 hours or longer. The restriction endonucleases EcoRI, HindIII, BamHI, SphI, PstI and ClaI were used. 20 lug of DNA are used for each digestion.
In order to monitor the completeness of the digestion, 10 ~1 (aliquot parts) are taken out at the start of the reaction and mixed with 0.4 ~9 of lambda phage-DNA. After 2 hours incubation, these aliquot portions are monitored by agarose gel electrophoresis and the completeness of digestion is assessed with the aid of a sample of the stained lambda phage DNA fragments.
After these checks have been carried out the reactions are stopped by adding EDTA to a final concentration of 20 mM and heating the solution to 70~C for 10 minutes. The DNA is precipitated by the addition of 0.3 M NaAc, pH=5.6 and 2.5 vols of ethanol. After 30 minutes incubation at -70~C
the DNA is pelleted in an Eppendorf centrifuge, washed once with 70% ethanol and dried. The resulting DNA is taken up in 30 ,ul of TE buffer.

c) Gel electrophoresis and Southern Transfer The digested DNA samples are fractionated according to their size in a 0.8% agar gel in TBE
buffer (10.8 9/1 Tris base, 5.5 9/1 boric acid, 0.93 9/1 EDTA). For this purpose, 15 ~ul of the DNA sample are mixed with 4 ~1 of loading buffer (0.02% SDS, 5 x TBE buffer, 50 mM EDTA, 50% glycerine, 0.1% bromophenol blue), heated briefly to 70~C
and loaded onto the troughs provided in the gel.
Lambda-DNA which has been cut with EcoRI and HindIII

- 42 - 134018~

is loaded separately and serves as a marker for the size of the DNA. Gel electrophoresis is carried out for 24 hours at about 1 V/cm. Then the DNA
is transferred to a nitrocellulose filter using the method of Southern (Schleicher and Schuell, BA85), using 10 x SSC (1 x SSC: 150 mM trisodium citrate, 15 mM NaCl, pH=7.0). After the filter has been dried at ambient temperature it is heated for 2 hours to 80~C in order to bind the DNA to it.

d) Hybridisation probe 20 ug of the plasmid P9A2 are cut with AvaII, thereby generating a fragment approximately 1100 bp long which contains the entire cDNA insert. This DNA fragment is again cut with Sau3A and AluI and the largest DNA fragment is isolated after agarose gel electrophoresis (see Figure 5b) by electroelution and elutip column chromatography. The resulting DNA (1.5 ~ug) is dissolved in 15 ul of water.
20 ~ug of the plasmid pER33 are cut with HindIII, and this expression plasmid for IFN-~2-Arg (E.
Rastl.-Dworkin et al. Gene 21, 237-248 (1983)) is cut twice. The smaller DNA fragment contains the gene for interferon-~2-Arg and is isolated in the same way as the desired fragment from the cDNA insert of plasmid P9A2.
Both DNA's are nick-translated using the method proposed by P.W.J. Rigby et al. (J. Mol.
Biol. 113, 237-251 (1977)). The nick translation is carried out with 0.2 ug of DNA in a solution of 50 ~1, consisting of 1 x nick buffer (1 x nick buffer: 50 mM Tris/Cl pH=7.2, 10 mM MgSO4, 0.1 mM
DTT, 50 ,ug/ml BSA), 100 ~umol each of dATP, dGTP
and dTTP, 150 uCi ~-32P-dCTP (Amersham, 3000 Ci/mMol) and 5 units of DNA polymerase I (Boehringer-Mannheim, nick translation quality). After 2 hours at 14~C
the reaction is stopped by adding the same amount 13~lol8~

of an EDTA solution (40 mMol) and the unreacted radioactive material is separated off by means of G50 column chromatography in TE buffer. The remaining specific radioactivity is approximately 100 x 106 cpm/,ug DNA.

e) Hybridisation and autoradiography The nitrocellulose filter is cut into two halves. Each half contains an identical set of lanes with Namalwa DNA which have has treated with one of the restriction enzymes mentioned in Example 4a. The filters are pre-hybridised in a solution containing 6 x SSC, 5 x Denhardt's (1 x Denhardt's:
0.02% bovine serum albumin (BSA), 0.02% polyvinyl-pyrrolidone (PVP), 0.02% Ficoll 400), 0.5% SDS,0.1 mg/ml of denatured calf thymus DNA and 10 mM
EDTA for 2 hours at 65~C. Hybridisation is carried out in a solution containing 6 x SSC, 5 x Denhardt's, 10 mM EDTA, 0.5% SDS and approximately 10 x 106 cpm of nick translated DNA for 16 hours at 65~C. One half of the filter is hybridised with interferon-o2-Arg-DNA and the other half with interferon-DNA
which has been isolated from the plasmid P9A2.
After hybridisation, both filters are washed at ambient temperature, four times with a solution consisting of 2 x SSC and 0.1% SDS and twice at 65~C for 45 minutes with a solution consisting of 0.2 x SSC and 0.01% SDS. The filters are then dried and exposed to a Kodak X-Omat S film.
Example 5 Preparation of the expression plasmids pRHW 12 and pRHW 11 Preliminary comment:
The preparation of the expression plasmids is illustrated in Figure 6 (not to scale), and also all the restriction enzyme digestions are carried out in accordance with the instructions of the enzyme manufacturers.

a) Preparation of the plasmid pRHW 10 100 lug of the plasmid P9A2 are digested with 100 units of the restriction endonuclease AvaII
(New England Biolabs). After digestion, the enzyme is deactivated by heating to 70~C and the fragments obtained are fractionated on a 1.4% agarose gel with TBE buffer (TBE buffer: 10.8 9/1 Tris base, 5.5 9/1 boric acid, 0.93 9/1 EDTA) according to their size. The band which contains the entire cDNA insert is electroeluted and purified using an elutip column (Schleicher & Schuell). Of the 20 ~9 obtained, 6 ~9 are further digested with the restriction endonuclease Sau3a (20 units in a total of 100 ~1 of solution). The fragments 15 -are separated using 2% agarose gel in TBE buffer.
After staining with ethidium bromide (EtBr) the DNA fragment 189 bp long is electroeluted and purified as described above (= fragment b in Figure 6).
In order to link the interferon gene with a promoter, a ribosomal binding site and a starting codon, the corresponding DNA fragment is isolated from the expression plasmid pER 33 (E. Rastl-Dworkin et al., Gene 21, 237-248 (1983)). For this purpose 50 ug of pER 33 are digested twice with the restriction enzymes EcoRI and PvuII and the resulting fragments are fractionated according to their size on a 1.4%
agarose gel in TBE buffer. The DNA fragment which is 389 bp long and contains the trp promotor, the ribosomal binding site and the starting codon, is electroeluted and purified using an elutip column.
The fragment thus obtained is then digested with Sau3A and the desired fragment 108 bp is obtained by agarose gel electrophoresis, electroelution and elutip column purification in a yield of approx-imately 100 ng (= fragment c in Figure 6).
20 ng of fragment (b) are ligated with 20 ngof fragment c in a volume of 40 lul using 10 units of T4 ligase in a solution containing 50 mM Tris/Cl _ 45 _ 1 3~ 01 8 pH=7.5, 10 mM MgC12, 1 mM DTT and 1 mM ATP, at 14~C for 18 hours. The enzyme is then destroyed by heating to 70~C and the resulting DNA is cut with HindIII in a total volume of 50 lul.
S 10 ~9 of the expression plasmid pER 103 (E.
Rastl-Dworkin et al., Gene 21, 237-248 (1983)) is linearised with HindIII in a total volume of 100 ~1. After 2 hours at 37~C 1 volume of 2 x phos-phatase buffer (20 mM Tris/Cl pH=9.2, 0.2 mM EDTA) together with one unit of calves intestine phosphatase ~CIP) are added. After 30 minutes at 45~C, a further unit of CIP is added and the incubation is continued for 30 minutes. The DNA thus obtained is purified by extracting twice with phenol, once with chloroform and precipitating by the addition of 0.3 M sodium acetate (pH=5.5) and 2.5 vol ethanol. It is then dephosphorylated in order to prevent religation of the vector during the next ligation step.
100 ng of the linearised pER 103 and the ligated fragment (b) and (c) (after HindIII digestion) are added to a solution of 100 ,ul which contains ligase buffer and ligated using T4-DNA ligase for 18 hours at 14~C.
200 ~1 of competent E. coli HB 101 (E. Dworkin et al., Dev. Biol. 76, 435-448 (1980)) are mixed with 20 ~1 of the ligation mixture and incubated for 45 minutes on ice. Then the uptake of DNA
is brought about by a heat shock for 2 minutes at 40~C. The cell suspension is incubated for a further 10 minutes on ice and finally applied to LB agar (10 9/1 trypton, 5 9/1 yeast extract, 5 9/l NaCl, 1.5% agar), containing 50 mg/l ampicillin.
The plasmids from the 24 resulting colonies obtained are isolated using the method of Birnboim and Doly (see Nucl. Acid. Res. 7, 1513-1523 (1979)). After diqestion with various restriction enzymes one plasmid has the desired structure. This is designated pRHW 10 (see Figure 6).

