AU3261299A

AU3261299A - Banana streak virus promoter and detection

Info

Publication number: AU3261299A
Application number: AU32612/99A
Authority: AU
Inventors: Glyn Harper; Roger Hull
Original assignee: Plant Bioscience Ltd
Current assignee: Plant Bioscience Ltd
Priority date: 1998-02-27
Filing date: 1999-02-26
Publication date: 1999-09-15
Anticipated expiration: 2019-02-26
Also published as: EP1056876A1; CA2321992A1; WO1999043836A1; GB9804293D0; CA2321992C; AU751495B2

Description

WO99/43836 PCT/GB99/00599 1 BANANA STREAK VIRUS PROMOTER AND DETECTION The present invention relates to Banana Streak Virus, in particular cloning and identification of its genome and 5 promoter, useful in transgenic strategies in Musaceae (Musa and Ensete) and in identification of antiviral agents, and also relates to detection of the virus in plants, in particular employing PCR primers designed on the basis of the genome sequence. 10 Banana (Musa) is the world's fourth most important commodity and is a subsistence and cash crop for many smallhold farmers particularly in West and Central Africa. Currently, improvements in the disease resistance, fruit yield and other 15 agronomic qualities of bananas and plantains are being investigated by the International Institute for Tropical Agriculture (IITA), Nigeria, and other institutes. These improvements have been hampered by the recent diagnosis of banana streak virus (BSV) (1) in the banana breeding stocks 20 and quarantine regulations have been preventing the movement of infected plant materials, even improved varieties. BSV is a member of the badnavirus group (2) which have non enveloped bacilliform particles of size 30 x 130-150 nm, 25 containing a circular double-stranded DNA genome of 7.4-8.0 kbp. The full sequences of the genomes of four members of this group have been reported, Commnelina yellow mottle virus (CoYMV; 3), rice tungro bacilliform virus (RTBV; 4, 5), WO99/43836 PCT/GB99/00599 2 sugarcane bacilliform virus (ScBV; 6), cocoa swollen shoot virus (CSSV; 7) and are known for at least two other members. This information has revealed common features of the group. They all have similar genome organizations with three open 5 reading frames (ORFs) (except RTBV, which has four) encoded on one strand. The first two ORF's potentially encode two small proteins (ORF 1 -22 kD, ORF 2 - 14 kD) of unknown function. The third ORF (-210 kD) encodes a polyprotein that is proteolytically cleaved to yield the viral coat protein 10 which contains a region with homology to an RNA binding domain together with regions with homology to aspartic protease (AP), reverse transcriptase (RT) and an RNase H (RH). In RTBV the extra ORF, ORF 4, is downstream of ORF 3 and has an unknown function. These features, together with a 15 potential tRNAmet binding site, suggest that badnaviruses are pararetroviruses. Following virus entry into the cell and nucleus the genome is transcribed into a greater than genome length transcript, 20 that (presumably) is both a polycistronic mRNA and a replication template. The DNA negative strand, primed by host tRNAmet is synthesised by a virally-encoded reverse transcriptase, and the positive strand by the same enzyme and the virally encoded ribonuclease H. 25 The use of RT in their replication can potentially lead to high degree of variation between isolates and different group members, and such variation has already been reported for BSV WO99/43836 PCT/GB99/00599 3 (8) The present inventors have succeeded in cloning the genome of a Nigerian isolate of BSV and identifying its promoter, 5 providing one aspect of the present invention. The promoter is useful for expression of transgenes in plants, including non-graminaceous monocots particularly Musaceae (Musa and Ensete)and graminaceous monocots such as rice and sugar cane. At least one strain of sugarcane bacilliform virus has been 10 shown to infect banana (Bouhida et al., 1993 J. Gen. Virol. 74: 15-22). The increasing importance of BSV highlights the need for the determination of specific properties of BSV that could be 15 used for its diagnosis. The symptoms of BSV can be readily confused with those of cucumber mosaic virus (CMV). BSV is serologically heterogeneous (8) and is present at low titre in the host. Serological methods in use, particularly ISEM, require sophisticated equipment and are relatively 20 insensitive. In a further aspect of the present invention, the inventors having cloned the BSV genome have designed PCR based diagnostic systems. PCR has been used in numerous studies for the rapid, 25 sensitive and reliable detection of viruses from a wide variety of sources. A direct PCR protocol for the sensitive detection of BSV from Musa plants is reported in Harper et al., 1996 (In (Ed) Marshall, Diagnostics for Crop Protection, WO99/43836 PCT/GB99/00599 4 BCPC Proccedings 65n, BCPC Surrey, UK, pp 47-51). Provisional results using this PCR approach indicated widespread if not universal presence of BSV sequences in Musa, in contrast to results obtained using other methods, 5 which indicated a much lower incidence of the virus. These findings and other reports provide indication of BSV sequences integrating into the Musa genome. The integrated sequences do no necessarily lead directly to observable disease symptoms, as there are plants documented that are and 10 have been apparently disease free. The present invention now provides a method that can be used for specific, reliable and sensitive detection of episomal BSV. 15 According to a first aspect of the present invention there is provided an isolated polynucleotide including a Banana Streak Virus (BSV) promoter. The nucleic acid may consist essentially of the promoter sequence. The promoter sequence 20 may be part of a larger molecule including for instance a heterologous coding sequence operably linked to the promoter. A preferred embodiment of a promoter according to the present invention has the sequence shown in SEQ ID NO 2, -350 to + 25 100 relative to the start of transcription site. Furthermore, a part (fragment), allele, mutant, variant or derivative of the promoter sequence shown (such as the upstream part of SEQ ID NO. 2 or a fragment thereof) should WO99/43836 PCT/GB99/00599 5 be sufficient for promoter activity to promote transcription of a heterologous sequence operatively linked, i.e. under the control of, the part, variant or derivative of the sequence shown. One or more fragments of the sequence may be included 5 in a promoter according to the present invention, for instance one or more motifs may be coupled to a "minimal" promoter. Such motifs may confer Banana Streak Virus promoter function on a promoter, such as suitability for or enhanced performance in non-graminaceous monocots. 10 In a further aspect, the present invention provides an isolated polynucleotide including a promoter, the promoter including a sequence of nucleotides shown in SEQ ID NO 2 and conferring BSV promoter function on a sequence operably 15 linked to the promoter. Restriction enzyme or nucleases may be used to digest the full-length nucleic acid shown, followed by an appropriate assay to determine the minimal sequence required for this function. A preferred embodiment of the present invention provides a nucleic acid isolate with 20 the minimal nucleotide sequence shown in SEQ ID NO 2 required for BSV promoter function. The promoter may include one or more sequence motifs or elements conferring BSV promoter function regulatory control 25 of expression. Other regulatory sequences may be included, for instance as identified by a mutation or digestion assay in an appropriate expression system or by sequence comparison with available information, e.g. using a computer to search WO99/43836 PCT/GB99/00599 6 on-line databases. By "promoter" is meant a sequence of nucleotides from which transcription of DNA operably linked downstream (i.e. in the 5 3' direction on the sense strand of double-stranded DNA) may be initiated. "Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for 10 transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter. The present invention extends to a promoter which has a 15 nucleotide sequence which is allele, mutant, variant or derivative, by way of nucleotide addition, insertion, substitution or deletion of a promoter sequence as provided herein. Systematic or random mutagenesis of nucleic acid to make an alteration to the nucleotide sequence may be 20 performed using any technique known to those skilled in the art. One or more alterations to a promoter sequence according to the present invention may increase or decrease promoter activity, or increase or decrease the magnitude of the effect of a substance able to modulate the promoter 25 activity. "Promoter activity" is used to refer to ability to initiate transcription. The level of promoter activity is WO99/43836 PCT/GB99/00599 7 quantifiable for instance by assessment of the amount of mRNA produced by transcription from the promoter or by assessment of the amount of protein product produced by translation of mRNA produced by transcription from the promoter. The amount 5 of a specific mRNA present in an expression system may be determined for example using specific oligonucleotides which are able to hybridise with the mRNA and which are labelled or may be used in a specific amplification reaction such as the polymerase chain reaction. Use of a reporter gene 10 facilitates determination of promoter activity by reference to protein production. In various embodiments of the present invention a promoter which has a sequence that is a fragment, mutant, allele, 15 derivative or variant, by way of addition, insertion, deletion or substitution of one or more nucleotides, of the sequence of the promoter shown in SEQ ID NO 2, has homology/similarity with the shown sequence which is at least about 5% greater than the homology that any of the promoter 20 sequences of other badnaviruses have with the sequence shown herein, preferably at least about 10% greater homology, more preferably at least about 20% homology, more preferably at least about 25% greater homology. These badnaviruses are Commelina yellow mottle virus, rice tungro bacilliform virus, 25 cocoa swollen shoot virus, sugarcane bacilliform virus and Dioscorea alata bacilliform virus (unpublished data), as noted elsewhere herein. The sequence in accordance with an embodiment of the invention may hybridise with the sequence WO99/43836 PCT/GB99/00599 8 shown in SEQ ID NO 2 but not any of the promoter sequences of these other badnaviruses under appropriately stringent selective hybridisation conditions. A promoter according to the invention may include one or more motifs that appear in 5 SEQ ID NO 2 and are able to confer BSV promoter function on a promoter which contains them. Similarly, nucleic acid according to certain embodiments of the present invention may have homology with all or part of 10 the nucleotide sequence shown in SEQ ID NO 2, which homology is greater over the length of the relevant part (i.e. fragment) than the homology shared between the part of SEQ ID NO 2 and a respective part of the nucleotide sequence of any of these other badnaviruses, and may be greater than about 5% 15 greater, more preferably greater than about 10% greater, more preferably greater than about 20% greater, and more preferably greater than about 30% greater. Homology may be taken over the full-length of a sequence or 20 over a part, such as 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 150, 200 contiguous nucleotides. That two nucleotide sequences are said to share "homology" or be "homologous" is based on sequence comparison. Any phylogenetic relationship is irrelevant for this. Those skilled in the art routinely 25 refer to homology between nucleotide sequences with no implication for evolutionary origin. Two homologous nucleotide sequences may also be said to be "similar" or have a certain per centage similarity or a certain per centage WO99/43836 PCT/GB99/00599 9 identity. In general it is not critical which of the various standard algorithms are used to determine how homologous two 5 nucleotide sequences are with one another. A preferred algorithm may be GAP, which uses the alignment method of Needleman and Wunsch (J. Mol. Biol. (1970) 48: 443-453) and is included in the Program Manual or the Wisconsin Package, Version 8, September 1994, Genetics Computer Group, 575 10 Science Drive, Madison, Wisconsin, USA). In the absence of instructions to the contrary, the skilled person would understand to use the default parameters with the aim of maximizing alignment, with a gap creation penalty = 12 and gap extension penalty = 4. 15 Similarity or homology (the terms are used interchangeably) or identity may be as defined and determined by the TBLASTN program, of Altschul et al. (1990) J. Mol. Biol. 215: 403-10, or BestFit, which is part of the Wisconsin Package, Version 20 8, September 1994, (Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA, Wisconsin 53711). Preferably sequence comparisons are made using FASTA and FASTP (see Pearson & Lipman, 1988. Methods in Enzymology 183: 63-98). Parameters are preferably set, using the default matrix, as 25 follows: Gapopen (penalty for the first residue in a gap): 12 for proteins / -16 for DNA; Gapext (penalty for additional residues in a gap): -2 for proteins / -4 for DNA; KTUP word length: 2 for proteins / 6 for DNA.

