MXPA99011147A - Specific gene activation by chimeric gal4 transcription factors in stable transgenic plants - Google Patents

Abstract

A method for regulating gene expression in a stably transformed transgenic plant cell utilizing a Gal4 chimeric transcription factor is described.

Description

ACTIVATION OF THE SPECIFIC GENE BY CHEMICAL TRANSCRIPTION FACTORS GAL4 IN STABLE TRANSGENIC PLANTS FIELD OF THE INVENTION The present invention relates to a method for regulating the expression of the transgene using a two-component system and, more particularly, to a specific system for stably transformed plants comprising 1) a promoter containing the binding sites Gal4 and, optionally, additional regulatory elements and ((2) a chimeric transcription factor. which contains a Gal4 binding domain of DNA and an activation domain.

BACKGROUND OF THE INVENTION The improvement of crop plants for a variety of traits, including resistance to diseases and pests, and improvements in grain quality such as oil, starch or protein composition, can be achieved by introducing new or modified genes (transgenes) into the genome. of the plant. The expression of genes including transgenes, in general, < ? F .: 31844 controls by the promoter through a complex group of protein / DNA and protein / protein interactions. Promoters can impart expression patterns that are either constitutive or limited to specific tissues or times during development. There are limitations in the types of expression achieved using the existing promoters for transgenic expression. One limitation is in the level of expression reached. It is difficult to obtain traits that require relatively high expression of an introduced gene, due to limitations in promoter resistance. A second limitation is that the expression pattern conferred by the particular promoter employed is inflexible in that the same pattern of expression dependent on the promoter is conferred from generation to generation.

To impart certain traits, it is desirable to have the ability to regulate the transgenic expression that confers the trait differently in successive generations. An example would be a trait that has a side effect that is detrimental to the viability of the seed, but that is desired in a grain product. For example, it can be contemplated using plant seeds to produce proteins, starches or other substances in grain (seeds of products not used for planting) that are detrimental to the viability of the seed. In this case it would be desirable to carry the transgene that confers the trait in an inactive state on the graft lines until the time of grain production. Then a new type of expression system is required to activate the trait gene in the grain.

Another limitation in current methods of transgenic expression is the inability to coordinately regulate multiple transgenes in transgenic crops. Multiple copies of the same promoter, direct coordinated regulation of multiple genes, can lead to inactivation of the gene through non-detection of the repeated induced gene (Ye and Signer, 1996, Proc. National Acad. Sci. 93: 10881-10886) or another means of cosuppression. Thus, a means for coordinating multiple transgenes is desirable.

Transcriptional activation is regulated mainly by means of transcription factors that interact with enhancer elements and promoters. The binding of transcription factors to such DNA elements constitutes a very important step in transcriptional initiation. The structural and functional analysis of the transcription factors revealed that many of these proteins have a modular protein structure, that is, they are often modular, they are made of a specific DNA binding domain and an activation domain that acts separately and independently. Researchers have found that heterogeneous domains can be combined, the resulting compound activators are functional in mammalian cells. An example of such an activator is the protein produced by fusion of the Gal4 binding domain of DNA with the activation domain of VP16.

Each transcription factor binds to its specific binding sequence in a promoter and activates the expression of the bound encoded region through interactions with coactivators and / or proteins that are a part of the transcription complex. A DNA binding domain and an activation domain derived from different proteins can be linked to produce a chimeric transcription factor. A transcription factor that has been studied is the yeast transcription factor Gal4 which is composed of a DNA binding domain and an activation domain. The native Gal4, a protein of 881 amino acids, is a transcriptional activator of the genes required for galactose catabolism in yeast S. cerevi s ia e. The protein binds specifically to the upstream activation sequence called UASG and activates the transcription of the diverged GAL1 and GALIO transcribed genes.

A two-component transcription factor / promoter system could be used to overcome the above limitations of transgenic expression with existing promoters. For example, a chimeric transcription factor comprising the Gal4 binding domain of DNA could be used as the basis of a two-component gene expression system. In fact, the chimeric transcription factors contain the Gal4 binding domain of DNA and several activation domains have been successfully used in plant cells in transient tests, but not in stable transformations.

The Gal4 binding domain of yeast DNA fused to one or two of its own activation domains was able to activate the expression of a reporter gene of chloramphenicol acetyl transferase (CAT), with the Gal4 binding sites in the promoter, in a transient test in tobacco protoplasts (Ma et al., 1988 Nature 334, p 631-633). The level of expression was similar to that directed by the CaMV 35S promoter. A chimeric transcription factor composed of the DNA binding domain Gal4_ and a coding activation domain of E DNA fragment. col i also of activated expression.

A chimeric transcription factor composed of the Gal4 binding domain of DNA and the proline-rich activation domain of GBF1, a binding transcription factor of the G box of Arabi dops is thaliana of activated expression of the reporter gene in luciferase with the binding sites Gal4 in the promoter when tested in a transient test using cell culture protoplasts of soybean seed (Schindler et al., 1992 EMBO J 11 p 1275-1289). Activated expression was lower than that conferred by the Gal4 activation domain factor of E. col i. Activation by the intact Gal4 protein was not observed, which was speculated to be due to the possible inefficient translation or instability of the protein.

A chimeric transcription factor composed of the Gal4 binding domain of DNA and the activation domain of • PvAlf, a seed-specific transcription factor of Pha s eoel us vu l ga ri s, the activated expression of a CAT reporter gene, with the binding sites Gal4 in the promoter, in a transient test in soy cotyledon cells (Bobb et al., 1995 Plant J 8 p 101-113).

No effect was detected in the binding domain Gal4 of DNA in stably transformed tobacco plants containing the GUS and NPTII reporter genes with the Gal4 sites in their promoters (Reuche et al., 1995 Plant Cell Reports, 14 p 773-776). No expression of the Gal4 DNA binding domain protein was detected.

The Canadian Patent Application Number 2,150,039, which was published on August 9, 1996, describes a method for controlling the expression of genes in transgenic plants using native Gal4 as the transactivator. Specifically, it describes an example in which a GUS reporter gene with the Gal4- sites in its promoter is targeted by the Gal4 protein expressed from the constitutive -CaMV 35S promoter. These two components were introduced into Arabi dopsi root cells and tested on leaf tissue that grows in callus cultures. When this sheet material was dyed for GUSOnly the veins were positive for the expression of the reporter's activity. These results are inconsistent with the expected constitutive expression across the entire sheet and all tissues in other words, the expected result was that the '"GUS expression should have been undistinguished from the GUS example expressed directly from the 35S promoter (Benfey et al., EMBO J 9: 1685-1696 (1990); Odell et al., Nature 313: 810-812 (1985)). Thus, it is likely that the expression that was detected only in the veins is due to the non-functioning of the controlled system described by the 35S promoter. The expression in the veins could be due to the integration of GUS adjacent to an endogenous regulatory sequence that directs the expression in the veins (Sundaresan et al., 1995, Genes &Development 9: 1797-1810; Topping et al., 1994 Plant J. 5: 895-903), or to remove the expression of the promoter operably linked to the GUS coding region. There is no indication that the Gal4 transactivator is expressed and functions to regulate the GUS expression, because it is co-introduced and not added separately to activate the Gal4 site promoter. This result indicates the failure of the transactivation system with Gal4, as found by other researchers, as discussed above.

While it is known that the chimeric Gal / white promoter transcription factor systems can function in plant cells in transient tests, there are only reports of failed or inconclusive attempts to use this type of system in stably transformed plants. Thus, there is a need for a two-component system to regulate transgenic expression. If such a system was available, then other techniques such as those described in the PCT application having the International Application Number WO 92/08341 which was published on May 29, 1992, the disclosure of which is incorporated herein by reference, could used to induce the expression of the trait gene only in the field of production. In other cases, a two component system could be used to amplify the level of expression of a promoter with the tissue specificity or cell type desired, while maintaining the tissue specificity or cell type desired. A two-component system could also be used to coordinately regulate multiple transgenes. In addition, an expression system that reaches expression levels not previously obtained with the known promoters is desirable for traits where high levels of protein levels are required to achieve the traits, such as the expression of a protein that has a content of lysine and / or high methionine which in turn can then improve the composition of amino acids in the seed.

BRIEF DESCRIPTION OF THE INVENTION This invention relates to a method for regulating the expression of the gene in a transiently transformed transgenic plant cell comprising, combining in the genome of the plant cell: (a) a first chimeric gene comprised in the 5 'to 3' direction: (1) a promoter operably linked to at least one Gal4 binding sequence; (2) a coding sequence or a complement thereof operably linked to the promoter; and (3) a polyadenylation signal sequence operably linked to the coding sequence or a complement thereof; with the proviso that when the promoter is a minimal promoter then the Gal4 binding sequence is located upstream of the minimal promoter; Y a second chimeric gene comprised in the 5 'to 3' direction; 1) a promoter; (2) a DNA sequence encoding a DNA binding domain of a Ga14 transcriptional activator; (3) a DNA sequence encoding a transcriptional activation domain operably linked to the DNA sequence of (2); Y (4) a polyadenylation signal sequence operably linked to the DNA sequence of (3); wherein the expression of the second chimeric gene regulates the expression of the first chimeric gene.

In another aspect, the first gene can also comprise at least one regulatory element.

BRIEF DESCRIPTION OF THE FIGURES AND LIST OF SEQUENCES The description of this patent contains at least one drawing made in color. Copies of this patent with color drawings will be provided by the Patent Office and Registered trademark on the request and payment of the necessary fee.

Figure 1 is a graph of the pG4G plasmid containing the chimeric G4G gene in pGEM9Zf. The G4G gene consists of 4 Gal4 binding sites, the promoter region and phaseolin leader 65, the GUS coding region and a sequence region of the 3'-phaseolin polyadenylation signal.

Figure 2 is a graph of the plasmid pPhG4G. This is a modified form of pG4G; it has an additional sequence of the 5 'region upstream of the phaseolin promoter that was added upstream of the G4G gene.

Figure 3 is a graph that compares the synthesis promoters used in the present study, and that represents the combinations between Gal4 elements with other regulatory elements.

Figure 4 is a graph of the plasmid pPh / P-G4Alf. This is the pUC18 plasmid in which the Ph / P-Gal4-PvAlf gene has been inserted. The chimeric gene consists of the promoter and phaseolin leader, the Gal4 DNA binding domain (DE), the PvAlf activation domain (DA) and the 3 'phaseolin signal sequence region.

Figure 5 is a graphic of the plasmid p35S-G4Alf. This is the plasmid. pUCld in which the p35S-Gal4-PvAlf gene has been "inserted." The chimeric gene is as shown in Figure 3, but with the substitution of the 35S promoter and the chlorophyll binding leader protein a / b for the promoter of phaseolin.

Figure 6 is a graph of pPh / P-G4 VP16. This is the pUCld plasmid in. that the chimeric gene Ph / P-Gal4-VP16 has been inserted. The chimeric gene is like that shown in Figure 3, but with the substitution of the activation domain VP16 by the activation domain PvAlf.

Figure 7 is a graph of the plasmid p35S-G4VP16. This is the pUCld plasmid in which the chimeric Ph / P-Gal 4 -VP16 gene has been inserted. The chimeric gene is like the one shown in Figure 4, but with the substitution of the activation domain VP16 by the activation domain PvAlf.

Figure 8 represents the different expression cassettes that encode the chimeric Gal4 activators that are used in this work.

Figure 9 presents the results of the fluoroethic tests demonstrating the specific activation of the GUS reporter gene of pZBL3 by the chimeric transactivator Ph / P-G4VP16 in transgenic tobacco seeds. The genetic crosses were made between different reporter lines (pZBL2 2C, 11A, 4B, pZBL3 2A, 6A, 4B, 3D) and the different effector lines Ph / P-G4VP16 (14A, 15A and 13B).

