CN103243178B - For detecting the primer of banana streak virus, test kit and detection method - Google Patents

Abstract

The invention discloses the primer for detecting banana streak virus, test kit and detection method, does is the sequence of described primer BSV? Primer-1:5 ˊ-atgagtaattctatcacaag-3 ˊ; BSV? Primer-2:5 ˊ-ttacttcaaatttctgagaa-3 ˊ.Do wherein said test kit and detection method comprise described primer BSV? Primer-1 and BSV? Primer-2.Utilize this primer and detection method to detect any of several broadleaf plants streak virus accuracy high, high specificity, susceptibility are high.

Description

For detecting the primer of banana streak virus, test kit and detection method

Technical field

The present invention relates to a kind of primer, test kit and detection method for detecting banana streak virus, belonging to biological technical field.

Background technology

Banana streak virus BSV belongs to Caulimoviridae Caulimoviridae or baculovirus belongs to Badnavirus, many bananas and plantain kind of the country such as Cameroon, Colombia, Malawi, Zanzibar, Morocco, Ghana, Benin, Nigeria, Uganda, Costa Rica, Australia, Jordan, Mauritius, Madeira archipelago, Canary island, Ecuador, South Africa, Madagascar, India, Brazil, Philippines and China Taiwan report successively and finds BSV, China's Mainland there is not yet the report finding this virus.

The host range of BSV is narrow.Existing known BSV can infect all members of Musaceae Musa musaspp., and it is also comparatively responsive to BSV that clothing any of several broadleaf plants belongs to ensete.In addition, sugarcane Saccharumofficinarum and a kind of edible Canna generalis Bailey platymiscium Cannasedulis is also the host of BSV.Classical symptom is that interrupted and/or continuous print chlorisis streak and shuttle streak appear in blade, and along with the development of symptom, can become downright bad black streak gradually, false stem, petiole and fruit ear also there will be striped symptom sometimes.Banana lines are sick closely similar with the symptom of Mosaic Banana, be easy to obscure, but BSV can develop into downright bad streak in the later stage, thus distinguished in field.According to observing for many years, BSV infects and also can cause other symptoms many, as: the inner necrosis of false stem becomes centre rot symptom, false basal part of stem enlargement, false stem separately and growth irregular arrangement, the symptoms such as leaf shrinkage is curling, suberification and blade narrow.Serious symptom also can cause plant dwarfing, does not even bloom, even if yield positive results, also fruit ear is little, fruit is not full.

The most important circulation way of BSV is by asexual propagation material, propagates as inhaled bud, tissue cultured seedling etc.In addition, propagate in semi-durable mode by mealybug Slanococcuscitri, Saccharicoccussacchari, seed also can pass is with this virus, but not by mechanical friction and soil-borne.Under natural condition, BSV is generally only confined within the scope of small area by the propagation of mealybug, and seldom diffusion spreads.Two novel species PseudococcuscomstockiKuwana of mealybug, DysmicoccusbrevipesCockerell can propagate BSV.The ovum of mealybug, nymph, adult all can pass poison, and the Virus spreading rate of nymph is higher than adult, and Virus spreading rate also there are differences because of the difference of any of several broadleaf plants veriety; BSV long-distance communications are often due to the transport of asexual propagation material, and this is the main path causing plant disease epidemic.Under natural condition, sugarcane bacilliform virus Sugarcanebacilliformvirus, SCBV also can be transmitted to banana by mealybug from sugarcane, and cause BSD symptom.

BSV is baculovirus plastochondria, and its size is 27nm ± 3nm × 119nm ± 8nm, A260/280 is 1.26.BSV has three kinds of existence forms: (1) has the free state of protein coat bag quilt.This form can detect all aobvious disease plant and a part of not showing in the plant of disease; (2) without the free state of protein coat bag quilt.The virus of this form only has the nucleic acid of supercoiled form, without protein coat; (3) state is integrated.Now evidence suggests, be integrated with BSV sequence in some any of several broadleaf plants genoid group, and some integration sequence is in certain ambient conditions, express by restructuring under the induction as group training, adverse circumstance etc., cause the appearance of the virion of free state.