1~0184 b) Preparation of the plasmid pRHW 12 About 10 ~ug of the plasmid pRHW 10 are cut with BamHI. Then the Klenow fragment of DNA polymerase I and the 4 deoxynucleoside triphosphates are added and incubated for 20 minutes at ambient temperature.
The linear blunt-ended plasmid fragment obtained is purified by phenol extraction and precipitation and then cut with the restriction endonuclease NcoI in a volume of 100 ,ul. The larger fragment is obtained by agarose gel electrophoresis, electro-elution and elutip purification. Fragment (a) (see Figure 6) is obtained by digestion of 4 ~ug of AvaII fragment which contains the P9A2-cDNA
insert (see above) with NcoI and AluI, thereby obtaining about 2 ,ug of fragment (a).
In the final ligation step, fragment (a) and the pRHW 10 added thereto, which has twice been digested with BamHI/NcoI, is ligated in a volume of 10 lul, using 10 ng of each DNA. Ligation of a filled in BamHI site to a DNA cut by AluI
restores a BamHI recognition site. Competent E.
coli HB 101 are transformed with the resulting ligation mixture as described above. Of the 40 colonies obtained, one is selected; this is designated pRHW 12.
The plasmid is isolated and the EcoRI/BamHI
insert is sequenced using the method of Sanger (F. Sanger et al., Proc. Nat. Acad. Sci 74, 5463-5467 (1979)). This has the expected sequence.
c) Preparation of the plasmid pRHW 11 This is carried out analogously to Example 5b. 1 ug of the plasmid pRHW 10 is digested with BamHI. The sticky ends of the resulting DNA are converted to blunt ends using the Klenow fragment of DNA polymerase I and the 4 deoxynucleoside triphos-phates and then the linearised DNA is cut with NcoI. The larger fragment is obtained by agarose _ . . . ~ . .

13~018~

gel electrophoresis, electroelution and elutip column chromatography.
The NcoI-AluI fragment is isolated from the clone E76E9 analogously to Example 5b. Then 10 ng of the vector part is ligated with 10 ng of the cDNA part in a volume of 10 ~1 under suitable conditions using 1 unit of T4 ligase. After transformation of the resulting DNA mixture in E. coli HB 101 and selection of the 45 resulting colonies on LB
plates containing ampicillin, a clone is selected, which is designated pRHW 11. After the corresponding clone has been cultivated, the plasmid DNA is isolated.
Its structure is proved by the presence of several specific restriction endonuclease cutting sites (AluI, EcoRI, HindIII, NcoI, PstI).

d) Expression of interferon activity by E. coli HB 101 containing the plasmid pRHW 12 100 ml of the bacterial culture are incubated up to an optical density of 0.6 at 600 nm in M9 minimal medium which contains all the amino acids with the exception of tryptophan (20 ~g/ml per amino acid), 1 ~ug/ml of thiamine, 0.2% glucose and 20 lug/ml of indol-(3)-acrylic acid (IAA), the inductor of the tryphtophan operon. Then the bacteria are pelleted by centrifuging (10 minutes at 7000 rpm), washed once with 50 mM Tris/Cl pH=8, 30 mM NaCl and finally suspended in 1.5 ml of the same buffer.
After 30 minutes incubation with 1 mg/ml of lysozyme on ice the bacteria are frozen and thawed five times. The cell debris are eliminated by centrifuging for 1 hour at 40,000 rpm. The supernatant is filtered sterile and tested for interferon activity in a plaque reduction assay using human A549 cells and encephalo-myocarditis virus.
Result: 1 litre of the bacterial culture produced contains 1 x 106 international units of interferon (A. Billiau, Antiviral Res. 4, 75-98 (1984)).

~ , . .. _ . . .. .. ,, ~, - 48 - 134018~
Example 6 Summary of the differences between the amino acid and nucleotide sequences of Type I interferons a) Comparison of the amino acid sequences A pairwise comparison of amino acid sequences is obtained by aligning the first cysteine residue of mature o-interferon with the first cysteine residue of the amino acid sequences which are coded for by the cDNA inserts of the plasmids P9A2 and E76E9. The two sequences are shown in Figure 7 as IFN-omega, since no differences could be detected between the specific sequences of the P9A2 or E76E9 clones in the values obtained. The only correction made was the insertion of a gap at position 45 of the interferon-oA, which was counted as mismatch.
If the sequence of the omega-interferon is a partner, the comparison is carried out taking into account the usual 166 amino acids. This value is shown in Figure 7 together with the additional 6 amino acids coded for by the clones P9A2 and E76E9.
The percentage differences are obtained by dividing the differences by the number 1.66. An additional amino acid thus represents a percentage of 0.6.
This gives 3.6% for the 6 additional amino acids of IFN-omega which are already contained in the percentage.
The comparisons with ~-interferon are carried out by aligning the 3rd amino acid of the mature ~-interferon with the first amino acid of the mature a-interferon or the first cysteine which is coded for by the plasmids P9A2 and E76E9. The longest comparison structure of an o-interferon with ~-interferon is thus over 162 amino acids, which gives 2 additional amino acids each for the o-interferon and ~-interferon. These are counted as errors and are shown separately in Figure 7 but they are included in the percentage. The listing of ~-interferon with the amino acid sequences of the clones P9A2 .. ~ . .. . . . ......

or E76E9 is carried out in the same way. However, this gives a total of 10 additional amino acids.

b) Comparison of the nucleotide sequences The sequences which are to be compared are listed analogously to Example 6a. The first nucleotide of the DNA of the mature o-interferon is the first nucleotide of the triplet of mature o-interferon coding for cysteine. The first nucleotide from the DNA of the plasmids P9A2 or E76E9 is also the first nucleotide of the codon for cysteine-l.
The first nucleotide from the DNA of ~-interferon is the first nucleotide of the third triplet.
The comparison is made over a total of 498 nucleotides if the individual DNAs of the o-interferons are compared with the DNA of ~-interferon, and over 516 nucleotides if the DNA sequences of the individual o-interferons or of the ~-interferon are compared with those of the plasmids P9A2 and E76E9. The absolute number of gaps is given in the left-hand part of the Table in Figure 7 and then the correspon-ding percentages are given in brackets.