WO99/43836 PCT/GB99/00599 10 Nucleic acid sequence homology may be determined by means of selective hybridisation between molecules under stringent conditions. 5 Preliminary experiments may be performed by hybridising under low stringency conditions. For probing, preferred conditions are those which are stringent enough for there to be a simple pattern with a small number of hybridisations identified as positive which can be investigated further. 10 For example, hybridizations may be performed, according to the method of Sambrook et al. (below) using a hybridization solution comprising: 5X SSC (wherein 'SSC' = 0.15 M sodium chloride; 0.15 M sodium citrate; pH 7), 5X Denhardt's 15 reagent, 0.5-1.0% SDS, 100 yg/ml denatured, fragmented salmon sperm DNA, 0.05% sodium pyrophosphate and up to 50% formamide. Hybridization is carried out at 37-42 0 C for at least six hours. Following hybridization, filters are washed as follows: (1) 5 minutes at room temperature in 2X SSC and 20 1% SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1% SDS; (3) 30 minutes - 1 hour at 370C in lX SSC and 1% SDS; (4) 2 hours at 42-650C in 1X SSC and 1% SDS, changing the solution every 30 minutes. 25 One common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is (Sambrook et al., 1989): Tm = 81.5C + 16.6Log [Na+] + 0.41 (% G+C) - WO99/43836 PCT/GB99/00599 11 0.63 (% formamide) - 600/#bp in duplex. As an illustration of the above formula, using [Na+] = [0.368] and 50-% formamide, with GC content of 42% and an 5 average probe size of 200 bases, the Tm is 57 0 C. The Tm of a DNA duplex decreases by 1 - 1.5 0 C with every 1% decrease in homology. Thus, targets with greater than about 75% sequence identity would be observed using a hybridization temperature of 42 0 C. Such a sequence would be considered substantially 10 homologous to the nucleic acid sequence of the present invention. It is well known in the art to increase stringency of hybridisation gradually until only a few positive clones 15 remain. Other suitable conditions include, e.g. for detection of sequences that are about 80-90% identical, hybridization overnight at 42 0 C in 0.25M Na 2 HP0 4 , pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 55 0 C in 0.1X SSC, 0.1% SDS. For detection of sequences that are greater than about 20 90% identical, suitable conditions include hybridization overnight at 650C in 0.25M Na 2

HPO

4 , pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 60 0 C in 0.1X SSC, 0.1% SDS. 25 An alternative, which may be particularly appropriate with plant nucleic acid preparations, is a solution of 5x SSPE (final 0.9 M NaCl, 0.05M sodium phosphate, 0.005M EDTA pH 7.7), 5X Denhardt's solution, 0.5% SDS, at 65"C overnight, WO99/43836 PCT/GB99/00599 12 (for high stringency, highly similar sequences) or 50°C (for low stringency, less similar sequences). Washes in 0.2x SSC/0.1% SDS at 65°C for high stringency, alternatively at 50-60°C in 1x SSC/0.1%SDS for low stringency. 5 In a further embodiment, hybridisation of nucleic acid molecule to a variant may be determined or identified indirectly, e.g. using a nucleic acid amplification reaction, particularly the polymerase chain reaction (PCR). PCR 10 requires the use of two primers to specifically amplify target nucleic acid, so preferably two nucleic acid molecules with sequences characteristic of BSV are employed. Using RACE PCR, only one such primer may be needed (see "PCR protocols; A Guide to Methods and Applications", Eds. Innis 15 et al, Academic Press, New York, (1990)). Thus a method involving use of PCR in obtaining nucleic acid according to the present invention may include: (a) providing a preparation of nucleic acid, e.g. from a 20 plant cell; (b) providing a pair of nucleic acid molecule primers useful in (i.e. suitable for) PCR, at least one of said primers being a primer specific for nucleic acid according to the present invention; 25 (c) contacting nucleic acid in said preparation with said primers under conditions for performance of PCR; (d) performing PCR and determining the presence or absence of an amplified PCR product.

WO99/43836 PCT/GB99/00599 13 The presence of an amplified PCR product may indicate identification of an allele or other variant. Table 1 shows % nucleotide homologies for various 5 Badnaviruses compared with the BSV sequence shown in SEQ ID NO 1 (over the full length) as determined using the algorithm GCG GAP (see above). The present invention also includes promoters that are 10 homologous to the BSV promoter, particular the sequence of SEQ ID NO 2. An homologous promoter may show greater than 55% homology with the sequence of SEQ ID NO 2, greater than 65% homology, greater than 75% homology, greater than 85% homology or greater than 95% homology. Such homology may be 15 shown for a sequence of at least 20 nucleotide bases, at least 50 nucleotide bases, at least 100 nucleotide bases, at least 300 nucleotide bases or at least 500 nucleotide bases. It should be noted that because banana streak virus is a 20 retrovirus employing reverse transcriptase (RT) which is known to be relatively error prone, a certain drift is to be expected in sequences occurring in Nature. Indeed, the sequence disclosed in SEQ ID NO 2 is obtained from a Nigerian isolate of BSV but other isolates may have sequences which 25 vary from that specific sequence to different degrees. These are encompassed by aspects and embodiments of the present invention.

WO99/43836 PCT/GB99/00599 14 An allelic variant of the BSV genome sequence of SEQ ID NO. 1 may in accordance with the present invention include one or more, or preferably all, of the following changes with respect to SEQ ID NO. 1: insertion of C as nucleotide 6779, 5 insertion of G as nucleotide 7087 (numbered 7088 if C is inserted as nucleotide 6779), substitution of T for A at nucleotide 4218, substitution of C for G at nucleotide 6606, substitution of G for A at nucleotide 7118 (numbered 7119 if C is inserted as nucleotide 6779 or G is inserted as 10 nucleotide 7087, and numbered 7120 if C is inserted as nucleotide 6779 and G is inserted as nucleotide 7088), substitution of C for G at nucleotide 7185 (numbered 7186 if C is inserted as nucleotide 6779 or G is inserted as nucleotide 7087, and numbered 7187 if C is inserted as 15 nucleotide 6779 and G is inserted as nucleotide 7088), substitution of T for C at nucleotide 7207 (numbered 7208 if C is inserted as nucleotide 6779 or G is inserted as nucleotide 7087, and numbered 7209 if C is inserted as nucleotide 6779 and G is inserted as nucleotide 7088). An 20 allelic variant of a promoter according to the invention may include one or more or preferably all of those of the above changes that fall within the promoter sequence. Further provided by the present invention is a nucleic acid 25 construct including a promoter region or a fragment, mutant, allele, derivative or variant thereof as discussed able to promote transcription in a plant, particularly in Musaceae or monocots, operably linked to a heterologous nucleic acid WO99/43836 PCT/GB99/00599 15 sequence, preferably a gene, e.g. a coding sequence. By "heterologous" in this context is meant a gene other than any coding sequence found naturally in banana streak virus. Modified forms of BSV coding sequences may be excluded. 5 Generally, the gene may be transcribed into mRNA which may be translated into a peptide or polypeptide product which may be detected and preferably quantitated following expression. A gene whose encoded product may be assayed following expression is termed a "reporter gene", i.e. a gene which 10 "reports" on promoter activity. The present invention also provides a nucleic acid vector including a promoter as disclosed herein. Such a vector may include a suitably positioned restriction site or other means 15 for insertion into the vector of a sequence heterologous to the promoter to be operably linked thereto. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer 20 sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al, 1989, Cold Spring Harbor Laboratory Press. Procedures for introducing DNA into cells depend on the host used, but are well known. 25 Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are WO99/43836 PCT/GB99/00599 16 described in detail in Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1992. The disclosures of Sambrook et al. and Ausubel et al. are incorporated herein by reference. Specific 5 procedures and vectors previously used with wide success upon plants are described by Bevan (Nucl. Acids Res. 12, 8711-8721 (1984)) and Guerineau and Mullineaux (1993)(Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific 10 Publishers, pp 121-148). Selectable genetic markers may be used consisting of chimaeric genes that confer selectable phenotypes such as resistance to antibiotics such as kanamycin, hygromycin, 15 phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate. A further aspect of the present invention provides a host cell (which may be microbial or plant) containing a nucleic 20 acid construct including a promoter element, as disclosed herein, operably linked to a heterologous nucleic acid sequence or gene. A still further aspect provides a method including introducing such a construct into a host cell. The introduction may employ any available technique well known to 25 the person skilled in the art. The introduction may be followed by causing or allowing expression of the heterologous nucleic acid sequence or gene WO99/43836 PCT/GB99/00599 17 under the control of the promoter. In one embodiment, the construct including promoter and nucleic acid sequence or gene is integrated into the genome 5 (e.g. chromosome) of the host cell. Integration may be promoted by including in the construct sequences which promote recombination with the genome, in accordance with standard techniques. 10 Nucleic acid molecules and vectors according to the present invention may be provided isolated and/or purified from their natural environment, in substantially pure or homogeneous form, or free or substantially free of nucleic acid or genes of the species of interest or origin other than the sequence 15 encoding a polypeptide with the required function. Nucleic acid according to the present invention may include cDNA, RNA, genomic DNA and may be wholly or partially synthetic. The term "isolate" encompasses all these possibilities. Where a DNA sequence is specified, e.g. with reference to a 20 figure, unless context requires otherwise the RNA equivalent, with U substituted for T where it occurs, is encompassed. An aspect of the present invention is the use of nucleic acid according to the invention in the production of a transgenic 25 plant. When introducing a chosen gene construct into a cell, certain considerations, well known to those skilled in the art must WO 99/43836 PCT/GB99/00599 18 be taken into account. The nucleic acid to be inserted should be assembled within a construct which contains effective regulatory elements which will drive transcription. There must be available a method of transporting the construct into 5 the cell. Once the construct is within the cell membrane, integration into the endogenous chromosomal material either will or will not occur. Finally, as far as plants are concerned the target cell type must be such that cells can be regenerated into whole plants. 10 Plants transformed with the DNA segment containing the sequence may be produced by standard techniques which are already known for the genetic manipulation of plants. DNA can be transformed into plant cells using any suitable 15 technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transfer ability (EP-A-270355, EP-A-0116718, NAR 12(22) 8711 - 87215 1984), particle or microprojectile bombardment (US 5100792, EP-A 444882, EP-A-434616) microinjection (WO 92/09696, WO 20 94/00583, EP 331083, EP 175966, Green et al. (1987) Plant Tissue and Cell Culture, Academic Press), electroporation (EP 290395, WO 8706614) other forms of direct DNA uptake (DE 4005152, WO 9012096, US 4684611), liposome mediated DNA uptake (e.g. Freeman et al. Plant Cell Physiol. 29: 1353 25 (1984)), or the vortexing method (e.g. Kindle, PNAS U.S.A. 87: 1228 (1990d) Physical methods for the transformation of plant cells are reviewed in Oard, 1991, Biotech. Adv. 9: 1 11.