BSV belongs to baculovirus and belongs to Badnavirus, and plastochondria size is about 30nm × 130nm, without coating, includes the double-stranded cyclic DNA of about 7.4kb size.BSV, the nucleotide sequence total length as Onne strain is 7389bp, and normal chain comprises 3 open reading frame ORF.Wherein ORF1 and ORF2 encodes two small proteins 20.8kD, 14.5kD, and function is not quite clear.These two ORF partly overlap, and overlapping sequence is ATGA, and wherein ATG is the initiator codon of ORF2, and TGA is the terminator codon of ORF1.ORF3 encodes a conjugated protein 208kD, this conjugated protein produces virus capsid protein by shearing action, and coatprotein is called for short: CP, asparticprotease are called for short AP, reversetranscriptase and are called for short RT, RNaseH abbreviation RH and movementprotein abbreviation MP etc.

Existing its specificity of the primer for detecting banana streak virus is strong relatively not, and susceptibility is relatively poor, and this often causes detected result accuracy not high.

Summary of the invention

The object of the invention is to overcome weak point of the prior art, a kind of primer for detecting banana streak virus is provided and comprises test kit and the detection method of this primer, utilize this primer and detection method to detect any of several broadleaf plants streak virus accuracy high, high specificity, susceptibility are high.

In order to achieve the above object, the present invention adopts following scheme:

For detecting a primer for banana streak virus, it is characterized in that:

Primer sequence:

BSVPrimer-1:5'-atgagtaattctatcacaag-3'；

BSVPrimer-2:5'-ttacttcaaatttctgagaa-3'。

Detect a test kit for banana streak virus, it is characterized in that this test kit includes:

Wherein said BSVPrimer-1 sequence is 5'-atgagtaattctatcacaag-3'; Described BSVPrimer-2 sequence is 5'-ttacttcaaatttctgagaa-3'.

A kind of test kit detecting banana streak virus as above, is characterized in that described DNAPolymeraseMixture comprises Taq polysaccharase, the MgCl of pcr amplification ₂25mM, dNTPs10mM; Described PositiveControl is the nucleic acid of banana streak virus.

Detect a detection method for banana streak virus, it is characterized in that comprising the following steps:

A, testing sample DNA extraction, obtain template DNA solution;

B, employing primer BSVPrimer-1 and BSVPrimer-2 carry out pcr amplification to the template DNA solution in steps A, obtain PCR reaction solution; Wherein said BSVPrimer-1 sequence is 5'-atgagtaattctatcacaag-3'; Described BSVPrimer-2 sequence is 5'-ttacttcaaatttctgagaa-3'.

C, get PCR reaction solution and carry out agarose gel electrophoresis analysis;

If there is the DNA band of 405bp in D, then prove detect in articles for use with banana streak virus.

In the present invention, the sequence of 405bp is:

atgagtaattctatcacaagctctgcagtataccaacaagcaattgctggaacaactggtgactgggaatcccctggagtagggatatctgaccgtggatcggtgaacaacacccagctcacaagacaactcaacaccattatattcctgtgtacaaagacacaacaggaagtcttagccttaaaagacacagtagcggacatccaaaaccgcttgagaatacttgaaaggaccggtgcaacatcagccggtaccccacaacttaagggtgaaattgacgccatcaatgagaagttatcaagaattcaacaaattcaagggagtcaaccaaggaaagacggtggtactgcggccactagcaaagtatttcaagacccctacaaacttctcagaaatttgaagtaa。

A kind of detection method detecting banana streak virus as above, is characterized in that the DNA extraction of testing sample described in steps A, specifically comprises the steps:

A1, get detected sample blade 0.1-0.2g, be positioned in the centrifuge tube of 1.5mL, liquid nitrogen freezing;

A2, by vibrator thermal agitation, with glass stick, blade to be ground;

A3, add the homogenate of 0.6mLDNA Extraction buffer, vibration mixing;

A4,65 DEG C of incubation 30min; Add 0.5mL chloroform again, mixing 5min;

The centrifugal 5min of a5,12000rpm, upper water moves in a new centrifuge tube mutually;

A6, add the Virahol of 0.6 times of volume, mix gently, room temperature places 30min;

The centrifugal 10min of a7,12000rpm, supernatant discarded;

A8,70% washing with alcohol precipitation, the centrifugal 2min of 12000rpm; Wash once with 100% second is pure again;

A9, supernatant discarded, vacuum-drying 5min;

A10, precipitation are dissolved in 30 μ LTE(pH8.0) among ,-20 DEG C save backup.

A kind of detection method detecting banana streak virus as above, is characterized in that described in step B, pcr amplification specifically comprises the following steps:

In 0.2mL centrifuge tube, add 10 × pcr amplification damping fluid 2.5 μ L, concentration is the MgCl of 25mmol/L ₂2 μ L, concentration is the dNTPs1 μ L of 10mmol/L, the Primer-150pmol of 1 μM, the Primer-250pmol of 1 μM, and sample DNA solution 1 μ L, adds water to 25 μ L, then adds Taq polysaccharase 0.5 μ L; 94 DEG C of sex change 3min; Then 94 DEG C of 40s, 44 DEG C of 40s, 72 DEG C of 1min, circulate 35 times; Last 72 DEG C extend 10min; Preserve reaction product for 4 DEG C.

A kind of detection method detecting banana streak virus as above, is characterized in that the analysis of agarose gel electrophoresis described in step C specifically comprises the following steps:

C1, with 1 × TAE damping fluid and agarose by 1.5% concentration prepare, in microwave oven, fusing evenly, is cooled to 50-60 DEG C;

C2, to add nucleic acid dye or concentration are the ethidium bromide of 1 μ g/mL, mix, and pour on gel platform, plug sample comb;

C3, after gel sets, extract comb, add appropriate TAE buffering;

C4, get 1 μ L sample loading buffer and mix with 5 μ LPCR reaction solutions, then respectively itself and suitable DNA molecular amount standard substance are added in sample well;

C5, switch on power and carry out electrophoresis, voltage 5V/cm;

C6, when the tetrabromophenol sulfonphthalein in sample loading buffer migrates to enough isolation of DNA fragments, stop electrophoresis; Whole glue is placed in gel imaging system observe, and record of taking pictures.

A kind of detection method detecting banana streak virus as above, it is characterized in that carrying out Serologic detection to testing sample before testing sample DNA extraction, concrete steps are as follows:

E1, take 50mg to show the plant tissue of suspect, use 50mg health tissues and tissue extraction damping fluid as negative control simultaneously, add 250 μ L Sample extraction damping fluids grindings and make analyte sample fluid;

E2, to be buffered the anti-BSV antibody of liquid dilution multi-clone rabbit with bag, in the well of elisa plate, then to add this dilution antibody of 90 μ L, 37 DEG C of insulation 4h;

E3, then use lavation buffer solution detersive enzyme yoke plate 3 times, every hole adds lavation buffer solution 300 μ L, each 5min;

E4, get analyte sample fluid 90 μ L and add in the well of elisa plate, and using health tissues and plant tissue extraction buffer as negative control, 4 DEG C of incubated overnight;

E5, use lavation buffer solution detersive enzyme yoke plate 3 times, every hole adds lavation buffer solution 300 μ L, each 5min;

E6, often hole add the second antibody of 90 μ L appropriate dilutions, i.e. mono-clonal BSV antibody, hatches 2h for 37 DEG C;

E7, use lavation buffer solution detersive enzyme yoke plate 3 times, every hole adds lavation buffer solution 300 μ L, each 5min;

E8, often hole add the sheep anti-mouse antibody of the alkali phosphatase enzyme mark of 90 μ L appropriate dilutions, hatch 2h for 37 DEG C;

E9, use lavation buffer solution detersive enzyme yoke plate 3 times, every hole adds lavation buffer solution 300 μ L, each 5min;

E10, every hole add the new substrate solution 90 μ L prepared, and then measure their OD respectively at different time ₄₀₅nm absorption value.

