MXPA02004307A - Seed preferred promoter from barley. - Google Patents

Abstract

The present invention provides a composition and method for regulating expression of heterologous nucleotide sequences in a plant. The composition is a novel nucleic acid sequence for a seed preferred promoter. A method for expressing a heterologous nucleotide sequence in a plant using the promoter sequence is also provided. The method comprises transforming a plant cell to contain a heterologous nucleotide sequence operably linked to the seed preferred promoter of the present invention and regenerating a stably transformed plant from the transformed plant cell.

Description

? SELECTED SEED PROMOTER OF BARLEY DESCRIPTION OF THE INVENTION The present invention relates to the field of plant molecular biology, more particularly to the regulation of gene expression in plants. Expression of the heterologous DNA sequences in a plant host is dependent in the presence of an operably linked promoter that is functional within the plant host. The choice of the promoter sequence will determine when and where within the plant the heterologous DNA sequence is expressed. When continuous expression is desired during all the cells of a plant, the constitutive promoters are used. In contrast, when gene expression in response to a stimulus is desired, promoters inducibles are the regulatory element of choice. When expression in specific tissues or organs is desired, preferred tissue promoters are used. That is, these promoters can direct expression in specific tissues or organs. The additional regulatory sequences current Upstream and / or downstream of the core promoter sequence can be included in the expression cassettes of the transformation vectors to cause approximately levels of expression variation of heterologous nucleotide sequences in a transgenic plant. See, for example, North American Patent No. 5,850,018.

Regulatory sequences can also be used in spatial and / or temporal expression of endogenous DNA. For example, specialized tissues are involved in fertilization and seed development. Of interest is the identification of promoters that are active in these seed tissues. In grain crops of agronomic importance, seed formation is the ultimate goal of plant development. The seeds are harvested for use in food, food, and industrial products. The amounts and proportions of protein, oil and starch components in those seeds determine their usefulness and value. The development time of -semilla is critical. The environmental conditions at any point prior to fertilization through the maturation of the seed can affect the quality and quantity of seed produced. In particular, the first 10 to 12 days after pollination (delayed phase) are critical in the development of corn seed. Several developmental events during the lag phase are important determinants of the fate of subsequent seed growth and development (Cheikh, N. et al., Plant Physiology 106: 45-5L (1994)). Therefore, a means to influence the development of the plant, particularly in the response to stress during this growth phase, is of interest. The identification of an active promoter sequence in tissues of developing seeds exposed to abiotic stresses would be useful. Specialized plant tissues are central to seed development. Following fertilization, developing seeds become carbon sinks displaced through the plant tissue of the photosynthetic sites. However, the development cereal seeds do not have direct vascular connections with the vegetable; instead, a short-distance transport mechanism operates to move the similarities of vascular tissues to the endosperm and embryo. For example, in corn, photosynthate enters the seed through the pedicle; in wheat and barley; through the nucellar projection and the aleurone layer. It is possible that this short distance similarity path between the plant tissue and the endosperm may operate to regulate the rate of transport of sucrose within the grain (Be ley, JD, and M. Black, Headquarters: Physiology of Development and Germination. , Plenum Press, 1985, pp. 38-39). Therefore, an active promoter in the expression of the gene within these specialized tissues, such as the projection or pedicle nucelar, can have significant effects on the development of the grain. During the rapid growth of seed, sucrose is passively discharged from the plant tissue into the parenchyma of pedicle parenchyma and inverted into hexose sugars by an invertase of cell wall binding acid. The hydrolysis of sucrose in the apoplast maintains a favorable gradient to continue discharging from the plant tissue and to provide hexoses that are carried by the basal endosperm cells. It has been shown that corn seeds induce abortion, in vi tro, they have only low levels of invertase activity in the pedicle. (Hanft, J.M. et al. (1986) Plant Physiol. 81: 503-510). Water stresses in the plant around the anthesis frequently result in seed absorption or restricted development. Studies suggest that sucrose continues to discharge from plant tissue at a low potential for ovarian water, but accumulates in the syphilis and apoplasm of the pedicle due to low invertase activity. (Zinselmeier, C, et al., (1995) Plant Physiol. 107: 385-391). This conclusion is supported by the findings of Miller and Chourey (Plant Cell 4: 297-305 (1992)), who show that the developed failure of miniature -1 seeds of maize is linked to the lack of invertase activity in the tissue pedicle during the early stages of seed development. Other specialized plant tissues are also closely involved in the critical processes of fertilization and seed development, for example, in corn, carpels, which constitute the ovary wall, converts the pericarp, a protective, resistant outer seed coat. scutellum, along with the endosperm, is involved in the displacement of similarities to the developing embryo.Aleuron, the surface layer of endosperm cells, is developed to serve as a necessary source of enzymes in germination. (Kiesselbach, TA The Structure and Reproduction of Com. NY, Cold Spring Harbor Press, 1999.) In the clarity of the important contributions of these specialized seed tissues to the development of appropriate grains, the identification of a promoter sequence that affect gene expression In addition, it would be desirable to identify an active promoter sequence in these specific tissues. icos in appropriate times, critical. Even more desirable would be the identification of an active promoter sequence in these specific tissues at appropriate, critical times, which are not negatively affected by environmental stress in the plant. The Glbl corn gene encoding globulin-1, a main embryo storage protein. (Kriz, A.L., et al. (1986) Plant Physiol. 82: 1069-1075) Glbl is expressed in developing maize seed during embryo development. (Belanger, F.C., et al. (1989) Plant Physiol. 96: 636-643). The Glbl promoter region has been identified, cloned, and introduced into tobacco plants by the transformation mediated by Agrobacterium. (Liu, S., et al. (1996) Plant Cell Reports 16: 158,162). The transformed vegetables demonstrate that the Glbl promoter has desirable temporal and tissue specificity. However, the Glbl promoter is positively regulated by abscisic acid (ABA). (Kriz, A.L., et al. (1990) Plant Physiol. 92: 538-542; Paiva, R., et al. , (1994) Vegetal 192: 332-339). The levels of the ABA hormone in the plant are known to fluctuate under cold conditions or desiccation. (Himmelbach, A., et al. (1998) Phil. Trans. R. Soc. Lond. 353: 1439-1444). Thus, the activity of the Glbl promoter can be differentially affected by environmental stress. There is a need for an active promoter sequence in tissues related to the specific seed at critical times in seed development and which are not negatively impacted by environmental stresses to the plant. In particular, it is desirable that the promoter activity is not deregulated by environmental stresses. It is an object of the present invention to provide a novel nucleotide sequence for modulating the expression of the gene in a plant. It is a further object of the present invention to provide an isolated promoter capable of directing transcription in a preferred manner of seed.