Example 7 Virus-inducible expression of omega-l-mRNA in Namalwa cells and NC37 cells a) Synthesis of a specific hybridisation probe for omega-l mRNA
10 pMol of the oligonucleotide d(TGCAGGGCTGCTAA) are mixed with 12 pMol of gamma-32P-ATP (specific activity: ~ 5000 Ci/mMol) and 10 units of polynucleotide kinase in a total volume of 10 ~ul (70 mM Tris/Cl pH = 7.6, 10 mM MgC12, 50 mM DTT) and left to stand for one hour at 37~C. The reaction is then stopped by heating to 70~C for 10 minutes. The resulting radioactively labelled oligonucleotide is hybridised with 5 pMol of M13pRHW 12 ssDNA (see Figure 9) in a total volume of 35 ~ul (100 mM NaCl) by standing for one hour at 50~C.

. ~ .

After cooling to ambient temperature, nick translation buffer, the 4 deoxynucleoside triphosphates and 10 units of Klenow polymerase are added to give a total volume of 50 ~1 (50 mM Tris/Cl pH
= 7.2, 10 mM MgC12, 50 ~g/ml BSA, 1 mM per nucleotide).
Polymerisation is carried out at ambient temperature for one hour and stopped by heating to 70~C for 5 minutes.
During the reaction, a partially double-stranded circular DNA is obtained. This is then cut in a total volume of 500 ~1 with 25 units of AvaII, using the buffer described by the manufacturer.
The double stranded regions are cut to uniform sizes. The reaction is then stopped by heating to 70~C for 5 minutes.

b) Preparation of RNA from virus-infected cells 100 x 106 cells (0.5 x 106/ml) are treated with 100 uMol of dexamethasone for 48 to 72 hours - the control contains no dexamethasone. To induce interferon, the cells are suspended in serum-free medium in a concentration of 5 x 106/ml and infected with 21~ units/ml of Sendai virus. Aliquot parts of the cell culture supernatants are tested for IFN activity in a plaque reduction assay (Example 5d). The cells are harvested 6 hours after the virus infection by centrifuging (1000 9, 10 minutes), washed in 50 ml of NP40 buffer (Example 4a), resuspended in 9.5 ml of ice cold NP40 buffer and lysed by the addition of 0.5 ml of 10% NP40 for 5 minutes on ice. After the nuclei have been removed by centrifuging (1000 x 9, 10 minutes) the supernatant is adjusted to pH=8 with 50 mM Tris/Cl, 0.5% sarcosine and 5 mM EDTA and then stored at -20~C. In order to isolate the total RNA from the supernatant, it is extracted once with phenol, once with phenol/chloro-form/isoamyl alcohol and once with chloroform/isoamyl alcohol. The aqueous phase is layered on top of 134~181 - -a 4 ml 5.7 molar CsCl cushion and centrifuged in an SW40 rotor (35 krpm, 20 hours) in order to free the extract from DNA and remaining proteins. The resulting RNA pellet is resuspended in 2 ml of TE, pH=8.0, and precipitated with ethanol. The RNA precipitated is then dissolved in water at a concentration of 5 mg/ml.

c) Detection of interferon-omega mRNA
0.2 ,ul of the hybridisation probe prepared in Example 7(a) are precipitated together with 20-50 ,ug of the RNA prepared according to Example 7(b) by the addition of ethanol. As a control, transfer RNA (tRNA) or RNA originating from E. coli transformed with the plasmid pRHW 12 (Example 5) is added instead of cellular RNA.
The resulting pellets are washed free from salt with 70% ethanol, dried and dissolved in 25 ul of 80%
formamide (100 mM PIPES pH=6.8, 400 mM NaCl, 10 mM
EDTA). Then the samples are heated to 100~C for 5 minutes in order to denature the hybridisation sample, adjusted directly to 52~C and incubated for 24 hours at this temperature. After hybridisation, the samples are placed on ice and 475 ~ul of Sl reaction mixture (4 mM Zn(Ac)2, 30 mM NaAc, 250 mM
NaCl, 5% glycerine, 20 ug ss calf thymus DNA, 100 units Sl nuclease) are added. After digestion at 37~C for 1 hour the reaction is stopped by ethanol precipitation.
The pellets are dissolved in 6 ,ul formamide buffer and separated essentially like samples from DNA sequencing reactions on a 6% acrylamide gel containing 8 M urea (F. Sanger et al., Proc. Nat.
Acad. Sci. 74, 5463-5467 (1979)).
For autoradiography, the dried gel is exposed to a DuPont Cronex~X-ray film using the Kodak Lanex~
regular intensifying screen at -70~C.

?~ ~r~G~e ~k Legend relating to Figure 10 Lanes A to C represent the controls.
Lane A: 20 ~ug tRNA
Lane B: 10 ~9 RNA from pER33 (E. coli - expression strain for interferon-o2-Arg) Lane C: 1 ng RNA from pRHW12 (E. coli expression strain for interferon-omega 1) Lane D: 50 ~ug RNA from untreated Namalwa cells Lane E: 50 ,ug RNA from virus-infected Namalwa cells Lane F: 50 ~9 RNA from Namalwa cells pretreated with dexamethasone and infected with virus Lane G: 20 ,ug of RNA from untreated NC 37 cells.
Lane H: 20 ~9 RNA from virus-infected NC 37 cells Lane I: 20 ug RNA from NC 37 cells pretreated with dexamethasone and infected with virus Lane M: Size marking (pBR322 cut with HinfI).
Lanes B and C show that the expected signal can only be detected when an omegal-specific RNA is among the RNA molecules. They also show that even a large excess of the wrong RNA does not cause a background signal (see lane B). Furthermore, the tRNA used as a hybridisation partner does not produce a signal either (see lane A).
Lanes G to I show the induction of the omegal-specific RNA in virus-infected NC 37 cells. The pretreatment with dexamethasone enhances this effect:.
Lanes D to F show that fundamentally the same result is obtained with Namalwa cells as with NC37 cells. However, the induction of omegal-specific RNA is not as great as in NC 37 cells. This result is parallel to the interferon titres which were measured in the corresponding cell supernatants.
This behaviour of interferon-omegal gene expression is thus as would be expected from an interferon Type I gene.

134018~L

Example 8 Isolation of the gene coding for IFN-omegal or genes related thereto:
a) Cosmid screening A human cosmid bank (human DNA (male) cloned in the cosmid vector pcos2 EMBL (A. Ponstka, H.-R.
Rockwitz, A.-M. Frischauf, B. Hohn, H. Lehrach Proc. Natl. Acad. Sci. 81, 4129-4133 (1984)) with a complexity of 2 x 106) was screened for the IFN-omega gene or related genes. E. coli DHl (rK-, mK+, rec.A; gyrA96, sup.E) was used as the host.
First of all, Mg + cells ("plating bacteria") were prepared. E. coli DHl grows overnight in L broth (10 9/1 trypton, 5 9/1 yeast extract, 5 9/1 NaCl) supplemented with 0.2% maltose. The bacteria are removed by centrifuging and taken up in a 10 mm MgS04 solution to give an optical density600 =
2. 5 ml of this cell suspension are incubated with 12.5 x 106 colony forming units of packed cosmids for 20 minutes at 37~C. Then 10 vol of LB are added and the suspension is kept at 37~C
for one hour for the purpose of expression of the kanamycin resistance coded for by the cosmid.
The bacteria are then removed by centrifuging, resuspended in 5 ml of LB and spread over nitrocellu-lose filter in 200 ul aliquots (BA85, Schleicher and SchUll, 132 mm diameter) placed on LB agar (1.5% agar in L broth) plus 30 ug/ml kanamycin.
About 10,000 to 20,000 colonies grow on each filter.
The colonies are replica-plated on further nitro-cellulose filters which are kept at 4~C.
A set of the colony filters is processed as described in Example lc), i.e. the bacteria are denatured, and the single strand DNA is fixed to the nitrocellulose. The filters are washed for 4 hours at 65~C in a 50 mM Tris/HCl, pH=8.0, 1 M NaCl, 1 mM EDTA, 0.1% SDS solution. The filters are then incubated at 65~C for 2 hours in a 5 x Denhardt's .. .... .. ...