Figure 10 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter gene of pZBL3 by the chimeric transactivator 35S-G4VP16 in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL2 2C, HA, 4B, pZBL3 2A, 6A, 4B, 3D) and the different effector lines 35S-G4VP16 (12A, 5A and 20A).

Figure 11 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter gene of pZBL3 by Ph / P-G4Alf in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL2C, HA, 4B, pZBL3 2A, 6A, 4B, 3D) and different effector lines Ph / P-G4Alf (17A, 14A and 3B).

Figure 12 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter gene of pZBL3 by 35S-G4Alf in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL2, 2C, HA, 4B, pZBL3 2A, 6A, 4B, 3D) and different effector lines 35S-G4Alf (1A, 4A and IB).

Figure 13 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter genes of pZBL5 by Ph / P-G4VPl6 in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL5, 3F, 2C, 1E, pZBL6 3B, 4F, 8E) and different 'effector lines Ph / P-G4VP16 (14A, 15A and 13B). A highly expressed transgenic line containing -410Ph / P-GUS was used as a control, giving a high level of seed-specific expression. A highly expressed transgenic line of 35S-GUS was used as a control.

Figure 14 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter genes of pZBL5 and pZBL6 by 35S-G4VP16 in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL5, 3F, 2C, 1E, pZBL6 3B, 4F, 8E) and different effector lines 35S-G4VP16 (12A, 5A and A) . A highly expressed transgenic line containing -410Ph / P-GUS was used as a control, giving a high level of seed-specific expression. A highly expressed transgenic line of 35S-GUS was used as a control.

Figure 15 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter genes of pZBL5 and pZBL6 by Ph / P-G4Alf in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL5, 3F, 2C, 1E, pZBL6 3B, 4F, 8E) and different effector lines Ph / P-G4Alf (17A, 14A and 3B). A highly expressed transgenic line containing -410Ph / P-GUS was used as a control, giving a high level of seed-specific expression. A highly expressed transgenic line of 35S-GUS was used as a control.

Figure 16 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter genes of pZBL5 and pZBL6 by 35S-G4VP16 in transgenic tobacco seeds. Genetic crosses were made between different reporter lines' (pZBL5, 3F, 2C, 1E, pZBL6 3B, 4F, 8E) and different effector lines 35S-G4Alf (1A, 4A and IB).

A highly expressed transgenic line that contains -410Ph / P-GUS was used as a control, giving a high level of specific expression of the seed. A highly expressed transgenic line of 35S-GUS was used as a control.

Figure 17 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter genes of pZBL5, pZBL8, pZBL9 and pZBLlO by Ph / P-G4VP16 in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL7 1A, pZBL8 4A, ID, pZBL9 3F, 4F, 7A, and pZBLlO 11H, 6D, 7C) and different effector lines Ph / P-G4VP16 (14A, 15A and 13B). A highly expressed transgenic line containing -410Ph / P-GUS was used as a control, giving a high level of seed-specific expression. A highly expressed transgenic line of 35S-GUS was also used as a control.

Figure 18 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter genes of pZBL7, pZBLd, pZBL9 and pZBLlO by 35S-G4VP16 in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL7 1A, pZBLd 4A, ID, pZBL9 3F, 4F, 7A, and pZBLlO 11H, 6D, 7C) and different effector lines 35S-G4VP16 (12A, 5A and 20A). A highly expressed transgenic line containing -410Ph / P-GUS was used as a control, giving a high level of seed-specific expression. A highly expressed transgenic line of 35S-GUS was also used as a control.

Figure 19 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter genes of pZBL7, pZBLd, pZBL9 and pZBLlO by Ph / P-G4Alf in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL7 1A, pZBL8 4A, ID, pZBL9 3F, 4F, 7A, and pZBLlO 11H, 6D, 7C) and different effector lines Ph / P-G4Alf (17A, 14A and 3B). A highly expressed transgenic line containing -410Ph / P-GUS was used as a control, giving a high level of seed-specific expression. A highly expressed transgenic line of 35S-GUS was also used as a control.

Figure 20 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter genes of pZBL7, pZBLd, pZBL9 and pZBLlO by Ph / P-G4Alf in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (pZBL7 1A, pZBLd 4A, ID, pZBL9 3F, 4F, 7A, y- pZBLlO 11H, 6D, 7C) and different effector lines 35S-G4Alf (1A, 4A and IB).

A highly expressed transgenic line containing -410Ph / P-GUS was used as a control, giving a high level of seed-specific expression. A highly expressed transgenic line of 35S-GUS was also used as a control.

Figure 21 presents the results of the fluorometric tests demonstrating the specific activation of the GUS reporter genes of -65-GUS and PhG4G by 35S-G4Alf or 35S-G4VP16 in transgenic tobacco seeds. Genetic crosses were made between different reporter lines (-65-GUS 5C, PhG4G 17C, 5A) and different effector lines 35S-G4A1Í (1A, IB, 4A) or the effector lines 35S-G4VP16 (12A, 5A, 21A and 20A ). A highly expressed transgenic line containing 35S-G4VP16 was used as a control, giving a high level of expression of the consecutive gene.

SEQ ID NO: 1 is the consensus sequence for a Gal4 binding site SEQ ID NOS: 2-6 are the sequences of the Gal4 binding sites that occur naturally with or are found in the promoters of the genes for galactose catabolism in Sa ccha romyces ceri vi s i a e.

SEQ ID NO: 7 is the central sequence of the RY-G-box-RY element used in Example 3.

SEQ ID NO: 8: is the sequence of the CACA box found in the glycine promoter 2.

SEQ ID NO: 9: is the sequence of the element of the legume box.

'SEQ ID NOS: 10-12 are the sequences of known variations of the RX box in the promoters of the different legume and glycine genes.

SEQ ID NO: 13 is the central sequence of the element Gy2 used in Example 4.

SEQ ID NOS: 14-16 are the known DNA segments that confer response to ABA and VPl.

SEQ ID NO: 17 is the central sequence of the regulatory element Em used in Example 5.

SEQ ID NO: 18 is the central sequence of the regulatory element Cl used in Example 6.

SEQ ID NO: 19 is the regulatory element of the box G used in Example 7.

SEQ ID NOS: 20 and 21 are the critical components of the CHS regulatory element of Unit I used in Example 8.

SEQ ID NO: 22 is Unit I CHS used in Example 7.

SEQ ID NOS: 23 and 24 are the oligonucleotides used to form the cassette of the Gal4 binding site described in Example 1.

SEQ ID NOS: 25 and 26 are the oligonucleotides used to form the cassette of the regulatory element RY-G-caja-RY specific for the seed described in Example 4.

SEQ ID NOS: 27 and 28 are the oligonucleotides used to form the cassette of the glycine-2 regulatory element described in Example 4.

SEQ ID NOS: 29-30 are the oligonucleotides used to form the cassette of the regulatory element Em described in Example 5.

SEQ ID NOS: 31 and 32 are the oligonucleotides used to form the cassette of the regulatory element Cl described in Example 6.

SEQ ID NOS: 33 and 34 are the oligonucleotides used to form the cassette of the regulatory element of box G described in Example 7.

SEQ ID NOS: 35 and 36 are the oligonucleotides used to form the cassette of the CHS regulatory element of Unit I described in Example 8.

BIOLOGICAL DEPOSIT The following plasmid has been deposited under the terms of the Budapest Treaty with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852 and carries the following access number: Plasmid Access Number Deposit Date PZBL1 ATCC 209128 June 24, 1997 DETAILED DESCRIPTION OF THE INVENTION The term "essentially similar" refers to nucleic acid fragments, wherein the changes in one or more nucleotide bases that result in the substitution of one or more amino acids, but does not affect the functional properties of the protein encoded by the sequence of DNA In this way, the "essentially similar" amino acid sequences are those in which the specific proteins have the equivalent function. It is therefore understood that the invention encompasses more than the specific exemplary sequences.

The term "gene" refers to a fragment of nucleic acid that expresses a specific protein or functional RNA, including the regulatory sequences that precede (5 'non-encoded sequences) and that follow (3' non-encoded sequences) the encoded sequence. The "chimeric gene" refers to any gene comprising the regulatory and coding sequences that are found in nature, or the sequences that encode the parts of the proteins that are not naturally bound, or the parts of the promoters that are not naturally occurring. united. Therefore, a chimeric gene could comprise the regulatory sequences and the coding sequences that are derived from different sources, or the regulatory sequences and the coding sequences derived from the same source, but arranged in a different way than that found in nature. "Endogenous gene" refers to a native gene in its natural location in the genome of an organism. A "foreign" gene refers to a gene that is not normally found in the host organism, which is introduced into the host organism by gene transfer. Foreign genes can include native genes inserted into a non-native organism, or chimeric genes. A "transgene" in a gene that has been introduced into the genome by a transformation procedure.

"Coding sequence" refers to a DNA sequence that encodes a specific amino acid sequence. "Regulatory sequences" refer to the nucleotide sequences located upstream (5 'non-coding sequences), within, or downstream (3'-non-coding sequences) of a coding sequence, and which influences the transcription, processing or stability of RNA, or translation of the associated coding sequence. Regulatory sequences include promoters, leader translational sequences, introns and polyadenylation signal sequences.

Promoter 'refers to a DNA sequence involved to control the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3 'to a promoter sequence. The "promoter" includes a minimal promoter which is a short DNA sequence comprised of a TATA box and other sequences that serve to specify the transcription initiation site, to which the regulatory elements are added for the control of expression. The "promoter" also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that are capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of the upstream and downstream elements, the latter elements are often referred to as enhancers. Therefore, an "enhancer" is a sequence of .DNA that can stimulate the promoter activity and could be an innate element of the promoter or a heterologous element inserted to improve the level or specificity of the tissue of a promoter. The promoters could be derived in their entirety from one. native gene, or could be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art, that different promoters could direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. The. promoters that cause a gene to be expressed in most cell types and, in most cases, are commonly referred to as "constitutive promoters". New promoters of various types used in plant cells are constantly being discovered; numerous examples could be found in the compilation by Okamuro and Goldberg, Biochemistry of Plants 15: 1-82, 1989. It is further recognized that because the majority of cases the exact surroundings of the regulatory sequences have not been fully defined, they could have identical activity promoter the DNA fragments of different lengths.

"Regulatory element" refers to a DNA sequence that plays a role in the determination of promoter activity, ie, a regulatory element may play a role in determining the activity of a regulatory sequence. The regulatory elements could affect the level, the specificity of the tissue / cell type and / or the developed expression time. A "regulatory element" could be a part of a promoter, or it could be located upstream of a minimum promoter. DNA sequences considered to be regulatory elements include sequences that have been shown to be target sites for the binding of transcription factors, as well as sequences whose properties have not yet been defined, but are known to have a function due to its elimination from a promoter that affects the expression. The "constitutive" regulatory elements are those that direct the expression in most of the tissues of the plant, through most of the plant's development cycle. The "seed-specific" regulatory elements are those that direct expression in the seed tissue during the development of the seed. There are different types of regulatory elements specific to the seed that could direct expression in different types of seed tissues or at different stages of seed development.

The "leader translation sequence" refers to a DNA sequence located between the promoter sequence of a gene and the coding sequence. The leader translation sequence is present in the processed mRNA completely upstream of the translation initiation sequence. The leader sequence of translation could affect the processing of the primary transcript to the mRNA, the stability or the efficiency of translation of mRNA. (Turner, R. and Foster, G. D. (1995) Molecular Biotechnology 3: 225).