It is a further object of the present invention to provide an improved control method of an endogenous or exogenous product in the seed of a transformed vegetable. It is a further object of the present invention to provide a method for effecting useful changes in the phenotype of a seed of a transformed vegetable. It is a further object of the present invention to provide a method for producing useful changes in the phenotype of a seed of a transformed vegetable. It is a further object of the present invention to provide a method for producing a novel product in the seed of a transformed vegetable. It is a further object of the present invention to provide a method for producing a novel function in the seed of a transformed vegetable. It is a further object of the present invention to provide a method for modulating the time or speed of development of the seed of a transformed vegetable. It is an additional object of the present invention to provide a method for regulating the accumulation of photosynthetic products in the developing seed of a transformed vegetable. It is a further object of the present invention to provide a method for regulating the production of phytohormones involved in seed development.

It is a further object of the present invention to provide a method for regulating the seed cell cycle machinery during its development. Therefore, in one aspect, the present invention relates to an isolated nucleic acid comprising a member selected from the group consisting of: a) nucleic acid, capable of directing expression in the carpel, embryo scutellum, pedicle, nucleus , pericarp, aleurone, or region that forms the pedicle of a developing seed; b) nucleic acids capable of directing expression in the carpel, embryo scutellum, pedicle, nucleus, pericarp, aleurone, or pedicle-forming region of a developing seed during critical periods of seed development; c) nucleic acids capable of directing expression in the carpel, school of embryo, pedicle, nucleus, pericarp, aleurone, or pedicle-forming region of a developing seed during favorable or unfavorable growth conditions; d) nucleic acids comprising a variant or fragment of at least 20 contiguous nucleotides of the sequence set forth in the SEQUENCE OF IDENTITY NO 1; e) the nucleic acid segment established in the SEQUENCE OF IDENTITY NO: 1; f) nucleic acids that hybridize to any of a), b), c), or d), under severe conditions; where severe conditions include: a hybridization at 42 ° C in a 50"(w / v) solution of formamide, 6X SSC, 0.5% SDS, 100 μg / ml salmon sperm, washed with 0.5% SDS and 0. IX of SSC at about 65 ° C for 30 minutes and repeated, g) nucleic acids having at least 65% sequence identity to IDENTITY SEQUENCE No. 1 wherein the% sequence identity is based on the complete sequence and determined by GAP analysis under predefined parameters In other aspects, the present invention relates to expression cassettes comprising the promoter operably linked to a nucleotide sequence, the vectors containing the expression cassette, and Stably Transformed Vegetables With At Least One Expression Cassette In a further aspect, the present invention relates to a method for modulating the expression in the seed of a stably transformed plant comprising the steps of (a) transforming a plant cell with an expression cassette comprising the promoter of the present invention, operably linked to at least one nucleotide sequence; (b) developing the plant cell under plant growth conditions and (c) regenerating a stably transformed plant from the plant cell wherein said bound nucleotide sequence is expressed in the seed. According to the invention, a nucleotide sequence is provided that allows the initiation of transcription in the seed. The sequence of the invention comprises the transcriptional initiation regions associated with the formation of seed and seed tissues. Thus, the compositions of the present invention comprise a novel nucleotide sequence for. a plant promoter, more particularly a promoter selected from seed. The term "seed" or "nugget" is intended to include the mature grain or ovule of a vegetable, or more broadly, a propagative plant structure.The terms "seed" and "nugget" are used interchangeably in the present. "favorable expression is intended in the seed, including in at least one of embryo, seed or nugget, pericarp, endosperm, nucellar projection, nucellos, aleuron, pedicle, and the like." heterologous nucleotide sequence "is intended as a sequence that does not occur naturally with the promoter sequence While this nucleotide sequence is heterologous to the promoter sequence, it may be homologous (native) or heterologous (foreign) in the host of the plant. which usually comprises a TATA box capable of directing the AR? II polymerase to initiate the synthesis of AR? at the appropriate transcription initiation site for a coding sequence. ica particular. A promoter may additionally comprise other recognition sequences generally placed upstream or 5 'to the TATA box, referred to as upstream promoter elements, which influences the rate of transcription initiation. It is recognized that they have identified the nucleotide sequences for the promoter region described herein, it is within the state of the art to isolate and identify additional regulatory elements in the untranslated region 'upstream of the particular promoter region identified herein. So the promoter region described ? in the present it was further defined generally comprising upstream regulatory elements such as those reliable for tissue and temporal expression of the coding sequence, enhancers and the like. In the same manner, promoter elements that allow expression in the desired tissue such as the seed can be identified, isolated, and used with other core promoters to confirm the preferred seed expression.

The isolated promoter sequence of the present invention can be modified to provide a range of expression levels of the heterologous nucleotide sequence. Less than the entire promoter region can be used and the ability to direct the preferred expression of retained seed. However, it is recognized that mRNA expression levels can be decreased with deletions of portions of the promoter sequence. Thus, the promoter can be modified to be a weak or strong promoter. Generally, a "promoter" which directs the expression of a sequence coding at a lower level is intended as a "weak promoter". By "lower level". Levels of approximately 1/10, 000 transcripts are intended to approximately 1 / 100,000 transcripts to approximately 1 / 500,000 transcripts. Conversely, a strong promoter directs the expression of a coding sequence at a high level, or to approximately 1/10 transcripts to approximately 1/100 transcripts to approximately 1 / 1,000 transcripts. Generally, at least about 20 nucleotides of an isolated promoter sequence will be used to direct the expression of a nucleotide sequence. However, shorter segments of a promoter can be effective in directing expression, and can particularly improve expression within specific tissues.

