CA2263891A1 - Enhanced transgene expression in a population of monocot cells employing scaffold attachment regions - Google Patents

Abstract

A method of increasing transgene expression in a population of monocot plant cells is described which involves the use of a DNA construct comprising, <u>inter alia</u>, at least one chicken lysozyme gene locus scaffold attachment region.

Description

ENHANCED TRANSGENE EXPRESSION IN A POPULATION OF MONOCOT CELLS E~'LOYING SCAFFOLD
Al-rACHMENT REGIONS

FIELD OF THE INVENTION
The present invention ~cl~ns to a method of increasing transgene e~ f s~.on and. in particular, to a method for ine~ea~ g l~ g~ lc e~ sion in a population of monocot cells using DNA constructs having at least one sc~ffold ch...P..~ region.
BACKGROUND OF THE rNVENTION
Improvement of crop plants for a variety of traits, including disease and pest reci~t~nre, and grain quality i~ ro~.,lll.,.ll~ such as oil, starch or protein c~nlposilion, can be achieved by introclucing new or modified genes into the plant geno~llc. However, traits .~ uhiilg relatively high ~ ;,ion of an inhoduced gene ("h~sgcinc") may not be ~(lr;- r~, or may be ~ f,d at very low L~luenc~
within a large population of L~ rullllauls. Accordingly, it is ~-rce,~-. y to prepare and analyze a large nurnber of in~e~f ~ t h~,ru- ---~nt~ in order to identify a plant with an c~ rejsion level that is adequate for producing the desired trait bec.~ e there is no reprodl)cib}e method for ~p~;llg a population of indepen-if nt stably tr~n~ru~ ...ed cells ~ll~,.e". the a~ gf ~les~ion level is incl~ased.
Scaffold h11~rhll--ont regions (SARs), also known in the art as matrLx ~cl-mf nt regions (MARs), cause various effects on the c~ession of L~ ge~rs SARs are DNA fra~n~nt~ comrri~ing specific nucleotide se.lu. nces that are a~le to bind to nuclear matrix plc~alions.derived from e.~ o~ic cells. SARs may be either con~ u~;~/e or h~ienl (Gef7~nhçrg et al. (1994) J. Cell Biol. 5~:22).
Transient SARs are thought to te.~olaL;ly attach a promoter region to the nuclear matrix. It is specul~ted that ~ rll...P .l is infll~nred by cell type, stage of deve!opment, or cQntlition~ of gene c~leision. Col,~ re SARs are thought to be found at the boundaries of DNA loop ~-)m~inc that are L, ~ ;on~lly independent. In ~nim~lc, the effects of SARs on c~lei~ion of an associated sgelle have been shown to include one or more of the following: position intlep.on~l~nee copy number dcl,e~-~e~-~-e, increased level of c~ ;on, and cluced v~ tion of c~les;~ion (Stief et al. (1989) Na~ure 341 :343; Bonifer et al.
(1990) EMBO J 9:2843; Klewz et al. (1991) Biochemistry 30:1264; McKnight et al. (1992) PNAS 89:6943).
PCT Application hsving Tnt~rn~tion~l Publication Number WO 94/07902 and published on April 14, 1994 desc~ibes a method for increasing ~ ;ssion and red..ring ~ ession variability of foreign genes in plant cells which uses a DNA

COnal~u~;l CO~ ;a~g, inter alia, a scaffold ~ ",r.~ region positioned either 5' to a ~.ans~ tion iniSi~tiort region or 3' to a structural gene.
Avlalnov~ et al., JCB S~rpfem~nt D (21B), page 129 (1995) plca~,led at the Keystone Mc~t;"g April 4-10 (1995), 1licr.lo5eS tne use of a yeast MAR to 5 1c~ c gene e~ c~a;ùn in maize cell lines. Also rlicrlosecl is a maize Adhl MAR that did work and a maize Mhal MAR that did not work in regltlstti~ gene cA,ulci,aion in maize cell lines.
In plants, the .c~u,l~d effects of SARs on l.a.~sgc.le ck~lc~aion have been quite variable. Breyne et al. ((1992) 171e Plan~ Cell 4:463) ~cl~G~ d that a SAR
10 from tobacco ,cduced the ~v~ialiûll of l~n~;g~ ~rL~lc~aiOll level among a population of tobacco !.~ r~ pruduccd by Ag~ùb~~ .,...cfo~ tinn In this study, the red~rtion in variability was due to c~ of e,.~,c~sion levcls at the low end of the obsci. ~, ,1 range of eA~,~;.sion level a7ld co.~ l,ote el;.";" ~ "
of lines from the high range. Thus, the aYerageL.~c~a;OIl level for the ~u~
15 of I . n..cr.... ,.~ was dewca3ed. In ~ jtirln, ~ ."cc of a SAR derived from the hurnan ,B-globin locus had no effect on either the v~;~liu~ or the rangc of , ~ -P eA~C;~
A SAR deriYed from a soyl,.,~ heat shock gene locus was shown to confer a 5 to 9 fold i"c.ca~e in l-.. -c~ L~ c~a;u~l in tob~cco plants Ir ~fu ~ ~d by 20 Agrob~ (Schoffl et al. (1993) TF~~r~rliC Research 2:93). The IIr~ ..f.
t~EJ.csa;on level correlated with !. -Ag. ..f copy ~ ., hu~ c~,r L~,G;,sion levels across the pûpul~ttinn of a~ ~jed ~-~ ,cr~ was highly variable.
A yeast SAR was able to confer 12-fold higher average cA~lcJa;on of a 25 ~cl~u~l~" gene ih~hud~ec~ into tobacco cells by particle bomba,~.,~ r~; .t.
Ir~ r~ ;on (Allen et al. (1993) The Plant Cell 5:603). Little reAllrtion in variation among ;i~A-,~f ~ l lines was obsG.~d. Ratherthan ob ~,.v~g copy number d~ .fe, lmes with higher copy n~..~.l-.. ~a actually had lower levels of lc~aiùiL
Allen et al. ((1996) The Plant Cen 8:899), using a tobacco SAR, obsel r~d 60-fold higher average ~ e~ ,r e.~ ;on in tobacco cells ~ ~"~r.~ Pd by particle bombald,l.. .~t, with in~lCasl~ d variation among it~lc~el~A~ -I lines.A SA~ located in the U~J~Ll Ca~lL region of the bean phaseolin ~lu.l.otel was shown to confer reduced variability and slightly hlc~cc,sed levels of c,.l,lcssion of 35 r~ ~UlL_l tr, ~g~r~s among ;..~ .cr~" . . ~ ; of Agrob.~
Ll~rUlll.ed tobacco plants (van der Geest et al. (1994) The Plant Jo2~rnal 6(3):413).