"Non-coding 3 'sequences refer to DNA sequences located downstream of a coding sequence and include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression . The polyadenylation signal is usually characterized by affecting the addition of the polyadenylic acid regions to the 3 'end of the mRNA precursor. The use of the different 3 'non-coding sequences is exemplified by Ingelbrecht et al., Plant Cell 1: 671-660, 1989.

The term "operably linked" refers to the association of the nucleic acid sequences on a single nucleic acid fragment, so that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence when it is capable of affecting the expression of the coding sequence (ie, that the coding sequence is under the transcriptional control of the promoter). The coding sequences can be operably linked to the regulatory sequences in sense or antisense orientation.

A "functional RNA" refers to an antisense RNA, ribozyme or other RNA that is not translated.

The term "expression", as used herein, refers to sense transcription (mRNA) or antisense RNA. The term also refers to the translation of mRNA into a polypeptide.

As used herein, the "Gal4 binding site" refers to the nucleotide sequence shown in SEQ ID NO: 1, or any essentially similar sequence to which the Gal4 binding domain of DNA can be linked. In other words, the terms "link site Gal4" and "terms" link sequence Gal4 'are used here interchangeably. CGGAGGACAGTCCTCCG (SEQ ID NO: i; The Gal4 binding sequence is the consensus sequence of the four Gal4 sites found in the Upstream Activation Sequence (UASG) that controls the expression of yeast GAL1 and the GALIO genes and one of the Gal4 sites found in the GAL7 promoter (Giniger et al., (1985) Cell 40: 767-774). The sequences of the original Gal4 site are presented in SEQ ID NO: 2-β. CGGAGGACAGTCCTCCG (SEQ ID NO: 2) CGGGTGACAGCCCTCCG - (SEQ ID NO: 3) AGGAAGACTCTCCTCCG (SEQ ID NO: 4) CGCGCCGCACTGCTCCG (SEQ ID NO: 5) CGGACAACTGTTGACCG (SEQ ID NO: 6) These different - 'sequences show that some variation can be done on the site. of binding, while maintaining the ability of Gal4 to bind, and the essentially similar sequences would be considered.

As used here, the "promoter of the binding site Gal4"refers to a promoter that is operably linked to at least one Gal4 site. In this manner, the" promoter of the Gal4 binding site "could include combinations such as, but not limited to, at least one Gal4 binding sequence and a minimal promoter, at least one Gal4 binding site and additional regulatory elements with a minimal promoter, a promoter with at least one added Gal4 binding sequence, or a promoter with at least one Gal4 binding sequence and regulatory elements added extras.

As used herein, the "activation domain" refers to a protein domain that has a stimulatory effect on transcription. The natural activation domains are portions of the transcription factors that can be fused to the DNA binding domains and shown to have transcriptional stimulatory effects. The natural activation domains can be altered, where amino acids are replaced or eliminated, without altering the stimulatory effects of transcription (Cress and Triezenberg, 1991, Science 251: 87-90, Drysdale et al., 1995, Molecular and Cellular Biology 15: 1220-1233).

"Transformation" refers to the transfer of a nucleic acid fragment into the genome of a host organism, which results in inheritance could include combinations such as, but not limited to, at least one Gal4 binding sequence and one minimal promoter. , at least one Gal4 binding site and additional regulatory elements with a minimal promoter, a promoter with at least one added Gal4 binding sequence, or a promoter with at least one Gal4 binding sequence and the additional regulatory elements added.

As used herein, the "activation domain" refers to a protein domain that has a stimulatory effect on transcription. The natural activation domains are portions of the transcription factors that can be fused to the DNA binding domains and shown to have transcriptional stimulatory effects. The natural activation domains can be altered, where amino acids are replaced or eliminated, without altering the stimulatory effects of transcription (Cress and Triezenberg, 1991, Science 251: 87-90, Drysdale et al., 1995, Molecular and Cellular Biology 15: 1220-1233).

"Transformation" refers to the transfer of a nucleic acid fragment into the genome of a host organism, which results in genetically stable inheritance. Host organisms that contain the transformed t-nucleic acid fragments are referred to as "transgenic" organisms. Examples of methods of plant transformation include Agrobacterium-mediated transformation (De Blaere et al. (1987) Meth. Enzymol 143: 277) and accelerated particle transformation technology or "gene gun" (Klein et al. (1987) Nature (Loñdon) 327: 70-73; Pat US No. 4,495,050).

This invention provides for the first time a system of the Gal4 chimeric transcription factor / target promoter that functions in stably transformed plants. Specifically, the present invention relates to a method for regulating the expression of the gene in a stably transformed transgenic plant cell comprising combining in the genome of the plant cell: a first chimeric gene comprised in the 5 'to 3 direction (1) a promoter operably linked to at least one Gal4 binding sequence; (2) a coding sequence or a complement thereof operably linked to the promoter; Y (3) a polyadenylation signal sequence operably linked to the coding sequence or a complement thereof; with the proviso that when the promoter is a minimal promoter then the Gal4 binding sequence is located upstream of the minimal promoter; Y a second chimeric gene comprised in the 5 'to 3' direction; (1) a promoter; (2) a DNA sequence encoding a DNA binding domain of a Ga 14 transcriptional activator; (3) a DNA sequence encoding a transcriptional activation domain operably linked to the DNA sequence of (2); Y (4) a polyadenylation signal sequence operably linked to the DNA sequence of (3); : - wherein the expression of the second chimeric gene regulates the expression of the first chimeric gene.

In another aspect, the first gene may further comprise at least one regulatory element.

The promoter of the Gal4 binding site in the first chimeric gene will be activated in the presence of the chimeric transcription factor produced by the second chimeric gene. It is known in the art that the presence of multiple copies of a DNA binding site in a promoter can increase the effectiveness of the promoter (Carey et al., 1990 Nature 345: 361). Thus, the binding site Gal4 in the first chimeric gene, comprises at least one binding site Gal4 having the sequence established in SEQ ID NO: l, or a sequence that is essentially similar. The second chimeric gene encoding the chimeric transcription factor comprises the sequence encoding the DNA binding domain of Gal4, which includes at least the 147 amino terminal amino acids of the Gal4 protein or an essentially similar sequence.

The activation domain can be any amino acid sequence that is capable of stimulating transcription. The activation domain, in general, is derived from a transcription factor or coactivator and it is this portion of the protein that interacts with other proteins involved in transcription, which is why the transcription process is stimulated. Thus, any activation domain that is capable of stimulating transcription can be used for the practice of the invention. Examples of dicotyledonous cells include, but are not limited to, soybean cells, tomato, potato, tobacco, rapeseed oil, sunflower, cotton, alfalfa, peas, beet, chickpea, lentil, lupine, bean, bean. Examples of monocotyledonous cells include, but are not limited to cells of corn, wheat, rye, barley, rice, sorghum.

A first chimeric gene comprising a promoter of the Gal4 binding site and a second chimeric gene encoding a Gal4 binding domain of chimeric DNA / activation domain transcription factor can be introduced into the genome of plant cells using techniques well known to those skilled in the art. These methods include, but are not limited to, (1) direct DNA capture, such as particle bombardment or electroporation (Klein et al (1987) Nature (London) 327: 70-73; US Pat. No. 4,945,050) , and (2) transformation mediated by Agrobacterium (De Blaere et al. (1987) Meth. Enzymol 143: 277).

A first chimeric gene comprising a promoter of the binding site Gal4 operably linked to a gene of interest and the second chimeric gene comprising a binding domain of Gal4 of DNA / transcription factor of the activation domain, are two separate components used for the practice of the invention. Each of these chimeric genes can be transformed separately into the genome of a plant species, such that the transformants that host a component are different from the transformants that host the second component. The two components can then be combined in the genome of a plant by genetic crossing of two transformants that host the two separate components. Thus, the first and second chimeric gene can be combined in the genome of the plant cell by (a) transformation of a plant cell with the first construct, (b) transformation of a second plant cell with the second construct, (b) c) growth of mature fertile plants of the transformed plant cells in (a) and (b) and (d) genetically crossing the transformed plants to produce the progeny whose genome contains the first and second constructions.

Alternatively, the two components could be introduced together in the same genome by transforming both components at the same time into the same cell. Yet another means is for a single component that is to be transformed into the genome, followed by a second transformation with the second component of the cells that already host the first component.

Therefore, in another aspect, this invention relates to plants transformed using the method of the invention and seeds obtained from such plants.

For the purpose of regulating the transcription of a transgene containing the promoter of the Gal4 binding site, this promoter is operably linked to a non-translational leader sequence, a coding region, a 3 'untranslated sequence and a polyadenylation signal sequence. Alternatively, the coding region could be replaced by a sequence that produces a functional RNA that could, on the other hand, mediate the control of gene expression by antisense technology, co-suppression or another expression gene.

The Gal4 binding domain of chimeric DNA / transcription factor of the activation domain could be regulated by any constitutive, tissue-specific promoter, or regulated in developed form. This transcription factor, however, regulates the expression of a transgene that contains the promoter of the binding site Gal4, that is, a promoter operably linked to at least one Gal4 binding sequence. The promoter of the Gal4 binding site contains minimally at least one Gal4 binding site and one TATA box. Additional elements could be present in the promoter of the Gal4 binding site, such as a CAAT box, or the binding sites for one or more transcription factors to part of the Gal4 binding domain of chimeric DNA / activation domain transcription factor . It is known in animal systems that the target of some combinations of transcription factors at the same promoter could produce synergistic effects on the level of expression (Lin et al., 1990 Nature 345: 359).

Further improvement of gene activation by the immediate two-component system can be obtained by the addition of other regulatory elements at the promoter of the Gal4 binding site or upstream of a minimal promoter. Such additional regulatory elements may be, but are not limited to, specific seed elements, constituents and improvers. A variety of elements have been identified that are involved in the expression of gene regulation during seed development. For example, the regulatory element RY of the RY-G box is commonly found in the seed storage protein and the gene promoters of lectin and is necessary for the positive regulation of the expression of the seed-specific gene in glycine. of soybean and the promoters of the β-phaseolin seed storage protein, and the promoter of the β-phaseolin bean seed storage protein (Leliever et al., 1992, Plant Physiol. 98: 3d7-391 Bustos et al., 1991 EMBO J. 10: 1469-1479; Kawagoe et al., 1994 Plant J. 5: dd5-690; Bobb et al., 1997 Nucleic Acids Research 25: 641-647; Dickinson et al. , 1998. Nucleic Acids Research 16: 371, Fuji ara and Beachy 1994, Plant Molecular Biology 24: 261-272, Chamberland et al., 1992, Plant Molecular Biology 19: 937-949). The sequences of the elements RY-G-caja-RY found in the different neutral promoters have variations, but they can be recognized by the presence of particular nucleotide sequences: CATGCAW (the characteristic "RY") and CACGTG (the "G box"). ). One or more copies of the element RY-G-box-RY, shown in SEQ ID NO: 7, or the sequence that is essentially similar, can be introduced into the promoter of the Gal4 binding site or upstream of a minimal promoter to increase the level of expression of the seed-specific gene in plants.

CATGCATGTCTACACGTGATCGCCATGCAA (SEQ ID NO: 7) The glycinein 2 (Gy2) regulatory element of the soy glycine 2 gene promoter contains a CACA element and a legume box, and is required for high-level seed-specific gene expression of this promoter (Leliever et al., 1992, Plant Physiol. 96: 367-391). The nucleotides that are recognized as the CACA elements and the legumin box are presented in SEQ ID NOS: 8 and 9, respectively.

