AU4893397A - Enhanced transgene expression in a population of monocot cells employing sca ffold attachment regions - Google Patents

Description

ENHANCED TRANSGENE EXPRESSION IN A POPULAΗON OF MONOCOT CELLS EMPLOYING SCAFFOLD ATTACHMENT REGIONS

FIELD OF THE INVENTION 5 The present invention pertains to a method of increasing transgene expression and, in particular, to a method for increasing transgene expression in a population of monocot cells using DNA constructs having at least one scaffold attachment region.

BACKGROUND OF THE INVENTION 10 Improvement of crop plants for a variety of traits, including disease and pest resistance, and grain quality improvements such as oil, starch or protein composition, can be achieved by introducing new or modified genes into the plant genome. However, traits requiring relatively high expression of an introduced gene ("transgene") may not be attained, or may be attained at very low frequency

15 within a large population of transformants. Accordingly, it is necessary to prepare and analyze a large number of independent transformants in order to identify a plant with an expression level that is adequate for producing the desired trait because there is no reproducible method for preparing a population of independent, stably transformed cells wherein the average expression level is

20 increased.

Scaffold attachment regions (SARs), also known in the art as matrix attachment regions (MARs), cause various effects on the expression of transgenes. SARs are DNA fragments comprising specific nucleotide sequences that are able to bind to nuclear matrix preparations .derived from eukaryotic cells. SARs may

25 be either constitutive or transient (Getzenberg et al. (1994) J. Cell Biol. 55:22). Transient SARs are thought to temporarily attach a promoter region to the nuclear matrix. It is speculated that attachment is influenced by cell type, stage of development, or conditions of gene expression. Constitutive SARs are thought to be found at the boundaries of DNA loop domains that are transcriptionally

30 independent. In animals, the effects of SARs on expression of an associated transgene have been shown to include one or more of the following: position independence, copy number dependence, increased level of expression, and reduced variation of expression (Stief et al. (1989) Nature 341:343; Bonifer et al. (1990) EMBO J 9:2843; Klewz et al. (1991) Biochemistry 30:1264; McKnight et

35 al. (1992) PNAS 89:6943).

PCT Application having International Publication Number WO 94/07902 and published on April 14, 1994 describes a method for increasing expression and reducing expression variability of foreign genes in plant cells which uses a DNA construct comprising, inter alia, a scaffold attachment region positioned either 5' to a transcription initiation region or 3' to a structural gene.

Avramova et al., JCB Supplement D (2 IB), page 129 (1995) presented at the Keystone Meeting April 4-10 (1995), discloses the use of a yeast MAR to regulate gene expression in maize cell lines. Also disclosed is a maize Adhl

MAR that did work and a maize Mhal MAR that did not work in regulating gene expression in maize cell lines.

In plants, the reported effects of SARs on transgene expression have been quite variable. Breyne et al. ((1992) The Plant Cell 4:463) reported that a SAR from tobacco reduced the variation of transgene expression level among a population of tobacco transformants produced by Agrobacterium transformation.

In this study, the reduction in variability was due to clustering of expression levels at the low end of the observed range of expression level and complete elirnination of lines from the high range. Thus, the average expression level for the population oftransformants was decreased. In addition, presence of a SAR derived from the human β-globin locus had no effect on either the variation or the range of transgene expression.

A SAR derived from a soybean heat shock gene locus was shown to confer a 5 to 9 fold increase in transgene expression in tobacco plants transformed by Agrobacterium (Schoffl et al. (1993) Transgenic Research 2:93). The transgene expression level correlated with transgene copy number; however, transgene expression levels across the population of surveyed transformants was highly variable.

A yeast SAR was able to confer 12-fold higher average expression of a reporter gene introduced into tobacco cells by particle bombardment-mediated transformation (Allen et al. (1993) The Plant Cell 5:603). Little reduction in variation among independent lines was observed. Rather than observing copy number dependence, lines with higher copy numbers actually had lower levels of expression. Allen et al. ((1996) The Plant Cell 5:899), using a tobacco SAR, observed

60-fold higher average transgene expression in tobacco cells transformed by particle bombardment, with increased variation among independent lines.