A SAR derived from the locus of the chicken Iysozyme gene greatly reduced variability of llallsg. nc e~l,resaion arnong independent, Agrobacterium-transforrned tobacco plants (Mlynarova et al. ( 1994) The Plant Cell 6:417). Theaverage e~ieasion level was increased approximately 4-fold, but the maximurn 5 expression level in any single transforrnant was no higher than plants transformed with constructs that did not contain SARs.
Thus, it is clear from the above discussion that the inclusion of nucleic acid fr~gmrnt~ encoding SARs in DNA constructs which are ~ arolllled into plant cells affect eA~ie~SiOn of associated l~lsgclles. However, the effect on 10 eA~ression is variable, and may be dependent on the nature of the host cell, the source of the SAR, and the means for introd~lcing ll~sg.,nes into host cells.
Moreover, no one heretofore has dçrnol-cl all,d the effect of the çhi5 L~rn lyaOGylllc gene locus SAR on e~ression of L~di~sgelles in a population of monocot plant cells.
SUMMARY OF THE INVENTION
In one em~o~lim~nt this invention con~e . ..~ a method for hlcl~ ~g the level of ~A~re.,sion of a hai~sgclle in a population of mon-)cot cells which comprises:
(a) tran~full,ling the population with a DNA construct which 20 comprises:
(1) a l,~ g. .-e COlll~liaillg, in the 5' to 3' direction:
(i) a promoter;
(ii) a coding sequence operably linked to the promoter;
and (iii) a polyadenylation signal sequence operably linked to the coding sequence; and (2) at least one chicken Iyso;~ylllc gene locus sc~ffokl ~tt~chmrnt region vvll~re;ll the scaffold nll~rk~ I region is positioned 5', 3', or 5' and 3' of the h~ e4 ~; and (b) incubating the transformed population under conditions suitable for cell growth.
In another embodiment this invention concerns a population of monocot cells co~ g a DNA construct which comprises:
- (1) a transgene comprising, in the 5' to 3' direction:
(i) a promoter;
(ii) a coding sequence operably linked to the promoter;
and W O 98/16650 PCT~US97/17709 (iii) a polyadenylation signal sequence operably linked to the coding sequence; and (2) at least one chicken lysozyme gene locus scaffold rhment region wherein the scaffold ~tt~t~hment region S is positioned 5', 3', or 5' and 3' ofthe llallsgenc.
BRIEF DESCRIPTION OF FIGURE~ AND SEOUENCE LISTINGS
Figure 1 is a diagram of the plasmid pMH40. The chimeric gene fr~m~ntc depicted in this figure are defined as follows: 35S/P-cabL n,l.r~,3enl~ a BamHI to NcoI f~m-ont, GUS r~les~ an NcoI to KpnI L~ .t, and NOS 3' 10 repl~se.~ts a KpnI to SalI fiMgmFnt The vector sequences are derived from pGEM9Zf and contain the ampicillin reeiet~nre gene.
Figure 2 is a diagram of the plasmid p40A53. A chimeric gene coneietin~
of the 35S/P-cabL, the GUS coding region, and NOS 3' region, is bounded by the rhi~k~n Iy~o;~;y~l.e locus SAR ("A cl~ ..f .1") The 5' A cl~ ~IF~ is located bet~veen Bam~II and Bam/Bgl sites, and the 3' A cle~ l is located between SalI and SpetXbaI. "J" refers to the junction point b~ BamHI and BglII sites in one case, and XbaI and SpeI sites in the other c~e.
Figure 3 is a ~phi~ ,S~ on of GUS ~ c activities in SAR(+) and SAR(-) BMS lines. Data from lines that had .lle~ able GUS enzyn~e activity are shown (n=15 for SAR(-) lines and n=28 SAR(+) lines).
SEQ ID NOs: 1 and 2 are the pair of oli~t n~ leotides ~nCo~1in~ the polylinker Lag~ ,l-t that was used to modify the 3' end of the A el~m~nt in order to facilitate col~h- ction of p40A53.
SEQ ID NOs:3 and 4 are the pair of oligonucleotides enco.1in~ the polylinker fragment that was used to modify the 5' end of the A el~ment in orderto f~rilit~te construction of p40A53.
BIOLOGICAL DEPOSIT
The following pl~mid has been deposited under the terms of the B~ rest Treaty with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852, and bears the following accession nurnber:
Plasmid Accession Number Date of Deposit p40A53 ATCC 97725 September 20, 1996 DETAILED DESCRIPTION OF T~E INVENTrON
l~is invention provides a method to illclease Lldnsgene e~ession in a 35 population of monocot plant cells by using DNA constructs comprising, inter alia, at least one chicken Iysozyme gene locus S f~R. The term "population" as used herein refers to a grouping of monocot cells in culture or as part of a plant or seeds PCTrUS97/17709 W O 9~/166S0 thereof. Specifically, the inclusion of a chicken Iysozyme gene locus SAR in DNA constructs used to transforrn monocot plant cells has a 2-fold effect:
( I ) transgene eX~Ie5SiOn as measured over the entire population of individual transformants is increased, and (2) the highest levels of transgene e~cprei,sion by 5 SAR-cont~ining individual transformants is increased over individual non-SAR-cont~ining transformants, i.e., transformants with identical transgenes lacking SARs.
Monocot cells which can be used to practice the present invention include a group of monocotyledonous plants P~mples of which are corn, wheat and rice.
DNA constructs used to transform a population of monocot plant cells compnse:
(1) a llansgene comprising in the 5' to 3' direction:
(a) a promoter;
(b) a coding sequence operably linked to the promoter; and (c) a polyadenylation signal sequence operably linked to the coding se-~u~nce; and (2) at least one chi~ n Iysozyme gene locus SAR positioned 5', 3' or 5' and 3' of the Ir~lsgcne.
The chicken lysozyme gene locus SAR-llansgcllc construct can be 20 introduced into the monocot genome using techniques well known to those skilled in the art. These methods include, but are not lirnited to, (I) direct DNA uptake, such as particle bom~ elll or cle~t~opol~ion, and (2) Agroba.;l~.iu~ d;s~ed r~ tion.
Fnh~ncçm~nt of t.~lsgcne eAyles~lon by such SARs may be practiced 25 with any transgene that is regulated by a co~ , tissue-specific or developn.- ..~s lly regulated promoter. The h ~ieF lf may encode a protein product or may produce a functional RNA that may, in turn, m~ te control of gene eA~.Ie~ion by ~ntic~nce, co-su~less;on or other gene e~yle~ion tec~nology.
"Gene" refers to a nucleic acid fragment that c~y~esses a specific protein or 30 specifies the production of a f~mction~l RNA, inrlu(ling regulatory sequencespreceding (5' non-coding sequences), following (3' non-coding sequences) and within the coding sequence. "Native gene" refers to a gene as found in nature with its own regulatory sequences. "Chimeric gene" refers to any gene that is not a native gene, comprising regulatory and coding sequences that are not found 35 together in nature. Accordingly, a chimelic gene may comprise regulatory sequences and coding sequences that are derived from dirrele.ll sources, or regulatory sequences and coding sequences derived from the same source but arranged in a manner different than that found in nature. "Endogenous gene"