TAACACA (SEQ ID NO: 8) TTCCATAGCCATGCATACTGAATGTCT (SEQ ID NO: 9 In the promoters of the different legume and glycine genes there are variations in the RY box of the legume box. The examples are shown in the SEQ ID NOS: 10-12 (Dickinson et al./ 1998. Nucleic Acids Research 16: 371).

CATGCATG (SEQ ID NO: 10 CATGCAAG (SEQ ID NO: 11) CATGCATA (SEQ ID NO: 12) One or more copies of the element Gy2, as shown in SEQ ID NO: 13, or of the sequence that is essentially similar, may also be used in combination with the Gal4 binding sites to increase the level of expression of the specific gene of the seed in plants.

TAACACACAAGGCTTCCATAGCCATGCATACTGAAGAATGTCT (SEQ ID NO: 13) The regulatory element Em, which includes the elements Emla, Em2 and Emlb of the promoter of the wheat gene Em, is strongly bound for regulation by abscisic acid (ABA) and for the corn transcription factor VP1 in transient tests with protoplasts of corn (Marcotte et al., - 1989, Plant Cell 1: 969-976; Vasil et al., 1995, Plant Cell 7: 1511-1518). Both ABA and VPl are involved in the regulation of gene expression during seed development. The nucleic acid segments that are recognized as the ABA and VPl response elements are shown in SEQ ID NOS: 14-16.

GGACACGTGGC (SEQ ID NO: 14) CGAGCAGGC (SEQ ID NO: 15 GCACACGTGCC (SEQ ID NO: 16 One or more copies of the Em element, as shown in SEQ ID NO: 17, or of the sequence that is essentially similar, may also be used in combination with the Gal4 binding sites to increase the expression level of the specific gene of the seed in plants.

GGACACGTGGCGCGACAGCAGGGACAACGAGCAGGCCGACGCACGTCCGCGTCGC TGCACACGTGCC (SEQ ID NO: 17 The regulatory element Cl, which includes the element GT and the element Sphl of the promoter of the corn Cl gene, is essential for the regulation of ABA and the transcription of VPl (Hattori et al., 1992, Gene &Development 6: 609- 618; Kao et al., 1996, Plant Cell 8: 1171-1179). One or more copies of the Cl element, as shown in SEQ ID NO: 18, or of the sequence that is essentially similar, can also be used in combination with the Gal4 binding sites to increase the expression level of the specific gene of the seed in plants.

GTGTCGTGTCGTCCATGCATGCAC (SEQ ID NO: 18) Box G (CACGTG) is a hexameric element found in many different plant gene promoters. There are many different types of binding factors of the G box with different binding specificities and affinities to its target sites. The sequences flanking the ACGT center affect the binding specificity of the binding factors of the G box (Menkens et al., 1995, TIBS 20: 506-510; Katagiri and Chua, 1992, Trends in Genetics 8: 22-27; Foster and Chua, 1994, FASEB 8: 192-200). One or more copies of the DNA segment containing a portion of the G box, as shown in SEQ ID NO: 19, or a sequence that is essentially similar can be used in combination with the Gal4 binding sites to increase the level of the expression of the constitutive gene or the expression of the tissue-specific gene in plants.

TCCACGTGGC (SEQ ID NO: 19 The combinations between the different sequences of the G box and the Gal4 binding sites can lead to the diversity and specificity of the expression of the plant gene in different tissues and organs. The I CHS unit of the chalcone synthase parsley gene promoter is an inducible element of light required for the activation of the specific gene in the response to light (Weisshaar et al., 1991, EMBO J. 10: 1777-1786; Menkens; et al., 1995, TIBS 20: 506-510). The nucleotides of this element that are recognized to be important for the light response are shown in SEQ ID NOS: 20 and 21.

CCACGTGGCC SEC ID NO: 20) GTCCCTCCAACCTAACC (SEQ ID NO: 21) One or more copies of the I CHS unit, as shown in SEQ ID NO: 22, or a sequence that is essentially similar, can be used especially in combination with the Gal4 binding sites to increase the level of constitutive gene expression .

CCACGTGGCCATCCGGTGGCCGTCCCTCCAACCTAACC (SEQ ID NO: 22) Another type of regulatory element that can improve gene activation by the immediate two-component system is an enhancer element.

Any improver can be added to the promoter of the binding site Gal4, optionally with the element RY-G-box-RY, the element Gy2, the element Em, the element Cl, the element of the box G or the element of unit I CHS. Examples of enhancers are the AT-rich enhancer of the phaseolin promoter (van der Geest et al., 1994 The Plant Journal 6 p 413-423, van der Geest et al., 1997, Plant Molecular Biology 33: 533-557 ), the OCS enhancer of the octopine synthase gene (Greve et al., 1983, J. Of. Molecular and Applied Genetics 1: 499-511), and the 35S virus promoter enhancer of the cauliflower mosaic (Odell et al., 1988, Plant Molecular Biology 10: 263-272).

The standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, EF and Maniatis, T. Mol ecular Cl on in g: A Labora t ory Man ua l; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (later "Maniatis").

The vectors of the plasmid comprising the immediate chimeric genes. they are constructed using conventional techniques well known to those skilled in the art. The choice of plasmid vector (Jones et al., EMBO J. 4: 2411-2418, 1985, De Almeida et al., MGG 218: 78-86, 1989), and thus multiple cases that could be screened for obtain lines that expose the level and the desired expression pattern. Such screening could be performed using conventional techniques well known to those skilled in the art, such as Southern DNA analysis, Northern analysis of mRNA expression, Western analysis of protein expression or phenotypic analysis.

The instant invention provides the means available to express the transgenes by providing a method for regulating the expression of the transgene in stably transformed plants. The method of the invention provides a means to achieve 1) a level of expression higher than the level expressed from the gene promoter of highly expressed seed storage protein, 2) the activation of the expression of grain following a cross-over, ) the coordinated regulation of multiple transgenes and 4) amplification of the level of expression maintaining the expression pattern of a tissue-specific or regulated promoter in developed form.

EXAMPLES The present invention is further defined in the following Examples, in which all parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, which indicate the preferred embodiments of the invention, are given by way of illustration only. From the foregoing description and these Examples, one skilled in the art can find out the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various uses and conditions. .

EXAMPLE 1 Construction of the GUS reporter gene of the Gal4 binding site promoter A promoter consisting of four Gal4 binding sites and a minimum phaseolin promoter which is understood to be 5 'to -65, was constructed from 5' to a beta-glucuronidase (GUS) coding region and a region of the signal sequence polyadenylation of 3 'phaseolin. The four segments of this chimeric gene called G $ G consist of the following: (1) Oligonucleotides containing four copies of the Gal4 DNA consensus sequence as set forth in SEQ ID NO: 1 (Brasselman et al., 1993, PNAS 90: 1657) and the terminal restriction sites. These oligonucleotides have the sequences shown in SEQ ID NOS: 23 and 24.

TCACCGGATCCTACGGAGGAC GTCCTCCGATTTACGGAGGACAGTCCTCCGAAT ATCGATAACGGAGGACAGTCCTCCGATTTACGGAGGACAGTCCTCCGAATTATCT GCAGAATAA (SEQ ID NO: 23) TTATTCTGCAGATAAT CGGAGGACTGTCCTCCGTAAATCGGAGGACTGTCCTCC GTTATCGATATTCGGAGGACTGTCCTCCGTAAATCGGAGGACTGTCCTCCGTAGG ATCCGGTGA (SEQ ID NO: 24) The double-stranded DNA fragment resulting from the template of these two oligonucleotides has a 5 'BamHI site and a 3' PstI site. (2) a Nsil-Ncol fragment extending from -65 of the phaseolin promoter to +77 with respect to the transcription initiation site. The Ncol site had previously been added (Slightom et al., 1991 Plant Mol Biol Man B16: 1). The ends PstI and Nsil are molded and ligated without regeneration of a restriction site. (3) an NcoI-EcoRI fragment containing the uida coding region (GUS; Jefferson et al., 1987 EMBO J 6: 3901). (4) An EcoRI-HindI I I fragment containing the region of the sequence of the phaseolin polyadenylation signal (Slightom et al., 1991 Plan Mol Biol Man B16: l). The G4G chimeric gene with Notl and Xbal sites added to the 5 'BamHI site. in the pGEM9Zf plasmid is called pG4G ( Figure 1 ) .

This chimeric gene was cloned as a BamHI-SalI fragment, after the addition of the SalI 3 'site to the HindIII site, in the binary vector pZBLl Agrobacterium tumefaciens that creates pZBL3. pZBLl contains the origin of replication of pBR322, the kanamycin-resistant gene of the nptl bacterium, the replication and stability regions of the pVSl plasmid of pseudomonas aeruginosa (Itoh et al., 1984), T-DNA borders described by van den Elzen et al., 1985, wherein the OCS enhancer (extending from -320 to -116 of the OCS promoter; Greve et al., 1983, J. Of Molecular and Applied Genetics 1: 499-511), which is a part of the fragment of the right bank, is removed, and a gene of Nos / P-nptlI-0cs3 'to serve as a plant selection marker resistant to kanamycin. Plasmid pZBLl has been deposited with the ATCC and carries the access number 209128.

A second chimeric gene with the binding sites Gal4 in the promoter was constructed identically to G4G with the addition of a DNA fragment located at 5 'to the four binding sites Gal4. This additional DNA fragment is derived from the upstream portion of the phaseolin promoter and is the 1.08 kilobase DNA fragment linked by the EcoRI site at -1471 and the Nsil site at -391, and which contains a region bound to the matrix. and an AT rich enhancer (obtained from Tim Hall, Texas A &M University, van der Geest et al., 1994 The Plant Journal 6 p 413-423, van der Geest et al., 1997, Plant Molecular Biology 33 : 533-557). The partial sequence of this DNA fragment (-890 to -391) is available (GenBank Accession # J01263 M13758) from which a probe can be made to isolate the total EcoRI-Nsil fragment. A fragment of PstI (polylinker site) - Nsil containing these sequences was subcloned into the Nsil site of the vector, pGEM9Zf, so that it could be removed as a Notl-Xbal fragment and then added to the G4G gene to create PhG4G. The construction of the PhG4G gene in a binary vector, a Ba HI 5 'site was first added to the PhG4G gene and then the BamHI-BamHI fragment containing the sequence upstream of the phaseolin promoter (Ph5') was cloned into the BamHI site upstream of the Gal4 sites in the binary pZBL3 vector to form pZBL7. The correct orientation of the Ph5 'fragment was confirmed by restriction enzyme analysis.

A control construct, -65-GUS, consisting of a minimum phaseolin -65 promoter fused to the GUS coding region and the sequence region of the 3'-phaseolin polyadenylation signal was made by fusing an Nsi- fragment. Xbal containing the -65 phaseolin promoter and the GUS coding region with a Xbal-HindIII fragment containing the 3 'phaseolin region at the PstI and HindIII sites of the pSP72 vector. This chimeric gene, without Gal4 sites, was cloned as a BamHI-XhoI fragment at the BamHI and SalI sites in the binary vector pZBLl to form pZBL2.