A SAR located in the upstream region of the bean phaseolin promoter was shown to confer reduced variability and slightly increased levels of expression of reporter transgenes among independent transformants of Agrobacterium- transformed tobacco plants (van der Geest et al. (1994) The Plant Journal

6(3)A13). A SAR derived from the locus of the chicken lysozyme gene greatly reduced variability of transgene expression among independent, Agrobacterium- transformed tobacco plants (Mlynarova et al. (1994) The Plant Cell 6:417). The average expression level was increased approximately 4-fold, but the maximum expression level in any single transformant was no higher than plants transformed with constructs that did not contain SARs.

Thus, it is clear from the above discussion that the inclusion of nucleic acid fragments encoding SARs in DNA constructs which are transformed into plant cells affect expression of associated transgenes. However, the effect on expression is variable, and may be dependent on the nature of the host cell, the source of the SAR, and the means for introducing transgenes into host cells. Moreover, no one heretofore has demonstrated the effect of the chicken lysozyme gene locus SAR on expression of transgenes in a population of monocot plant cells. SUMMARY OF THE INVENTION

In one embodiment this invention concerns a method for increasing the level of expression of a transgene in a population of monocot cells which comprises:

(a) transforming the population with a DNA construct which comprises:

(1) a transgene comprising, in the 5' to 3' direction:

(i) a promoter;

(ii) a coding sequence operably linked to the promoter; and (iii) a polyadenylaition signal sequence operably linked to the coding sequence; and

(2) at least one chicken lysozyme gene locus scaffold attachment region wherein the scaffold attachment region is positioned 5', 3', or 5' and 3' of the transgene; and (b) incubating the transformed population under conditions suitable for cell growth.

In another embodiment this invention concerns a population of monocot cells containing a DNA construct which comprises:

(1) a transgene comprising, in the 5' to 3' direction: (i) a promoter;

(ii) a coding sequence operably linked to the promoter; and (iii) a polyadenylation signal sequence operably linked to the coding sequence; and (2) at least one chicken lysozyme gene locus scaffold attachment region wherein the scaffold attachment region is positioned 5', 3', or 5' and 3 ' of the transgene.

BRIEF DESCRIPTION OF FIGURES AND SEQUENCE LISTINGS Figure 1 is a diagram of the plasmid pMH40. The chimeric gene fragments depicted in this figure are defined as follows: 35S/P-cabL represents a BamHI to Ncol fragment, GUS represents an Ncol to Kpnl fragment, and NOS 3' represents a Kpnl to Sail fragment. The vector sequences are derived from pGEM9Zf and contain the ampicillin resistance gene.

Figure 2 is a diagram of the plasmid p40A53. A chimeric gene consisting of the 35S/P-cabL, the GUS coding region, and NOS 3' region, is bounded by the chicken lysozyme locus SAR ("A element"). The 5' A element is located between BamHI and Bam/Bgl sites, and the 3' A element is located between Sail and

Spe/Xbal. "J" refers to the junction point between BamHI and Bglll sites in one case, and Xbal and Spel sites in the other case.

Figure 3 is a graphical representation of GUS enzyme activities in SAR(+) and SAR(-) BMS lines. Data from lines that had measurable GUS enzyme activity are shown (n=15 for SAR(-) lines and n=28 SAR(+) lines).

SEQ ID NOs:l and 2 are the pair of oligonucleotides encoding the poly linker fragment that was used to modify the 3' end of the A element in order to facilitate construction of p40A53.

SEQ ID NOs:3 and 4 are the pair of oligonucleotides encoding the polylinker fragment that was used to modify the 5' end of the A element in order to facilitate construction of p40A53.