.

refers to a native gene in its natural location in the genome of an or~nism. A
"foreign" gene refers to a gene not normally found in the host org~niqm, but that is introduced into the host organism by transformation. Foreign genes can comprise native genes inserted into a non-native org~ni.qrn, or chimeric genes. A
5 "transgene" is any gene that is introduced into the genome of an organism through a transforrnation procedure.
"Coding sequence" refers to a DNA sequence that codes for a specific arnino acid sequence or a functional RNA. "Regulatory sequences" refer to nucleotide sequences located U~ak~ (S' non-coding sequences), within, or 10 do~lla~ ll (3' non-coding sequences) of a coding sequence, and which influence the transcription, proc~csing, stability and subsequent translation o~the transcribed RNA. Regulatory sequences include promoters, enh~n~ers, introns, translation leader sequences and polyadenylation signal sequences.
"Promoter" refers to a DNA se~lu~l,ce capable of co~trolling the ~Al.les~ion 15 of a coding sequence. In general, a coding sequ~,ncc is located 3' to a promoter sequence. The promoter sequence CG~ of proximal and more distal U~
elçment~, the latter cl~."e..l~ often rer~ d to as e ~h~ -~ a Acco,dingly, an "enh~n-~er" is a DNA se~lu~,lce which can stim~ te promoter activity and may be an irmate el~m~nt of the promoter or a heterologous ele.lle.lt i~;~s~,ted to e~h~nce 20 the level or tissue-specificity of a promoter. Promoters may be derived in their en~ ly from a native gene, or be co~ osed of dirr~ element~ derived from di~le~lt promoters found in nature, or even compriqe synthetic DNA se~ o,l1~ It is understood by those skilled in the art that di~le,ll promoters may direct theex~lCSSiQn of a gene in dirr~,.e,lt tissues or cell types ("tissue-specific"), or at 25 different stages of development ("develop~ lly regulated"), or in response todifferent enviroll~rlenlal conditions (see OL~ , J. K. and Goldberg, R. B. In The Biochemistry oJPlants; Ac~d~nic Press: New York, 1989; Vol. 2, pp 1-82;
and Goldberg, R. B. et al. (1989) Cell 56:149; and the lGÇe,ences cited therein).
Promoters which cause a gene to be ~;A~ ,ssed in most cell types at most times are 30 commonly referred to as '~cons~ ;ve promoters". It is further recognized thatsince in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of dirr~ ~lt lengths may have identical promoter activity.
The 'ltr~nql~tion leader sequence" refers to a DNA sequence located 35 bet~,veen the ~ sc,;~tion start site of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA u~ n of the translation start sequence, and may affect one or more of li1e following:

W O 98/166S0 rCT~US97/17709 processing of the primary transcript to mRNA, mRNA stability and translation efficiency. Turner, R. and Foster, G. D. (1995) Molecular Biotechnology 3:225.
The "3' non-coding sequences" refer to DNA sequences located downstream of a coding sequence and include polyadenylation signal sequences 5 and other sequences encoding regulatory signals capable of affecting mRNA
processing or gene ~ e;,sion. Ingelbrecht, I. L. W. et al. (1989) Plant Cell 1:671 .
The term "operably linlced" refers to nucleic acid sequences on a single nucleic acid fragrnent which are ~s~ori~ted so that the function of one is affected 10 by the other. For example, a promoter is operably linked with a coding sequence when it is capable of affecting the eA~lession of that coding sequence (i.e., that the coding sequence is under the tr~neçriptional control of the promoter).
Coding sequences can be operably linked to regulatory sequences in sense or anti~nse ori~nt~tion "Sense ol;&~ ;Ollll refers to the a~ genlent of 15 regulatory sequences and coding se.lu,nces wL~ n Lldilsc~;~tion will result in production of an RNA ~ cc~ t that can be tran~l~tçcl into the polypeptide encoded by the coding se.~ CC. "~nti~n~e orientatiol-" refers to the ~lang~
of regulatory se.luences and coding se.l.~c~ cs ~lle.ehl Llalls~ )tion will result in pro~lu~tion of an RNA IranS~ t that is comple.~ ly to all or part of a target 20 ~ llal ~ ~ails~ t or mRNA and that blocks the ~l.le;,~ion of a target gene.
The term "~lession", as used herein, refers to the l~ sc~ on of sense (rnRNA) or anti~Pn~e RNA derived from the nucleic acid La~lllclll of the invention. The term "~ ,ssion" may also include subsequent trand~tion of mRNA into a polypeptide. ~ l;c~lce inhibition" refers to the prod~ction of 25 ~ntie~n~e RNA transcripts and the resl~lting su~ ,sj;on of the e~l~,~;,ion ofidentical or çss~ntially similar foreign or endogenous genes (U.S. Patent No.
5,107,065 the disclosure of which is hereby incollJolaled by ~if~lence).
"Ovele~ .,sion" refers to the production of a gene product in lr~sgel~ic orgs~ni~m~ that ex~ ee~'c levels of production in normal or non-transforrned 30 orgsni~mc "Co-suppression" refers to the production of sense RNA Llallscl;~t~and the resulting ~up~lesiion of the ~ es~ion of identical or e~entislly similarforeign or endogenous genes (U.S. Patent No. 5,231,020 the disclosure of which is hereby incorporated by l~f~ cc).
'lTrall~ llationll refers to the transfer of a nucleic acid fragment into the 35 genome of a host cell, resulting in genetically stable inheritance. Host cells conts.ining the transformed nucleic acid fr~gm~nts are referred to as "transgenic"
cells, and orgsinism~ comprising lransgellic cells are referred to as "transgenic orgS~ni~m~". Examples of methods of transforrnation of plants and plant cells CA 0226389l l999-02-23 W O 98/166S0 PCTnUS97/17709 include Agrobacteriurn-mediated transforrnation (De Blaere et al. ~1987) Meth.
Enzymol. 143:277) and particle bombardment technology (Klein et al. (1987) Nature (London) 327:70-73; U.S. Patent No. 4,945,050). Whole plants may be regenerated from transgenic cells by methods well known to the skilled artisan (see, for example, Fromm et al. (1990) Bio/Technolo~ 8:833).
By the method disclosed herein, transgene e~cl,les~ion in a transformed population of monocots can be enh~n~e~i over expression in monocots that have been transformed with ll~lsgenes lacking at least one chicken Iysozyme gene locus SAR. Accordingly, the. method is useful for increasing eA~lcssion levels of desirable polypeptides. Moreover, more effective control of gene eA~.e3sion by ~ntieçnee or co-:iU~ ssion technologies may be achieved by a~ru.~ lg higher levels of ~A~.es~ion of fimCtio~ (i.e., ~ntieence or sense) RNA !.t.
EXAMPLES
The present invention is further defined in the following eA~ s. It will be l--~rstood that the ~ 'es are illustrative only and the present invention is not limited to uses ~escriberl in the ~Y~mrles From the above di~c~leeion and the following eY~mrlç~e~ one skilled in the art can as~ hl~ and without d~lillg from the spirit and scope thereof, can make various cll~r ees and modifications to the invention to adapt it to various uses and conditions. All such mo-lific~tion.e are intentled to fall within the scope of the claims.
Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are ~les~ribed more fully in Sambrook, J., Fritsch, E.F. and M~ni~ti~ T. Molecular Cloning:A Laboratory Manual; Cold Spring Harbor Laboldlol~ Press: Cold Spring Harbor, 1989 (hereinafter "Maniatis").