It is recognized that for increased levels of transcription, enhancers can be used in combination with the promoter regions of the invention. Enhancers are nucleotide sequences that act to increase the expression of a promoter region. The enhancers are known in the art and include the SV40 enhancer region, the enhancer element 35S, the like. The term "isolated" refers to the material, such as a nucleic acid or a protein, which is: (1) substantially or essentially free of components which normally accompany or interact with it as it is found in its natural environment. The isolated material optionally comprises material not found with the material in its natural environment; or (2) if the material is in its natural environment, the material has been synthetically altered or synthetically produced by deliberate human intervention and / or placed in a different location within the cell. The alteration or synthetic creation of the material can be done on the material inside or apart from its natural state. For example, a naturally occurring nucleic acid becomes an isolated nucleic acid if it is altered or produced by synthetic, non-natural methods, or if it is transcribed from DNA that has been altered or produced by unnatural, synthetic methods. The isolated nucleic acid can also be produced by the synthetic re-arrangement ("redistribution") of a part or parts of one or more allelic forms of the gene of interest. Likewise, a nucleic acid that occurs naturally (for example, a promoter) becomes isolated, if it is introduced in a different place in the genome. The nucleic acids which are "isolated", as defined herein, are also referred to as "heterologous" nucleic acids. Methods for isolation of promoter regions are well known in the art. A method is described in U.S. Patent Application No. 60 / 098,690, filed August 31, 1998, incorporated herein by reference. The sequence for the promoter region of the present invention is set forth in the SEQUENCE OF IDENTITY NO: 1. The promoter region of the invention can be isolated from any plant, including, but not limited to, barley. { Hordeum vulgare), corn. { Zea mays), cañola. { Brassica napus, Brassica rapa ssp. ), alfalfa. { Medicago sativa), rice. { Oryza sativa), rye. { Sécale cereale), sorghum. { Sorghum bicolor, Sorghum vulgare), sunflower. { Helianthus annuus), wheat. { Tri ticum aestivum), soy. { Glycine max), tobacco. { Nicotiana tabacum), potato. { Solanum tuberosum), peanut. { Arachis hypogaea), cotton. { Gossypi um hirsutum), sweet potato. { Ipomoea bata tus), cassava. { Manihot esculenta), coffee. { Cofea spp. ), coconut. { Cocos nucífera), pineapple. { ananas comosus), citrus trees. { Ci trus spp), cocoa. { Theobroma cacao), tea. { Camellia sinensis), banana. { Musa spp. ) , avocado . { Persea americana), fig. { Ficus casica), guava. { Psidium guajava), mango. { Mangifera indica), olive tree. { Olea europaea), oats. { Avena sativa), vegetables, ornamentals, and conifers. Preferably, the vegetables include barley, corn, soybean, sunflower, safflower, barley, wheat, rye, alfalfa and sorghum. The promoter sequences of other plants can be isolated according to well-known techniques based on their sequence homology to the promoter sequence set forth herein. In these techniques, all or part of the known promoter sequence is used as a probe which selectively hybridizes to other sequences present in a population of cloned genomic DNA fragments (ie, genomic libraries) of a chosen organism. The methods are readily available in the art for hybridization of nucleic acid sequences. The entire promoter sequence or portions thereof can be used as a test capable of specifically hybridizing to corresponding promoter sequences. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique and are preferably at least about 10 nucleotides in length, and more preferably at least about 20 nucleotides in length. Such probes can be used to amplify corresponding promoter sequences of an organism chosen by the well known process of the polymerase chain reaction (PCR). This technique can be used to isolate additional promoter sequences from a desired organism or as a diagnostic assay to determine the presence of the promoter sequence in an organism. Examples include screening the hybridization of plated DNA libraries (either plates or colonies); see for example Innis et al. , eds., (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press). The terms "stringent conditions" or "conditions of severe hybridization" include references under conditions under which a probe will hybridize to its target sequence, to a degree detectably greater than other sequences (eg, at least 2-fold on the base) . Severe conditions are dependent on target sequence and will differ depending on the structure of the polynucleotide. By controlling the severity of the hybridization and / or washing conditions; the target sequences can be identified which are in addition 100 ° in a probe (homologous probe). Alternatively, severe conditions may be adjusted to allow some imbalance in sequences so that lower degrees of similarity are detected (heterologous polling). Generally, probes of this type are in a range of about 1000 nucleotides in length to about 250 nucleotides in length. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization, Nucleic Acid Probes, Part I, Chapter 2"Overview of Principles of Hybridization and the Strategy of Nucleic Acids Probes Assays" , Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al. , Eds., Greene Publishing and Wiley-Interscience, New York (1995). See also Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). In general, the sequences that correspond to the promoter sequence of the present invention and hybridize to the promoter sequence described herein will be at least 50% homologous, 70% homologous, and even 85% homologous or more with the sequence described. That is, the sequence similarity between the probe and the target may vary, sharing at least about 50": about 70%, and still about 85% sequence similarity.

The specificity is normally the function of post-hybridization washes, the critical factors being the ionic strength and the temperature of the final washed solution. Generally, severe wash temperature conditions are selected to be about 5 ° C to about 2 ° C lower than the melting point (Tm) for the specific sequence at a defined ionic strength and pH. The melting point, or denaturation, of DNA occurs during a narrow temperature range and represents the disruption of the double helix within its unique complementary strands. The process is described by the temperature of the transition point, Tra, which is also called the melting temperature. The formulas are available in the art for the determination of melting temperatures. Preferred hybridization conditions for the promoter sequence of the invention include hybridization at 42 ° C in 50% (w / v) formamide, 6 X SSC, 0.5% (w / v) SDS, 100 μg / ml DNA of salmon sperm. Exemplary severe wash down conditions include hybridization at 42 ° C in a 2X SSC solution, 0.5% (w / v) SDS for 30 minutes and repeating. Moderate severe exemplary conditions include a wash in 2X SSC, 0.5% (w / v) SDS at 50 ° C for 30 minutes and repeating. Exemplary elevated severe conditions include a wash in 2X SSC, 0.5 ^ (w / v) SDS, at 65 ° C for 30 minutes and repeating. The sequences corresponding to the promoter of the present invention can be obtained using all the above conditions. For purposes of defining the invention, high severe conditions are used. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. . 48: 443 (1970); by the search for the similarity method of Pearson and Lipman, Proc. Nati Acad. Sci. 85: 2444 (1988); for co-purposed implementations of these algorithms, including, but not limited to: CLUSTAL in the PC / Gene program by Intelligenetics, Mountain, View, California; GAP, BESTFIT, BLAST, FASTA and TFASTA in the Wisconsin Genetics Software Package; Genetics Computer Group (GCG), 575 Science Dr., Madison, Wisconsin, USA; the CLUSTAL program is well described by Higgins and Sharp, Gene 73: 237-244 (1988); Higgins and Sharp, CABIOS 5: 151-153 (1989); Corpet, et al. , Nucleic Acids Research 16: 10881-90 (1988); Huang, et al. , Computer Applications in the Biosciences 8: 155-65 (1992), and Pearson, et al. , Methods in Molecular Biology 24: 307-331 (1994).