BIOLOGICAL DEPOSIT The following plasmid has been deposited under the terms of the Budapest Treaty with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852, and bears the following accession number:

Plasmid Accession Number Date of Deposit p40A53 ATCC 97725 September 20, 1996

DETAILED DESCRIPTION OF THE INVENTION This invention provides a method to increase transgene expression in a population of monocot plant cells by using DNA constructs comprising, inter alia, at least one chicken lysozyme gene locus SAR. The term "population" as used herein refers to a grouping of monocot cells in culture or as part of a plant or seeds thereof. Specifically, the inclusion of a chicken lysozyme gene locus SAR in DNA constructs used to transform monocot plant cells has a 2-fold effect: (1) transgene expression as measured over the entire population of individual transformants is increased, and (2) the highest levels of transgene expression by SAR-containing individual transformants is increased over individual non-SAR- containing transformants, i.e., transformants with identical transgenes lacking SARs.

Monocot cells which can be used to practice the present invention include a group of monocotyledonous plants examples of which are corn, wheat and rice. DNA constructs used to transform a population of monocot plant cells comprise:

(1) a transgene comprising in the 5' to 3' direction:

(a) a promoter;

(b) a coding sequence operably linked to the promoter; and (c) a polyadenylation signal sequence operably linked to the coding sequence; and

(2) at least one chicken lysozyme gene locus SAR positioned 5', 3' or 5' and 3' of the transgene.

The chicken lysozyme gene locus SAR-transgene construct can be introduced into the monocot genome using techniques well known to those skilled in the art. These methods include, but are not limited to, (1) direct DNA uptake, such as particle bombardment or electroporation, and (2) Agrobacterium-mediated transformation.

Enhancement of transgene expression by such SARs may be practiced with any transgene that is regulated by a constitutive, tissue-specific or developmentally regulated promoter. The transgene may encode a protein product or may produce a functional RNA that may, in turn, mediate control of gene expression by antisense, co-suppression or other gene expression technology.

"Gene" refers to a nucleic acid fragment that expresses a specific protein or specifies the production of a functional RNA, including regulatory sequences preceding (5' non-coding sequences), following (3' non-coding sequences) and within the coding sequence. "Native gene" refers to a gene as found in nature with its own regulatory sequences. "Chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source but arranged in a manner different than that found in nature. "Endogenous gene" refers to a native gene in its natural location in the genome of an organism. A "foreign" gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by transformation. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A "transgene" is any gene that is introduced into the genome of an organism through a transformation procedure.

"Coding sequence" refers to a DNA sequence that codes for a specific amino acid sequence or a functional RNA. "Regulatory sequences" refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, processing, stability and subsequent translation of the transcribed RNA. Regulatory sequences include promoters, enhancers, introns, translation leader sequences and polyadenylation signal sequences.

"Promoter" refers to a DNA sequence capable of controlling the expression of a coding sequence. In general, a coding sequence is located 3' to a promoter sequence. The promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an "enhancer" is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types ("tissue-specific"), or at different stages of development ("developmentally regulated"), or in response to different environmental conditions (see Okamuro, J. K. and Goldberg, R. B. In The Biochemistry of Plants; Academic Press: New York, 1989; Vol. 2, pp 1-82; and Goldberg, R. B. et al. (1989) Cell 55:149; and the references cited therein). Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths may have identical promoter activity.

The "translation leader sequence" refers to a DNA sequence located between the transcription start site of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence, and may affect one or more of the following: processing of the primary transcript to mRNA, mRNA stability and translation efficiency. Turner, R. and Foster, G. D. (1995) Molecular Biotechnology 3:225.

The "3' non-coding sequences" refer to DNA sequences located downstream of a coding sequence and include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. Ingelbrecht, I. L. W. et al. (1989) Plant Cell 7:671.

The term "operably linked" refers to nucleic acid sequences on a single nucleic acid fragment which are associated so that the function of one is affected by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., that the coding sequence is under the transcriptional control of the promoter).

Coding sequences can be operably linked to regulatory sequences in sense or antisense orientation. "Sense orientation" refers to the arrangement of regulatory sequences and coding sequences wherein transcription will result in production of an RNA transcript that can be translated into the polypeptide encoded by the coding sequence. "Antisense orientation" refers to the arrangement of regulatory sequences and coding sequences wherein transcription will result in production of an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target gene.