13~018~

(see Example lc), 6 x SSC, 0.1% SDS solution and hybridised with about 50 x 106 cpm of nick-translated denatured IFN-omegal DNA (HindIII-BamHI insert of the clone pRHW12, see Figure 6) for 24 hours at 65~C in the same solution. After hybridisation, the filters are washed first 3 x 10 minutes at ambient temperature in a 2 x SSC, 0.01% SDS solution and then 3 x 45 minutes at 65~C in a 0.2 x SSC, 0.01% SDS solution. The filters are dried and exposed to Kodak X-Omat S film using an intensifier film at -70~C. Positively reacting colonies are localised on the replica filters, scratched off and resuspended in L broth + kanamycin (30 ,ug/ml).
Of this suspension, a few ul are spread out on LB agar + 30 ~ug/ml kanamycin. The resulting colonies are replica-plated on nitrocellulose filters.
These filters are hybridised with 32P-labelled IFN-omegal-DNA as described above. From each hybridi-sing colony, the cosmid is isolated using the method described by Birnboim & Doly (Nucl. Acids Res.
7, 1513 (1979)). With this cosmid DNA preparation, E. coli DHl was transformed and the transformants were selected on LB agar + 30 ,ug/ml kanamycin.
The transformants were again tested with 32P-radio-actively labelled IFN-omegal DNA for positively reacting clones. One clone in each case starting from the original material isolated is selected and the cosmid thereof is produced on a larger scale (Clewell, D.B. and Helinski, D.R., Biochemistry 9, 4428 (1970)). Three of the isolated cosmids are designated cos9, coslO and cosB.

b) Sub-cloning of hybridising fragments in PUC8 1 ~9 of cosmids cos9, coslO and cosB were cut with HindIII under the conditions recommended by the manufacturer (New England Biolabs). The fragments are separated on 1% agarose gels in TBE
buffer by electrophoresis and transferred to nitro-134018'i cellulose filters according to Southern (Example 4c). The two filters are hybridised with nick-translated IFN-omegal DNA as described in Example 4d, and washed and exposed. About 20 ~ug of each cosmid are cut with HindIII and the fragments formecl are separated by gel electrophoresis. The fragments hybridising with IFN-omegal-DNA in the preliminary tests are electroeluted and purified via elutip columns (Schleicher & Schuell). These fragments are ligated with HindIII-linearised dephosphorylated pUC8 (Messing, J., Vieira, J., Gene 19, 269-276 (1982)) and E. coli JM101 (supE, thi, (lac-proAB), [F', traD36, pro AB, lac q Z M15] (e.g. P.L. Biochemicals) is transformed with the ligase reaction solution.
The bacteria are spread on LB agar containing 50 ugJml of ampicillin, 250 ug/ml of 5-bromo-4-chloro-3-indolyl-~-D-galactopyranoside (BCIG, Sigma) and 250 ug/ml of isopropyl-~-D-thiogalacto-pyranoside (IPTG, Sigma). A blue colour of the resulting colonies indicates the absence of an insert in pUC8. The plasmid DNAs were isolated on a small scale from some white clones, then cut with HindIII
and separated on 1% agarose gels. The DNA fragments were transferred to nitrocellulose filters and hybridised with 32P-IFN-omegal-DNA as above. Starting from cos9 and coslO, a subclone was selected in each case. These clones have been designated pRHW22 and pRH57. From cosB, two DNA fragments which hybridise well with the IFN-omegal DNA probe were subcloned. The resulting clones have been designated pRH51 and pRH52.

c) Sequence analysis The DNA inserted in pUC8 is separated from the vector part by cutting with HindIII and subsequent gel electrophoresis. This DNA, about 10 ug, is ligated in 50 yl of reaction solution using T4 DNA ligase, the volume is adjusted to 350 ~ul with . .

nick translation buffer (Example 4d) and then decom-posed using ultrasound, whilst cooling with ice (MSE 100 Watt ultrasonic disintegrator, maximum output at 20 kHz, five times 30 seconds). Then the ends of the fragments are repaired by adding 1/100 vol of 0.5 mM dATP, dGTP, dCTP and dTTP and 10 units of Klenow fragment of the DNA polymerase I for 2 hours at 14~C. The resulting DNA fragments having blunt ends are separated according to their size on a 1% agarose gel. Fragments of sizes between 500 and 1000 bp were isolated and subcloned in the dephosphorylated phage vector M13 mp8 cut with SmaI. The single strand DNA of recombinant phages is isolated and sequenced using the method developed by Sanger (Sanger, F. et al., Proc. Natl. Acad.
Sci 74, 5463-5467 (1976)). The individual sequences are put together to form the total sequence by means of computers (Staden, R., Nucl. Acids Res.
10, 4731-4751 (1982)).
d) Sequence of the subclone pRH57 (IFN-omegal) The sequence is shown in Figure 11. This fragment which is 1933 bp long contains the gene for interferon-omegal. The region coding for protein comprises the nucleotides 576 to 1163. The sequence is totally identical to that of the cDNA insert of clone P9A2. The nucleotide portion 576 to 674 codes for a signal peptide of 23 amino acids.
The TATA box is at a distance characteristic of interferon Type I genes in front of the starting codon ATG (positions 476-482). The gene has a number of signal sequences for polyadenylation during transcription (ATTAAA at positions 1497-1502, or 1764-1796; AATAAA at positions 1729-1734 or 1798-1803), the first of which is present in the clone P9A2.

134018~

e) Sequence of the subclone pRHW22 (IFN-pseudo-omega2) Figure 12 shows the sequence, 2132 bp long, of the HindIII fragment from the cosmid cos9 which hybridises with the IFN-omegal-DNA probe. An open reading frame exists from nucleotide 905 to nucleotide 1366. The amino acid sequence derived therefrom is shown. The first 23 amino acids are similar to those of the signal peptide of a typical Type I interferon. The following 131 amino acids show a similarity to interferon omegal, up to amino acid 65, whilst tyrosine is notable as the first amino acid of the mature protein.
Following amino acid position 66 is the sequence of a potential N-glycosylation site (Asn-Phe-Ser).
From this point onwards the amino acid sequence is different from that of a Type I interferon.
However, it can be demonstrated that similarity to IFN-omegal can be established by suitable insertions and the resulting displacement of the protein reading frame (see Example 9). Thus, from the standpoint of Type I interferons, the isolated gene is a pseudogene:
IFN-pseudo-omega2.

f) Sequence of the subclone pRH51 (IFN-pseudo-omega3) The HindIII fragment originating from cosmid B and about 3500 bp long which hybridises with the IFN-omegal DNA probe is partially sequenced (Figure 13). An open reading frame is obtained from nucleotide position 92 to 394. The first 23 amino acids display the features of a signal peptide. The subsequent sequence starts with tryptophan and shows similarity to IFN-omegal up to amino acid 42. Thereafter, the derived sequence is different from IFN-omegal and ends after amino acid 78.
The sequence can be altered by insertions so that it is then greatly homologous to IFN-omegal (Example 9). The gene is designated IFN-pseudo-omega3.