EXAMPLE 2 Construction of Chimeric Gal4 Transcription Activators A chimeric Gal4-PvAlf transcriptional activator was constructed under the control of a phaseolin promoter -410 (Ph / P-G4Alf) or a Cab leader of the 35S promoter (35S-G4Alf). The chimeric activator gene Ph / P-G4Alf has four segments: (1) a 494 bp HindIII-NcoI fragment of the phaseolin promoter, which extends up to -410 and includes leader sequences up to +77 (Slightom et al. , 1991 Plant Mol Biol Man B16: l), (2) a Ncol-Smal fragment encoding the N-terminal 147 amino acids of the Gal4 DNA binding domain (Ma et al., 1998 Nature 334: 631), (3) a Smal-Sall fragment encoding the 243 N-terminal amino acids of the PvAlf activation domain (Bobb et al., 1995 Plant J 8 p 101-113) -, (4) a 1.2 kb SalI-HindIII fragment containing the phaseolin sequence 3' . In the chimeric activator gene 35S-G4Alf, a HindIII-NcoI fragment of the 35S promoter and the Cab leader was used to replace the phaseolin promoter -410 and the leader sequence in the chimeric gene Ph / P-G4Alf. The CaMV 35S promoter + the leader (cab) of the chlorpyl a / b binding protein includes the 35S promoter sequences extending from 8 bp beyond the (3 'to) binding site of the transcription operably linked to a 60 bp untranslated leader DNA fragment derived from the cab 22L gene (Harpster et al., 1988 Mol.Gen.Gennet 212: 182).

Another activator of chimeric Gal4-VPl6 transcription was also made under the control of a phaseolin promoter -410 (Ph / P-G4VPlβ) or a Cab leader of the 35S promoter (35S-G4VPl 6). A fragment of Ncol-BamHI (BamHI sharpening) encoding the N-terminal 147 amino acids of the DNA binding domain Gal4 and the terminal C amino acids of the VP16 activation domain of the herpes simplex virus (Triezenberg et al., 1988 Genes and Dev 2: 718) was cloned into the Ncol site and the Smal site of the Ph / P-G4Alf or 35S-G4Alf to replace the G4Alf segments.

Each chimeric activator gene was first cloned as a HindIII fragment in the pSK vector of the HindIII site that had a second KpnI site added between the Bam Hl Xbal polylinker sites. The expression cassette of the chimeric activator was then cut as a Kpnl fragment and cloned into the Kpnl site of the binary vector pZ5KAD creating pZ 5KAD-Ph / P-G4A1 f, pZ5KAD-35S-G4Alf, pZ 5KAD-Ph / P- G4VPl 6, pZ5KAD-35S-G4VP16. The binary vector pZ5KAD contains the origin of replication of PBR322, the nptl resistance gene of bacterial kanamycin, the regions of replication and stability of the pVSl plasmid of Ps and udomon as (Itoh et al., 1984), The edges of T-DNA (van den Elzen et al., 1985), and a 35 S / P-ALSR-ALS 3 'gene to serve as a selection marker for the sulphonylurea-resistant plant.

Each construction of the binary vector was transformed into LBA4404 from Agroba c t eri um t umefa ci s, which was then used to inoculate the tissue of the tobacco leaf. The transgenic tobacco plants were obtained essentially by the method of De Blaere et al. (1987) Meth. Enzymol. 143: 277. The selection for the transformed shoots was clorsul forona of 20-50 ppb or 100 mg of kanamycin / 1. The shots were given in 20 mg of chlorsulforone / 1 or 100 mg of kanamycin / l.

EXAMPLE 3 Addition of the RY-G-box-RY regulatory element of the seed to the promoter of the Gal4 binding site Oligonucleotides containing two copies of the consensus sequence of the RY-G-box-RY element (Conceicao and Krebbeers, 1994 Plant J. 5: 493-505; Bustos et al., 1991 EMBO J. 10: 1469-1479; Ka Aug et al., 1994 Plant J. 5: 885-890; Bobb et al., 1997 Nucleic Acids Research 25: 641-647; Dickinson et al., 1998. Nucleic Acids Research 16: 371; Fujiwara and Beachy 1994, Plant Molecular Biology 24: 261-272; Chamberland et al., 1992, Plant Molecular Biology 19: 937-949) and terminal restriction sites BamH I were designed. These oligonucleotides have the sequences shown in SEQ ID NOS: 25 and 26.

GATCCTGCATGCATGTCTACACGTGATCGCCATGCAATTTGGCTCACCCCTCGAG CTGCAGTAGCATGC CAGTCTGTTGCATGCATGTCTACACGTGATCGCCATGCA ATT (SEQ ID NO: 25 GATCAATTGCATGGCGATCACGTGTAGACATGCATGCAACAGACTGAAGCATGCT ACTGCAGCTCGAGGGGTAGGCCAAATTGCATGGCGATCACGTGTAGACATGCATG CAG SEQ ID NO: 26) The double strand DNA fragment resulting from the template of these two oligonucleotides have the BamH I sites as the 5 'and 3' ends. The BamH I 5 'site was a perfect site that could be cut again by BamH I after cloning. The BamH I 3 'site could only be used for ligation. The DNA fragment from the template was directly cloned into the BamH I site upstream of the four copies of the Gal4 binding site of G4G to form (RY-G-caj-RY) 2-G4G. The direct orientation of this RY-G-box-RY element upstream of the Gal4 sites was confirmed by digestion of BamH I. The forming gene (RY-G-ca j a -RY) 2-G4G was cloned as a BamHI-SalI fragment in the binary vector pZBLl creating pZBL4 as described in Example 1.

EXAMPLE 4 Addition of the regulatory element of Glycinin 2 to the promoter of the binding site Gal4 Oligonucleotides containing two copies of the Glycinin 2 (Gy2) element (CACA element plus the legume box) of the glycine-2 legume gene (Lelievre et al., 1992, Plant Physiology 98: 387-391) and the sites were designed. BamH I restriction terminals. These oligonucleotides have the sequences shown in SEQ ID NOS: 27 and 28.

GATCCGTGTAACACACAAGGCTTCCATAGCCATGCATACTGAAGAATGTCTCAAT GGCTCACCCCTCGAGCTGCAGTAGCATGCTTCAGTCTGTGTGTAACACACAAGGC TTCCATAGCCATGCATACTGAAGAATGTCTCAA (SEQ ID NO: 27) GATCTTGAGACATTCTTCAGTATGCATGGCTATGGAAGCCTTGTGTGTTACACAC AGACTGAAGCATGCTACTGCAGCTCGAGGGGTGAGCCATTGAGACATTCTTCAGT ATGCATGGCTATGGAAGCCTTGTGTGTTACACG (SEQ ID NO: 28 The double-stranded DNA fragment resulting from the template of these two oligonucleotides has the BamH I sites at both the 5 'and 3' ends. The template DNA fragment was cloned directly into the BamH I site upstream of the four copies of the Gal4 binding site in G4G to form (Gy2) 2-G4G as described in Example 3.

EXAMPLE 5 Addition of regulatory element Em regulated by ABA- and VPl to the promoter of the binding site Gal4 Oligonucleotides containing two copies of the consensus sequence of the Em element (extending from -152 to -78 from the transcription start site of the wheat Em promoter, Marcotte et al., 1989, Plant Cell 1: 969 were designed. -976; Vasil et al., 1995, Plant Cell 7: 1511-1518) and the terminal restriction BamH I sites. These oligonucleotides have the sequences shown in SEQ ID NOS: 29 and 30.

GATCCTGCCGGACACGTGGCGCGACAGCAGGGACAACGAGCAGGCCGACGCACGT CCGCGTCGCTGCACACGTGCCGCCTTGGCTCACCCCTCGAGCTGCAGTAGCATGCTTCAGTCTGTTGCCGGACACGTGGCGCGACAGCGGGACAACGAGCAGGCCGACG CACGTCCGCGTCGCTGCACACGTGCCGCCT (SEQ ID NO: 29) GATCAGGCGGCACGTGTGCAGCGACGCGGACGTGCGTCGGCCTGCTCGTTGTCCC TGCTGTCGCGCCACGTGTCCGGCAACAGACTGAAGCATGCTACTGCAGCTCGAGGGGTGAGCCAAGGCGGCACGTGTGC GCGACGCGGACGTGCGTCGGCCTGCTCGTT GTCCCTGCTGTCGCGCCACGTGTCCGGCAG (SEQ ID NO: 30 The double-stranded DNA fragment resulting from the template of these two oligonucleotides has the BamH I sites at both the 5 'and 3' ends. The DNA fragment from the template was cloned directly into the BamH I site upstream of the four copies of the Gal4 binding site in G4G to form (Em) 2-G4G as described in Example 3. The (Em) 2 gene Chimeric G4G was cloned as a BamHI-SalI fragment in the binary vector pZBLl creating pZBL5 as described in Example 1.

EXAMPLE 6 Addition of regulatory element Cl regulated by ABA- and VPl to the promoter of the binding site Gal4 Oligonucleotides containing two copies of the Cl element (including the GT element and the Sphl element) were designed (Hattori et al., 1992, Gene &Development 6: 609-618; Kao et al., 1996, Plant Cell 8 : 1171-1179) and the BamH I sites of terminal restriction. These oligonucleotides have the sequences shown in SEQ ID NOS: 31 and 32.

GATCCGCAGTGTCGTGTCGTCCATGCATGCACTTTTGGCTCACCCCTCGAGCTGC AGTAGCATGCTTCAGTCTGTGCAGTGTCGTGTCGTCCATGCATGCACTTT (SEQ ID NO: 31) CATGCTACTGCAGCTCGAGGGGTGAGCCAAAAGTGCATGCATGGACGACACGACA CGATCAAAGTGCATGCATGGACGACACGACACTGCACAGACTGAAGTGCG (SEQ ID NO: 32) The double-stranded DNA fragment resulting from the template of these two oligonucleotides has the BamH I sites at both the 5 'and 3' ends. The template DNA fragment was cloned directly into the BamH I site upstream of the four copies of the Gal4 binding site in G4G to form (C1) 2 -G4G as described in Example 3.

EXAMPLE 7 Addition of the regulatory element of the constitutive box G to the promoter of the binding site Gal4 Oligonucleotides containing four copies of the G box element, TCCACGTGGC (Menkens et al., 1995, TIBS 20: 506-510, Katagiri and Chua, 1992, Trends in Genetics 8: 22-27, Foster and Chua, were designed. 1994, FASEB 8: 192-200) and the BamH I sites of terminal restriction. These oligonucleotides have the sequences shown in SEQ ID NOS: 33 and 34.

GATCCTCCACG GGCTATTCAAT CTCCACGTGGCTGGCTCACCCCTCGAGCTGC AGTAGCATGCTTCAGTCTGTTCCACGTGGCTTCAAGATTTTCCACG GGC (SEQ ID NO: 33) GATCGCCACGTGGAAAATCTTGAAGCCACGTGGAACAGACTGAAGCATGC ACTG CAGCTCGAGGGGTGAGCCAGCCACGTGGAGTATTGAATAGCCACGTGGAG (SEQ ID NO: 34) The double-stranded DNA fragment resulting from the template of these two oligonucleotides has the BamH I sites at both 5 'and 3' ends. The DNA fragment from the template was cloned directly into the BamH I site upstream of the four copies of the Gal4 binding site in G4G to form (G-ca ja) -G4G as described in Example 3. The gene (G- ca) Chimeric 4-G4G was cloned as a BamHI-SalI fragment in the binary vector pZBLl creating pZBLd as described in Example 1.

EXAMPLE 8 Addition of the CHS regulatory element of Unit I inducible to light to the promoter of the binding site Gal4 Oligonucleotides containing two copies of the CHS Unit I element of the chalcone synthase parsley gene were designed (including box I and box II; (Weisshaar et al., 1991, EMBO J. 10: 1777-1786; Menkens et al. al., 1995, TIBS 20: 506-510) and the terminal restriction sites BamH I. These oligonucleotides have the sequences shown in SEQ ID NOS: 35 and 36.