WO99/43836 PCT/GB99/00599 19 Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous and monocotyledonous species. For examples of production of stable, fertile transgenic plants in economically relevant monocot plants see 5 inter alia Toriyama, et al. (1988) Bio/Technology 6, 1072 1074; Zhang, et al. (1988) Plant Cell Rep. 7, 379-384; Zhang, et al. (1988) Theor Appl Genet 76, 835-840; Shimamoto, et al. (1989) Nature 338, 274-276; Datta, et al. (1990) Bio/Technology 8, 736-740; Christou, et al. (1991) 10 Bio/Technology 9, 957-962; Peng, et al. (1991) International Rice Research Institute, Manila, Philippines 563-574; Cao, et al. (1992) Plant Cell Rep. 11, 585-591; Li, et al. (1993) Plant Cell Rep. 12, 250-255; Rathore, et al. (1993) Plant Molecular Biology 21, 871-884; Fromm, et al. (1990) 15 Bio/Technology 8, 833-839; Gordon-Kamm, et al. (1990) Plant Cell 2, 603-618; D'Halluin, et al. (1992) Plant Cell 4, 1495 1505; Walters, et al. (1992) Plant Molecular Biology 18, 189 200; Koziel, et al. (1993) Biotechnology 11, 194-200; Vasil, I. K. (1994) Plant Molecular Biology 25, 925-937; Weeks, et 20 al. (1993) Plant Physiology 102, 1077-1084; Somers, et al. (1992) Bio/Technology 10, 1589-1594; W092/14828. In particular, Agrobacterium mediated transformation is now emerging also as an highly efficient alternative transformation method in monocots (Hiei et al. (1994) The 25 Plant Journal 6, 271-282). The generation of fertile transgenic plants has been achieved in the cereals rice, maize, wheat, oat, and barley (reviewed WO99/43836 PCT/GB99/00599 20 in Shimamoto, K. (1994) Current Opinion in Biotechnology 5, 158-162.; Vasil, et al. (1992) Bio/Technology 10, 667-674; Vain et al., 1995, Biotechnology Advances 13 (4): 653-671; Vasil, 1996, Nature Biotechnology 14 page 702). 5 Banana has been transformed: for example see Sagi et al., 1995, BioTechnology 13: 481-485, and May et al., 1995, BioTechnology 13: 486-492. 10 Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective. Alternatively, a combination of different techniques may be employed to enhance the efficiency of the transformation process, eg bombardment with Agrobacterium 15 coated microparticles (EP-A-486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233). Following transformation, a plant may be regenerated, e.g. 20 from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant. Available techniques are reviewd in Vasil et al., Cell Culture and Somatic Cel Genetics of Plants, Vol I, II and 25 III, Laboratory Procedures and Their Applications, Academic Press, 1984, and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989.

WO99/43836 PCT/GB99/00599 21 The particular choice of a transformation technology will be determined by its efficiency to transform certain plant species as well as the experience and preference of the person practising the invention with a particular methodology 5 of choice. It will be apparent to the skilled person that the particular choice of a transformation system to introduce nucleic acid into plant cells is not essential to nor a limitation of the invention, nor is the choice of technique for plant regeneration. 10 Also according to the invention there is provided a plant cell having incorporated into its genome nucleic acid, particularly heterologous nucleic acid, as provided by the present invention. A further aspect of the present invention 15 provides a method of making such a plant cell involving introduction of a vector including the sequence of nucleotides into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce the sequence of nucleotides into the genome. The 20 invention extends to plant cells containing nucleic acid according to the invention as a result of introduction of the nucleic acid into an ancestor cell. A further aspect of the present invention provides a method 25 of making such a plant cell involving introduction of nucleic acid or a suitable vector including the sequence of nucleotides into a plant cell and causing or allowing recombination between the vector and the plant cell genome to WO99/43836 PCT/GB99/00599 22 introduce the sequence of nucleotides into the genome. The invention extends to plant cells containing nucleic acid according to the invention as a result of introduction of the nucleic acid into an ancestor cell. 5 In the context of a host cell containing "heterologous" nucleic acid, the term "heterologous" may be used to indicate that the gene/sequence of nucleotides in question have been introduced into said cells of the plant or an ancestor 10 thereof, using genetic engineering, i.e. by human intervention. A transgenic plant cell, i.e. transgenic for the nucleic acid in question, may be provided. The transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome. A heterologous gene may replace an 15 endogenous equivalent gene, ie one which normally performs the same or a similar function, or the inserted sequence may be additional to the endogenous gene or other sequence. An advantage of introduction of a heterologous gene is the ability to place expression of a sequence under the control 20 of a promoter of choice, in order to be able to influence expression according to preference. Furthermore, mutants, variants and derivatives of the wild-type gene, e.g. with higher or lower activity than wild-type, may be used in place of the endogenous gene. Nucleic acid heterologous, or 25 exogenous or foreign, to a plant cell may be non-naturally occuring in cells of that type, variety or species. Thus, nucleic acid may include a coding sequence of or derived from a particular type of plant cell or species or variety of WO99/43836 PCT/GB99/00599 23 plant, placed within the context of a plant cell of a different type or species or variety of plant. A further possibility is for a nucleic acid sequence to be placed within a cell in which it or a homologue is found naturally, 5 but wherein the nucleic acid sequence is linked and/or adjacent to nucleic acid which does not occur naturally within the cell, or cells of that type or species or variety of plant, such as operably linked to one or more regulatory sequences, such as a promoter sequence, for control of 10 expression. A sequence within a plant or other host cell may be identifiably heterologous, exogenous or foreign. Plants which include a plant cell according to the invention are also provided, along with any part or propagule thereof, 15 seed, selfed or hybrid progeny and descendants. A plant according to the present invention may be one which does not breed true in one or more properties. Plant varieties may be excluded, particularly registrable plant varieties according to Plant Breeders' Rights. It is noted that a plant need not 20 be considered a "plant variety" simply because it contains stably within its genome a transgene, introduced into a cell of the plant or an ancestor thereof. In addition to a plant, the present invention provides any 25 clone of such a plant, seed, selfed or hybrid progeny and descendants, and any part of any of these, such as cuttings, seed. The invention provides any plant propagule, that is any part which may be used in reproduction or propagation, WO99/43836 PCT/GB99/00599 24 sexual or asexual, including cuttings, seed and so on. Also encompassed by the invention is a plant which is a sexually or asexually propagated off-spring, clone or descendant of such a plant, or any part or propagule of said plant, off 5 spring, clone or descendant. The invention further provides a method of influencing or affecting a physical characteristic of a plant, including causing or allowing expression of a heterologous nucleic acid 10 sequence as discussed within cells of the plant. Characteristics which may be influenced include resistance, immunity, tolerance, hypersensitivy to pathogens such as viruses, fungi and bacteria, pests such as nematodes and weevils, agronomic characters such as dwarfism of the plant, 15 yield of seed or other product, fertility or sterility and quality of fruit. The invention further provides a method of influencing a physical characteristic of a plant including expression from 20 nucleic acid according to the present invention as above, within cells of a plant, following an earlier step of introduction of the nucleic acid into a cell of the plant or an ancestor thereof. Such a method may influence or affect a characteristic of the plant, such as noted above. This may 25 be used in combination with any other gene, such as transgenes involved in determining or modifying any of the characteristics noted or other phenotypic trait or desirable property.

WO99/43836 PCT/GB99/00599 25 Nucleic acid constructs including a promoter (as disclosed herein) and a heterologous gene (reporter) may be employed in screening for a substance able to modulate activity of the promoter. For anti-viral purposes, e.g. for treatment of BSV 5 in banana or other disease, a substance able to down-regulate expression of the promoter may be sought. In other contexts, e.g. for expression of a product useful in modifying a plant characteristic as noted, it may be desirable to obtain a substance able to up-regulate expression from the promoter. 10 A method of screening for ability of a substance to modulate activity of a promoter may include contacting an expression system, such as a host cell, containing a nucleic acid construct as herein disclosed with a test or candidate substance and determining expression of the heterologous 15 gene. The level of expression in the presence of the test substance may be compared with the level of expression in the absence of the test substance. A difference in expression in the 20 presence of the test substance indicates ability of the substance to modulate gene expression. An increase in expression of the heterologous gene compared with expression of another gene not linked to a promoter as disclosed herein indicates specificity of the substance for modulation of the 25 promoter. A promoter construct may be introduced into a cell line using any technique previously described to produce a stable cell WO99/43836 PCT/GB99/00599 26 line containing the reporter construct integrated into the genome. The cells may be grown and incubated with test compounds for varying times. Cells may be regenerated into plants and assay or screening methods carried out in 5 accordance with the present invention on the plant or a part thereof, such as leaf or fruit. The cells and/or plant may be Musaceae, Musa, Ensete, banana or plantain. 10 Following identification of a substance which modulates or affects promoter activity, the substance may be investigated further. Furthermore, it may be manufactured and/or used in preparation, i.e. manufacture or formulation, of a 15 composition which may contain at least one additional component, such as a diluent or solvent. These may be administered to cells or plants to modulate promoter activity. 20 Thus, the present invention extends in various aspects not only to a substance identified using a nucleic acid molecule as a modulator of promoter activity, in accordance with what is disclosed herein, but also a composition including such a substance, a method including administration of such a 25 composition to a plant, e.g. for decreasing expression for instance in treatment (which may include preventative treatment) of BSV or other disease of a plant, such as of Musaceae (Musa or Ensete) or monocots such as noted above, WO 99/43836 PCT/GB99/00599 27 use of such a substance in manufacture of such a composition and a method of making a composition including admixing such a substance with an acceptable diluent or carrier, and optionally other ingredients. 5 Further aspects of the present invention relate to "diagnostic" methods and means for determining the presence in a plant, particularly Musaceae, of episomal banana streak virus. 10 According to a further aspect of the present invention there is provided a method of determining the presence or absence of banana streak virus in a plant, the method including bringing into contact specific binding molecules 15 specific for banana streak virus and a test sample including extract of a test plant under conditions wherein the specific binding molecules bind banana streak virus particles if present in the test sample; performing PCR on the test sample using primers specific 20 for banana streak virus; determining the presence or absence of a PCR product characteristic of banana streak virus. The plant extract to be tested may be provided by using a 25 carbonate buffer as grinding medium, as is well known in the art. The specific binding molecules may be immobilised on a solid WO99/43836 PCT/GB99/00599 28 support such as a column, allowing for ease of washing away of non-binding material (e.g. Clark et al. (1986) Methods in Enzymology 118: 742-751). One or more washing steps is preferably included prior to performance of the PCR. 5 The specific binding molecules may include antibodies or specific binding fragments thereof. Methods of producing antibodies include immunising a mammal 10 (e.g. human, mouse, rat, rabbit, horse, goat, sheep or monkey) with banana streak virus or one or more proteins or protein fragments thereof. Antibodies may be obtained from immunised animals using any of a variety of techniques known in the art, and might be screened, preferably using binding 15 of antibody to antigen of interest. For instance, Western blotting techniques or immunoprecipitation may be used (Armitage et al, 1992, Nature 357: 80-82). Antibodies may be polyclonal or monoclonal. 20 As an alternative or supplement to immunising a mammal, antibodies with appropriate binding specificity may be obtained from a recombinantly produced library of expressed immunoglobulin variable domains, e.g. using lambda bacteriophage or filamentous bacteriophage which display .5 functional immunoglobulin binding domains on their surfaces; for instance see W092/01047. Various fragments of antibodies are known in the art to have WO99/43836 PCT/GB99/00599 29 the ability to bind target antigen specifically, including Fab, scFv, Fd, Fv, diabodies and so on. Since the role of a specific binding member in the context of this aspect of the present invention is to bind, and effector functions 5 provided by whole antibody are not relevant, any specific binding molecule including any binding fragment of an antibody may in principle be used. Suitable PCR primers include those which are directed to 10 regions of the genome that are likely to be conserved among BSV isolates, such as in sequences coding for amino acid sequences conserved among plant pararetroviruses in the aspartate protease and reverse transcriptase regions. Because of the redundancy of the genetic code, these 15 sequences are not found in other pararetroviruses. Preferred primers include the following sequences: Forward v3012, 5' GGA ATG AAA GAG CAG GCC Reverse v 1573, 5' AGT CAT TGG GTC AAC CTC TGT CCC. 20 PCR techniques for the amplification of nucleic acid are described in US Patent No. 4,683,195. In general, such techniques require that sequence information from the ends of the target sequence is known to allow suitable forward and 25 reverse oligonucleotide primers to be designed to be identical or similar to the polynucleotide sequence that is the target for the amplification. PCR comprises steps of denaturation of template nucleic acid (if double-stranded), WO99/43836 PCT/GB99/00599 30 annealing of primer to target, and polymerisation. The nucleic acid sequence information provided herein, particularly in SEQ ID NO 1, readily allow the skilled person to design PCR primers. References for the general use of PCR 5 techniques include Mullis et al, Cold Spring Harbor Symp. Quant. Biol., 51:263, (1987), Ehrlich (ed), PCR technology, Stockton Press, NY, 1989, Ehrlich et al, Science, 252:1643 1650, (1991), "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, Academic Press, New York, 10 (1990). On the basis of the sequence and other information provided herein, oligonucleotide primers may be designed by those skilled in the art. An oligonucleotide for use in nucleic 15 acid amplification may have about 10 or fewer triplets (e.g. 6, 7 or 8), i.e. be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24). Generally specific primers are upwards of 14 nucleotides in length, but need not be more than 18-20. 20 The presence of a PCR product indicative or characteristic of banana streak virus may be determined by means of any of the many screening procedures available to those skilled in the art, including detection of the PCR products by size, hybridization with a BSV probe, restriction endonuclease 25 restriction patterns and/or sequencing. Further aspects and embodiments will be apparent to those of ordinary skill in the art. Embodiments of the present WO99/43836 PCT/GB99/00599 31 invention will now be illustrated by way of example. Figure 1 shows a map of the BSV genome, the full sequence for which is shown as SEQ ID NO. 1. 5 SEQ ID NO. 2 shows a sequence of a preferred promoter according to one embodiment of the present invention. All documents mentioned anywhere herein are incorporated by 10 reference. EXAMPLE 1 - Cloning of BSV Virus isolation and purification 15 BSV-infected banana plants (cultivar TMP4698 which is a tetraploid hybrid of Obino 1'Ewai x Calcutta 4) were supplied, as in vitro plantlets or screenhouse-grown plant suckers, by IITA, Onne Field Station, Nigeria. Plant sucker outer tissue was removed and the corms were sterilised in 1% 20 sodium hypochlorite for 1 h and quarantined for 1 month, prior to moving to the greenhouse and maintenance at 28 C day, 25°C night. Leaf material was finely ground in liquid nitrogen and 25 blended into 2 volumes buffer A (50 mM sodium phosphate pH 6.1, 5 mM dithiothreitol, 5 mM diethyldithiocarbamate, 0.5% polyethylene glycol (PEG 6000). Celluclast (Novo Nordisk) was added to 2%, incubated with stirring at 37 C for 2 h then WO99/43836 PCT/GB99/00599 32 overnight at room temperature. Triton X-100 was added to 1% and the incubation carried out for a further 30 min. All subsequent steps were carried out at 4°C. The supernatant from a low speed centrifugation at 10,000g for 10 min, was 5 further centrifuged at 120,000g for 90 min. The pellet was resuspended in 100 ml buffer A, centrifuged through a 5% sucrose cushion at 120,000g for 2.5 h and the pellet resuspended in 5 ml buffer A. The virus was further purified according to Lockhart (2) by centrifugation in a 0-40% Cs 2