Sequence fragments with high percentage identity to the sequence of the present invention also refer to those fragments of a particular promoter nucleotide sequence described herein that operates to promote the preferred seed expression of an operably linked heterologous nucleotide sequence. . These fragments will comprise at least about 20 contiguous nucleotides, preferably at least about 50 contiguous nucleotides, more preferably at least about 75 contiguous nucleotides, even more preferably at least about 100 contiguous nucleotides of the particular promoter nucleotide sequence described in I presented. The nucleotides of such fragments will usually comprise the TATA recognition sequence of the particular promoter sequence. Such fragments can be obtained by the use of restriction enzymes to unfold the naturally occurring promoter nucleotide sequences described herein; synthesizing a nucleotide sequence from the naturally occurring promoter DNA sequence; or it can be obtained through the use of PCR technology. See particularly, Mullis et al. (1987) Methods Enzymol. 155: 335-350, and Erlich, ed. (1989) PCR Technology (Stockton Press, New York). Again, variants of these promoter fragments, such as those resulting from site-directed mutagenesis, are encompassed by the compositions of the present invention. Nucleotide sequences comprising at least about 20 contiguous sequences of the sequence set forth in the SEQUENCE OF IDENTITY NO: 1. These sequences can be isolated by hybridization, PCR, and the like. Such sequences encompass fragments capable of directing the preferred expression of seed, fragments useful as probes to identify similar sequences, as well as elements responsible for temporal or tissue specificity. Biologically active variants of the promoter sequence are also encompassed by the composition of the present invention. A regulatory "variant" is a modified form of a regulatory sequence in which one or more bases have been modified, removed or added. For example, a routine way to remove part of a DNA sequence is to use an exonuclease in combination with the DNA amplification to produce unidirectional nesting deletions of the double stranded DNA clones. A commercial equipment for this purpose is sold under the trade name Exo-Size ™ (New England Biolabs, Beverly, Mass.). Briefly, this procedure involves the incubation of exonuclease III with DNA to progressively remove nucleotides in the 3 'to 5' direction in 5 'projections, blunt ends or notches in the DNA template. However, exonuclease III is unable to remove nucleotides in the 3 ', base 4 projections. The timed digestion of a clone with this enzyme produces unidirectional nesting eliminations. An example of a regulatory sequence variant is a promoter formed by one or more deletions from a broad promoter. The 5 'portion of a promoter up to the TATA box near the transcription start site can be removed without canceling the promoter activity, as described by Zhu et al. , The Plant Cell 7: 1681-89 (1995). Such variants must retain the promoter activity, particularly the ability to direct expression in seed or seed tissues. Biologically active variants include, for example, the native promoter sequences of the invention having one or more nucleotide substitutions, deletions or insertions. The promoter activity can be measured by Northern blot analysis, measurements of reporter activity when transcriptional fusions are used, and the like. See, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.), incorporated herein by reference. The nucleotide sequence for the promoter of the invention, as well as fragments and variants thereof, can be provided in expression cassettes together with heterologous nucleotide sequences for expression in the plant of interest, more particularly in the seed of the plant. Such an expression cassette is provided with a plurality of restriction sites for insertion of the nucleotide sequence to be under the transcriptional regulation of the promoter. These expression cassettes are useful in the genetic manipulation of any plant to achieve a desired phenotypic response. The genes of interest expressed by the promoter of the invention can be used by varying the phenotype of the seeds. This can be achieved by increasing the expression of endogenous or exogenous products in seeds. Alternatively, the results can be achieved by providing for a reduction of expression of one or more endogenous products, particularly enzymes or cofactors in the seed. These modifications may result in a change in the phenotype of the transformed seed. General categories of genes of interest for the purpose of the present invention include, for example those genes involved in information, such as zinc fingers, those involved in communication, such as kinases, and those involved in home care, such as hot shock proteins. More specific categories of transgenes include genes that encode traits important for agronomic quality, insect resistance, disease resistance, herbicide resistance, and grain characteristics. Still other features of transgenes include genes to induce the expression of exogenous products such as enzymes, "cofactors, and plant hormones and other eukaryotes as well as prokaryotic organisms." It is recognized that any gene of interest, including the native coding sequence, can bind The modifications that affect the grain traits include altering the levels of saturated and unsaturated fatty acids, and increasing the levels of amino acids containing lysine and sulfur can be desired, as well as enhancing the levels of amino acids containing lysine and sulfur. modifications to the quantity and / or type of starch contained in PCT / US94 / 382 filed on April 10, 1997; PCT / US96 / 08219 filed on March 26, 1997; PCT / US96 / 08220 filed March 26, 1997 and US Patent No. 5,703,409, issued December 30, 1997; the descriptions of which are incorporated herein by reference. Additional examples are lysine and / or sulfur-rich seed proteins encoded by soy 2S albumin described in PCT / US97 / 04409 filed March 20, 1996, and the barium chymotrypsin inhibitor, Williamson et al. (1987) Eur. J. Biochem. 165: 99-106, the descriptions of which are incorporated for reference. In a more preferred embodiment, the promoter of the present invention modulates genes encoding proteins which act as cell cycle regulators, or which control carbohydrate metabolism or phytohormone levels, as has been shown in tobacco and cannabis with other promoters. selected tissue. (Ma, Q.H., et al., (1998) Australian Journal of Plant Physiology 25 (1): 53-59; Roeckel, P., et al., (1997) Transgenic Research 6 (2): 133-141). The expression of endogenous or heterologous nucleotides under the direction of the promoter can result in the maintenance of a desirable seed phenotype under adverse environmental conditions. Derivatives of the following genes can be made by site-directed mutagenesis to increase the level of preselected amino acids in the encoded polypeptide. For example, the gene encoding the high barley lysine polypeptide (BHL) is derived from the barium chymotrypsin inhibitor, PCT / US97 / 20441 filed on November 1, 1996 and PCT / US97 / 20441 filed October 31 of 1997; the descriptions of each are incorporated herein for reference. Other proteins include methionine-rich plant proteins such as sunflower seed, Lilley et al. (1989) Proceedings of the World Congress on Vegetable Protein Utilization in Human Foods and Animal Feedstuffs, Applewhite, H. (ed.); American Oil Chemists Soc., Champaign, IL: 97-502, incorporated herein by reference; corn, Pedersen et al. (1986) J. Bdol. . Chem. 261-6279; Kirihara et al. (1988) Gene 71: 359, both incorporated herein by reference; and rice, Musumura et al (1989) Plant Mol. Biol. 12: 123 incorporated herein by reference. Other important genes that encode latex, Floury 2, growth factors, seed storage factors and transcription factors. Agronomic traits in seeds can be improved by altering the expression of genes that affect the response of seed growth and development during environmental stress, Cheikh-N et al. , (1994) Plant Physiol. 106 (1): 45-51, and genes that control carbohydrate metabolism to reduce seed abortion in corn, Zínselmeier et al. (1995) Plant Physiol. 107 (2): 385-391. The insect resistance genes can encode resistance to pests that have major production hindrances such as rootworm, cutworm, European Corn Borre, and the like. Such genes include, for example, Bacillus thuringiensis endotoxin genes, U.S. Patent Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; Geiser et al. (1986) Gene 48: 109; lecithins, Van Damme et al. (1994) Plant Mol. Biol. 24: 825; and similar. Genes encoding disease resistant traits include detoxification genes, such as against pheumonosin (PCT / US95 / 10284 filed June 7, 1995); avirulence (avr) and disease resistance genes (R) Jones et al. (1994) Science 266: 789; Martín et al. (1993) Science 262: 1432; Mindrinos et al. (1994) Cell 78: 1089; and similar. Alterations in gene expression may also affect the type or quantity of products of commercial interest; for example, starch for the production of paper, textiles and ethanol. Another important commercial use of transformed vegetables is the production of polymers and bioplastics such as described in US Patent No. 5,602,321, issued February 11, 1997. Genes such as B-Ketothiolase, PHBase (polyhydroxybutyrate synthase) and acetoacetyl- CoA "reductase" (see Schubert et al (1988) J. Bacteriol 170 (12): 5837-5847) facilitates the expression of polyhydroxyalkanoates (PHAs). The nucleotide sequence operably linked to the promoter described herein can be an antisense sequence. for a target gene By "antisense DNA nucleotide sequence" a sequence which is a reverse orientation in the normal 5 '-a-3' orientation of that nucleotide sequence is intended.When supplied in a plant cell, the expression of the antisense DNA sequence prevents normal expression of the DNA nucleotide sequence for the target gene.The antisense nucleotide sequence encodes a transcript RNA ion that is complementary to, and capable of hybridizing with, the endogenous messenger RNA (mRNA) produced by the transcription of the nucleotide sequence of AD? for the target gene. In this case, the production of the native protein encoded by the target gene is inhibited to achieve a desired phenotypic response. In this way the promoter sequence described herein can be operably linked to sequences of AD? antisense to reduce or inhibit the expression of a native protein in the vegetable seed. The expression cassette will also include, in the 3 'terminus of the heterologous nucleotide sequence of interest, a functional transcriptional and translational termination region in plants. The terminal region can be native with the promoter nucleotide sequence of the present invention, it can be native with the sequence of AD? of interest, or it may be derived from another source. Suitable termination regions are available from the A. tumefaciens Ti plasmid, such as the octopine synthase and nopaline synthase terminator regions. See also, Guerineau et al. (1991) Mol. Gen. Genet. 262: 141-144; Proudfoot (1991) Cell 64: 671-674; Sanfacon et al. (1991) Genes Dev. 5: 141-149; Mogen et ai. (1990) Plant Cell 2: 1261-1272; Munroe et al. (1990) Gene 91: 151-158; Bailas et al. 1989) Nucleic Acids Res. 17: 7891-7903; Joshi et al. (1987) Nucleic Acid Res. 15: 9627-9639. The expression cassettes may additionally contain 'leader sequences 5'. Such leader sequences can act to improve translation. Translation leaders are known in the art and include: picornavirus leaders, eg, EMCV leader (region 5 'of Uncoded Encephalomyocarditis), Elroy-Stein et al. (1989) Proc. Nat. Acad. Sci. USA 86: 6126-6130; Potivirus leaders, for example, TEV leader (Tobacco Etch Virus), Allison et al. (1986); MDMV leader (Maize Dwarf Mosaic Virus), Virology 154: 9-20; heavy chain binding protein of human unoglobin (BiP), Macejak et al. (1991) Nature 353: 90-94; untranslated leader of mRNA protein coated alfalfa mosaic virus (AMV RNA 4), Jobling et al. (1987) Nature 325: 622-625); leader of the tobacco mosaic virus (TMV), Gallie et al. (1989) Molecular Biology of RNA, pages 237-256; and leader of the mottled chlorotic corn virus (MCMV) Lommel et al. (1991) Virology 81: 382-385. See also Della-Cioppa et al. (1987) Plant Physiology 84: 965-968. The cassette may also contain sequences that improve the translation and / or stability of mRNAs such as introns.