Construction of SAR-Tl~lsgelle Expression Vectors The plasmid pMH40 (Figure 1) col--r.. ;:5GS the following genetic cle ,.
a CaMV 35S promoter, cab leader, the uid4 coding region, and the NOS
polyadenylation signal se.lu~ ce~ The CaMV 35S promoter is a 1.3 kb DNA
fragment that extends 8 bp beyond (i.e., 3' of) the tl~lselil,~ion start site. The cab leader is a 60 bp untr~nsl~t~d leader DNA rragllle~ll derived from the chlorophyll a/b ("cab") binding protein gene 22L (Harpster et al. (1988) Mol. Gen. Genet.
212: 182). The cab leader was operably joined to the 3' end of the 35S plOl~lO~
fr~m~nt The uid4 coding region, which encodes the ~-glucuronidase protein ("GUS"; Jefferson et al. (1987) EMBO~ 6:3901) was operably linked to the 3' end of cab leader. Finally, an 800 bp DNA fragrnent co~ the polyadenylation signal sequence region from the nopaline synthase gene ("NOS";
Depicker et al. (1982) ~ Mol. Appl. Genet. 1:561) was operably linked to the uidA

W O 98/166S0 PCT~US97117709 coding region. These DNA frR~m~r~t~, together comprising a 35S-GUS chimeric gene, were inserted by stand_rd cloning techniques into the vector pGEM9Zf (Promega; Madison WI) to yield plasmid pMH40. pMH40, re~,ese~lling a SAR(-) construct, was used in control experiments in order to establish b_seline values of expression in the absence of scaffold ~tt~chment regions.
The chicken Iysozyme gene locus SAR is contAined on a 3 kb fragment of DNA that is located between 8.7 kb _nd 11.7 kb UlJs~ (i.e., S') of the chirl~n Iysozyme gene coding region (Phi-Van, L. and Stratling, W. H. (1988) EMBO~
7:655). This SAR, also called the "A elç ~e .1", is present in the plRCmid pUC-B-l-Xl (Phi-Van, L. and Stratling, W. H., supra) as a BamHI-XbaI
L .g.~-f .t, and is flanked by the following restriction sites: KpnI and SmRI on the 5' side; and SR~I, PstI and SphI on the 3' side.
For insertion of an A cl~ on the 5' side of a 35S-GUS chimeric gene that is identical to that in pMH40 except for a ~holt~.~ed NOS 3' L~l.le,lt of 300 bps, the following double stTRn~l~d oligrm~cleotide polylinker was inserted into pUC-B-l-Xl that had been previously ~ligçsted with Xb~ and PstI:

5' - CTAGAGAATTCAGATCTCTGCA - 3' (SEQID NO:I) 3' - TCTTAAGTCTAGAG - 5' (SEQ ID NO:2).
This mRnip~ tion resulted in deletiQn of the S~I site and introduction of EcoRI and BglII restriction c~ c sites b~ . ee.l the XbaI and PstI sites presentat the 3' end of the A clt ..~ ~ The A cle ..P~ was then excised ~ a BarnHI-BglII
25 fragment and ins~lte~ into the BamHI site located at the 5' end of the 3SS
promoter of the 35S-GUS chimeric gene.
For insertion of an A el~ ~"~ .1 on the 3' side of the 35S-GUS cl-im~nc gene, the following double ~ dcd oligonucleotide polylinker was inserted into pUC-B-l-Xl that had been previously ~ligested with KpnI and BarnHI:

5' - GTACCGTCGACGAATTCG - 3' (SEQ ID NO:3) 1111111111'1111 3' - GCAGCTGCTTAAGCCTAG - 5' (SEQ ID NO:4).
This manipulation resulted in deletion of the SmaI site and introduction of SalI and EcoRI restriction enzyme sites between the KpnI and BarnHI sites present at the 5' end of the A element. The A element was then excised as a SalI-XbaI fragrnent and inserted into the SalI and SpeI sites located 3' to the 35S-GUS chimeric gene.

_ . . . . , , ~ .

W O 98/16650 PCTnUS97/17709 The manipulations described above resulted in insertion of A elements both 5' and 3' to the chimeric 35S-GUS gene (see Figure 2).