SO

4 10 gradient in 10% sucrose [steps 40, 30, 20, 10, 0%] at 120,000g for 2.5 h. The viral band was identified by ISEM, carried out according to Lockhart (2) using mixed BSV antisera. The virus was diluted four fold in buffer A, pelleted at 150,000g for 60 min and resuspended in 100 Al 50 15 mM sodium phosphate pH 6.1. Cloning and sequence analysis Virion DNA was purified by digestion of virus particles with Proteinase K at 1 mg/ml in 100 mM TrisCl pH 8.0, 2 mM CaC1 2 , 20 2% SDS, for 2 h at 65'C. Following phenol extraction, the DNA was precipitated, washed in 70% ethanol, dried and resuspended in 50 Al TE [10 mM TrisCl, 1 mM EDTA pH 8.0) Sambrook et al. (13)]. The DNA was digested with Eco R1 and the resulting fragments cloned into pBluescript II SK+ 25 (Stratagene). One clone had sequence homology to ScBV and other badnaviruses. Primers were designed using the clone sequence information to allow PCR amplification of the entire virion DNA. The primers were contiguous, facing in opposite WO99/43836 PCT/GB99/00599 33 directions (nucleotide numbering for the completed BSV sequence, see below): V1514 5' TGCGGGTGCTTCTTCACCC (anti sense @ 2778), V1517 5' TATGCACCAGCTACAAGTGC (sense @ 2779). The Expand TM Long Template PCR system (Boehringer) was used, 5 following the manufacturer's protocol for a 0.5-12 kb template (system 1). The template was 0.1-1.0 pl of the isolated virus DNA and the primers were used at a final concentration of 300 nM. The amplification cycle conditions were 94 C x 1 min, [92 C x 20 s, 50'C x 30 s, 68°C x 6 min] 10 xl0, [92 C x 20 s, 50 C x 30 s, 68°C x 6 min with 20 s increment/cycle] x 15 and a final extension for 68"C x 7 min. The 7.39 kb PCR product and sub-clones derived from it were sequenced manually using Sequenase version 2.0 (USB, United 15 States Biochemicals) and automatically using the Prism system (Applied Biosystems) and an ABI 373 sequencer. The sequence was analysed using the GCG sequence package (14). All DNA manipulations were performed according to Sambrook et al.(13). 20 For isolation of RNA, 2 g symptomatic banana leaves were ground to a powder in liquid N 2 , added to 24 ml 100 mM Tris C1 pH 8.0, 20 mM EDTA, 500 mM NaCl, 20 mM mercaptoethanol, 2% SDS and incubated at 65"C for 10 min. After the addition of 25 8 ml 3M sodium acetate and incubation on ice for 10 min, the solution was centrifuged at 10,000 x g for 10 min and the supernatant was filtered through two layers of Miracloth. The nucleic acid was precipitated by the addition of 0.7 vol.

WO99/43836 PCT/GB99/00599 34 isopropanol, incubation at -20"C for 30 min and centrifugation. The pellet was resuspended in 2 ml TE, extracted with phenol/chloroform then chloroform and the RNA precipitated by the addition of lithium acetate to give 2 M 5 and incubation at 4"C overnight. The RNA pellet was washed twice in 80% ethanol and resuspended in 40 pl water. Formaldehyde-containing gel electrophoresis and northern blotting of RNA was as described in Sambrook et al.(13). The 5' end of the transcript was mapped by primer extension using LO the method of Medberry et al. (3). The primer used was 5 ATCTTGCGCTCTACTCGC at 7361 bp in the BSV sequence. Primer design and PCR PCR primer pairs were chosen from aligned amino acid L5 sequences corresponding to the aspartic protease and reverse transcriptase regions of the derived BSV sequences. The PCR was performed on DNA isolated from banana leaves using the method of Li et al. (15), using the basic protocol described by manufacturers of the Taq DNA polymerase (Gibco BRL). The 0 conditions were 94 C for 2 min, [94 C for 1 min, 40-50 C for 1 min, 72 C for 1 min] x 30 cycles, followed by a 5 min extension at 72'C. Reaction products were separated by electrophoresis through a 1.5% agarose gel and detected by fluorescence of ethidium bromide under UV light. Following 5 photography, the reaction products were transferred onto nylon membrane (Hybond-N, Amersham). A 32 P-labelled probe was synthesised by random priming using the full-length BSV PCR product as template (16). Hybridisation and washing was at WO99/43836 PCT/GB99/00599 35 65"C using the solutions and protocols described by the membrane supplier (Amersham). Virus purification 5 The virus purification gave a low yield of bacilliform particles of size -30 x 130 nm, that could be trapped on BSV antiserum-coated carbon grids but not on CSSV antiserum coated grids. The virus could be detected by ISEM in a crude extract of infected leaf, but not in leaf-dip preparations. 10 Virus sequence analysis The complete 7388bp nucleotide sequence of both strands of the Nigerian isolate of BSV was determined as is shown in SEQ ID NO 1. As with other badnaviruses and caulimoviruses the 15 numbering of the sequence begins at the putative 5' minus strand priming site and this conserved tRNAmetinit binding site sequence is found in BSV. Overall the sequence shows low but recognisable similarity to 20 other badnaviruses, with highest similarity to ScBV and least to RTBV (Table 1). The sequence is sufficiently different from those of other badnaviruses for BSV to be considered a distinct virus. 25 The + strand contains three large ORF's (Figure 1). This number, their size and order are similar to other badnavirus sequences, with the exception of RTBV which possesses an additional ORF (4, 5). The BSV ORF III shows similarity to WO99/43836 PCT/GB99/00599 36 the ORF III sequences of other badnaviruses, in particular over regions that encode the conserved putative viral replicase functions AP, RT and RH. 5 Transcript mapping Northern blots of total RNA from BSV-infected banana tissue revealed only one BSV-specific band of 7.5 kb. This is the size expected for the major transcript of a pararetrovirus the size of BSV. 0 To map the 5' end of the major transcript RNA extracted from infected banana tissue was used for primer extension. The primer was 5'-ATCTTGCGCTCTACTCGC-3'. Two strong stops were found indicating that the transcript start site was at 7260 5 or 7261bp, 25 nt downstream of a potential TATA box (TATATAA) sequence (see later). Attempts to map the 3' end of the transcript using the approach of Medberry et al. (3) proved unsuccessful. 0 PCR detection of BSV Primer sequences for PCR were selected from within the conserved sequences putatively coding for RT and AP. This primer pair consistently gave a strong amplification product, of the expected size of 644 bp. Hybridisation with a BSV 5 probe and sequencing of this product confirmed its origin as BSV. Amplification of this band could also be achieved from crude preparations from infected plants. All Musa plants tested gave this same size band, and all plants from Onne WO99/43836 PCT/GB99/00599 37 station gave the same pattern when the band was cut with Alu 1. DISCUSSION 5 The BSV genome contains three large ORF'S (Figure 2) potentially coding for proteins of 20.8, 14.5 and 208 kD. The size and order of the ORF'S are very similar to those of most other badnaviruses. Characteristically the ORF'S overlap, 10 that between ORFs 1 and 2 being ATGA (ATG being start of ORF 2 and TGA stop of ORF 1) and thus resembling RTBV (Hay et al) and that between ORFs 2 and 3 being TAATG. Badnaviruses are characterised by having very few AUG translational start codons in the first two ORFs (see reference 16). Ftterer et 15 al. (17) proposed that ORFs 2 and 3 of RTBV (and other badnaviruses) are translated by leaky scanning due to the paucity or poor context of start codons in ORFs 1 and 2. It was also suggested that the AUG-rich leader sequence is bypassed, at least in RTBV, by a "ribosome-shunt" mechanism 20 (18). The leader sequence of BSV is rich in AUG codons. ORF 1 has four AUG codons which is more than other badnaviruses but they are all in poor context (19); the sole AUG codon in ORF 2, that at the start, is also in a poor context. Thus, although there are more AUG codons than other badnaviruses in 25 ORF 1 it is likely that the expression strategy is similar to that described by Fatterer et al. (17). The presence and arrangement of functional domains in ORF WO99/43836 PCT/GB99/00599 38 III, cysteine rich zinc finger-like RNA-binding domain common to all retroelements (20), AP, RT and RH found in ORF III is identical to the those found in other badnaviruses (Table 2). This ORF also contains the additional cysteine-motif 5 characteristic of all other badnaviruses thus far sequenced. The function of this extra "cys" sequence is unknown but it may be involved with translational control (21). Phylogenetic analysis of the currently available badnavirus 10 sequences shows BSV to be more closely related to ScBV and the other "three ORF" badnavirus than to RTBV. The sequence is sufficiently different from those of other badnaviruses for it to be considered a distinct virus. L5 The 5' end of the transcript was mapped to the cytosine/adenosine doublet at 7260/7261, a similar relative position in the genome as in CoYMV (3) and at +25nt with respect to a potential TATA box. There is also an as-1-like sequence as described by Medberry et al (3) for CoYMV (23) 20 (Table 2). A potential polyadenylation signal (AAATAAAAA) is found at 7295 bp. which would give a 35 nt terminal redundancy to the full-length transcript . This terminal redundancy is smaller than those of other plant pararetroviruses (e.g. CoYMV 109-132 nt, RTBV 215 - 216 nt; .5 CaMV 176 nt ; 3, 23, 23) but of similar size to some of the retrovirus terminal redundancies (mouse mammary tumor virus, 15 nt; avian leukosis virus 20 nt; 24). Although it was not possible to map the 3' end of the BSV transcript it cannot be WO99/43836 PCT/GB99/00599 39 downstream of the tRNA binding site as this would affect the replication mechanism. The 5' end of the transcript is 128/127 nt from the tRNA binding site but no polyadenylation signal motifs were found downstream of that at 7361. 5 References for Example 1 and cloning of banana streak virus promoter 1. Lockhart B.E.L. Phytopathology 76, 995-999. 1986. 2. Lockhart B.E.L. Phytopathology 80,127-131. 1990. 10 3 Medberry, et al. Nucl. Acid Res. 18, 5505-5513. 1990. 4. Hay, et al. Nucl. Acids Res. 19, 2615-2621. 1991. 5 Qu, et al. Virology. 185, 354-364. 1991. 6. Bouhida, et al. J. Gen Virol. 74, 15-22. 1993. 7. Hagen, et al. Virology 196, 619-628. 1993. 15 8. Lockhart B.E.L. and Olszewski N.E. In: Breeding Banana and Plantain for Resistance to Diseases and Pests. J Ganry (ed.). CIRAD/INIBAP, Montpellier, France, pp 105 113. 1993. 9. Bejarano, et al. Proc. Natl Acad. Sci. 93, 759-764. 20 1996. 10. Richert-P6ggeler K.R. and Shepherd R.J. Virology 236, 137-146. 1997. 11. LaFleur, et al. Phytopathology 86, S100-S101. 1996. 12. Sambrook, et al. Molecular Cloning: A Laboratory 25 Manual. Cold Spring Harbor Laboratory Press, New York. 1989. 13. Devereux, et al. Nucl. Acid Res. 12,387-395. 1984. 14. Li, et al. Molec. Biol. Rep. 12, 215-220. 1994.