GATCCCCTTAT CCACGTGGCCATCCGGTGGCCGTCCCTCCAACCTAACCTCCCT TGTGGCTCACCCCTCGAGCTGCAGTAGCATGCTTCAGTCTGTCCTTATTCCACGTGGCCATCCGGTGGCCGTCCCTCCAACCTAACCTCCCTTG (SEQ ID NO: 35) GATCCAAGGGAGGTTAGGTTGGAGGGACGGCCACCGGATGGCCACGTGGAATAAG GACAGACTGAAGCATGCATCTGCAGCTCGAGGG_GTGAGCCACAAGGGAGGTTAGG TTGGAGGGACGGCCACCGGATGGCCACGTGGAATAAGGG (SEQ ID NO: 36) Each copy of the Unit I CHS element is underlined and the conserved nucleotides are in bold. The double-stranded DNA fragment resulting from the template of these two oligonucleotides has the BamH I sites at both the 5 'and 3' ends. The DNA fragment from the template was cloned directly into the BamH I site upstream of the four copies of the Gal4 binding site in G4G to form (CHS-Unit I) 2-G4G as described in Example 3 EXAMPLE 9 _ Addition of the AT- enhancer of phaseolin to the promoter of the binding site (RY-G-caj-RY) 2-Gal 4 An additional DNA enhancer fragment was introduced upstream of the binding sites (RY-G-box-RY) 2-Gal4. As described in Example 1, this AT enhancer was derived from the upstream portion of the phaseolin promoter (Ph5 ') which extends from an EcoRI site at -1471 to an Nsil site at -391, and which contains a region bound to the matrix and an AT enhancer (obtained from Tim Hall, Texas A &M University, van der Geest et al., 1994 The Plant Journal 6 p 413-423, van der Geest et al., 1997 , Plant Molecular Biology 33: 533-557). To construct the Ph5 '- (RY-G-ca j a-RY) 2-G4G gene in a binary vector, the BamHI-BamHI fragment containing Ph5' as described in Example 1, was cloned into the current BamHI site above the sites (RY-G-box-RY) 2-Gal4 in the binary vector pZBL4 to form pZBLd. The correct orientation of the PhS 'fragment was confirmed by the analysis of the restion enzyme.

- EXAMPLE 10 Addition of the phaseolin AT enhancer to the promoter of the binding site (Em) 2-Gal4 As in Example 9, the phaseolin- AT enhancer was also introduced into the GUS reporter gene of the binding site (Em) 2-Gal4 promoter. To construct the Ph5 '- (Em) 2 -G4G gene in a binary vector, the BamHI-BamHI fragment containing Ph5' as described in Example 1, was cloned into the BamHI site upstream of the (Em) 2 sites -Gal4 in the binary vector pZBL5 to form pZBL9. The correct orientation of the Ph5 'fragment was confirmed by analysis of the restion enzyme.

EXAMPLE 11 Addition of the AT- enhancer of phaseolin to the promoter of the binding site (box-G) 4-Gal 4 As in Example 9, the phaseolin- AT enhancer was also introduced into the GUS reporter gene of the binding site promoter (G-ca j a) -Gal4. To construct the gene Ph5 '- (G-ca ja) 4-G4G in a binary vector, the BamHI-BamHI fragment containing Ph5' as described in Example 1, was cloned into the BamHI site upstream of the sites ( G-caj) 4-Gal4 in the binary vector pZBLd to form pZBLlO. The correct orientation of the Ph5 'fragment was confirmed by analysis of the restion enzyme.

EXAMPLE 12 Genetic crossing of transgenic tobacco plants The primary transformations were transferred to the soil and grew in a growth chamber maintained during a cycle of 14 hr, 21 ° C of day, 10 hr ~ 18 ° C at night, with approximately 80% relative humidity, under white fluorescent and incandescent light.

The plants grew to maturity and hand polinations were performed using a slight modification of the procedure of Wernsmañ, E.A. and D. F. Matzinger in Hybridizat ion of Crop Plants W.R. Fehr and H. Hadley, eds, pp. 657-668 (1980). Briefly, the flowers of the plants to be used as the female parents were selected on the day before the anthesis; the corolla was divided longitudinally, the anthers were removed and the stigma was pollinated with the pollen of the flowers of the male plants that the anthers were allowed to grow on the plant. To avoid contamination of the pollen to reach the stigma, a length of 4 cm of a cocktail shaker, one end capped with modeling clay, slid over the stigma and style and remained in the place of the corolla. Each flower was marked. The capsules were allowed to grow to maturity and then harvested.

The genetic crosses were carried out in the R0 generation (primary transformants) between the effector plants carrying a chimeric transcription factor and the reporter plants carrying a GUS gene from the promoter of the Gal4 binding site. Three independent transgenic tobacco plants containing a reporter gene were individually crossed to the three independent transgenic lines containing an effector gene. Reporter plants were also crossed to wild-type tobacco plants that serve as a control for the level of expression of the gene in the absence of the effectors.

EXAMPLE 13 Testing the expression of the transgene in the seed Fx seeds from transgenic crosses were analyzed for GUS activities. For each sample of approximately 100 seeds (30 mg) they were rapidly frozen in liquid N2 and grown in 0.5 ml of GUS lysis buffer (NaH2P0 / 50 M Na2HP04, pH 7, 10 mM EDTA, 0.1% Triton X-100, 0.1% of Sarcosil, b-Mercaptoethanol 10 mM). Following a high speed centrifugation of 15 min at 4 ° C, the supernatant was collected and stored at -70 ° C until it was tested. For the GUS test, 25 μl of the GUS lysis buffer was first added to each individual well of a 96-well fluorometric microtiter plate (Titretek Fluoroplate: ICN Biomedicals). One microliter of each sample extract was added in 25 μl of GUS lysis buffer in each well. One hundred and fifty microliters of the freshly prepared MUG substrate (4-met ilumbeliferil-b-D glucuronide 1.7 mM (Sigma) in Lysis buffer GUS) was added to each well. The reaction was stopped by adding 75 μl of 0.6 M Na2C03 at 0, 30, 60 and 120 minutes after the addition of MUG substrate. Fluorescence was detected and quantified using a Perkin-Elmer LS-3B spectrometer. The activities of the samples were determined from a standard curve constructed by plotting the amount of the MU (p ol) standards against their measured fluorescence intensities. Protein tests were performed on the same sample extracts using the Bio-rad Protein Assay System (Hercules, CA) following the manufacturer's instructions for the microtiter plate protocol. The GUS activities were then calculated as pmol / min / mg of protein.

As shown in Figures 9-12, the chimeric G4VP16 and G4Alf transcription factors, under the control of the phaseolin promoter or the 35S promoter, specifically activated the promoter of the Gal4 binding site. This activation of the gene required the specific Gal4 binding sites in the response promoters, because gene activation was not detected in reporter lines pZBL2, which are the control without Gal4 sites in the promoter.

For example, in Figure 9, the IL lanes show the GUS activities in the Fi seed resulting from the crossing of line 2A of pZBL3 (which carries the promoter gene, ie, the GUS gene driven by the promoter from the site of Gal4 binding) with the wild-type (WT) plants or the Ph / P-G4VP16 14A, 15A or 13B lines (which, with the exception of the wild-type negative control, carry the chimeric transcription factor under the control of the promoter of specific phaseolin of the seed). Lane 1, in this way shows the background level of expression when the chimeric transcription factor is not provided: J-L show -the range of expression levels that were obtained with both components of the present system. All are clearly greater than the control, which indicates that the chimeric transcription factor is activating the previous transcription of the antecedent level. The majority of the crosses were made using three additional pZBL3 transgenic lines. The M-R lanes show the results of the pZBL3 6A, 4B and 3D reporter lines of the crossing with a simple 14A Ph / P-G4VP16 line (lanes N, P, R) and the WT control (lanes M, O, Q). Again, the chimeric transcription factor activates the GUS expression well above the background levels in all crosses.

The specificity of this gene activation system was also demonstrated. Lanes A and B show the GUS activities in the Fi seed, which result from the crossing of a pZBL2 2C control plant (a minimum promoter lacking from the Gal4 binding sites) with WT or Ph / P-G4VP16 from line 14A . The activation of the Gal4 binding sites present is not observed.

Figures 10-21 are read in a similar manner as described in Figure 9.

As shown in Figures 13-16, the Em element regulated by ABA- and VPl or the constitutively regulated G box element were also used in combination with the Gal4 binding sites. The chimeric G4VP16 and G4Alf transcription factors, under the control of the phaseolin promoter or the 35S promoter, specifically activated the promoter (pZBL5) of the binding site (Em) 2-Gal4 or the promoter (pZBL6) of the binding site (box G) -Gal4 used to express the GUS reporter gene in stable transgenic tobacco seeds. As shown in Figure 13, the level of gene activation, conferred by combining the sites of the box G and Gal4 together (pZBLd), is much higher than that obtained from the Gal4 sites alone (pZBL3) (compare the level of GUS activity in lane N in Figure 13 to lane N in Figure 9). Lane Q shows the level of GUS activity in the seed of a highly expressed Ph / P-GUS line. This is the control of the Ph / P-GUS line previously described (Odell et al., 1994 Plant Phys. 106: 447) which contains a phaseolin promoter -410. Lane R shows the GUS activity in the seed of a highly expressed 35S-GUS line, which is derived from the p'ZloxAG transformants described in Russell et al. 1992 Mol. Gen. Genet. 234: 49. Examples of the two-component expression system demonstrated in lane N of Figure 13, as well as in lane O of Figure 14, and lane P of Figure 15, had expression levels that are greater than those of phaseolin promoter. Many more examples in these figures had the expression that is greater than that of the 35S promoter.

Figures 17-20 show the activation of the promoters containing an AT rich enhancer from the 5 'region of the phaseolin promoter located upstream of the Gal4 sites (pZBL7), the sites (RY-G-caj-RY). ) 2-Gal4 (pZBL8), sites (Em) 2-Gal4 (pZBL9) or sites (G-ca ja) 4-Gal4 (pZBLlO). The transcription factors G4VP16 and G4Alf chimeric. under the control of the phaseolin promoter or the 35S promoter, specifically activated the Gal4 sites in pZBL7, pZBLd, pZBL9 and pZBLlO to express in GUS reporter gene in stable transgenic tobacco seeds. The level of GUS activities in the Fi seed that results from the crossing of the pZBL7, pZBLd, pZBL9 or pZBLlO plants to the WT plants indicates the level of background expression of the GUS gene constructs in these plants. In the two-component Gal4 system that includes the specific elements of the seed or the constituent elements and an A-rich enhancer, the regulatory elements work together to further activate the expression of the gene and increase the level of gene expression.

As shown in Figures 9-20, the activation levels vary in the crossings between the different transformed lines. The highest activation was achieved when an effector line Ph / P-G4VP16 (14A) or a Ph / P-G4Alf line (17A) crossed with reporter lines pZBL9 3F, 4F or pZBLlO 11H, 7C (Figure 17, lanes L, N, T, Z, Figure 9, lane L). The best expression level of the gene conferred by this Gal4 system of two components in the seeds, was about 3 folds higher than that conferred by the phaseolin promoter (compare lanes L and A 'in Figure 17) and approximately 17 folds greater than the 35S promoter (compare lanes L and B 'in Figure 17). Similar, but at much lower activation levels were achieved when they were used as effectors 35S-G4VP16 and 35S-G4Alf (Figures 18 and 20).

In this way, the two-component regulatory system of the invention that is based on at least one Gal4 binding site and optionally the regulatory elements,, and the Gal4 DNA binding domain, in conjunction with an activation domain, was "Successful in the activation of gene expression in the seed that hosts both components of the system." The most effective lines were able to direct expression at a level greater than 3 folds than that obtained from the highly active phaseolin promoter.