134018~

g) Sequence of the insert of pRH52 (IFN-pseudo-omega4) The sequence of the HindIII fragment which is 3659 bp long, is isolated from cosmid B and which hybridises with IFN-omegal-DNA, is shown in Figure 14. An open reading frame, the translation product of which is partially homologous to IFN-omegal, is located between nucleotide positions 2951 and 3250. After a signal peptide of 23 amino acids, the further amino acid sequence begins with phenylalanine. Homology to IFN-omegal is interrupted only after the 16th amino acid, continues at the 22nd amino acid and ends at the 41st amino acid.
Translation would be possible up to amino acid 77. Analogously to Example 8e) and 8f), good homology can be established with IFN-omegal by the introduction of insertions (Example 9). The pseudo gene isolated here is designated IFN-pseudo-omega4.

Example 9 Evaluation of the genes for 4 members of the IFN-omega family Figure 15 is a listing of the genes for IFN-omegal to IFN-pseudo-omega4 together with the amino acid translation. To establish better analogy, gaps are inserted in the individual genes which are indicated by dots. No bases are omitted.
The numbering of the bases includes the gaps.
The amino acid translation of IFN-omegal is retained (e.g. at positions 352-355: "C.AC" codes for His).
In the case of the pseudo genes, translation into an amino acid is given only where this is unambigiously possible. This list immediately shows that the 4 isolated genes are related to one another. Thus, for example, the potential N-glycosylation site (nucleotide positions 301 to 309) is obtained in all 4 genes.

,.. ~ . . _ . . .

Similarly, apart from the case of IFN-pseudo-omega4, at nucleotide positions 611 to 614, there is a triplet which represents a stop codon and which, in the case of IFN-omegal, terminates a mature protein with a length of 172 amino acids. There are premature stop codons in IFN-pseudo-omega2 (nucleotide positions 497 to 499) and in IFN-pseudo-omega4 (nucleotide positions 512 to 514) using this arrangement.
The degree of relationship between the genes or the amino acid translations can be calculated from the arrangement shown in Figure 15. Figure 16 shows the DNA homologies between the members of the IFN-omega gene family. In the comparison in pairs, those positions where one of the two 15 -partners or both partners have a gap are not included in the counting. The comparison gives a homology of about 85% between IFN-omegal-DNA and the sequences of the pseudo genes. IFN-pseudo-omega2-DNA is about 82% homologous to the DNAs of IFN-pseudo-omega3 and IFN-pseudo-omega4. Figure 17 shows the results of comparisons of the signal sequences and Figure 18 shows the results of the comparisons of the "mature" proteins. The latter vary between 72 and 88%. However, this homology is substantially greater than that between IFN-omegal and the o-IFNs and ~-IFN (Example 6). The fact that the individual members of the IFN-omega family are more distant from one another than the members of the o-IFN
family can be explained by the fact that three of the four isolated IFN-omega-genes are pseudo genes and are not subject to the same selection pressure as functional genes.

, - 60 - 13 g0 184 Example 10 Fermentation Strain storage:
A single colony of the strain E. coli HB101/pRHW12 on LB-agar (25 mg/l ampicillin) is inoculated into trypton-soya-broth (OXOID CM129) containing 25 mg/l ampicillin and incubated at 37~C by shaking at 250 RPM until an optical density at 546 nm of about 5 is reached (log-phase). 10% (W/V) of sterile glycerol are added to the culture, which is then placed in sterile ampoules in 1.5 ml portions and frozen at -70~C.

Inoculum stage:
The medium contains 15 g/l Na2HPO4. 12H2O;
0.5 g/l NaCl; 1.0 g/l NH4Cl; 3.0 g/l KH2PO4; 0.25 g/l MgSO4. 7H2O; 0.011 g/l CaC12; 5 g/l casamino acid (Merck 2238); 6.6 g/l glucose-monohydrate; 0.1 g/l ampicillin; 20 mg/l cysteine and 1 mg/l thiamine-hydrochloride. Each of 4 1000 ml Erlenmeyer flasks containing 200 ml of this medium is inoculated with 1 ml of a thawed culture of HB101/pRHW12 and incubated by shaking at 250 RPM at 37~C for 16 to 18 hours.
Production stage:
The medium consists of 10 g/l (NH4)2HPO4;
4.6 g/l K2HPO4.3H2O; 0.5 g/l NaCl; 0.25 g/l MgSO4.7H2O;
0.011 g/l CaC12; 11 g/l glucose-monohydrate; 21 g/l casamino acids (Merck 2238); 20 mg/l cysteine, 1 mg/l thiamine-hydrochloride and 20 mg/l 3-~-indoleacrylic acid. 8 litres of a sterile medium in a 14 1 fermentor (height:radius = 3:1) are inoculated with 800 ml of said cultures. The fermentation runs at 28~C, 1000 RPM of agitation (effigas-turbine), an aeration rate of 1 vvm (volume/volume/minute) and an initial pH of 6.9. During fermentation, the pH decreases to 6.0 and is then regulated automatically at this 134018~

level by 3N NaOH. After the optical density at 546 nm has reached 18 to 20 (usually after 8.5 to 9.5 hours of fermentation) the culture is cooled to 20~C under aeration and agitation and then brought to pH = 2.2 by addition of 6N H2SO4 without aeration. After one hour of agitation at 800 rpm and 20~C, the resulting biomass is centrifuged in a CEPA
laboratory centrifuge type GLE at 30,000 rpm. The cell paste is frozen and stored at -20~C.
Example 11 Purification of omeqa (Gly)-interferon a) Partial purification All steps are performed at 4~C.
140 g of biomass (E. coli HB101 transformed with the expression plasmid pRHW12) are resuspended in 1150 ml of precooled 1~ acetic acid and stirred for 30 minutes. The pH
of the suspension is shifted to 10.0 by the addition of 5 M
NaOH. The suspension is stirred for another two hours. The pH is then readjusted to 7.5 using 5 M HCl and the stirring continued for a further 15 minutes. The suspension is centrifuged at 4~C for 1 hour at 10,000 rpm (J21 centrifuge (Beckman*) JA10-rotor).
The clear supernatant is applied to a 150 ml CPG
controlled pore glass-column (CPG 10-350, mesh size 120/200) at a flow rate of 50 ml/hour. The column is washed using 1 1 25 mM Tris pH = 7.5/lM NaCl and the bound material is eluted * Trade-mark .X

.. . ... .. ..... ..

13~018~
- 61a - ~
with a solution containing 25 mM Tris pH = 7.5/lM KCNS/50 ethyleneglycol at a flow rate of 50 ml/hour.
The interferon activity containing fractions are pooled and dialysed over night against about 100 vol. of 0.1 M
Na-phosphate/10% polyethyleneglycol 40,000. The resulting precipitate is removed by centrifugation at 4~C for 1 hour at 10,000 rpm (J21 centrifuge, ~A20 rotor) [See Table 1 below].