WO99/43836 PCT/GB99/00599 40 15. Feinberg A.P. and Vogelstein B. Anal. Biochem. 132, 6 13. 1983. 16. Fftterer, et al. J. Virol. 71, 7984-7989. 1997. 17. FiTterer, et al. J. Virol. 70, 2999-3010. 1996. 5 18. Lutche, et al. EMBO J. 6, 43-48. 1987. 19. Covey S.N. Nucl. Acids Res. 14, 623-633. 1986. 20. Hull R. Ann. Rev. Phytopathol. 34, 275-297. 1996. 21. Lam, et al. Proc. Natl. Acad. Sci. USA 86:7890-7894. 1989 10 22. Lam E. and Chua N.-H. Plant Cell 1, 147-1156. 1989 23. Medberry, et al. Plant Cell 4, 185-192. 1992 24. Bao Y. and Hull R. Virology 197, 445-448. 1993. 25. Guilley, et al. Cell 30, 763-773. 1983. 26. Coffin, et al. In Virus Taxonomy: Classification and 15 nomenclature of viruses. Eds Murphy F.A., Fauquet C.M., Bishop D.H.L., Ghabrial S.A., Jarvis A.W., Martelli G.P., Mayo M.A. and Summers M.D. Pp. 193-204. 1995 Springer Verlag. 27. Comstock J. C. and Lockhart B.E.L. Plant Disease. 74, 20 530. 1990. EXAMPLE 2 - Expression of a heterologous sequence operably linked to BSV promoter 25 All standard methods of molecular biology are from Ausubel et al., Current Protocols in Molecular Biology, Wiley, 1996. Subcloning the BSV promoter/leader fragment WO99/43836 PCT/GB99/00599 41 A portion of the BSV genome (fragment length of 1614 bp), was amplified from plasmid pSac21 by polymerase chain reaction with the addition of suitable cloning sites for creation of a chimeric gene. 5 The primer defining the 5' end of the promoter/leader element was 5'-GCCAGATCTAAGCTTCCCGGGATAATCAGAACTGACAGTCA-3'. The primer defining the 3' end of the promoter/leader element 10 was 3'-GCCCCATGGATTGTATGCAAGGTGAA-3'. This region of the BSV genome comprises the promoter and leader (pBSV/BSV1) for expression of BSV genes. BglII and SmaI sites were added at the upstream end of the promoter 15 element, and an NcoI site was added at the end of the BSV leader region. This fragment was cloned blunt ended into the EcoRV site of pBluescriptKS+ (Stratagene, La Jolla, CA, USA), and several clones were sequenced to identify one with the correct sequence. 20 Construction of pBH850 To prepare a LUCintron chimeric gene, an overlap PCR strategy was used, in which three different fragments were generated as follows: 25 1) fragment (1) amplification of pJJ3792 (source of LUC) with primer set NC389(1) and NC392(4) to give an upstream portion of the LUC CDS overlapping fragment (2); WO99/43836 PCT/GB99/00599 42 2) fragment (2) amplification of pAR4401 (source of st-ls ivs2 intron, described in Vancanneyt et al., (Mol Gen Genet, 220, 245-50, 1990)) with primers NC390(2) and NC393(5) to give the st-iS ivs2 intron overlapping fragment (1); 5 3) fragment (3) amplification of pJJ3792 with primers NC391(3) and NC394(6) to give a downstream portion of the LUC cds overlapping fragment (2). All reactions were done with Pfu polymerase using 20 cycles. 10 Subsequently, iil of fragment (1) and 1zl of fragment (2) were mixed and amplified using Taq polymerase (15 cycles) with primers NC389 and NC393. In a separate reaction, il of fragment (2) and 1il of 15 fragment (3) were amplified under the same conditions using primers NC390 and NC394 to produce fragments (1-2) and (2-3). In the final reaction, 1il of fragment (1-2) and i.l of fragment (2-3) were mixed and amplified using Pfu polymerase (15 cycles) to generate the full length product using primers 20 NC389 and NC394. This fragment was cloned into a pUC-based vector as a blunt-ended fragment, and the sequence of an isolate confirmed. Primers: 25 NC389 5'-AACCATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCCCT-3' WO99/43836 PCT/GB99/00599 43 NC390 5'-GTAAGTTTCTGCTTCTACCTT-3' NC391 5 5'-GTGGCCCCCGCTGAATTGGAA-3' NC392 5'-AGGTAGAGCAGAAACTTACCTGATACCCTTTGTATTTA-3' 10 NC393 5'-TTCCAATTCAGCGGGGGCCACCTGCACATCAACAAATTT-3' NC394 5'-ACTCTAGATTACAATAGCTAA-3' 15 The resulting LUC-int sequence that includes the complete luciferase CDS was used to construct pBH850, which has the LUCint sequence linked to the SpMas promoter (construct 6 from Ni et al., Plant J., 7, 661-76, 1995) and the nos 3' end 20 (Bevan et al., Nuc Acids Res, 11, 369-85, 1983). The LUC-int sequence was isolated as an NcoI-XbaI fragment, following digestion and gel purification. A pUC plasmid that had a LUC sequence (de Wet et al., Mol Cell Biol, 7, 725-37, 1987) linked to the SpMas promoter and the nos 3' end was digested 25 with NcoI and XbaI and the fragment containing the vector, promoter and 3' end was gel-purified. These two fragments were ligated together to give pBH850, which comprises a SpMas-LUC-int-3'nos chimeric gene.

WO99/43836 PCT/GB99/00599 44 Construction of a pBSV/BSV2-LUC chimeric gene The pBSV/BSV1 fragment was excised from the plasmid described above using XhoI and NcoI, and the fragment was gel-purified. A pUC-based plasmid (pBH850) containing a SpMas-LUCintron 5 3'nos chimeric gene was digested with PstI and NcoI to liberate a fragment containing the LUC-INT CDS and the nos 3' end, which was gel-purified. pBluescriptKS+ was digested with PstI and XhoI, and the vector fragment was gel-purified. The three fragments were ligated together to create a 10 pBluescript-derived plasmid with the BSV/BSV/LUC-INT/3'nos chimeric gene. Plasmid isolates with the expected restriction digestion pattern were identified. One such isolate was designated pMM7393 and retained for transient expression analysis. Plasmid DNA was prepared using a 15 standard alkaline lysis method. Expression reference plasmid As a reference plasmid for the transient expression analysis, a pUC-based plasmid (pJJ3792; available from DNA Plant 20 Technologies, Oakland, CA, USA) containing a CaMVp35S-LUC 3'nos chimeric gene was used. Plasmid DNA was prepared using a standard alkaline lysis method. Biollistics control plasmid 25 As an internal control for shot-to-shot variation for biollistics DNA delivery, a pUC-based plasmid (pP07119) comprising a 2xCaMVp35S-GUSintron-3'ocs chimeric gene was used. This is one of a wide range of similar plasmids that WO99/43836 PCT/GB99/00599 45 can be used as a biollistics control for banana, including plasmids such as pZO1052 (which has a CaMV 35S-GUS chimeric gene; Ha et al., Plant Cell Rep, 11, 601-604, 1992) or pBI221 (which has a similar chimeric gene; Clontech, Palo Alto, CA). 5 Plasmid DNA was prepared using a standard CsCl gradient method. Biollistics DNA delivery The banana suspension cultures were derived from male flowers 10 of the cv. Grand Nain, and maintained in liquid according to Grapin et al. (In Vitro Cell. Dev. Biol.-Plant, 32, 66-71, 1996). Suspension cells were removed from fresh suspension cultures, the suspension cells were successively sieved through nylon mesh to produce a fraction between 250Am and 15 600gm, and the embryogenic suspension fraction was then spread thinly onto filter paper discs. Approximately 20-30mg of suspension cells were used per biollistics shot. Plasmid DNA was precipitated onto tungsten particles using a 20 standard CaCl2/spermidine precipitation step (Vain et al., Plant Cell Rep., 12, 84-88, 1993). 20Ag of each LUC-gene plasmid were mixed with 10pg of the GUS control plasmid and coated onto 2mg of tungsten particles. 3A1 of suspended tungsten particles (out of 15A1 in a single prep) were 25 delivered per shot, using a particle inflow gun (Finer et al., Plant Cell Rep., 11, 323-28, 1992). Enzymes assays WO99/43836 PCT/GB99/00599 46 The suspension cells were incubated for 19 hours and then luciferase activity (resulting from expression of the LUC chimeric gene) was monitored using a single photon counting program on a Beckman scintillation counter. Beta 5 glucuronidase activity (resulting from expression of the GUS chimeric gene) was measured by determining fluorescence of the released methyl-umbelliferone from the methylumbelliferyl-glucuronide substrate. 12 DNA introductions were performed with each prep; 8 of the samples 10 were taken for luciferase assay, and 4 of the samples were taken for glucuronidase assay. Results 15 Results demonstrating good expression driven by BSV promoter in planta are shown in Table 4 below. EXAMPLE 3 - Detection of BSV 20 Virus Isolation Musa plants with typical chlorotic streaks were collected from the Onne Research Station, IITA, Nigeria. Virus minipreps were prepared from 5 g leaf tissue samples following the protocol of Ahlawat et al. (1996). The identity 25 of the BSV was confirmed by ISEM. DNA extraction and sample preparation DNA was isolated from Musa leaf tissue by the method of Li et WO99/43836 PCT/GB99/00599 47 al. (1994). Crude extracts were prepared from growing leaves for direct PCR and IC-PCR by grinding at 1:10 (w/v) in either of two different protocols. The first used 1 x phosphate buffered saline (PBS) / 10 mM mercaptoethanol as grinding 5 medium, followed by centrifugation at 13,000 g for 1 min. The supernatant was removed and used in the subsequent assay. The alternative used PBS/ 2% poly-vinyl pyrrolidine (PVP) /1% sodium sulphite as grinding medium followed by filtration through glasswool. The resulting filtrate was used. 10 For DB-PCR, plant extracts were prepared by the second method using carbonate buffer (1.59 g Na 2