The term "expression", as used herein, refers to the transcription of sense (mRNA) or antisense RNA derived from the nucleic acid fragment of the invention. The term "expression" may also include subsequent translation of mRNA into a polypeptide. "Antisense inhibition" refers to the production of antisense RNA transcripts and the resulting suppression of the expression of identical or essentially similar foreign or endogenous genes (U.S. Patent No. 5,107,065 the disclosure of which is hereby incorporated by reference). "Overexpression" refers to the production of a gene product in transgenic organisms that exceeds levels of production in normal or non-transformed organisms. "Co-suppression" refers to the production of sense RNA transcripts and the resulting suppression of the expression of identical or essentially similar foreign or endogenous genes (U.S. Patent No. 5,231,020 the disclosure of which is hereby incoφorated by reference).

"Transformation" refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance. Host cells containing the transformed nucleic acid fragments are referred to as "transgenic" cells, and organisms comprising transgenic cells are referred to as "transgenic organisms". Examples of methods of transformation of plants and plant cells include Agrobacterium-mediated transformation (De Blaere et al. (1987) Meth. Enzymol. 143:211) and particle bombardment technology (Klein et al. (1987) Nature (London) 327:10-13; U.S. Patent No. 4,945,050). Whole plants may be regenerated from transgenic cells by methods well known to the skilled artisan (see, for example, Fromm et al. (1990) Bio/Technology 5:833).

By the method disclosed herein, transgene expression in a transformed population of monocots can be enhanced over expression in monocots that have been transformed with transgenes lacking at least one chicken lysozyme gene locus SAR. Accordingly, the. method is useful for increasing expression levels of desirable polypeptides. Moreover, more effective control of gene expression by antisense or co-suppression technologies may be achieved by affording higher levels of expression of functional (i.e., antisense or sense) RNA transcripts.

EXAMPLES The present invention is further defined in the following examples. It will be understood that the examples are illustrative only and the present invention is not limited to uses described in the examples. From the above discussion and the following examples, one skilled in the art can ascertain, and without departing from the spirit and scope thereof, can make various changes and modifications to the invention to adapt it to various uses and conditions. All such modifications are intended to fall within the scope of the claims.

Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E.F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Maniatis"). EXAMPLE 1

Construction of SAR-Transeene Expression Vectors The plasmid pMH40 (Figure 1) comprises the following genetic elements: a CaMV 35S promoter, cab leader, the uidA coding region, and the NOS polyadenylation signal sequence. The CaMV 35S promoter is a 1.3 kb DNA fragment that extends 8 bp beyond (i.e., 3' of) the transcription start site. The cab leader is a 60 bp untranslated leader DNA fragment derived from the chlorophyll a/b ("cab") binding protein gene 22L (Harpster et al. (1988) Mol Gen. Genet. 272:182). The cab leader was operably joined to the 3' end of the 35S promoter fragment. The uidA coding region, which encodes the β-glucuronidase protein ("GUS"; Jefferson et al. (1987) EMBO J. (5:3901) was operably linked to the 3" end of cab leader. Finally, an 800 bp DNA fragment containing the polyadenylation signal sequence region from the nopaline synthase gene ("NOS"; Depicker et al. (1982) J. Mol. Appl. Genet. 7:561) was operably linked to the uidA coding region. These DNA fragments, together comprising a 35S-GUS chimeric gene, were inserted by standard cloning techniques into the vector pGEM9Zf (Promega; Madison WI) to yield plasmid pMH40. pMH40, representing a SAR(-) construct, was used in control experiments in order to establish baseline values of expression in the absence of scaffold attachment regions.

The chicken lysozyme gene locus SAR is contained on a 3 kb fragment of DNA that is located between 8.7 kb and 11.7 kb upstream (i.e., 5') of the chicken lysozyme gene coding region (Phi- Van, L. and Stratling, W. H. (1988) EMBOJ. 7:655). This SAR, also called the "A element", is present in the plasmid pUC-B- 1 -X 1 (Phi- Van, L. and Stratling, W. H., supra) as a BamHI-Xbal fragment, and is flanked by the following restriction sites: Kpnl and Smal on the 5' side; and Sail, Pstl and Sphl on the 3' side.