,~
~. ~
,. ~

, ... .~____ 13~018~

b) Further purification The dialysed and concentrated CPG-eluate is diluted with 5 vol of buffer A (O.lM Na-phosphate pH = 6.25/25% 1,2-propyleneglycol). The solution is applied to a MonoS* 5/5 (Pharmacia, cation exchange) column equilibrated with buffer A
using a "superloop" (Pharmacia). Elution is carried out using a linear gradient from 0 to lM NaCl in buffer A in a total of 20 ml at a flow rate of 0.5 ml/hour. The flow through and the 1 ml fractions are collected and tested for interferon activity by means of a plaque reduction assay using human A549 cells and EMC-virus. The active fractions are pooled.

Table 1 volume Biological test protein total u/mg yield (ml) (u/ml *) U total (mg/ml) (mg) start 1150 15000 17.3x106 3.6 4140 4180 100%
ft 2200 <600 <1.3x106 0.74 1628 <600 < 5%

eluate 124.3 170000 21.0x105 16.8 2088 10000 121%
after dia- 41 300000 12.3x106 12.6 516.6 23800 71%
lysis * Plaque-reduction assay: A549 cells, EMC-virus ft flow through U: units using interferon-~2 as a standard * Trade-mark ; _ -63 - 134018~
Example 12 Characterisation of HuIFN-omegal A. Antiviral activity on human cells B. Antiviral activity on monkey cells C. Antiproliferative activity on human Burkitt's lymphoma cells (Cell line: Daudi) D. Antiproliferative activity on human cervical carcinoma cells (cell line: Hela) and synergism with HuIFN-gamma and human tumour necrosis factor E. Stability at low pH
F. Serological characterisation.

A. Antiviral activity on human cells Assay cell line: Human lung carcinoma cells - A549 (ATCC CCL 185) Challenge virus: Murine encephalomyocarditis virus (EMCV) Assay method: Inhibition of cytopathic effect A partially purified preparation of HuIFN-omegal with a protein content of 9.4 mg/ml was diluted in cell culture medium and applied to the assay plates. The preparation showed an antiviral effect with a specific activity of 8300 Iu/mg relative to the reference standard preparation Go-23-901-527 (National Institutes of Health, Bethesda, Maryland, USA).

B. Antiviral activity on monkey cells 30 Assay cell line: GL-V3 vervet monkey kidney cells (Christofinis G.J., J. Med. Microbiol. 3, 351-258;
1970)-Challenge virus: vesicular stomatitis virus (VSV) Assay method: Plaque reduction A partially purified preparation of HuIFN-omegal (see Example 12A) was diluted in culture 134018~

medium and applied to the assay cells. The preparation showed a specific activity of 580 units/mg.

C. Antiproliferative activity on human Burkitt's lympnoma cells (Cell line: Daudi) The human Burkitt's lymphoma cell line Daudi was grown in the presence of various concentrations of HuIFN-omegal (see Example 12A). Cultures were started at 100,000 cells/ml; cell densities were determined after 2, 4 and 6 days in culture (37~C).
Untreated cultures served as controls. All cultures were run in triplicate. Figure 19 shows the results of the experiment. Cell proliferation was partially and transiently inhibited at 10 lU/ml, and was ~strongly inhibited at 100 lU/ml.
The following symobols are used in Figure 19:
O control, ~ lIu/ml, ~ 10 Iu/ml, ~ 100 IU/ml.

D. Antiproliferative activity on human cervical carcinoma cells (cell line: Hela) The human cervical carcinoma cell line HeLa was grown in the presence of one of the following proteins or a mixture of two of the following proteins:
HuIFN-omegal (see Example 12A) at 100 IU/ml.
HuIFN-gamma (see Example 12A) at 100 IU/ml.
Human tumour necrosis factor (HuTNF), 98% pure, prepared by Genentech Inc., San Francisco, USA (see Pennica D. et al., Nature 312, 712-729, 1984) at 100 ng/ml.
All binary combinations of the mentioned proteins had the same concentrations as above.
In each case, 2 cultures were started at 50,000 cells/3 cm petri dish and incubated for 6 days at 37~C; thereafter cell densities were determined.
HuIFN-omegal and HuTNF had only a weak influence on the growth of the cells, whereas HuIFN-gamma ... ~ ~ .. .

- 65 - 1 34 ~1 8 showed a clear cytostatic activity. A combination of IFN-gamma with IFN-omegal showed a synergistic cytostatic/cytotoxic activity. The results of this experiment are shown in Figure 20.
In this figure, the following symbols are used:
C untreated control, T HuTNF, O HuIFN-omegal, G HuIFN-gamma.

E. Stability at low pH
A preparation of HuIFN-omegal (see Example 12A) was diluted in cell culture medium RPMI 1640 medium containing 10% fetal calf serum) and adjusted to pH 2 with hydrochloric acid. Following incubation at 4~C for 24 hours, the preparation was neutralized using sodium hydroxide and its antiviral activity titrated as in Example 12A. The preparation showed 75% of the activity of a control incubated at neutral pH; HuIFN-omegal therefore can be regarded as stable at low pH.
F. Serological characterisation To compare the serological properties of HuIFN-omegal and Hu-lFN-~2, samples of both proteins (see Example 12A) were diluted to contain 100 iu/ml, mixed with equal volumes of solutions of various antisera or monoclonal antibodies and incubated for 90 minutes at 37~C. The antiviral activity of these samples was then compared with those of untreated controls. Table 2 shows the results of the experiment. The antiviral activity of HuIFN-omegal was neutralized only by an antiserum to human leukocyte-derived IFN at relatively high concentration, but not by a polyclonal antiserum to HuIFN-~, HuIFN-~2 or various monoclonal antibodies that neutralise HuIFN-~2. HuIFN-omegal is thus serologically unrelated to HuIFN-~2 as well as to HuIFN-~. Symbols used in Table 2: - not tested, 0, no neutralization, + partial neutralization, +++ complete neutralization.

Table 2 AntiserumDilution Neutralization of monoclonal~g/ml antibody HuIFN-~2 HuIFN-omegal EBI_ll) 1 +
1 0 +++
1 0 0 +++

EBI_31) 1 +++
1 0 +++
100 +++
1000 +++ ~

L3B7 ) 100 +++ 0 1000 +++ ~

sheep anti3) leukocyte IFN 1: 50 000 +++
1:5 000 +++ 0 1:500 +++ +
1:50 - +++

rabbit anti HuIFN-~2 1:1 000 +++
1:100 +++ O
1:10 - O

sheep anti4) HuIFN-~ 1:50 - 0 1) EP-A 0.119.476 2) Drug Research 35 364-369 (1985) 3) Research reference reagent catalog no. G-026-502-568 4) Research reference reagent catalog no. G-028-501-568 Research Resources Branch, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland, USA.

Claims (44)

1. A pure form of an omega interferon polypeptide of Type 1 coded for by a cDNA insert of plasmids P9A2 or E76E9 (deposited at the DSM within E. coli HB101 under the numbers DSM 3003 and 3004 respectively), an interferon polypeptide coded for by a sequence which will hybridise with a sequence corresponding to an interferon-coding sequence of plasmid P9A2 or E76E9 or a degenerate variation thereof under stringent hybridisation conditions suitable for detecting about 85% or higher homology, or an N-glycosylated derivative thereof with interferon activity.

2. A pure form of an omega interferon Type 1 polypeptide of 168 to 174 amino acids which has a divergence of 30 to 50%
compared to .alpha.-interferon and a divergence of at least 70% compared to .beta.-interferon, and, if required, further comprising a leader peptide or an N-glycosylated derivative thereof with interferon activity.

3. An interferon polypeptide according to claim 1 having a divergence of 40 to 48% compared to a-interferon or an N-glycosylated derivative thereof with interferon activity.

4. An interferon polypeptide according to claim 1, 2 or 3 comprising 172 amino acids or an N-glycosylated derivative thereof with interferon activity.