Transformation of Monocot Cells with SAR-Trans~ene Expression Vectors 5Black Mexican Sweet (BMS) is a commonly used, corn-derived, monocot cell line. BMS cells were m~intztinç~l as suspension cultures in the following medium ("MS+"): MS salts (GIBCO Laboratories, Grand Island NY), 0.5 mg/L
thi~nnine, l S0 mglL L-asparagine, 20 g/L sucrose, and 2 mg/L
2,4-dichlorophenoxyacetic acid. The pH of this medium was adjusted to 5.8 using lN KOH. The cells were subcultured 2-3 times per week by adding 25 mL of cells to 25 mL of fresh medium in a 250 mL flask. Flasks were incllb~ted with ch~kin~ (125 rpm) and grown at 26~C degrees in the dark.
BMS cell suspension cultures were tr~ncformed by the method of particle gun bom~ t (Klein et al. (1987) Nature 327:70). A DuPont Biolistic~
PDS1000/He insl~llen~ was used for transformations. Seven to 10 mL ofthe BMS suspension culture, obt~i~,ed 2-4 days after subclllt~.ring, was distributedevenly about a Wh~tm~n #1 filter disk inct~lled in a Buchner funnel under slightvacuurn. The filters were transferred onto plates of solid MS+ medium (MS+
cont~ ;..g 6 g/L agar) and stored at 26~C degrees overnight.
Plasmid DNA was ~ cipi~led onto gold particles as follows. The following COlllpUne.llS were added to 50 uL of a 60 mg/mL s ~p~ ion of 1 rnm gold particles in the order listed: pl~cmi~l DNA (5 ug of pMH40 or 9 ug of p40A53, each mixed with 5 ug of pDETRIC, a pl~cmi~l that conl~ines the bar gene from Streptomyces hygroscopicus that confers recict~nre to the herbicide glufosinate (Thompson et al. (1987) EMBOJ6:2519) (the bar gene had its translation codon changed from GTG to ATG for proper translation initiation in plants (De Block et al. (1987) EMBO J6:2513), is driven by the 35S promoter from Cauliflower Mosaic Virus, and uses the polyadenylation signal from the octopine synthase gene from Agrobacterium tumefaciens), 50 uL of 2.5M CaCl2, and 20 uL of 0.1M sperrnitline Equimolar amounts of SAR(-) and SAR(+) plasmids were used in bomba~ This particle p~e~udlion was ~git~ted for 3 minutes, spun in a microfuge for 10 seconds, and the supernatant removed. The DNA-coated particles were then washed once with 400 uL of 70% ethanol and re~u~ended in 40 uL of anhydrous ethanol. The DNA-coated particle ~ cion was sonicated three times for I second each. Seven and a half microliters of theDNA-coated particle sUcpen~ion were then loaded onto each macro carrier disk.
Th~ filter disk co..~ t~ g the BMS cells was placed about 3.5 inches away from the re~aining screen and bombarded twice. Membrane rupture ~ J~ullc was W O 98/166S0 PCTrUS97/17709 set at lO00 psi and the chamber was evacuated to minus 28 inches of mercury.
Two plates were bombarded per construct per experiment. Bombarded plates were incubated for 7 days at 26~ degrees in the dark. After 7 days, bombarded tissue was scraped from the filter, resucpended in liquid MS+ and plated on solid S MS+ medium supplemPntçd with 3 mg/L Bialaphos. Over a period of 3 to 7 weeks, rapidly growing clurnps of tissue, rel)rese..~ transformed lines, were transferred by spreading onto fresh solid MS+ medium supplemPnted with 3 mg/L
Bi~larhos. Transformed tissue derived from bomb~-l-n~ of p40A53 was generally slower in appea~ g. Growing lines were picked over the course of time 10 until a population of 54 lines was obtained for each DNA construction. Lines were sl~bcultl~red after 2-3 weeks on solid MS+ medium supple~nented with 2 mg/L Bi~l~ph~)s AssaY of Tl~ls~,.lc Ex~ression Fifty-four lines ~ rv.l.. ~d with DNA constructs COI.~;.. ;.. ~ SARs (+) and 54 lines tran~rulllled with DNA collstlucl~ without SARs (-) were colllpd~d for ~ lt~,l L~ sgenF. e,.l.res~ion by hi~oehF ~~ic~l st~inin~ The following hi~toche~ic~l staining solution was ~ ,d:
GUS Hi~tr~r~ ic~1 Assay Solution O.lM NaPO4 buffer, pH7.0 50.00 mL
0.1 M K3 (~e(CN)6) 0.1 M K4 (Fe(CN)6)~3H20 0.50 mL
0.5 M Na2EDTA 0.50 mI, Deio~i7~1 H20 48.50 mL
~X-gluc lO0 mg ~ X-gluc = 5- bromo-4-chloro-3-indoyl-~-glucoronide A small amount of tissue from each line was placed in each well of a 96 well plate COr~ g 0.25 m~ of GUS assay solution. Following i"c.lb~,~ion overnight at 37~C, each line was scored on a scale of 0 to 5 based on a visual rating of the intensity of blue st~ining, indicative of the quantity of GUS enzyme activity.
25 Results are presented in Table 1.
Table 1 Visual AssaY of GUS Activitv GUS ActivitY
Lines Tested0 (Negative) 1,2 or 3 (Low) 4 or 5 (High) SAR(-) (n=54) 35 12 7 SAR(+) (n=54) 25 5 24 ~ . . . . .... . .. ..