EXAMPLE 14 Test of transgenic expression in seed plants Fi tobacco seed plants from genetic crosses were also analyzed for GUS activities. For each cross analyzed, approximately 50 seeds were germinated and grown in humid sand at room temperature (20 ° C) under fluorescent lights for 14 days. Seed plants (including leaf and root tissue) were grown in 1.0 ml of GUS lysis buffer. The GUS tests and the protein tests were done as described above. As shown in Figure 21, G4Alf and G4VPI6 were driven by the 35S promoter, the expression gene was specifically activated in stable transgenic tobacco seed plants. The highest activation levels were achieved in the genetic crossing between the effector lines 35S-G4VP16 and the reporter line PhG4G 17C (lanes O, P). The highest level of expression of the gene conferred by this system of expression of the Gal4 gene of two components in tobacco seed plants, was approximately the same level as that conferred by the 35S promoter (compare lanes P and R). Activation was not observed below the background when no Gal4 binding sites (-65-5C, lanes A-D) are provided. Activation of the specific gene was obtained in the seed plants with 35S-G4Alf, but to a lesser degree (lanes E-L). In all cases, it can be observed that the use of different individual transformants for the reporter and the effector, results in activation levels that differ. Those skilled in the art will recognize this as the manifestation of the "position effects" commonly observed in the families of transgenic plants (Jones et al., EMBO J. 4: 2411-2418, 1985; De Almeida et al., MGG 218: 78-86, 1989).

In this manner, the regulation system of the two-component gene of the invention, which is based on at least one binding site Gal4 and optionally additional regulatory elements and the Gal4 binding domain of DNA, in conjunction with an activation domain , was successful in the activation of gene expression in seed plants that host both components of the seed. The most effective lines were able to direct the expression to the same level as that obtained from the highly active 35S promoter.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: (A) ADDRESS: E DUPONT OF NEMOURS AND COMPANY (B) STREET: 1007 MARKET STREET (C) CITY: WILMINGTON (D) STATE: DELAWARE (E) COUNTRY: UNITED STATES OF AMERICA AMERICA (F) CP. 19898 (G) TELEPHONE: 302-992-5481 (H) TELEFAX: 302-773-0164 (I) TELEX: 6717325 (ii) TITLE OF THE INVENTION: ACTIVATION OF THE SPECIFIC GENE BY MEANS TRANSCRIPTION FACTORS GAL4 CHEMICALS IN STABLE TRANSGENIC PLANTS (iii) NUMBER OF SEQUENCES: 36 (iv) AVAILABLE COMPUTER FORM (A) TYPE OF MEDIA: DISKETTE, 3.50 INCHES (B) COMPUTER: IBM COMPATIBLE PC (C) OPERATING SYSTEM: MICROSOF WINDOWS 95 (D) SOFTWARE: MICROSOFT WORD VERSION 7. OA (v) DATE OF CURRENT APPLICATION: (A) NUMBER OF APPLICATION: (B) DATE OF PRESENTATION: (C) CLASSIFICATION: (vi) DATE OF PREVIOUS APPLICATION: (A) NUMBER OF APPLICATION: 08 / 881,687 (B) DATE OF SUBMISSION: 24"OF JUNE 1997 (vii) ATTORNEY / MANDATORY INFORMATION (A) NAME: CHRI STENBURY, LYNNE M. (B) REGISTRATION NUMBER: 30,971 (C) REFERENCE / REGISTRATION NUMBER: BB-1078 '-A (2) INFORMATION FOR SEQ ID NO: l (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iü) HYPOTHETICAL: YES (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: CGGAGGACAG TCCTCCG 17 (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) iii) HYPOTHETICAL: NO i) ORIGINAL SOURCE: (A) ORGANISM: Saccharomyces cerevisiae (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2 CGGATTAGAA GCCGCCG 17 (2) INFORMATION FOR SEQ ID NO: 3 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic: (iii) HYPOTHETICAL: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Saccharomyces cerevisiae (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: CGGGTGACAG CCCTCCG 17 (2) INFORMATION FOR SEQ ID NO: 4 i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Saccharomyces cerevisiae (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4: AGGAAGACTC TCCTCCG 17 (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic; (vi) ORIGINAL SOURCE: (A) ORGANISM: Saccharomyces cerevisiae (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: CGCGCCGCAC TGCTCCG 17 (2) INFORMATION FOR SEQ ID NO: 6 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Saccharomyces cerevisiae (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: CGGACAACTG TTGACCG 17 (2) INFORMATION FOR THE SEC ID YEAR: 7: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "element RY-G-caja-RY" (iii) HYPOTHETICAL: YES (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: CATGCATGTC TACACGTGAT CGCCATGCAA 30 (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 7 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO ix) CHARACTERISTICS :, (A) NAME / KEY: my c_enla zamiento (B) LOCATION: 1..6 (D) OTHER INFORMATION: / function = "caja CACA" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8: TAACACA 7 (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: TTCCATAGCC ATGCATACTG AATGTCT 27 (2) INFORMATION FOR SEQ ID NO: 10: i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 8 base pairs (B) TYPE: 'nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 10 CATGCATG (2) INFORMATION FOR SEQ ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 8 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11 CATGCAAG (2) INFORMATION FOR SEQ ID NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 8 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 12 CATGCATA (2) INFORMATION FOR SEQ ID NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (ix) FEATURE: (A) NAME / KEY: my s c_caracteris tica JJB) LOCALIZATION: 1..7 (D) OTHER INFORMATION: / standard name = "CACA box" (ix) CHARACTERISTICS: (A) NAME / KEY: my s c_characteristic (B) LOCALIZATION: 14..43 (D) OTHER INFORMATION: / standard name = "leguminous box" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13: TAACACACAAA GGCTTCCATA GCCATGCATA CTGAAGAATG TCT 43 (2) INFORMATION FOR SEQ ID NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 11 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14: GGACACGTGG C 11 (2) INFORMATION FOR SEQ ID NO: 15: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 9 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 15: CGAGCAGGC 9 (2) INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 16: GCACACGTGC C 16 (2) INFORMATION FOR SEQ ID NO: 17: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 67 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO ix) CHARACTERISTICS: (A) NAME / KEY: my c_characteristic (B) LOCATION: 1..11 (D) OTHER INFORMATION: / standard name ^ "Element E the" ix) FEATURE: (A) NAME / KEY: my sc_characteristic (B) LOCATION: 28..36 (D) OTHER INFORMATION: / standard name ^ "Element Em2" ix) FEATURE: (A) NAME / KEY: my c_characteristics (B) LOCATION: 57..67 (D) OTHER INFORMATION: / standard name = "Emlb element" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 17: GGACACGTGG CGCGACAGCA GGGACAACGA GCAGGCCGAC GCACGTCCGC 50 GTCGCTGCAC ACGTGCC 67 (2) INFORMATION FOR SEQ ID NO: 18: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 18: GTGTCGTGTC GTCCATGCAT GCAC 24 (2) INFORMATION FOR SEQ ID NO: 19: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 10 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (ix) FEATURE: (A) NAME / KEY: my c_characteristics (B) LOCATION: 2..8 (D) OTHER INFORMATION: / standard name = "portion of box G" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 19: TCCACGTGGC 10 (2) INFORMATION FOR SEQ ID NO: 20: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 10 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: YES (ix) FEATURE: (A) NAME / KEY: my c_characteristic (B) LOCATION: 2..7 (D) OTHER INFORMATION: / standard name = "box element G * (xi) DESCRIPTION OF SEQUENCE: SEC ID NO: 20: CCACGTGGCC 10 (2) INFORMATION FOR SEQ ID NO: 21 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii HYPOTHETICAL: NO (ix) FEATURE: (A) NAME / KEY: my sc_characteristic (B) LOCATION: 2..7 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 21: CGGATTAGAA GCCGCCG 17 (2) INFORMATION FOR SEQ ID NO: 22 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (ix) FEATURE: (A) NAME / KEY: my c_characteristic (B) LOCATION: 2..7 (D) OTHER INFORMATION: /.standard name = "portion of box G ' (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 22: CCACGTGGCC ATCCGGTGGC- CGTCCCTCCA ACCTAACC 3¡ (2) INFORMATION FOR SEQ ID NO: 23: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 119 pairs' of bases (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL NO ix) CHARACTERISTICS: (A) NAME / KEY: proteí na_enla zada (B) LOCATION: 14..30 (D) OTHER INFORMATION: / enlace_radical = "domain of linkage Gal4 ' (ix) CHARACTERISTICS: (A) NAME / KEY: protein_enla zada (B) LOCATION: 36..52 (D) OTHER INFORMATION: / enlace_radical = "domain of linkage Gal4 ' (ix) CHARACTERISTICS: (A) NAME / KEY: proteí na_enla zada (B) LOCATION: 64..80 (D) OTHER INFORMATION: / enlace_radical = "linkage domain Gal4 'ix) FEATURE: (A) NAME / KEY: protein_enda zada (B) LOCATION: 86..102 (D) OTHER INFORMATION: / enlace_radical = "domain linkage Gal4 ' (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 23: TCACCGGATC CTACGGAGGA CAGTCCTCCG ATTTACGGAG GACAGTCCTC 50 CGAATATCGA TAACGGAGGA CAGTCCTCCG ATTTACGGAG GACAGTCCTC 100 CGAATTATCT GCAGAATAA "119 (2) INFORMATION FOR SEQ ID NO: 24 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 119 base pairs (B) TYPE: nucleic acid (C) "HEBRA: simple. (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) FEATURE: (A) NAME / KEY: protein_in the fold (B) L0CALIZAC1ÓN: 18..34 (D) OTHER INFORMATION: / enlace_radical = "linkage domain Gal4 ' (ix) FEATURE: (A) NAME / KEY: linked_protein (B) LOCATION: 40..56 (D) OTHER INFORMATION: / radial_link = "Gal4 binding domain" (ix) CHARACTERISTICS: (A) NAME / KEY: protein_enda zada (B) LOCATION: 68..84 (D) OTHER INFORMATION: / enlace_radical = "domain of linkage Gal4 ' (ix) FEATURE: (A) NAME / KEY: linked_protein (B) LOCATION: 90..106 (D) OTHER INFORMATION: / radial_link = "Gal4 binding domain" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 24: TTATTCTGCA GATAATTCGG AGGACTGTCC TCCGTAAATC GGAGGACTGT 50 CCTCCGTTAT CGATATTCGG AGGACTGTCC TCCGTAAATC GGAGGACTGT 100 CCTCCGTAGG ATCCGGTGA 119 (2) INFORMATION FOR SEQ ID NO: 25: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 113 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) CHARACTERISTICS: (A) NAME / KEY: my c_caract eristic (B) LOCATION: 8..37 (D) OTHER INFORMATION: / standard name ^ "element RY-G-caja-RY" (ix) FEATURE: (A) NAME / KEY: my sc_characteristic (B) LOCATION: 82..111 (D) OTHER INFORMATION: / standard name = "element RY-G-box-RY" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 25: GATCCTGCAT GCATGTCTAC ACGTGATCGC CATGCAATTT GGCTCACCCC 50 TCGAGCTGCA GTAGCATGCT TCAGTCTGTT GCATGCATGT CTACACGTGA 100 TCGCCATGCA ATT 113 (2) INFORMATION FOR SEQ ID NO: 26: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 113 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) FEATURE: (A) NAME / KEY: my c_characteristics (B) LOCATION: 7..36 (D) OTHER INFORMATION: / standard name = "element RY-G-box-RY" (ix) FEATURE: (A) NAME / KEY: my c_characteristic (B) LOCATION: 81..110 (D) OTHER INFORMATION: / standard name = "element RY-G-box-RY" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 26: GATCAATTGC ATGGCGATCA CGTGTAGACA TGCATGCAAC AGACTGAAGC 50 ATGCTACTGC AGCTCGAGGG GTAGGCCAAA TTGCATGGCG ATCACGTGTA 100 GACATGCATG CAG 113 (2) INFORMATION FOR SEQ ID NO: 27 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 143 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) CHARACTERISTICS: (A) NAME / KEY: my s c_caract eri s t i ca (B) LOCATION: 9..51 (D) OTHER INFORMATION: / standard name ^ "element Gy2" ix) FEATURE: (A) NAME / KEY: my s c_caracteri s t i ca (B) LOCATION: 98..140 (D) OTHER INFORMATION: / standard name = "element Gy2" (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 27: GATCCGTGTA ACACACAAGG CTTCCATAGC CATGCATACT GAAGAATGTC 50 TCAATGGCTC ACCCCTCGAG CTGCAGTAGC ATGCTTCAGT CTGTGTGTAA 100 CACACAAGGC TTCCATAGCC ATGCATACTG AAGAATGTCT CAA 143 (2) INFORMATION FOR SEQ ID NO: 28 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 143 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) CHARACTERISTICS: (A) NAME / KEY: my c_enla zamient o (B) LOCATION: 8..50 (D) OTHER INFORMATION: / standard name = "element Gy2" (ix) CHARACTERISTICS: (A) NAME / KEY: my sc_caract er i s t ica (B) LOCATION: 97..139 (D) OTHER INFORMATION: / standard name ^ "element Gy2" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 28: GATCTTGAGA CATTCTTCAG TATGCATGGC TATGGAAGCC TTGTGTGTTA 50 CACACAGACT GAAGCATGCT ACTGCAGCTC GAGGGGTGAG CCATTGAGAC 100 ATTCTTCAGT ATGCATGGCT ATGGAAGCCT TGTGTGTTAC ACG 143 (2) INFORMATION FOR SEQ ID NO: 29 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 195 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) FEATURE: (A) NAME / KEY: my sc_characteristic (B) LOCATION: 10..76 (D) OTHER INFORMATION: / standard name = "regulatory element Em (ix) CHARACTERISTICS: (A) NAME / KEY: my s c_caract erí s t i ca (B) LOCATION: 125..191 (D) OTHER INFORMATION: / standard name = "regulatory element Em? (xi) DESCRIPTION OF, THE SEQUENCE: SEQ ID NO: 29 GATCCTGCCG GACACGTGGC GCGACAGCAG GGACAACGAG CAGGCCGACG 50 CACGTCCGCG TCGCTGCACA CGTGCCGCCT TGGCTCACCC CTCGAGCTGC 100 AGTAGCATGC TTCAGTCTGT TGCCGGACAC GTGGCGCGAC AGCAGGGACA 150 ACGAGCAGGC CGACGCACGT CCGCGTCGCT GCACACGTGC CGCCT 195 (2) INFORMATION FOR SEQ ID NO: 30: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 195 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) FEATURE: (A) NAME / KEY: my sc_caract er i s t ica (B) LOCATION: 9..75 (D) OTHER INFORMATION: / standard name = "regulatory element Em? (ix) FEATURE: (A) NAME / KEY: my s c_caract er i s t i ca (B) LOCALIZATION: 124..190 (D) OTHER INFORMATION: / standard name = "regulatory element Em '' (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30: GATCAGGCGG CACGTGTGCA GCGACGCGGA CGTGCGTCGG CCTGCTCGTT 50 GTCCCTGCTG TCGCGCCACG TGTCCGGCAA CAGACTGAAG CATGCTACTG 100 CAGCTCGAGG GGTGAGCCAA GGCGGCACGT GTGCAGCGAC GCGGACGTGC 150 GTCGGCCTGC TCGTTGTCCCTGCTGTCGCG CCACGTGTCC GGCAG 195 (2) INFORMATION FOR SEQ ID NO: 31: i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 105 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) CHARACTERISTICS (A) NAME / KEY: my s c __characteristic character (B) LOCATION: 9..32 (D) OTHER INFORMATION: / standard name = "regulatory element Cl ' (ix) CHARACTERISTICS: (A) NAME / KEY: misc_caract erí sica (B) LOCATION: 79..102 (D) OTHER INFORMATION: / standard name = "Regulatory element Cl ' (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 31: GATCCGCAGT GTCGTGTCGT CCATGCATGC ACTTTTGGCT CACCCCTCGA 50 GCTGCAGTAG CATGCTTCAG TCTGTGCAGT GTCGTGCGT CCATGCATGC 100 ACTTT 105 (2) INFORMATION FOR SEQ ID NO: 32: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 105 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear. (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc oligonucleotide ' (iii) HYPOTHETICAL: NO (ix) CHARACTERISTIC: (A) NAME / KEY: my c_caract eristic (B) LOCATION: 8..31 (D) OTHER INFORMATION: / standard name = "regulatory element Cl ' (ix) FEATURE: (A) NAME / KEY: my c_characteristic (B) LOCATION: 78..101 (D) OTHER INFORMATION: / standard name = "regulatory element Cl ' (xi) DESCRIPTION "OF THE SEQUENCE: SEQ ID NO: 32: GATCAAAGTG CATGCATGGA CGACACGACA CTGCACAGAC TGAAGCATGC 50 TACTTGCAGCT CGAGGGGTGA GCCAAAAGTG CATGCATGGA CGACACGACA 100 CTGCG 105 (2) INFORMATION FOR SEQ ID NO: 33 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 105 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) CHARACTERISTICS: (A) NAME / KEY: my c_characteristic (B) LOCATION: 6..15 (D) OTHER INFORMATION: / standard name = "box element G dodecamérico" (ix) FEATURE: (A) NAME / KEY: my sc_caract eristic (B) LOCATION: 26..35 (D) OTHER INFORMATION: / standard name = "box element G dodecamérico" (ix) CHARACTERISTICS: (A) NAME / KEY: my c_caract erí s tica (B) LOCATION: 76..85 (D) OTHER INFORMATION: / standard name = "box element G dodecamérico ' (ix) FEATURE: (A) NAME / KEY: my c_caract er i s t i ca (B) LOCATION: 96..105 (D) OTHER INFORMATION: / standard name = "box element G dodecamerico ; xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 33 GATCCTCCAC GTGGCTATTC AATACTCCAC GTGGCTGGCT CACCCCTCGA 50 GCTGCAGTAG CATGCTTCAG TCTGTTCCAC GTGGCTTCAA GATTTTCCAC 100 GTGGC 105 (2) INFORMATION FOR SEQ ID NO: 34: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 105 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) CHARACTERISTICS: (A) NAME / KEY: my s c_caract er i s t i ca (B) LOCALIZATION: 5".. 14 (D) OTHER INFORMATION: / standard name =" box element G dodecamérico " (ix) FEATURE: (A) NAME / KEY: my c_characteristic (B) LOCATION: 25..34 (D) OTHER INFORMATION: / standard name = "dodecamérico G box element" (ix) FEATURE: (A) NAME / KEY: my c_characteristic (B) LOCATION: 75..84 (D) OTHER INFORMATION: / standard name = "dodecamérico G box element" (ix) CHARACTERISTICS: (A) NAME / KEY: my c ‡ erractic cís (B) LOCATION: 95..104 (D) OTHER INFORMATION: / standard name = "box element G dodecamérico" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 34: GATCGCCACG TGGAAAATCT TGAAGCCACG TGGAACAGAC TGAAGCATGC 50 TACTGCAGCT CGAGGGGTGA GCCAGCCACG TGGCGTATTG AATAGCCACG 100 TGGAG 105 (2) INFORMATION FOR SEQ ID NO: 35: i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 149 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) CHARACTERISTICS: (A) NAME / KEY: my sc_caract eristic (B) LOCATION: 13..50 (D) OTHER INFORMATION: / standard name = "regulatory element of the I CHS unit" (ix) FEATURE: (A) NAME / KEY: my c_characteristic (B) LOCATION: 105..142 (D) OTHER INFORMATION: / standard name = "regulatory element of the I CHS unit" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 35: GATCCCCTTA TTCCACGTGG CCATCCGGTG GCCGTCCCTC CAACCTAACC 50 TCCCTTGTGG CTCACCCCTC GAGCTGCAGT AGCATGCTTC AGTCTGTCCT 100 TATTCCACGT GGCCCATCCG TGGCCGTCCC TCCAACCTAA CCTCCCTTG 149 2) INFORMATION FOR SEQ ID NO: 36 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 149 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (iii) HYPOTHETICAL: NO (ix) FEATURE: (A) NAME / KEY: my sc_characteristic (B) LOCATION: 12..49 (D) OTHER INFORMATION: / standard name = "regulatory element of the I CHS unit" (ix) FEATURE: (A) NAME / KEY: mcaracteri s t i ca (B) LOCATION: 104..141 (D) OTHER INFORMATION: / standard name ^ "regulatory element of the I CHS unit" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 36: GATCCAAGGG AGGTTAGGTT GGAGGGACGG CCACCGGATG GCCACGTGGA 50 ATAAGGACAG ACTGAAGCAT GCATCTGCAG CTCGAGGGGT GAGCCACAAG 100 GGAGGTTAGG TTGGAGGGAC GGCCACCGGA TGGCCACGTG GAATAAGGG 149 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Having described the invention as above, the content of the following is claimed as property.