For insertion of an A element on the 5' side of a 35S-GUS chimeric gene that is identical to that in pMH40 except for a shortened NOS 3' fragment of 300 bps, the following double stranded oligonucleotide poly linker was inserted into pUC-B-1-Xl that had been previously digested with Xbal and Pstl:

5' - CTAGAGAATTCAGATCTCTGCA - 3' (SEQIDNO:l) l l l l l l l l l l l l l l 3' - TCTTAAGTCTAGAG - 5' (SEQ ID NO:2).

This manipulation resulted in deletion of the Sail site and introduction of EcoRI and Bglll restriction enzyme sites between the Xbal and Pstl sites present at the 3' end of the A element. The A element was then excised as a BamHI-Bglll fragment and inserted into the BamHI site located at the 5' end of the 35S promoter of the 35S-GUS chimeric gene.

For insertion of an A element on the 3' side of the 35S-GUS chimeric gene, the following double stranded oligonucleotide polylinker was inserted into pUC-B-1-Xl that had been previously digested with Kpnl and BamHI:

5' - GTACCGTCGACGAATTCG - 3' (SEQIDNO:3) l l l l l l l l l l l l l l

3' - GCAGCTGCTTAAGCCTAG - 5' (SEQIDNO:4).

This manipulation resulted in deletion of the Smal site and introduction of

Sail and EcoRI restriction enzyme sites between the Kpnl and BamHI sites present at the 5' end of the A element. The A element was then excised as a Sall-Xbal fragment and inserted into the Sail and Spel sites located 3' to the 35S-GUS chimeric gene. The manipulations described above resulted in insertion of A elements both 5' and 3' to the chimeric 35S-GUS gene (see Figure 2).

EXAMPLE 2 Transformation of Monocot Cells with SAR-Transgene Expression Vectors Black Mexican Sweet (BMS) is a commonly used, corn-derived, monocot cell line. BMS cells were maintained as suspension cultures in the following medium ("MS+"): MS salts (GIBCO Laboratories, Grand Island NY), 0.5 mg/L thiamine, 150 mg/L L-asparagine, 20 g/L sucrose, and 2 mg/L 2,4-dichlorophenoxyacetic acid. The pH of this medium was adjusted to 5.8 using IN KOH. The cells were subcultured 2-3 times per week by adding 25 mL of cells to 25 mL of fresh medium in a 250 mL flask. Flasks were incubated with shaking (125 rpm) and grown at 26°C degrees in the dark.

BMS cell suspension cultures were transformed by the method of particle gun bombardment (Klein et al. (1987) Nature 327:10). A DuPont Biolistic™ PDS 1000/He instrument was used for transformations. Seven to 10 mL of the BMS suspension culture, obtained 2-4 days after subculturing, was distributed evenly about a Whatman #1 filter disk installed in a Buchner funnel under slight vacuum. The filters were transferred onto plates of solid MS+ medium (MS+ containing 6 g/L agar) and stored at 26°C degrees overnight. Plasmid DNA was precipitated onto gold particles as follows. The following components were added to 50 uL of a 60 mg/mL suspension of 1 mm gold particles in the order listed: plasmid DNA (5 ug of pMH40 or 9 ug of p40A53, each mixed with 5 ug of pDETRIC, a plasmid that containes the bar gene from Streptomyces hygroscopicus that confers resistance to the herbicide glufosinate (Thompson et al. (1987) EMBO J 6:2519) (the bar gene had its translation codon changed from GTG to ATG for proper translation initiation in plants (De Block et al. (1987) EMBO J 6:2513), is driven by the 35S promoter from Cauliflower Mosaic Virus, and uses the polyadenylation signal from the octopine synthase gene from Agrobacterium tumefaciens), 50 uL of 2.5M CaCl₂, and 20 uL of 0.1 M sperrnidine. Equimolar amounts of SAR(-) and S AR(+) plasmids were used in bombardments. This particle preparation was agitated for 3 minutes, spun in a microfuge for 10 seconds, and the supernatant removed. The DNA-coated particles were then washed once with 400 uL of 70% ethanol and resuspended in 40 uL of anhydrous ethanol. The DNA-coated particle suspension was sonicated three times for 1 second each. Seven and a half microliters of the DNA-coated particle suspension were then loaded onto each macro carrier disk.