67a

5. The interferon polypeptide according to claim 1 designated omega (Gly)-interferon and comprising the amino acid sequence:

Cys Asp Leu Pro Gln Asn His Gly Leu Leu Ser Arg Asn Thr Leu Val Leu Leu His Gln Met Arg Arg Ile Ser Pro Phe Leu Cys Leu Lys Asp Arg Arg Asp Phe Arg Phe Pro Gln Glu Met Val Lys Gly Ser Gln Leu Gln Lys Ala His Val Met Ser Val Leu His Glu Met Leu Gln Gln Ile Phe Ser Leu Phe His Thr Glu Arg Ser Ser Ala Ala Trp Asn Met Thr Leu Leu Asp Gln Leu His Thr Gly Leu His Gln Gln Leu Gln His Leu Glu Thr Cys Leu Leu Gln Val Val Gly Glu Gly Glu Ser Ala Gly Ala Ile Ser Ser Pro Ala Leu Thr Leu Arg Arg Tyr Phe Gln Gly Ile Arg Val Tyr Leu Lys Glu Lys Lys Tyr Ser Asp Cys Ala Trp Glu Val Val Arg Met Glu Ile Met Lys Ser Leu Phe Leu Ser Thr Asn Met Gln Glu Arg Leu Arg Ser Lys Asp Arg Asp Leu Gly Ser Ser a derivative thereof N-glycosylated at amino acid position 78, or degenerate derivative thereof with interferon activity.

6. The interferon polypeptide according to claim 5 designated omega (Glu)-interferon, and comprising the same amino acid sequence as the interferon polypeptide according to claim 5 except that amino acid residue 111 is glutamic acid rather than glycine, a derivative thereof N-glycosylated at amino acid position 78 or degenerate derivative thereof with interferon activity.

7. An interferon polypeptide according to claim 1,2,3,5 or 6 fused to the leader peptide:

Met Ala Leu Leu Phe Pro Leu Leu Ala Ala Leu Val Met Thr Ser Tyr Ser Pro Val Gly Ser Leu Gly.

8. A polydeoxyribonucleotide comprising a coding sequence for an omega-interferon according to claim 1 or comprising a pseudo gene sequence capable of hybridising with a sequence corresponding to said omega interferon-coding sequence under stringent hybridisation conditions suitable for detecting about 85% or higher homology with the chosen interferon coding sequence.

9. A polydeoxyribonucleotide according to claim 8 comprising the omega (Gly)-interferon coding sequence:

, or a coding equivalent thereof.

10. A polydeoxyribonucleotide comprising the coding sequence of claim 9 except that codon 111 is GAG (coding for glutamic acid) rather than GGG (coding for glycine), or a coding equivalent thereof.

11. A polydeoxyribonucleotide according to claim 8, 9 or 10 wherein the omega-interferon coding sequence or pseudo gene sequence is fused with a coding sequence for a leader peptide.

12. A polydeoxyribonucleotide according to claim 8, 9 or 10 comprising an omega (Gly)-interferon coding sequence or an omega (Glu)-interferon coding sequence fused with the nucleotide sequence:
ATG GCC CTC CTG TTC CCT CTA CTG
GCA GCC CTA GTG ATG ACC AGC TAT AGC CCT GTT GGA TCT CTG GGC
which nucleotide sequence codes for a leader peptide.

13. A polydeoxyribonucleotide comprising the omega (Gly)-interferon gene of sequence:

14. A polydeoxyribonucleotide comprising the same gene sequence as in claim 13 except that codon 111 of the omega-interferon coding sequence is GAG rather than GGG.

15. A polydeoxyribonucleotide which comprises the IFN-pseudo-omega2-gene of sequence:

16. A polydeoxyribonucleotide which comprises the IFN-pseudo-omega3-gene of sequence:

17. A polydeoxyribonucleotide which comprises the IFN-pseudo-omega4-gene of sequence:

18. A recombinant DNA molecule comprising a polydeoxyribonucleotide according to claim 8, 9 or 10.

19. A plasmid vector, phage vector or cosmid vector comprising a polydeoxyribonucleotide according to claim 8, 9 or 10.

20. Plasmid P9A2 (deposited in E. coli HB101 at the DSM
under number DSM 3003).

21. Plasmid E76E9, (deposited in E. coli HB101 at the DSM
under number DSM 3004).

22. A cosmid vector selected from the cosmid vectors designated Cos9, Cos10 and CosB, comprising a polydeoxyribonucleotide according to claim 8, 9 or 10.

23. A plasmid selected from the plasmids designated pRH57, pRHW22, pRH51 and pRH52 comprising a polydeoxyribonucleotide according to claim 8, 9 or 10.

24. A recombinant DNA molecule comprising an expression vector suitable for transformation of a microorganism or cells derived from a multicellular organism, said expression vector comprising a coding sequence for an omega interferon or a pseudo gene sequence capable of hybridising with a sequence corresponding to such an omega interferon-coding sequence under stringent hybridisation conditions (suitable for detecting about 85% or higher homology with a chosen interferon coding sequence) at an appropriate site for expression within a desired host.

25. A recombinant DNA molecule according to claim 24 comprising an expression vector suitable for transformation of E. coli.

26. A recombinant DNA molecule according to claim 24 comprising a yeast expression vector.

27. A recombinant DNA molecule according to claim 26 wherein an omega-interferon coding sequence is connected to a portion of the leader sequence of a MF-alpha-1 yeast gene beginning at position 256 from the initiation codon.

28. An expression vector according to claim 24 derived from plasmid pBR322 wherein a shorter EcoR1/BamH1 fragment of plasmid pBR322 is replaced by a polydeoxyribonucleotide comprising the sequence:

Cys Asp TGT GAT C ~ IFN-omega-coding sequence ~
Sau3A

29. pRHW12.

30. pRHW11.

31. A recombinant DNA molecule selected from the group which comprises:

a) pRHW12, b) pRHW11, c) pRH57, d) pRHW22, e) pRH51, f) pRH52, and g) pRHW10.

32. A process for preparing a pRHW12 or pRHW11 expression vector which process comprises:
a) to prepare a pRHW12 expression vector, isolating a NcoI-AluI fragment from the cDNA insert of plasmid P9A2 and ligating it with the larger fragment obtained by cutting the plasmid pRHW10 with BamHI, filling the cutting sites to obtain a linearized blunt-ended form using the Klenow fragment of DNA polymerase 1 and the 4 deoxynucleoside triphosphates and subsequently cutting with NcoI, or, b) to prepare a pRHW11 expression vector, isolating the NcoI-AluI fragment from the cDNA insert of plasmid E76E9 and ligating it with the larger fragment obtained by cutting the plasmid pRHW10 with BamHI, filling the cutting sites to obtain a linearized blunt-ended form using the Klenow fragment of DNA
polymerase 1 and the 4 deoxynucleoside triphosphates and subsequently cutting with NcoI.

33. A process according to claim 32 wherein plasmid pRHW10 is constructed by inserting the DNA fragment:

HindIII Sau3A NcoI
a~AGCTTAAAG ATGTGTGATC TGCCTCAGAA CCATGGCCTA CTTAGCAGGA 50 AGATCACACA TCTTTA~gct t Sau3A HindIII
at the HindIII site of plasmid pER103.