In those cases where it is desired to have the expressed product of the heterologous nucleotide sequence directed to a particular organelle, particularly the plasmid, amiloplast, or endoplasmic reticulum, or secreted on the surface of the cell or extracellularly, the expression cassette may further comprising a coding sequence for a transit peptide. Such transit peptides are well known in the art and include, but are not limited to, the transit peptide for the acyl carrier protein, the small subunit of RUBISCO, plant EPSP synthase, and the like. In preparing the expression cassette, the various DNA fragments can be manipulated, so that they are provided for the DNA sequences in the proper orientation and, as appropriate, in the appropriate reading frame. Towards this end, the adapters or linkers can be used to join the DNA fragments or other manipulations can be involved to provide convenient restriction sites, removal of extra-fluid DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction extracts, annealing and resubstitutions, such as transitions and transversions, may be involved. As noted herein, the present invention provides vectors capable of expressing genes of interest under the control of the promoter. In general, the vectors must be functional in plant cells. Sometimes, it may be preferable to have vectors that are functional in E. coli (e.g., production of protein by raising antibodies, DNA sequence analysis, construction of inserts, obtaining amounts of nucleic acids). Vectors and methods for cloning and expression in E. coli are discussed in Sambrook et al. (supra) The transformation vector comprising the promoter sequence of the present invention operably linked to a heterologous nucleotide sequence in an expression cassette, may also contain at least one additional nucleotide sequence for a gene for co-transformation in the organism. Alternatively, the additional sequences can be provided in another transformation vector. The vectors that are functional in plants can be binary plasmids derived from Agrobacterium. Such vectors are capable of transforming plant cells. These vectors contain left and right border sequences that are required for integration into the host (plant) chromosome. At a minimum, among these border sequences is the gene to be expressed under the control of the promoter. In the preferred modalities, a selectable marker and a reporter gene are also included. For ease of obtaining sufficient amounts of the vector, a bacterial origin that allows replication in E. coli is preferred. Reporter genes can be included in the transformation vectors. Examples of suitable reporter genes known in the art can be found in, for example, Jefferson et al. (1991) in Plant Molecular Biology Manual, ed. Gelvin et al. (Kluwer Academic Publishers), pp. 1-33; DeWet et al. (1987) Mol. Cell. Biol. 7: 725-737; Goff et al. (1990) EMBO J. 9: 2517-2522; Kain et al. (1995) BioTechniques 19: 650-655; and Chiu et al. (1996) Current Biology 6: 325-330. Selectable marker genes for the selection of transformed cells or tissues can be included in the transformation vectors. These may include genes that confer antibiotic resistance or herbicide resistance. Examples of suitable selectable marker genes include, but are not limited to, genes encoding resistance to chloramphenicol, Herrera Estrella et al. (1983) EMBO J. 2: 987-992; Methotrexate, Herrera Estrella et al. (1983) Nature 303: 209-213; Meijer et al. (1991) Plant Mol.