The filter disk containing the BMS cells was placed about 3.5 inches away from the retaining screen and bombarded twice. Membrane rupture pressure was set at 1000 psi and the chamber was evacuated to minus 28 inches of mercury. Two plates were bombarded per construct per experiment. Bombarded plates were incubated for 7 days at 26° degrees in the dark. After 7 days, bombarded tissue was scraped from the filter, resuspended in liquid MS+ and plated on solid MS+ medium supplemented with 3 mg/L Bialaphos. Over a period of 3 to

7 weeks, rapidly growing clumps of tissue, representing transformed lines, were transferred by spreading onto fresh solid MS+ medium supplemented with 3 mg/L Bialaphos. Transformed tissue derived from bombardment of p40A53 was generally slower in appearing. Growing lines were picked over the course of time until a population of 54 lines was obtained for each DNA construction. Lines were subcultured after 2-3 weeks on solid MS+ medium supplemented with 2 mg/L Bialaphos.

EXAMPLE 3 Assay of Transgene Expression Fifty-four lines transformed with DNA constructs containing SARs (+) and 54 lines transformed with DNA constructs without SARs (-) were compared for reporter transgene expression by histochemical staining. The following histochemical staining solution was prepared: GUS Histochemical Assay Solution

0.1 M NaPO₄ buffer, pH7.0 50.00 mL

0.1 M K₃ (Fe(CN)₆) 0.50 mL

0.1 M K₄ (Fe(CN)₆)*3H₂0 0.50 mL

0.5 M Na₂EDTA 0.50 mL

Deionized H₂0 48.50 mL

*X-gluc 100 mg

* X-gluc = 5- bromo-4-chloro-3-indoyl-β-glucoronide

A small amount of tissue from each line was placed in each well of a 96 well plate containing 0.25 mL of GUS assay solution. Following incubation overnight at 37°C, each line was scored on a scale of 0 to 5 based on a visual rating of the intensity of blue staining, indicative of the quantity of GUS enzyme activity. Results are presented in Table 1. "

Table 1 Visual Assay of GUS Activity

GUS Activity

Lines Tested 0 (Negative) 1,2 or 3 (Low) 4 or 5 (High)

SAR(-) (n=54) 35 12 7

SAR(+) (n=54) 25 5 24 These results indicate that the presence of the SAR reduces the percentage of negative lines in a population, and increases the percentage of high activity lines. Quantitative values for GUS activity in transformants were determined for the high and low activity lines, as well as a portion of the negative lines. Sample extracts were prepared for each line as follows. 200-300 mg of fresh BMS tissue was suspended in 500 uL of extraction buffer (50 mM NaPO₄, 10 mM EDTA, 0.1% TritonX-100 and 0.1% Sarkosyl) and ground with a pestle. A small quantity of sand was included in the cell suspension in order to aid in cell disruption.

Following a brief centrifugation, the supernate was collected and stored at -70°C until assayed.

Sample extracts were prewarmed to 37°C prior to testing. One hundred and twenty microliters of each sample extract was placed into an individual well of a 96- well microtitre plate. Thirty microliters of prewarmed (37°C), freshly prepared, MUG substrate buffer (10 mM 4-methylumbelliferyl-β-D glucoronide (Sigma) in extraction buffer) was then added to each well. Twenty microliter aliquots were later removed at time points of 0, 10, 15, 30, 60, and 120 minutes after addition of MUG substrate buffer and placed into individual wells of a fluorometric microtitre plate (Titretek Fluoroplate; ICN Biomedicals), each well containing 180 uL of 0.2M NaCO₃ in order to stop the reaction. Fluorescence was detected and quantified using a Perkin-Elmer LS-3B spectrometer. Sample activities were interpolated from a standard curve constructed by plotting concentration of 4-MU (4-methylumbelliferone) standards (Sigma) versus their measured fluorescence intensity. This curve was used to convert fluorescence intensity of sample extracts to uM 4-MU.