CO

3 , 2.93 g NaHCO 3 , per litre, pH 9.6) as grinding medium. 15 PCR and primers The PCR reaction mix of 50 Al contained lx buffer supplied (Gibco-BRL), 200 AM each dATP, dCTP, dGTP, dTTP, 2.5 mM MgC1 2 , 10 pmol each forward and reverse primer, 2 units Taq polymerase (Gibco-BRL). PCR conditions were 94 0 C x 1 min, 20 (94 0 C x 1 min, 50 0 C x 1 min, 720 x 2 min) x 33 cycles and a final extension at 72 0 COC x 5 min. Primers used to detect BSV were the pair v3012-v1573 of which the sequences are given above. They were chosen from aligned amino acid sequences corresponding to the AP and RT regions derived from 25 the Onne isolate BSV sequence. The primers have been tested for the amplification of a predicted 644 bp product and its specificity to BSV has been confirmed by Southern hybridization and sequence analysis of the product (Harper et WO99/43836 PCT/GB99/00599 48 al., 1996). Musa nuclear DNA was detected by PCR using the primer pair 5'ACTAAAACGCCTATAACTCC and 5' GCTCCAATACCCATAAGAA to amplify a 260 bp fragment of a Musa intermediate repetitive sequence (Baurens et al. 1996). 5 A region of the nuclear encoded ACC oxidase gene was amplified using degenerate primers to two conserved regions ASFYNPGS (forward 5'GCGTCGTTCTAYAACCCGGRAGC) and EPRFEAM (reverse 5' SCYWNCGAAKCTT GGMWCC). EMBL accession x91076, 10 Musa acuminata accol gene. Mitochondrial DNA was detected using the primer pair nadlB nadlC to amplify an intron sequence of the nadl mitochondrial gene (Demesure et al. 1995). Chloroplast DNA was detected by 15 PCR using the primer pair rbcLPl-atpBPl to amplify the intergenic region between rbcL and atpB (Al-Janabi et al. 1994). IC-PCR and DB-PCR 20 For IC-PCR, rabbit polyclonal antiserum to BSV or a mouse polyclonal antiserum to BSV were used for coating. Sterile 0.5 ml polypropylene microcentrifuge tubes were loaded with 25 Al of purified IgG (1 ug/Al diluted to 1/500) in carbonate buffer, and incubated at 37 0 C for 2 hours or 4 0 C overnight. 25 After 3 washes with PBS/0.05% Tween-20, 25 Al plant extract were loaded and incubated at 37oC for 2 hours or 4oC overnight. For DB-PCR the plant extract in coating buffer was added directly to the tubes without prior coating with anti- WO99/43836 PCT/GB99/00599 49 BSV IgG and incubated at 4 0 C overnight. For both techniques the tubes were similarly washed with PBS three times and dried briefly. PCR was carried out directly in the tubes, as described for PCR, without a specific disruption treatment 5 for the virion particles. Analysis and RE analysis of PCR products After amplification, 10-15 p1l of the PCR reaction products were separated by electrophoresis through 1.2 % agarose in 10 either 1x TBE or lx TAE. Following ethidium bromide binding DNA was visualised on a UV transilluminator. DNA markers were supplied by Gibco-BRL. PCR products were directly restricted in the PCR reaction mix by the addition of 0.5 pl of the appropriate restriction enzyme to 10 Al of each PCR reaction 15 and incubating at 37 0 C for 1 hour prior to electrophoresis of the whole sample. Southern hybridisation Reaction products were separated by electrophoresis through a 20 1.5% agarose gel and detected by fluorescence of ethidium bromide under UV light. Following photography, the reaction products were transferred onto nylon membrane (Hybond-N, Amersham). A 32 P-labelled probe was synthesised by random priming using the full-length BSV PCR product as template 25 (Feinberg and Vogelstein 1983). Hybridisation and stringent washing was carried out at 65 0 C using the solutions and protocols described by the membrane supplier. Autoradiography was carried out as described by Sambrook et al. (1989) WO99/43836 PCT/GB99/00599 50 Cloning and sequencing PCR products were cloned into a TA vector (Invitrogen) following purification with PCR preps kit according to the 5 manufacturers protocol (Promega). All DNA manipulations were performed according to Sambrook et al. (1989). Plasmids containing the cloned PCR product inserts were sequenced by the dideoxynucleotide chain termination method (Sanger et al. 1977) using Sequenase version 2.0. (United States Biochemicals) and 10 M13 forward and reverse primers. Results Standard-PCR and amplification conditions 15 The expected BSV DNA fragment of 664 bp was amplified from leaf tissue samples collected from field grown plants with or without characteristic BSV chlorotic or necrotic streak symptoms. The same amplification product was also obtained from leaf samples collected from plants grown in a screenhouse 20 or cool room (22"C) again with or without BSV symptoms. More interestingly, the expected amplified product was obtained from tissues collected from in vitro plantlets. The amplified product hybridized to the cloned BSV probe and the hybridization signal was detected after high stringency washing 25 conditions. The sequence of the PCR product was identical to that of episomal BSV sequence. No product was amplified from nucleic acid extracts of traveller's palm (Ravenala madagascariensis) or Heliconium sp. nor from samples without WO99/43836 PCT/GB99/00599 51 template DNA. Hybridizations using a digoxigenin-labelled, cloned fragment from one BSV isolate indicated an apparent low homology between the probe and the amplification products. Even under moderate wash conditions, the PCR products amplified 5 from some clones that appeared intense on ethidium bromide stained gels produced only faint hybridization signals. Optimal conditions for amplification were determined. A lower annealing temperature (37 oC) used in the initial cycles of the 10 PCR program, led to non-specific amplification products being visible on gels. However, only a single PCR product was detected after Southern hybridization. Performing all 40 cycles with an annealing temperature of 55 'C led to a slight decrease in intensity of the bands observed on agarose gels. 15 An annealing temperature of 60 OC greatly reduced the intensity of the amplified products from the banana samples tested. Altering the MgC1 2 concentration between 4 mM and 2.5 mM had little effect on the observed intensity of amplification products. A concentration of 1 mM MgC1 2 resulted in 20 inconsistent amplification of the 664-bp DNA fragment. Under optimal conditions, a product was readily obtained from 0.1 picogram of BSV full length DNA. Boiling the template DNA with the primers, followed by 25 quenching on ice, increased the sensitivity of detection of ScBV in most sugarcane samples (Braithwaite et al., 1995). This procedure was not necessary for amplification from solutions containing either the cloned BSV virus genome or purified BSV WO 99/43836 PCT/GB99/00599 52 virions. Comparison of techniques for BSV-indexing Twenty plants were examined for typical BSV symptoms and 5 samples taken from leaves showing different appearances. Typical chlorotic or necrotic BSV symptoms were shown by 9 plants (13 symptomatic samples), the remaining 11 being symptomless (23 symptomless samples) (Table 3). ISEM detected BSV in 10 of the 36 samples, while BSV using dot-blot 10 hybridization assay was detected in only 6 of the 36 virus minipreps. However, PCR generated amplification products of the expected size (644 bp) in 32 of 34 virus miniprep samples and produced strong hybridization signals with Southern analysis using a BSV derived probe. The two PCR-negative 15 samples (TMP3x 15108-1 and FHIA-1) were also negative by ISEM (Table 3). These results indicate PCR to be a much more sensitive technique for BSV indexing than the use of symptoms, ISEM or dot-blot hybridization. 20 IC-PCR and DB-PCR Both IC-PCR and DB-PCR consistently amplified the BSV-specific 664 bp product from crude leaf extracts or virus minipreps prepared from BSV-infected Musa spp. No such product was amplified from crude leaf extract prepared other plant species 25 (Traveller's palm, Tobacco, Heliconium sp., Sugar cane) or PCR solutions containing no DNA template. Pre-treatment of the tubes for 1 hour at 37 0 C with either 1% WO99/43836 PCT/GB99/00599 53 BSA or 5% fat-free skimmed milk powder could reduce the apparent virus binding in both IC- and DB-PCR. In contrast, 1 mg/ml herring sperm DNA as blocking agent had no effect on virus binding. 5 Musa nuclear intermediate repetitive DNA sequence, the mitochondrial gene nadl and the chloroplast intergenic region DNA could be detected in Musa genomic DNA. However they could not be detected in the IC-PCR tubes in which BSV sequences 10 could be detected. Comparative results of tenfold serial dilutions of crude leaf extract indicated that IC-PCR and DB-PCR are at least as sensitive, and for some samples, more sensitive than 15 standard-PCR probably due to the removal of inhibitory substances by the washing steps in IC- and DB-PCR. The sensitivity IC-PCR and DB-PCR to detect BSV was compared with that of standard-PCR, ELISA and ISEM using virus 20 minipreps from plants previously indexed by ISEM and ELISA. The sensitivities of the PCR-based methods are comparable to each other and they are all much better than for the other detection methods. IC-PCR distinguishes integrated BSV and episomal BSV sequences and so is useful in the context of the 25 present invention. DISCUSSION Despite the concerted efforts of many researchers (Lockhart WO99/43836 PCT/GB99/00599 54 and Olszeswki, 1993; Harper et al., 1996; Braithwaite et al., 1995) and international centres (INIBAP, 1995), reliable detection of BSV from infected plant materials has become a serious constraint for the safe movement of improved Musa 5 germplasm. Currently, there are no reports on development of protocols for reliable detection of BSV from in vitro plantlets that are suitable for germplasm movement. Our results presented in this study demonstrate a PCR technique that detects BSV from such in vitro plantlets and is suitable 10 for the large-scale initial screening of in vitro Musa germplasm, thus reducing the numbers of potential 'BSV-free' plant materials for further confirmatory indexing. The approach used here has been to use a "composite" antisera 15 generated against numerous different BSV isolates to trap virus particles and a subsequent PCR with primers based on the sequence of a Nigerian BSV isolate. Alternative degenerate primers are available (Lockhart and Olszeswki, 1993,) for amplification of isolates with widely varying 20 sequence. The washing steps following immuno-capture effectively remove PCR-inhibitory substances improving the reproducibility of results. A detailed comparative analysis of all the reported degenerate primers in combination with restriction analysis, may provide useful information 25 regarding the sequence variability of BSV and the possibility to differentiate and detect all isolates of BSV. The PCR primers and conditions described here provide a WO99/43836 PCT/GB99/00599 55 specific, sensitive method for diagnosing BSV-infected banana/plantain from both in vitro propagated or field grown plants. This method is currently being applied for screening and surveying banana germplasm from quarantine plant 5 materials, and in the field to ascertain the full extent and distribution of BSV infection. Integration The health status of plant material indexed for BSV solely by 10 PCR may be questioned due to a possibility of BSV DNA integration into Musa spp. (LaFleur et al., 1996). Using degenerate primers, integrated sequences of BSV have been detected from Musa germplasm collected from all over the world (LaFleur et al., 1996). Our results with PCR of Musa 15 DNA using BSV specific primers confirm that essentially all Musa cultivars appear to possess integrated BSV sequences. Additional evidence is shown by genomic Southern analysis when carefully isolated very high molecular weight Musa DNA hybridises to BSV sequences. The apparently high degree of 20 infection of Musa sp. by BSV shown in this study, is mimicked by the widespread infection of sugarcane by the related ScBV (Comstock and Lockhart, 1990, Braithwaite et al., 1995). Our results show that episomal virus can be specifically 25 detected with high sensitivity and specificity. Musa nuclear, mitochondrial or chloroplast DNA which may contain possible BSV integrated sequences are not captured by the anti-sera or by the tubes in which the assay is carried out.