Biol .. 16: 807-820; hygromycin, Waldron et al. (1985) Plant Mol. Biol .. 5: 103-108; Zhijian et al. (1995) Plant Science 108: 219-227; Streptomycin, Jones et al. (1987) Mol. Gen. Genet. 210: 86.91; Spectinomycin, Bretagne-Sagnard et al. (1996) Transgenic Res. 5: 131-137; bleomycin, Hille et al. (1990) Plant Mol. Biol. 7: 171-176; sulfonamide, Guerineau et al. (1990) Plant Mol. Biol. 15: 127-136; Bromoxynil, Stalker et al. (1988) Science 242: 419-423; glyphosate, Shaw et al. (1986) Science 233: 478-481; phosphinothricin, DeBlock et al. (1987) EMBO J. 6: 2513-2518. Other genes that could be useful in the recovery of transgenic events, but could not be required in the final product would include, but are not limited to, examples such as GUS (β-glucuronidase), Jefferson (1987) Plant Mol. Biol. Rep. 5: 387); GFP (green fluorescent protein), Chalfie et al. (1994) Science 264: 802; luciferase, Teeri et al. (1989) EMBO J. 8: 343; and the maize genes that code for the production of anthocyanin, Ludwig et al. (1990) Science 247: 449. The transformation vector comprising the particular promoter sequence of the present invention, operably linked to a heterologous nucleotide sequence of interest in an expression cassette, can be used to transform any plant. In this form, genetically modified vegetables, plant cells, plant tissue, seed, and the like can be obtained. The transformation protocols may vary depending on the plant type or plant cell, ie monocot or dicot, objectives for transformation. Suitable methods for transforming plant cells include microinjection. Crossway et al. (1986) Biotechniques 4: 320-334; electroporation, Riggs et al. (1986) Proc. Nati Acad. Sci. USA 83: 5602-5606; Agrobacterium-mediated transformation, see for example, Townsend et al. U.S. Patent 5,563,055; direct gene transfer, Paszkowski et al. (1984) EMBO J. 3: 2717-2722; and ballistic particle acceleration, see for example, Sanford et al. U.S. Patent 4,945,050; Tomes et al. (1995) in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Philips (Springer-Verlag, Berlin); and McCabe et al. (1988) Biotechnology 6: 923-926. Also see Weissinger et al. (1988) Annual Rev. Genet. 22: 421-477; Sanford et al. (1987) Particulate Science and Technology 5: 27-37 (onion); Christou et al. (1988) Plant Physiol. 87: 671-674 (soybean); McCabe et al. (1988) Bio / Technology 6: 923-926 (soybean); Datta et al. (1990) Biotechnology 8: 736-740 (rice); Klein et al. (1988) Proc. Nati Acad. Sci. USA 85: 4305-4309 (corn); Klein et al. (1988) Biotechnology 6: 559-563 (corn); Klein et al. (1988) Plant Physiol. 91: 440-444 (corn); Fromm et al. (1990) Biotechnology 8: 833-839; Hooydaas-Van Slogteren et al. (1984) Nature (London) 311: 763-764; Bytebier et al. (1987) Proc. Nati Acad. Sci. USA 84: 5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tisuues, ed. G.P. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9: 415-418; Y Kaeppler et al. (1992) Theor. Appl. Genet 84: 560-566 (transformation mediated by whiskers); D. Halluin et al. (1992) Plant Cell 4: 1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12: 250-255 and Christou et al. (nineteen ninety five) Annals of Botany 75: 407-413 (rice); Osjoda et al. (nineteen ninety six) Nature Biotechnology 14: 745-750 (corn through Agrobacterium tumefaciens); all of which are incorporated herein by reference. Cells that have been transformed can be grown in vegetables according to conventional forms. See, for example, McCormick et al. (1986) Plant Cell Reports 5: 81-84. These plants can then be grown, and pollinated with the same transformed strain or different strains. The resulting hybrid having seed expression selected from the desired phenotypic characteristic can then be identified. Two or more generations can be developed to ensure that the seed expression selected from the desired phenotypic characteristic is stably maintained and inherited. The following examples are proposed by way of illustration and not by way of limitation. EXAMPLES The structural Nuci gene from barley was previously isolated and characterized by Doan et al. (Plant Molecular Biology 31: 877-886, nineteen ninety six). The following examples describe the isolation and cloning of the Nuclc promoter. of barley and the proof of its activity in corn. Example 1: Nuclc Promoter Isolation: Three primers were designed based on the Nuci mRNA sequence (Access Genbank Z69632): SEC. ID. No. 2 CACTCGCAGGCGTAGTCGGAGAACTC SEC. ID. No. 3 TGCAGGCGGTAAGTGCGTCCTTCCT SEC. ID. No. 4 TACCGGCGCACTTGATCTTGCAGAGCCA The primers and barley genomic DNA were used in conjunction with the GenomeWalker (Clontech) team to isolate the promoter. The manufacturers protocol was followed and approximately 1.3 Kb of the 5 'sequence was obtained. The analysis of the upstream sequence revealed obvious control element motifs. An approximately 1-Kb fragment of the 5 'upstream sequence, start in the first methionine of the barley coding sequence, was then isolated. Two primers (SEQ ID No. 5: CCCAAGCTTTACGTTTGAGACGTATCATGTCG and SEQ ID NO: 6: CGGGATCCCGCTCCTTGCTCGTGCTGGCGAAG) with restriction sites were designed and PCR was used to isolate the fragment using techniques known to those of skill in the art. The fragment was 1091 bp in length (SEQ ID NO: 1), and Nuclc was designed. The? DN was inserted into a transformation vector (see Example 2, below). The construction was transformed into corn and the vegetables were used to evaluate the promoter activity. Example 2: Expression Summary for Nuclc Promoter: The Agrobacterium um strain used in this example was modified to contain nucleic acid encoding the Nuclc promoter and a GUS reporter gene to be expressed in the transformed cells. The nucleic acid to be transferred was incorporated into the T region and flanked by at least one T-DNA border sequence. In the Ti plasmid, the T region is distinct from the vir region whose functions are responsible for the transfer and integration. Binary vector systems have been developed where manipulated deactivated T-DNA carrying the foreign DNA and vir functions are presented in separate plasmids. In this manner, a T-DNA region comprising foreign DNA (the nucleic acid to be transferred) is constructed in a small plasmid which replicates in E. coli. This plasmid is conjugatively transferred in a tri-parental mating in A. tumefaciens which contains a virulence gene carrying plasmid compatible. The vir functions are supplied in trans to transfer the T-DNA into the plant genome. Preferred vectors are super-binary vectors. See, for example, U.S. Patent No. 5,591,616 and EPA 0604662A1, incorporated herein by reference. Such a super-binary vector has been constructed containing a region of DNA originating from the virulence region of the Ti plasmid pTiBo542 (Jin et al. (1987) J. Bacteriol 169: 4411-4425) contained in an Agrobacterium tumefaciens A281 super virulent that exhibits extremely high transformation efficiency (Hood et al. (1984) Biotechnol., 2: 702-709; Hood et al. (1986) J. Bacteriol. 168: 1283-1290; Komari et al. (1986) J. Bacteriol. 166: 88-94; Jin et al. (1987) J. Bacteriol. 169: 4411-4425; Komari T. (1989) Plant Science 60: 223-229; ATCC Access No. 37394). Super-binary vectors are known in the art and include pTOK162 (Japanese Patent Application (Kokai) No. 4-222527, EP-A-504, 869, EP-A-604, 662, and US Patent No. 5,591,616 incorporated in the present for reference) and pTOK233 (Komari, T. (1990) Plant Cell Reports 9: 303-306; and Ishida et al (1996) Nature Biotechnology 14: 145; incorporated herein by reference). Other super-binary vectors can be constructed by the methods set forth in the above references. For example, the super-binary vector pTOK162 is capable of replication in E. coli and A. tumefaciens. Additionally, the vector contains the virB, virC and virG genes from the virulence region of pTiBo542. The plasmid also contains an antibiotic resistance gene, a selectable marker gene, and the nucleic acid of interest to be transformed into the plant. The T region of the super-binary vectors and other vectors for use in the expression of the gene are constructed to have restriction sites for the insertion of the genes to be delivered. Alternatively, the DNA to be transformed can be inserted into the T-DNA region of the vector using homologous recombination in vivo. See, Herrera-Esterella et al. (1983) EMBO J. 2: 987-995; Horch et ai. (1984) Science 223: 496-498). It is believed in the fact of homologous recombination that the super-binary vector has a homologous region with a region of pBR322 or another similar plasmid. Thus, when the two plasmids are assembled into a desired gene, they are inserted into the super-binary vector by genetic recombination through the homologous regions. The vectors of this example are constructed using standard molecular biology techniques known to those of ordinary skill in the art. A reporter gene and a selectable marker gene were inserted between the T-DNA borders of a superbinary vector. The reporter gene was the ß-glucorinated (GUS) gene (Jefferson, RA et al., 1986 Proc. Nati, Acad. Sci. (USA) 83: 8447-8451) within whose coding region the second intron was inserted. from the ST-LS1 gene of potato (Vancanneyt et al., Mol.Gen. Genet, 220: 245-250, 1990), to produce the intron-GUS, to avoid the expression of the gene in Agrobacterium (see Ohta, S. et al., 1990, Plant Cell Physiol. 31 (6): 805-813). A fragment containing bases 2 to 310 from the terminator of the potato proteinase inhibitor (pinll) gene (An et al., Plant Cell 1: 115-122, 1989) was the blunt end current below the GUS coding sequence. , to create the GUS expression cassette. For the selectable marker, a Cauliflower Mosaic Virus 35S promoter with a duplicated enhancer region (2X35S; bases -421 to -90 and -421 to +2 from Gardner et al., Nucí Acids Res. 9: 2871-2888, 1981) was created. A fragment containing Omega-leader leader sequence (Gallie, D.R., et al., 1987, Nucleic Acids Research 15 (8): 3257-3273) was inserted current. downstream of the 35S promoter followed by a fragment containing the first intron of the corn alcohol dehydrogenase ADH1-S gene (Dennis et al., Nucí Acids Res. 12: 3983-3990, 1984). The BAR coding sequence (Thompson et al., EMBO J. 6: 2519-2523, 1987) was cloned downstream of the leader sequence, with the pinll terminator ligated downstream of BAR, to create the BAR expression cassette. Briefly, the plasmid was constructed by inserting the GUS expression cassette and the BAR expression cassette between the edges of the right and left T-DNA in pSBll. The GUS cassette was inserted near the edge of the right T-DNA. The Nuclc promoter fragment was inserted into the vector in front of the GUS-intron gene. Plasmid pSBll was obtained from Japan Tobacco Inc. (Tokyo, Japan). The construction of pSBll from pSB21 and the construction of pSB21 from initial vectors was described by Komari et al. (nineteen ninety six, Plant J. 10: 165-174). The 7βND-T of this plasmid was integrated into the superbinary plasmid pSBl (Saito et al., EP 672 752 Al) by homologous recombination between the two plasmids. The pSBl plasmid was also obtained from Japan Tobacco Inc. The E. coli HB101 strain containing the plasmid containing the Nuclc promoter was paired with the Agrobacterium strain LBA4404 harboring pSBl to create the co-integrated plasmid in the Agrobacterium tumefaciens strain LBA4404 using the method of Ditta et al., . { Proc. Nati Acad. Sci. USA 77; 7347-7351, 1980). . { See also, Patent Application No. 08 / 788,018, WO Publication No. 98/32326, for a further discussion of Agrobacterium-mediated transformation, incorporated herein by reference). The resulting co-integrated plasmid, the tri-parent mating product described above, was transformed into the genotypes (1) Hi-II and (2) Hi-II x PHN46. (See, US Patent No. 5,567,861 for more information about PHN46). The T0 plants were generated and the promoter analysis was conducted on the Tl seed from both genotypes.