Protein assays were performed on the same sample extracts using the BCA Protein Assay Reagent (Pierce Chemical; Rockford, IL) following the manufacturer's instructions for the Microtitre Plate Protocol. GUS enzyme activities were then calculated as pmoles 4-MU/mg protein. Time points taken over the course of the assay were evaluated and data converted to pmoles 4-MU/mg protein/min. For purposes of data presentation, activities were then multiplied by 1000.

Fourteen of the lines that were rated either 0 or 1 in the visual assay were tested in the quantitative assay; these lines had no detectable enzyme activity. Visual ratings of 1 were based on microscopic detection of spots of GUS activity in generally negative tissue. This amount of activity was not sufficient to be detected in the quantitative (MUG) assay. The remainder of the lines with visual ratings of 0 or 1 were assigned enzyme activity scores of zero. All but 2 SAR(-) lines with visual ratings of 2 and above demonstrated enzyme activity levels ranging between 15.8 and 215.9 pmoles 4-MU/mg protein/min x 1000 as shown in Table 2. The two exceptions possessed no detectable activity, and most likely resulted from uneven sampling of chimeric tissue.

Table 2 Quantitative Assay of GUS Activity

SAR(-) SAR(+) line pmoles 4-MU/mg/min line pmoles 4-MU/mg/min

1 - 39 0 1 - 26 0

40 15.8 27 35.0

41 16.6 28 87.1

42 21.8 29 124.3

43 24.0 30 124.9

44 34.7 31 140.4

45 43.2 32 168.7

46 62.3 33 195.5

47 66.3 34 207.0

48 70.6 35 207.9

49 72.5 36 271.3

50 75.1 37 310.8

51 77.0 38 317.2

52 122.2 39 378.0

53 161.2 40 403.2

54 215.9 41 576.5

42 805.1

43 830.6

44 1123.2

45 1135.2

46 1363.1

47 1536.3

48 1707.6

49 2036.8

50 2590.5

51 2915.3

52 4022.4

53 6603.6 54 8596.0

Based on these quantitative assays, the population of 54 SAR(-) lines had an average enzyme activity level of 20.0. The population of 54 SAR(+) lines had an average enzyme activity level of 718.8. This result demonstrates a SAR- dependent increase in expression of 36-fold between the two populations of transformants. When only the lines with measurable enzyme activity levels are compared, the S AR(+) lines again show an increase in expression. The S AR(-) lines have an average enzyme activity level of 72.0 while the SAR(+) lines have an average enzyme activity level of 1386.2, a 19-fold increase. These results are graphically presented in Figure 3.

The data in Table 2 and Figure 3 also indicates that 19 of 54 (35%) of the SAR(+) lines have GUS activities that are higher than any of the SAR(-) lines. The maximum level of expression achieved by an individual line was increased by the presence of the SAR. The enzyme activity of the highest expressing SAR(-) line was 215.9, while the activity of the highest S AR(+) line was 8596.0, an increase of 39.8 fold.

The variation in expression among transformants of the SAR(+) population increased over the range of activities displayed by the SAR(-) lines. Enzyme activities ranged between 35.0 and 8596.0, the highest expressor being 245.6 times higher than the lowest expressor. The range of activities for the SAR(-) population was between 15.8 and 215.9, the highest being 13.7 times higher that the lowest.