WO99/43836 PCT/GB99/00599 56 Development of the assay The ease of sample preparation for this technique is suitable for the handling of large number of samples. Under limited laboratory facility conditions, either antibody-coated or 5 empty Eppendorf tubes may be hand-carried or shipped by collaborating scientists, and the tubes returned back after loading of samples and washing to complete PCR assay. A similar system for detection of viruses by ELISA by mail is reported to be successful (Gaikwad and G. Thottappilly, 10 1988.) Dot-blot hybridisation could be a more efficient, economical and technically less demanding detection system for handling large number of samples. However, our results show that 15 ISEM, ELISA and PCR assays were more reliable methods than this assay and confirm the results of Lockhart and Olszeswki, (1993). ELISA is not sufficiently sensitive or reliable to detect 20 BSV, (a low-titre virus) in infected plants without characteristic symptoms, and its wider application is limited. Nevertheless, ELISA has proved useful to confirm BSV-infection from symptomatic plants. ISEM has proved sensitive enough to detect BSV from plants with low BSV 25 titre. Our results presented in this study further show that PCR linked to the serological technique provides a rapid, sensitive assay system.

WO99/43836 PCT/GB99/00599 57 Possible improvements to the current PCR protocols could allow wider application of Musa virus-diagnosis. For example, CMV infection of Musa has been generally observed under field conditions as sole or mixed infection with BSV. 5 The symptoms caused by CMV are often confused with those caused by BSV. An IC-RT-PCR is being developed for CMV detection with the ultimate aim of developing a simultaneous detection of both BSV and CMV in a single test tube from individual samples. 10 PCR Because of its high sensitivity, PCR assay may produce 'false negative or false positive' results. The small-scale DNA extraction procedure allows detection from a very small 15 portion of the tissue. Virus distribution may not be uniform in all tissue portions of a plant, for example in some portions of leaf tissue virus particles may be absent. Therefore, if the assay of a whole plant is based on a single small sample, it is possible that false negative will result. 20 This problem can be reduced, however, by taking multiple samples from different leaves and combining them into a composite samples. Our experiments so far have not shown the virus to be absent from certain parts of a leaf, and leaves are an appropriate tissue for assay. 25 Experimental errors (e.g. contamination) or non-specific amplification are a possible source of "false" positive results. DNA hybridization of the amplification product with WO99/43836 PCT/GB99/00599 58 the homologous probe rules out any possibility of a false positive. These problems can also be minimized by multiple testing of individual plants and the use of independent confirmatory assays (e.g. ISEM) for reliable diagnosis. 5 Our results have shown a rapid, sensitive and accurate assay for episomal BSV. At present ISEM is the confirmatory diagnostic test especially for international movement of Musa germplasm (Diekmann and Putter, 1996). However as the wider LO application of ISEM for indexing large numbers of samples is limited by labour, equipment requirement and the time required to perform the assay, IC-PCR should be considered as its replacement assay. .5 References for Example 2 and detection of banana streak virus 1. Ahlawat, et al. Plant Disease 80, 590-592. 1996. 2. Al-Janabi, et al. Theor. Appl. Genet. 88, 933-944. 1994. 3. Baurens, et al. Mol. Gen. Genet. 253, 57-64. 1996. 4. Bouhida, et al. Journal of General Virology 74, 15-22. 0 1993. 5. Braithwaite, et al. Plant Disease 79, 792-796. 1995. 6. Comstock, J. C., Lockhart, B. E. L. Plant Disease 74, 530. 1990. 7. Demesure, et al. Molecular Ecology 4, 129-131. 1995. 5 8. Diekmann, M., Putter, C. A. J. FAO/IPGRI Technical Guidelines for the Safe Movement of Germplasm. No. 15. Musa. 2nd Edition. Food and Agriculture Organization of the United Nations, Rome/ International Plant Genetic WO99/43836 PCT/GB99/00599 59 Resources Institute, Rome. 1996. 9. Feinberg, A. P., Vogelstein, B. Analytical Biochemistry 132, 6. 1983. 10. Gaikwad D.G. and Thottappilly, G. J. Phytopathology 121: 5 366-369. 1988. 11. Hagen, et al. Virology, 196, 619-628. 1993. 12. Harper, et al. Detection of banana streak virus. In (Ed) Marshall, G. Diagnostics for Crop Protection. BCCP Proceedings 65, BCCP, Surrey, UK. pp 47-51. 1996. 10 13. Hay, et al. Nucleic Acids Research 19, 2615-2621. 1991. 14. LaFleur, et al. Phytopathology 86, S100-S101. 1996. 15. Lassoudierre, A. Fruits 29,349-347. 1974. 16. Li, et al. Plant Mol. Biol. Rep. 12, 215-220. 1994. 17. Lockhart, B. E. L. Phytopathology 76, 995-999. 1986. 15 18. Lockhart, B. E. L. Phytopathology 80, 127-131. 1990. 19. khart, B. E. L., Olszewski, N. E. Serological and genomic heterogeneity of banana streak badnavirus: implications for virus detection in Musa germplasm. In Ganry, J. (Ed.), Breeding banana and plantain for resistance to diseases 20 and pests. CIRAD/INIBAP, Montpellier, France, pp. 105-113. 1993. 20. Medberry, et al. Nucleic Acid Research 18, 5505-5513. 1990. 21. Qu, et al. Virology. 185:354-364. 1991. 25 22. Sambrook, et al. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY. 1989. 23. Sanger, et al. Proc. Natl. Acad. Sci. USA 74, 5463-5467. 1977.

WO 99/43836 PCT/GB99/00599 60 24. Takahashi, et al. Phytopathology. 83, 655-659. 1993.

WO 99/43836 PCT/GB99/00599 61 Table 1. Badnmirun.s nucleotide homology comparison Virus % nucleotide sequence homology to BSV CoYMV 42.7 CSSV 49.0 DaBV 47.8 RTBV 40.7 ScBV 51.2 WO 99/43836 PCT/GB99/00599 62 Table 2. as-1 sequence Distance TATA from TATA sequence CaMV cacTGACGtaagggaTGACGcac 34 ctcTATATAAgca CoYMV tgaTGATGtcattgaTGACGgcg 176 cctTATTTAAgca FMV gtaTTACGaacgcagTGACGaca 22 atcTATTTAAaga BSV tagTCACGcacga--TGACCttt 181 ctcTATATAAgga WO 99/43836 PCT/GB99/00599 63 Table Comparative detection of BSV Sample Symptoms Result No ISEM PCR I a Symptonmles] -ve +ve lb Necrotic +ve +vc I c Symptonmless -ve +ve Id Symptomles s -ve +ve 2 Symptomless -ve -ve 3 Symptoml-ess -ve +ve 4 Symptorrmless +ve +ve Sa Necrotic -ve +ve Sb Symptoml-ess +ve +ve Sc Symptomless +ve +ve 6a Symptomless +ve +ve 6b Necrotic -ve +ve 7a Necrotic +ve +ve 7b Necrotic +ve +ve 7c Chlorotic +ve +ve 7d Chlorotic +ve +ve 8 Symptomless -ye -ve 9 Symptomless +ve 10 Symptomless -ve 11 la Symptomless -ve +ve 11 b Symptomless -ve +ve 11 c Symptomless -ve +ve 12a Chlorotic -ve +ve 12b Necrotic -ve +ve 12c Symptomless -re +ve 13a Symptomless -ve +re 13b Symptomless -ve +ve 14a Necrotic -ve +ve 14b Symptomless -ve +ve 14c Symptomless -ve +ve 15 Symptomless -ve +ve 16 Necrotic -ve +ve 17 Necrotic -ve +ve 18 Symptomless -ve +ve 19 Symptomless -ve +ve 20 Chlorotic +ve +ve WO99/43836 PCT/GB99/00599 64 Table 4 35S promoter BSV promoter Luciferase activity (cpm/pg protein) 1,272,388 7,645,568 1,372,242 4,004,633 1,808,389 3,842,321 833,581 1,458,931 1,279,123 3,164,783 872,056 4,139,964 707,714 2,291,611 815,308 4,889,694 average: 1,120,100 3,939,688 Glucuronidase activity (pmols 4-MU/min/mg protein) 93,217 29,837 32,002 13,318 39,584 16,231 23,268 8,668 average: 47,018 17,013 Normalized luciferase activity 23.8 232 WO 99/43836 PCT/GB99/00599 65 SEQ ID NO: 1 TGGTATCAGAGCAAGGTTCGTTTTTATGGCTTTCATGGGTAATTCCTTT AGTGACGAGCCGTTTTTATATAAGTA GATTTAAATTGTTTAAATTGGAGCTGTATTCAGTCTTTCTTAGAAATG AGCATGATTTCGATTATAGCTGGTCAAGGCTGTAGGGAAAAATGATTATG TTTTCATGTCAAACAGCACAGAAGAC GAAGAGAATGGGGGAAAAATTGGTTCTTCGCATGTATGAGGATATATCC TAGAAACAGAACATAACCTGCGTGAGTACTTACAGCCAGATAATAT CCTATATAGAAACATGGGCATCGTGAAGTATAAGACTGACTGACTACA& GCTCCTTTATAAACAAAAGGATCATAGACCTCTGTACGTCAATACGGGTT AAGCATCCTGGAGGAGTACTCCTATCTAGTTTACGAAGAAAGTCATTC ACCTTGCATACAATTTATGGTCGAGAAACTTGGGATCAAAAATTCCAGG AATTTCTAACTCATCTGAACTCACTCAAGCTCACTTGAGTATCTTGAC TTGGCAACGGAAGCCAAIAGTCTCAACAAGATCTTGCTCATAATTTGCA CATCAACACTTATCGACTAAGCCTTACAGGGAAGGTCCTTTGGACTTCTG GAAGGAAAAATCGGGATTTACTTGTGCAGATAATCGGTGAGCAGGAGGCT CAAAGAAGGACTTATTGGAGTTGCAGAACTTAGTAGATTGTGCGCAG CCAGCGTAACGATCTTAAGAAGGCTCACGAAAAGCTGGACGTCTTGTCTG ATGAGCTTAAAGCTCTCAGAAAGGACTATCTGAAGAGGCGCCCCTTGAGC AAGAAGTAGATGTTGGACCGAACTAT CATAGAGAAGCAAACTGAGGCCTTAACTGAGGAGCTGACTAGAJAGTTC AAAATCTGAAAAAATTATTCATGACTTTGAGCGAAGCTCATGGGATGA GTATTTAAGTTCGATCACACATCGAC ACTGGTGACTGGGAATCCCCTGGAGTAGGATATCTGACCGTGGATCGGT GACAACACCCAAACTACCATTTCTTT CAAAGACACAACAGGAAGTCTTAGCCTTAGACACAGTAGCGACTC CAAAACCGCTTGAGAATACTTGAA-AGGACCGGTGCAACATCAGCCGGTAC CCAACTAGTAATAGCACAGGATACAA TTCAACAAATTCAAGGGAGTCAACCAAGGAGACGGTGGTACTGCGGCC ACACAGATCAACCAALCTTAAATGAT ATGTAAACAATACGACAACACCGTAG AGGCCCTATAGCAATAGATTGACCAA GAGCAGCATACGAAGCCCCGATTGCCAGGCAGACCATATA GGAAGGGTTGTAGGACGACAACCCCGGGAGCATACACTATCTATGTGT AGCCATCGGTACGAGCTCCCGGAGAA TACGAAGATTTTATCAGGCGCTTATG ATTCGACGAAAGAGATCCTACAGGAC AGTGTTTAAACAATCTTAGGTGCCGA GATGGAACACW7TTTAAGCGACAACT CATAGGACATATGCAGGCACGATGGCCTTAGTCCGGATACACG ATGGACTCAGGAGGAGAAGAAGGCAGATCCATTATGAGCTATGAGG CTACGCCAGCCACAACAGCTCGAAAT ATGACCATAAGGGATTTCTACCCATGT-ATCGTATCCTAJACTA GGAACGGTCAGTAGCATTCGTACGAC GTAGATGAGACTCACCATGTTCCCAACGTCGGATCGCCTATATAT CAAAGAGTAGTGGAGTACTTACTCCAAGGCGTTAAGCTATAAGC TCAGAAGCTGAGTAC AGTAT CACTTGAACTCAGC CCCATTGTTCATCACACAI ACCAAT