The immature grains of 21 transgenic cases were harvested at specific intervals after pollination, starting at 0 DAP and extending to 20 DAP. Each grain was analyzed vertically from silk scar to pedicle and examined by histochemical staining. Specifically, each section was incubated in a 0.1 M sodium phosphate buffer solution, pH 7.0, containing 0.5% X-gluc (5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid, sodium salt , first dissolved in DMSO) and 0.1% of Triton X-100. The sections were incubated overnight at 37 ° C. More cases initially exhibited the GUS expression in the silk scar, pedicle or hilar placental funicular region (<3DAP), then the expression was mainly located in the lower half of the nucleus and pedicle region (3 DAP to 12 DAP). GUS expression became undetectable by dyeing after 12 DAP in more cases. Silks, husks, foliages and roots were also analyzed, and no consistent expression was observed in any of these tissues. The tissue and temporal specificity of the promoter was confirmed in the subsequent generation. All publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are incorporated herein for reference to the same extent as if each individual publication or patent application was specifically and individually incorporated for reference. Although the above invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims. Reservoir Plasmids containing polynucleotide sequences of the invention were deposited on June 29, 2000, with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Virginia USA, 20110-2209, and Access No. assigned PTA -2176. This deposit will be maintained under the terms of the Budapest Treaty in the International Recognition of the Deposit of Microorganisms for the Purposes of the Patent Procedure. In addition, during the reliance on this patent application, access to the deposited crops will be available to the Commissioner of Patents and Trademarks and to persons determined by the Commissioner to be nominated therein under 37 C.F.R. § 114 and 35 U.S.C. § 122. This deposit is simply made as a convenience by those of experience in the art and it is not an admission that a deposit is required under 35 U.S.C. § 112. All restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably eliminated in the granting of a patent. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by government action.