Claims (11)

. CLAIMS

1. A method for regulating the expression of the gene in a stably transformed transgenic plant cell, characterized in that it comprises combining in the genome of the cell of the plant: (a) a first chimeric gene comprised in the 5 'to 3' direction: (1) a promoter operably linked to at least one Gal4 binding sequence; (2) a coding sequence or a complement thereof operably linked to the promoter; Y (3) a polyadenylation signal sequence operably linked to the coding sequence or a complement thereof; with the proviso that when the promoter is a minimal promoter then the binding sequence Gal4 is located upstream of the minimum promoter; and; b) a second chimeric gene comprised in the 5 'to 3' direction; (1) a promoter; (2) a DNA sequence that encodes a DNA binding domain of a Gal4 transcriptional activator (3) a DNA sequence encoding a transcriptional activation domain operably linked to the DNA sequence of (2); Y 4) a polyadenylation signal sequence operably linked to the DNA sequence of (3); wherein the expression of the second chimeric gene regulates the expression of the first chimeric gene.

2. A method according to claim 1, characterized in that the first gene further comprises at least one regulatory element.

3. A method according to claim 1, characterized in that the first gene further comprises a minimal promoter and at least one regulatory element located upstream of the binding sequence Gal4.

4. A method according to claim 2 or 3, characterized in that the regulatory element is selected from the group consisting of a specific element of the seed or a constituent element.

5. A method according to claim 4, characterized in that - the regulating element also comprises an enhancer.

6. A method according to claim 2 or 3, characterized in that the regulatory element is selected from the group consisting of RY-G-BOX-RY, Em, Cl, Gy2, G-Box, CHS Unit 1 or the 5 'enhancer of a phaseolin promoter.

7. A method according to claim 1, 2 or 3, characterized in that the first and second constructions are combined in the genome of the plant cell by (a). Transforming a cell of the plant with the first construct, (b) transform a second cell of the plant with the second construction, (c) grow the mature fertile plants from the cells of the transformed plants in (a) and (b) and (d) cross genetically the transformed plants to produce the progeny whose genome contains the first and second construction.

8. A method according to claim 1, 2 or 3, characterized in that the transcriptional activation domain is an acid transcriptional activation domain.

9. A method according to claim 1, 2 or 3, characterized in that the DNA sequence encoding the transcriptional activation domain is obtained from the transcription factors selected from the group consisting of PvAlf or VP16.

10. A transformed plant, characterized in that it has at least one gene whose expression is regulated using the method of claim 1, 2 or 3.

11. The seeds, characterized in that they are obtained from the plant of claim 10.