AACTACGACAACTCACGGAGTATACGA~GGTATTATGAGC

WO 99/43836 PCT/GB99/00599 66 ATCCTCAGCGCCACCAAATACAAJCGAAJGATGGAGATTCAGATGATGACA TCCAAGCCACAATAGAGCATGTTACATGCTTTATATTGAAGATACATCT GATACTGACTATCCAGTCATGGCAGCTGAGAGGAAATCTTTCCTCTTGA AACTGGGGAAGCTATTCATTTGAATG ATATCACGGATGATGAGGAAGATTCCAGATCACkJATACGTGATGATCTG GAAGACAATGAAGAATTCCCACCTCAGGGTTGAAAGTCTTATC CTCAGTAGCTGAAACAGCAATCAGTCATATAGACCACCAGATGCTGAAA TGGGAAGACGAAGACACAAGGACGAG GCTGGATCAAGGCCTTTCCCCTTTATGCCCAAAGGAGGACCAAGGAGGTG GGTCACAGATTTCTTCTCGAAATGCA GAGCTTCTAGCAGATTAACAGATGAG TGGGAGAGCATTACCCTCCTACACATGACGGAJAGATTTTTGATAATGC TgaCGACAAATGAGATACATGGAGJACCTTCTCGGAGAJAGACGAGAAGA AGCACTTCATTGAATGGAGGATGAGTATAcAGCAGATATGAGACAATG AAGTAGATGAACAGTCCAAACTATAA TCATAATTTTGAACCCATGACATCTA AAGATGCGGCCTATAACCTTGAGAGCCTGTCTGCCAGAGATGACA GAAACACAAAAAGATATTTCTTTACA AAAGAACTGCTAAGATACAGATCTAC AACTACCAAGAGGTCTAGGAGATGAGGTTGAAGGCATTCATGGAAAAA CACAGACCGAGACCCCAGTACTACAA ATCTAGACGGGAAGTGATCA-ATTGC AATGGATTTCTGCAGAAGCACGCCAGTACATGGTTTATACAGAGACAAG TCTCGAGAGACAAAAGAACTCAGAAC CCTATCAGTGATGAAAGATTTTCTAA AGAAAATTGCAGGTGTTATGCCTGTGAGAGAGGGACATTTCGCCTCT GAATGCAAGAATCCAGAAGATTGATAGAGTCAGGTTCTGACTC TCTAGACTTGGAGATGGATTAGACGTTATCTCAGTCGCTTGATGAAG ATAGACGCTTTCAAGTAGACGTATCG TTAAAGAAAGAGCTCAACAGGTTTTT ATCTGAAGCAGCTCCTAGCATAGGATTGACTGAAGTAGATGA CT7rTTAGGCACTGTTT'=GCAATA GAGTATTCAATCGTAAAGTATATGAG TATCCAACATGATCTAGCACTGAAGG AAACCCGGAGAAACTGGA~AACAGGT AAGAAGACACTTTAAAGCCGGAAACC ACGTaACAAGdTGAAAAATACTTAT TCCTTATCAAGCAGAAGATATCCTACCTATAGATT ATGGTAGAAATAAATTGGACAAAGAA GGAACATATTCTAGAGCCATAGTTAG CAAGGAACAACCATCTCAATATCAAATGTGAGATAGAA TAACAG AAGGTAGTCCTGAACGCTCTTGACACTGGAGCTACGTCIy3GTAGC AGTAAGTAACTAGATAAACGCAAAAA TCATTATTCGAGGAGTCTATAGTAACGCGGAATCA GCGGGAAAGCTATGGGTTGGTAGCTGGTTCTACTCCAACTT.r WO 99/43836 PCT/GB99/00599 67 TATTATGCCTTCATTAGCTGATGGAGTTCATATGATCATAGGCATGATT TTTAACGTGCAGAAGAAGTAGCCATA AAACTAACGAAGCCACAATCTACGAT TATAGATGATGATCAGAATTAAAGGA CTGAGAGTTCTAGAGGGGATTTCTGAGATTTATATCTCCTGACATT ATGAAAGAAATGAATTGAAGACCCAC TTGAAAACGTAAGAGATAG~kACCGT TGTATAGCGCATAACTTACCAATAAA ACAGCAGAGCAAGTTTGATAATACGC TTAGTAACTGAACGCAGTGAATTGAA AGGTTGACCCAATGACTGGAAGGAGGAGGAAGGAGAGATTGGTG TTTAACTATAAGAGGCTGATGATACACTGAAAGACCAGTACAGTTT GCTGATAACTATAAGATGATCAGTTT GCAAGTTTGATTTAAAGAGTGGGTTTCATCAAGTAGCATGGACCCAGAG TCTATTCCCTGGACGGCATTTTGGGCTATAGATGGGCTGTATGAGTGGCT AGTTCCTGATAAAGCCTCAATCAGAA TGGACAATTGCTTTAGAGGGACGAGGATTTTATTGCGGTATACATTGAT GAAATGATTTAAATAACAAAAACTTA GAAATTTATGACATCTGCGAGAATGGTTTAGTCTTAAJGTCCGACA AATAATGACAAAATGCTCAGGACATG AATAAATATGACTATTATAAGTACAA GA-GTAGATAGAGGAGATAGATGTGA TCCTTAATTATGCTAGGAGCTAATTCCGACTGGGAA3ATCCTTGGA TGTATGGAAGGCTGGGGAGTATGTAGTGAAACTGATAGTCTGCA GCCAAGATGGTCAGAGATCTGTGCTTATGCGAGGAATTCACTC CCTAAGAATGCCGGAAAGTTAAAATT GAAGTAGTTTACTATAAAACCTACGA TGCGCAC-TGGGTTTCAAAACGG~AA~ CACAATAAG~TCTCAAATCTACGAAG CTTGAGATTAAGTTTGATGCAAGCAACGTTTAGCGA CATTTAGCGTAGTATCCACGAAGACA CTAGTTTGTATCGGGGAGATCCAGAA ACGTCAAAAATATATTGAAAAAGAAT GTGCAAGTCGTGACAACAGGTAATAT AAACGTTCATTGTCATACACAATAGT TCAACTCGATCGCGGATTATCGGACA CATGI=CTGTTGAGAAATATGTGGAG AAGTAAGGGAAATGAGATTAAGCCCG GGAGATCGGGGAGAATTCTCAAAGAA CTATAGTCCAACGTGAACGATAGCGA CGAGTGGCGGACCCCTACGTTGATACACCGGTGTGAGACT CAAAGTATAAGTCTCTT ATTGTCGGTCGTTCTAGTC ACCCAGC GGCTGCGATTAGAATGT

GGCGGCTTAGTCTTCGATTGTGTCAC

WO 99/43836 PCT/GB99/00599 68 AACGATGCCAGAAAGCTCCACAACTCTCTATATAAGGAGCCTTGTATTCA GGTTGCAAACACGCACCACAACGCGAGTTTACTCCTGATTTGAGATAA AAACTTCTGTGCTTGAAACACACTTTGTGCGAGTTCACTTTGTGCGAGTA

GAGCGCAAGATCCTAGTTCCGCGAGCGTAGACCCGTC

WO 99/43836 PCT/GB99/00599 69 SEQ ID NO: 2 1 ACG CAAG.AA TATCTTATTG AAGATGCTCT AQATCTGCTG GATATcAGTA 51 ATGATQACTG AAGCGGAAGT GGCGGA.CCCC TACCACGTGT TGATACCAAC 101 CGGTGTG.AAG ACTGATAAGA TGCGGAGTGA GCTGGATAcc ACTCACTTTA 151 TGTAAAGAGG AGACAAN3TA TAATGTCTCT TTATTTTA~r, TTTGTCGGTG 201 TGCGTTGTCT AGTCACGCAC GATGACCTTT AGTAACTTTG CAGGATTCTT 251 ACGCAAAGTT GTTAGGCCAG AGACATG3TGA TGATOCTTAT CTGCATTATT 301. GGTG-GATGCC ACCTAACGAT GCCP,GAAAGC TCCACAACTC T C TA 04A ro 35 Si AGOOTTOTA TTCAGGTTGC AAACACGC!AC CACAACGCGA GTTTACTCCT 401 GATTTGAGZAA ATAAAAACTT CTGTGCTTQA AACACACTTT GTGCGAGTC 451 A

Claims

1. An isolated polynucleotide consisting of a Banana Streak Virus promoter sequence selected from: (a) the promoter sequence of a Nigerian isolate of Banana 5 Streak Virus shown in SEQ ID NO. 2; (b) a promoter sequence of an isolate of Banana Streak Virus, which promoter sequence is an allelic variant of the promoter sequence of SEQ ID NO. 2; (c) a fragment of (a) or (b) which, when operably linked to a LO transcribable sequence, promotes transcription of the transcribable sequence in a Musaceae plant cell.

2. An isolated polynucleotide according to claim 1 wherein said promoter sequence is shown in SEQ ID NO. 2. L5

3. An isolated polynucleotide consisting of a promoter sequence, which promoter sequence: (i) selectively hybridizes under stringent conditions with a polynucleotide complementary to a polynucleotide which has 0 the nucleotide sequence shown in SEQ ID NO: 2; and (ii) when operably linked to a transcribable sequence promotes transcription of the transcribable sequence in a Musaceae plant cell. 5

4. An isolated polynucleotide according to claim 2 which has a nucleotide sequence found in a strain of Banana Streak Virus.

5. An isolated polynucleotide consisting of a promoter WO99/43836 PCT/GB99/00599 71 sequence, which promoter sequence is at least 75% identical to the promoter sequence shown in SEQ ID NO: 2 and which when operably linked to a transcribable sequence promotes transcription of the transcribable sequence in a Musaceae plant 5 cell.

6. A nucleic acid construct comprising the promoter sequence of a polynucleotide according to any one of claims 1 to 5 and a non-Banana Streak Virus sequence. 10

7. A nucleic acid construct according to claim 6 wherein the promoter sequence is operably linked to a transcribable sequence. 15

8. A nucleic acid vector suitable for transformation of a plant cell and including the promoter sequence of a polynucleotide according to any one of claims 1 to 5.

9. A nucleic acid vector according to claim 8 wherein the 20 promoter sequence is operably linked to a transcribable sequence.

10. A plant cell containing a heterologous polynucleotide, nucleic acid construct or nucleic acid vector according to any 25 one of claims 1 to 9.

11. A plant cell according to claim 10 having a heterologous said polynucleotide or nucleic acid construct within its WO 99/43836 PCT/GB99/00599 72 chromosome.

12. A plant cell according to claim 10 or claim 11 which is comprised in a plant, a plant part or a plant propagule, or an 5 extract or derivative of a plant.

13. A method of producing a cell according to claim 10 or claim 11, the method including incorporating said polynucleotide, nucleic acid construct or nucleic acid vector 10 into the cell by means of transformation.

14. A method according to claim 13 which includes recombining said polynucleotide or said nucleic acid construct with the cell genome nucleic acid such that it is stably incorporated 15 therein.

15. A method according to claim 13 or claim 14 which includes regenerating a plant from one or more transformed cells. 20

16. A plant comprising a plant cell according to claim 10 or claim 11.

17. A part or propagule of a plant comprising a plant cell according to claim 10 or claim 11. 25

18. A method of producing a plant, the method including incorporating a polynucleotide, nucleic acid construct or nucleic acid vector according to any of claims 1 to 9 into a WO99/43836 PCT/GB99/00599 73 plant cell and regenerating a plant from said plant cell.

19. A method according to claim 18 including sexually or asexually propagating or growing off-spring or a descendant of 5 the plant regenerated from said plant cell.

20. Use of a nucleic acid vector according to claim 8 or claim 9 in the production of a transgenic plant.