WO 98tl6650 PCT/US97/17709 These results indicate that the presence of the SAR reduces the pc~ nl~ge of negative lines in a population, and increases the percentage of high activitylines.
Quantitative values for GUS activity in transformants were determined for the high and low activity lines, as well as a portion of the negative lines. Sample extracts were prepared for each line as follows. 200-300 mg of fresh BMS tissue was suspended in 500 uL of extraction buffer (50 mM NaPO4, 10 mM EDTA, 0.1% TritonX- 100 and 0.1% Sarkosyl) and ground with a pestle. A small quantity of sand was included in the cell suspension in order to aid in cell disruption.
Following a brief centrifugation, the s~pem~te was collected and stored at -70~Cuntil assayed.
Sample extracts were prewarmed to 37~C prior to testing. One hundred and twenty rnicroliters of each sample extract was placed into an individual well of a 96-well microtitre plate. Thirty microliters of ~ie~ ed (37~C), freshly ple~aled, MUG substrate buffer (10 mM 4-m~lhy~ ellifçryl-~-D glucoronide (Sigma) in extraction buffer) was then added to each well. Twenty microliter aliquots were later removed at time points of 0, 10, 15, 30, 60, and 120 ~ .,s after addition of MUG substrate buffer and placed into individual wells of a fluorometric microtitre plate (Titretek Fluoroplate; ICN Biomedicals), each wellcont~ining 180 uL of 0.2M NaCO3 in order to stop the reaction. Fluo,~isce -re was ~letectecl and quantified using a Perkin-Elmer LS-3B ~e~ .,.neter. Sample activities were interpolated from a standard curve constructed by plotting concentration of 4-MU (4-methylumbelliferone) standards (Sigma) versus their measured fluorescence interisity. This curve was used to convert fluo~scG~-~e intensity of sample ~ ls to uM 4-MU.
Protein assays were pelrol,lled on the same sample extracts using the BCA
Protein Assay Reagent (Pierce l~h~omical; Rockford, IL) following the m~nl~f~ctllrer's instructions for the Microtitre Plate Protocol. GUS el~ylllc activities were then calculated as pmoles 4-MU/mg protein. Time points taken over the course of the assay were evaluated and data converted to pmoles 4-MU/mg protein/min. For ,.)ull,oses of data p,es~.,~lion, activities were then multiplied by 1000.
Fourteen of the lines that were rated either 0 or 1 in the visual assay were tested in the qu~ aLi~e assay; these lines had no detectable enzyme activity.
Visual ratings of I were based on microscopic detection of spots of GUS activityin generally ne - ~ive tissue. This arnount of activity was not sufficient to bedetee- ~; the :~u~ntit~tive (MUG) assay. The -~ ainder of the lines with visual ~2 ratings of 0 or 1 were ~q~ d c.~lllc activity scores of zero. All but 2 SAR(-) lines with visual ratings of 2 and above d~ Oh'l~ aled c.~llle sctivity levels ranging ~ ,cn 15.8 and 215.9 pmoles 4-MU/mg protein/min x 1000 as shown in Table 2. The two exceptions possec~ecl no detect~kle activity, and most likely S resulted from uneven sampling of chimeric tissue.
Table 2 Ouautil~ e Assay of GUS Activity SAR(-) SAR(+) line pmoles4-MU/mg/min line pmoles4-MU/mg/min 15.8 27 35.0 41 16.6 28 87.1 42 21.8 29 124.3 43 24.0 30 124.9 44 34.7 31 140.4 43.2 32 168.7 46 62.3 33 195.5 47 66.3 34 207.0 48 70.6 35 207.9 49 72.5 36 271.3 75.1 37 310.8 51 77.0 38 317.2 52 122.2 39 378.0 53 161.2 40 403.2 54 215.9 41 576.5 42 805.1 43 830.6 44 1123.2 1135.2 46 1363.1 47 1536.3 48 1707.6 49 2036.8 2590.5 51 2915.3 52 4022.4 53 6603.6 54 8596.0 Based on these q~ t;l;1l;ve assays, the population of 54 SAR(-) lines had an average en~ne activity level of 20Ø The population of 54 SAR(+) lines had an average el~ylllc activity level of 718.8. This result ~letnon~trates a SAR-5 dependent increase in e~l~ ~sion of 36-fold between the two populations of transformants. When only the lines with measurable enzyme activity levels are compared, the SAR(+) lines again show an h~clease in e~leSSiOn. The SAR(-) lines have an average enzyme activity level of 72.0 while the SAR(+) lines have an average enzyme activity level of 1386.2, a l9-fold h~clease. These results are 10 graphically ~lesclllc~ in Figure 3.
The data in Table 2 and Figure 3 also indicates that 19 of 54 (35%) of the SAR(+) lines have GUS activities that are higher than any of the SAR(-) lines.
The 11~ ~Y il~ level of e~les~ion achieved by an individual line was i~.c~dsed by the l.le3ence of the SAR. The enzyme activity of the highest ~ ssing SAR(-) line was 215.9, while the activity of the highest SAR(+) line was 8596.0, an illcl~ase of 39.8 fold.
The v~ri~tion in cA~ ,ssion among tran~r~ of the SAR(+) population h~cl~ia3ed over the range of activities displayed by the SAR(-) lines.
Enzyme activities ranged b.,l~ ,ell 35.0 and 8596.0, the highest c A,ur~;,sor being 20 245.6 times higher than the lowest ~ ~iessor. The range of activities for theSAR(-) population was ~.,t~.,~ 15.8 and 215.9, the highest being 13.7 times higher that the lowest.