The reagent adopted in the present invention:

1, ELISA detection reagent

1.1 bags are buffered liquid 1000mL (pH9.6)

Na ₂CO ₃1.59g

NaHCO ₃2.93g

NaN ₃0.2g

Be dissolved in 1000ml distilled water, the pH of solution is 9.6.

1.2PBS damping fluid 1000mL (pH7.2-7.4)

Dissolve with sterilized water and be settled to 1000mL.

1.3 Sample extraction damping fluid 1000mL

Diethyl carbonyl diamine (DIECA) 2.0g

PVP-1020.0g

Dissolve with PBS damping fluid (pH7.2-7.4) and be settled to 1000mL.

1.4 lavation buffer solution 1000mL

1.5 antibody dilution buffer

1 × PBS damping fluid

0.5% bovine serum albumin (BSA)

1.6 substrate buffer solutions (pH9.8) 1000mL

Diethanolamine 97mL

Adding distil water 800mL

NaN ₃0.2g

Adjust pH to 9.8 with HCl, be then settled to 1000mL.

1.7 substrate solution

In substrate buffer solution, add the substrate 4-NPP (p-NitrophenylPhosphate, pNPP) of alkaline phosphatase, concentration is 1mg/mL.

2, PCR detection reagent

2.1DNA extraction buffer:

2.2TE damping fluid

10mmol/LTris-HCl,pH8.0

1mmol/LEDTA,pH8.0

2.3TAE damping fluid

40mmol/LTris-HAc,

1mmol/LEDTA,pH8.0

2.46 × sample loading buffer

Tetrabromophenol sulfonphthalein 0.25%

2.5 primer synthesis

Conserved sequence design Auele Specific Primer according to BSV:

BSVPrimer-1:5'-atgagtaattctatcacaag-3'Tm=51.6

BSVPrimer-2:5'-ttacttcaaatttctgagaa-3'Tm=49.5

The detecting instrument adopted in the present invention and apparatus:

1, enzyme mark detector

2, PCR amplification instrument

3, electrophoresis apparatus

4, table-type high-speed refrigerated centrifuge

5, gel imaging system

6, electronic analytical balance

7, pipettor (0.1-2 μ L, 2-10 μ L, 10-100 μ L, 100-1000 μ L)

8, mortar

9,0.2mL, 0.5mL, 1.5mL centrifuge tube

10, elisa plate

In sum, beneficial effect of the present invention:

This test kit is for detecting banana streak virus (BSV).Positive control is the carrier containing the BSV gene of cloning out from morbidity Leaf of banana; Use this test kit, as long as add the nucleic acid of measuring samples and the pair of primers of the BSV in this test kit, just PCR reaction can be carried out, significantly simplify operating process, decrease the pollution in PCR operating process, make detection efficiency increase substantially, detection sensitivity is also very high, can reach 0.1pg simultaneously; The PCR primer 3 ' using these goods to increase in addition to obtain is held also with " A " base, can Direct Cloning in T-Vector.

Accompanying drawing explanation

Fig. 1 is that PCR method of the present invention detects banana streak virus gel electrophoresis figure.

Wherein:

1、M：100bpDNAmarker；

2, CK-, blank;

3, CK+, positive control;

4,1 ~ 17, detected sample.

Embodiment

Below in conjunction with embodiment, the present invention is described further:

Embodiment 1

Test kit of the present invention:

Packing Unit: 25 μ l × 24.PCR reaction system 24 secondary amounts of 50 μ l, each use 25 μ l.