Claims (17)

1. CLAIMS 1. An isolated promoter that is capable of directing transcription in a preferred form of the seed, wherein said promoter comprises a polynucleotide selected from the group consisting of: a) a polynucleotide comprising a variant or functional fragment of at least one 20 contiguous nucleotides of the sequence established in the SEQUENCE OF IDENTITY NO. 1; b) a polynucleotide of the SEJC. ID. DO NOT. 1; c) polynucleotides having at least 65% sequence identity to SEC. ID. DO NOT. 1, wherein the identity of the percent sequence is based on the complete sequence and is determined by GAP analysis under defective parameters; and d) any polynucleotide, the complementary strand of which hybridizes to either a), b) or c) under severe conditions, where severe conditions include hybridization at 42 ° C in a 50% (w / v) formamide solution , 6X SSC, 0.5% SDS, 100 μg / ml salmon sperm, washing with 0.5% SDS and 0. IX SSC at approximately 65 ° C for 30 minutes and repeating.
2. 2. A polynucleotide of. according to claim 1, barley isolate.
3. 3. An expression cassette comprising a promoter according to claim 1, and a nucleotide sequence operably linked to such a promoter, characterized in that the promoter is capable of initiating the transcription and expression of the nucleotide sequence in a seed of a transformed plant. with the expression cassette.
4. 4. A transformation vector comprising an expression cassette according to claim 3.
5. 5. A plant, or its parts, stably transformed with an expression cassette according to claim 3.
6. 6. The parts of the plant in accordance with with claim 5, characterized in that the plant parts are selected from the group consisting of: cells, protoplasts, cell tissue cultures, calluses, cell agglomerations, embryos, pollen, ovules, seeds, flowers, grains, ears, ears, foliages , husks, stems, roots, root tips, stamens and silk.
7. The vegetable according to claim 5, characterized in that the vegetable is a monocot.
8. 8. The plant according to claim 7, characterized in that the monocot is corn, barley, wheat, oats, rye, sorghum or rice.
9. 9. The plant according to claim 5, characterized in that the plant is a dicot.
10. 10. The plant according to claim 9, characterized in that the dicot is soybean, alfalfa, safflower, tobacco, sunflower, cotton or barley.
11. 11. The plant seeds according to claim 5.
12. 12. A method for selectively expressing a first nucleotide sequence in a plant seed, such method comprises transforming a plant with a transformation vector comprising an expression cassette, the cassette of expression comprises a promoter and a first nucleotide sequence operably linked to the promoter, wherein the promoter is capable of initiating the transcription and expression of the first nucleotide sequence in a plant seed, wherein the promoter comprises a second nucleotide sequence selected from the group consisting of: a) polynucleotides comprising a variant or functional fragment of at least 20 contiguous nucleotides of the sequence set forth in the SEQUENCE OF IDENTITY NO. 1; b) a polynucleotide of the SEQUENCE OF IDENTITY NO. 1; c) a polynucleotide having at least 65% sequence identity to the SEQUENCE OF IDENTITY NO. 1 wherein the% sequence identity is based on the complete sequence and is determined by GAP analysis under defective parameters; and d) a polynucleotide, the complement of which hybridizes to either a), b) or c) under severe conditions.
13. The method according to claim 12, characterized in that the first nucleotide sequence encodes a polypeptide involved in the metabolism of fatty acid.
14. 14. The method according to the claim 12, characterized in that the first nucleotide sequence encodes a polypeptide involved in the metabolism of the protein.
15. 15. The method according to claim 12, characterized in that the first nucleotide sequence encodes a polypeptide involved in carbohydrate metabolism.
16. 16. The method according to claim 12, characterized in that the first nucleotide sequence encodes a polypeptide involved in phytohormone biosynthesis.
17. 17. The method according to claim 12, characterized in that the first nucleotide sequence encodes a polypeptide involved in the regulation of the cell cycle.