SEQUENCE LIST ING GENERAL I NFORMAT ION :

(i) APPLICANT:

(A) NAME: E. I. DUPONT DE NEMOURS AND COMPANY

(B) STREET: 1007 MARKET STREET

(C) CITY: WILMINGTON

(D) STATE: DELAWARE

(E) COUNTRY: USA

(F) POSTAL CODE (ZIP) : 19898

(G) TELEPHONE: 302-992-5481 (H) TELEFAX: 302-773-0164 (I) TELEX: 6717325

(ii) TITLE OF INVENTION: ENHANCED TRANSGENE EXPRESSION IN

MONOCOTS

(iii) NUMBER OF SEQUENCES: 4

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: 3.5 INCH DISKETTE

(B) COMPUTER: IBM PC COMPATIBLE

(C) OPERATING SYSTEM: MICROSOFT WORD FOR WINDOWS 95

(D) SOFTWARE: MICROSOFT WORD VERSION 7.0A

(v) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(vi) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 60/028,165

(B) FILING DATE: OCTOBER 17, 1996

(vii) ATTORNEY/AGENT INFORMATION:

(A) NAME: CHRISTENBURY, LYNNE M.

(B) REGISTRATION NUMBER: 30,971

(C) REFERENCE/DOCKET NUMBER: BB-1072

(2) INFORMATION FOR SEQ ID NO : 1 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: DNA (GENOMIC)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 1 : CTAGAGAATT CAGATCTCTG CA 22

(2) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 14 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: DNA (GENOMIC)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: TCTTAAGTCT AGAG 14

(2) INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: DNA (GENOMIC)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: GTACCGTCGA CGAATTCG 18

(2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 BASE PAIRS

(B) TYPE: NUCLEIC ACID

(C) STRANDEDNESS: SINGLE

(D) TOPOLOGY: LINEAR

(ii) MOLECULE TYPE: DNA (GENOMIC) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: GCAGCTGCTT AAGCCTAG 18 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM

The indications made below relate to the microorganism referred to in the description on page 4 , line 32

B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet | [

Name of depositary institution AMERICAN TYPE CULTURE COLLECTION

Address of depositary institution (including postal code and country) 12301 Parklawn Drive Rockville , Maryland 20852 US

Dale of deposit Accession Number

20 September 1996 (20.09.96) 97725

C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet Q

In respect of those designations in which a European patent is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the" date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample. (Rule 28(4) EPC)

D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)

E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)

The indications listed below will be submitted to the International Bureau later (specify the general nature of ^"the indications e g "Accession Number of Deposit")

For International Bureau use only

I 1 This sheet was received by the International Bureau on

Authorized officer

i orm PCT/RO/134 (July 1992) 17

Claims (9)

CLAIMS What is claimed is:

1. A method for increasing the level of expression of a transgene in a population of monocot cells which comprises: (a) transforming the population with a DNA construct which comprises:

(1) a transgene comprising, in the 5' to 3' direction:

(i) a promoter;

(ii) a coding sequence operably linked to the promoter; and

(iii) a polyadenylation signal sequence operably linked to the coding sequence; and

(2) at least one chicken lysozyme gene locus scaffold attachment region wherein the scaffold attachment region is positioned 5¹, 3', or 5' and 3' of the transgene; and

(b) incubating the transformed population under conditions suitable for cell growth.

2. The method of Claim 1 wherein the population of monocot cells are corn cells.

3. The method of Claim 1 further comprising regenerating whole plants from the transformed cells.

4. The method of Claim 1 wherein the promoter is a tissue-specific promoter.

5. A population of monocot cells containing a DNA construct which comprises:

(1) a transgene comprising, in the 5' to 3' direction:

(i) a promoter;

(ii) a coding sequence operably linked to the promoter; and (iii) a polyadenylation signal sequence operably linked to the coding sequence; and

(2) at least one chicken lysozyme gene locus scaffold attachment region wherein the scaffold attachment region is positioned 5', 3', or 5' and 3' of the transgene.

6. The population of monocot cells of Claim 5 wherein the monocot cells are corn cells.

7. Plants regenerated from the population of Claim 5 or 6.

8. Seeds obtained from the plants of Claim 7.

9. The population of monocot cells of Claim 5 wherein the promoter is a tissue-specific promoter.