W O 98/16650 PCTnUS97/17709 SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT:
(A) NAME: E. I. DUPONT DE NEMOURS AND COMPANY
~B) STREET: 1007 MARKET STREET
(C) CITY: WILMINGTON
(D) STATE: DELAWARE
(E) COUNTRY: USA
(F) POSTAL CODE (ZIP): 19898 (G) TELEPHONE: 302-992-5481 (H) TELEFAX: 302-773-0164 (I) TELEX: 6717325 (ii) TITLE OF INVENTION: ENHANCED TRANSGENE EXPRESSION IN
MONOCOTS
(iii) NUMBER OF SEQUENCES: 4 (iv) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: 3.5 INCH DISKETTE
(B) COMPUTER: IBM PC COMPATIBLE
(C) OPERATING SYSTEM: MICROSOFT WORD FOR WINDOWS 95 (D) SOFTWARE: MICROSOFT WORD VERSION 7.0A
(v) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vi) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: 60/028,165 (B) FILING DATE: OCTOBER 17, 1996 (vii) ATTORNEY/AGENT INFORMATION:
(A) NAME: CHRISTENBURY, LYNNE M.
(B) REGISTRATION NUMBER: 30,971 (C) REFERENCE/DOCKET NUMBER: BB-1072 CA 0226389l l999-02-23 W O 98/16650 PCTrUS97/17709 (2) INFORMATION FOR SEQ ID NO:l:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(li) MOLECULE TYPE: DNA (GENOMIC) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 14 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
tii) MOLECULE TYPE: DNA (GENOMIC) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
TCTTAAGTCT AGAG lg (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR
(ii) MOLECULE TYPE: DNA (GENOMIC) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 18 BASE PAIRS
(B) TYPE: NUCLEIC ACID
(C) STRANDEDNESS: SINGLE
(D) TOPOLOGY: LINEAR .
(ii) MOLECULE TYPE: DNA (GENOMIC) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

CA 0226389l l999-02-23 WO 98/166SO PCTrUS97/17709 INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCTRule 13bis) A. The i " ti made bclow relate to the ~. L referred lo in the Jc;..,- il,Iio"
on page 4 , line 32 B. IDENTIFICATION OF DEPOSIT Furthcr dcposits sre identir~ed on an ad-lilional shect O
Name of deposilsry institution AMERICAN TYPE CULTURE COLLECTION
Address of depositary institution (including poslal code and countrJ~) 12301 Parklawn Drive Rockville, Maryland 20852 US

0;1~C of dcposil Accession Number 20 September 1996 (20.09.96) 97725 C. ADDITIONAL INDICATIONS (leave b/ank if not arr/i ~ D.) This :.,fo~ , is continued on an additional sheet O
In respect of those designations in which a European patent is sought,a sample of the deposited microorganis~ will be made available until the publication of the mention of the grant of the European patent or until the~date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample. (Rule 28 (4) EPC) D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if thc ~ ' ~ o._ are notfor all designaled .~;tates) E. SEPARATE FUhh.~nll~lG OF INDICATIONS (leave blank if not app'i ' 'P.) Thc i ' listed belowwill besubmitted lo lhe I . ' Bureau Ister(specifylhegeneralnahreofiheindicaliolLre~ "Accession Number of Deposit") For receiving Office use only For I ' Bureau use only This sheet was received with thc ~ rr'i O This sheet was received by the I '~ I.a~lu.. al Bureau on:

Aulhorized offlcer Authorized omcer ) ~Q~ ~pl~
l orm PCT/RO/134 (~uly 1992) 17

Claims (9)

What is claimed is:

1. A method for increasing the level of expression of a transgene in a population of monocot cells which comprises:
(a) transforming the population with a DNA construct which comprises:
(1) a transgene comprising, in the 5' to 3' direction:
(i) a promoter;
(ii) a coding sequence operably linked to the promoter;
and (iii) a polyadenylation signal sequence operably linked to the coding sequence; and (2) at least one chicken lysozyme gene locus scaffold attachment region wherein the scaffold attachment region is positioned 5', 3', or 5' and 3' of the transgene; and (b) incubating the transformed population under conditions suitable for cell growth.

2. The method of Claim 1 wherein the population of monocot cells are corn cells.

3. The method of Claim 1 further comprising regenerating whole plants from the transformed cells.

4. The method of Claim 1 wherein the promoter is a tissue-specific promoter.

5. A population of monocot cells containing a DNA construct which comprises:
(1) a transgene comprising, in the 5' to 3' direction:
(i) a promoter;
(ii) a coding sequence operably linked to the promoter; and (iii) a polyadenylation signal sequence operably linked to the coding sequence; and (2) at least one chicken lysozyme gene locus scaffold attachment region wherein the scaffold attachment region is positioned 5', 3', or 5' and 3' of the transgene.

6. The population of monocot cells of Claim 5 wherein the monocot cells are corn cells.

7. Plants regenerated from the population of Claim 5 or 6.

8. Seeds obtained from the plants of Claim 7.

9. The population of monocot cells of Claim 5 wherein the promoter is a tissue-specific promoter.