34. A process according to claim 33 wherein the DNA
fragment inserted at the HindIII site of plasmid pER103 is constructed by ligating the following 189bp Sau3A fragment obtainable from the cDNA insert of plasmid P9A2 or plasmid E76E9 Asp Leu Pro Gln Asn His Gly Leu Leu Ser Arg Asn Thr Leu ~GAT CTG CCT CAG AAC CAT GGC CTA CTT AGC AGG AAC ACC TTG 42 Sau3A NcoI

Val Leu Leu His Gln Met Arg Arg Ile Ser Pro Phe Leu Cys Leu Lys Asp Arg Arg Asp Phe Arg Phe Pro Gln Glu Met Val Lys Gly Ser Gln Leu Gln Lys Ala His Val Met Ser Val Leu His Glu Met Leu Gln Gln Ile CTG CAG CA~g atc 189 Sau3A
with the following 108 bp fragment obtainable by digesting the 389 bp EcoR1-PvuII fragment of plasmid pER33 with Sau 3A
EcoRI Sau3A
gaattcacgct~GATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTCGCGA 59 mRNA-Start Met RBS HindIII
Cys Asp TGT~gat c Sau3A
and cutting the resulting fragment with HindIII.

35. A process according to claim 33 wherein the DNA
fragment inserted at the HindIII site of plasmid pER103 is constructed by ligating the following DNA fragment constructed from two synthetic oligonucleotides 5'-AGCTTAAAGATGTGT 3' 3'- ATTTCTACACACTAGp 5' with the 189bp Sau3A fragment obtainable from the cDNA insert of plasmid P9A2 or plasmid E76E9.

36. A process according to claim 32 wherein step a) com-prises (i) digesting pP9A2 with Ava II and isolating a cDNA
fragment, (ii) digesting the cDNA fragment with Sau3a to obtain a 189 bp DNA fragment, (iii) ligating the 189 bp DNA fragment of (ii) with a 108 bp DNA fragment, obtainable by digesting pER33 with EcoRI and PyuII, whereby the thus obtained 389 bp DNA fragment was isolated after further digesting with Sau3a, (iv) treating the product of (iii) with HindIII, (v) ligating the product of (iv) with dephosphorylated pER103, which has previously been lirlearised with HindIII and treated with calves intestine phosphatase, to give pRHW10, (vi) digesting pRHW10 with BamHI and filling the cutting sites using the Klenow fragment of DNA polymerase I to obtain a linearised blunt-ended form, (vii) cutting the product of (vi) with NcoI and isolating the larger fragment, (viii) ligating the product of (vii) with the digesting product of (i) with NcoI
and AluI, and wherein step (b) comprises parts (i) to (viii), whereby in the step (viii) is used as starting plasmid the plasmid E76E9 instead of P9A2.

37. A pure form of a polypeptide having the sequence:
Met Ala Leu Leu Phe Pro Leu Leu Ala Ala Leu Glu Val Cys Ser Cys Gly Ser Ser Gly Ser Leu Gly Tyr Asn Leu Pro Gln Asn His Gly Leu Leu Gly Arg Asn Thr Leu Val Leu Leu Gly Gln Met Arg Arg Ile Ser Pro Phe Leu Cys Leu Lys Asp Arg Ser Asp Phe Arg Phe Pro Gln Glu Lys Val Glu Val Ser Gln Leu Gln Lys Ala Gln Ala Met Ser Phe Leu Tyr Asp Val Leu Gln Gln Val Phe Asn Phe Ser His Lys Ala Leu Leu Cys Cys Met Glu His Asp Leu Pro Gly Pro Thr Pro His Phe Thr Ser Ser Ala Ala Gly Thr Pro Gly Asp Leu Leu Gly Ala Gly Asp Gly Arg Arg Arg Ser Trp Gly Gln Trp Val Ile Glu Gly Ser Thr Leu Ala Leu Arg Arg Tyr Phe Gln Glu Ser Ile Ser Thr

38. A pure form of a polypeptide having the sequence:
Met Val Leu Leu Leu Pro Leu Leu Val Ala Leu Pro Leu Cys His Cys Gly Pro Val Gly Ser Leu Ser Trp Asp Leu Pro Gln Asn His Gly Leu Leu Ser Arg Asn Thr Leu Ala Leu Leu Gly Gln Met Cys Arg Ile Ser Thr Phe Leu Cys Leu Lys Asp Arg Arg Asp Phe Arg Phe Pro Leu Glu Met Trp Met Ala Val Ser Cys Arg Arg Pro Arg Pro Cys Leu Ser Ser Met Arg Cys Phe Ser Arg Ser Ser Ala Ser Ser Pro Gln Ser Ala Pro Leu Leu Pro Gly Thr.

39. A pure form of a polypeptide having the sequence:
Met Val Leu Leu Leu Val Leu Leu Val Ala Leu Leu Leu Cys Gln Cys Gly Pro Val Gly Ser Leu Gly Phe Asp Leu Pro Gln Asn Arg Gly Leu Leu Ser Arg Asn Thr Leu Ala Phe Trp Ala Lys Cys Arg Ile Ser Thr Phe Leu Cys Leu Lys Asp Arg Arg Asp Phe Arg Phe Pro Leu Glu Met Trp Met Ala Val Ile Cys Arg Arg Pro Arg Leu Cys Leu Ser Ser Met Arg Cys Phe Ser Arg Ser Ser Ala Ser Ser Pro Gln Ser Ala Pro Leu Leu Pro Gly Thr.

40. A process for preparing a substantially pure form of an omega interferon polypeptide of Type 1 coded for by a cDNA insert of plasmids P9A2 or E76E9 (deposited at the DSM within E. coli HB101 under the numbers DSM 3003 and 3004 respectively), an interferon polypeptide coded for by a sequence which will hybridise with a sequence corresponding to an interferon-coding sequence of plasmid P9A2 or E76E9 or a degenerate variation thereof under stringent hybridisation conditions suitable for detecting about 85% or higher homology, or an N-glycosylated derivative thereof with interferon activity, which comprises transforming a suitable host cell with an expression vector according to claim 24 containing a coding sequence for the desired polypeptide at a site for expression and isolating the desired polypeptide from resulting transformant cells.

41. A process according to claim 40 wherein said polypeptide comprises omega (Gly)- interferon said expression vector comprises pRHW12 and said host cell comprises E. coli HB101 which process comprises culturing E. coli HB101/pRHW12 cells at a pH of about 6 at about 28°C in culture medium, separating the cells from the medium, treating the separated cells with 1% acetic acid and then adding sufficient 5M NaOH to give a pH of about 10, stirring for about two hours, adding sufficient 5M HC1 to give a pH of about 7.5, subsequently isolating a clear supernatant, passing said supernatant through a controlled pore glass column to bind said interferon to said column, eluting said column with a solution containing Tris, KCNS and ethylene glycol at a pH of about 7.5 to obtain interferon containing fractions, dialysing said fractions against sodium phosphate and polyethylene glycol, then diluting with sodium phosphate and 1, 2-propyleneglycol at a pH of about 6.25, applying the product thereof to a cation exchange column to bind interferon to said column, then eluting said column with a linear gradient of 0 to 1M NaCl in sodium phosphate and 1,2-propyleneglycol at a pH of about 6.25 and aggregating interferon containing fractions.

42. A pharmaceutical composition comprising at least one interferon polypeptide according to claim 1 in association with a pharmaceutically acceptable carrier or excipient.

43. A pharmaceutical composition according to claim 42 comprising a synergistic mixture of at least one said interferon polypeptide with .alpha.-interferon, in association with a pharmaceutically acceptable carrier or excipient.

44. A pharmaceutical composition according to claim 42 comprising a synergistic mixture of at least one said interferon polypeptide with human tumour necrosis factor, in association with a pharmaceutically acceptable carrier or excipient.