This test kit comprises the DNAPolymeraseMixture mixture of the PCR reaction detecting banana streak virus BSV, the MicroPCRtube(25 μ l/ being filled to 0.2ml has been divided to prop up) in, during use, as long as add the nucleic acid of measuring samples and the BSVPrimer in this test kit, just PCR reaction can be carried out, significantly simplify operating process, decrease the pollution in PCR operating process.The PCR primer 3 ' using these goods to increase to obtain is held with " A " base, can Direct Cloning in T-Vector.

Test kit forms

Preserve

-20℃。Multigelation activity may reduce.

Working method

1. by following component preparation PCR reaction solution.

2.PCR reaction conditions.

First 94 DEG C of 3min sex change; Then 94 DEG C of 30sec, 44 DEG C of 1min, 72 DEG C of 1min, 35 circulations; Last 72 DEG C of 10min.

3. result judges

After reaction terminates, get the agarose gel electrophoresis that PCR reaction solution 5 μ l carries out 1% concentration, positive findings should be the DNA fragmentation of 405bp length.

Embodiment 2

The present invention detects the detection method of banana streak virus, comprises the following steps:

A, testing sample DNA extraction, obtain template DNA solution;

A1, get detected sample blade 0.1-0.2g, be positioned in the centrifuge tube of 1.5mL, liquid nitrogen freezing;

A2, by vibrator thermal agitation, with glass stick, blade to be ground;

A3, add the homogenate of 0.6mLDNA Extraction buffer, vibration mixing;

A4,65 DEG C of incubation 30min; Add 0.5mL chloroform again, mixing 5min;

The centrifugal 5min of a5,12000rpm, upper water moves in a new centrifuge tube mutually;

A6, add the Virahol of 0.6 times of volume, mix gently, room temperature places 30min;

The centrifugal 10min of a7,12000rpm, supernatant discarded;

A8,70% washing with alcohol precipitation, the centrifugal 2min of 12000rpm; Wash once with 100% second is pure again;

A9, supernatant discarded, vacuum-drying 5min;

A10, precipitation are dissolved in 30 μ LTE(pH8.0) among ,-20 DEG C save backup.

B, employing primer BSVPrimer-1 and BSVPrimer-2 carry out pcr amplification to the template DNA solution in steps A, obtain PCR reaction solution; Wherein said BSVPrimer-1 sequence is 5'-atgagtaattctatcacaag-3'; Described BSVPrimer-2 sequence is 5'-ttacttcaaatttctgagaa-3;

In 0.2mL centrifuge tube, add 10 × pcr amplification damping fluid 2.5 μ L, concentration is the MgCl of 25mmol/L ₂2 μ L, concentration is the dNTPs1 μ L of 10mmol/L, the Primer-150pmol of 1 μM, the Primer-250pmol of 1 μM, and sample DNA solution 1 μ L, adds water to 25 μ L, then adds Taq polysaccharase 0.5 μ L; 94 DEG C of sex change 3min; Then 94 DEG C of 40s, 44 DEG C of 40s, 72 DEG C of 1min, circulate 35 times; Last 72 DEG C extend 10min; Preserve reaction product for 4 DEG C.

C, get PCR reaction solution and carry out agarose gel electrophoresis analysis;

C1, with 1 × TAE damping fluid and agarose by 1.5% concentration prepare, in microwave oven, fusing evenly, is cooled to 50-60 DEG C;

C2, to add nucleic acid dye or concentration are the ethidium bromide of 1 μ g/mL, mix, and pour on gel platform, plug sample comb;

C3, after gel sets, extract comb, add appropriate TAE buffering;

C4, get 1 μ L sample loading buffer and mix with 5 μ LPCR reaction solutions, then respectively itself and suitable DNA molecular amount standard substance are added in sample well;

C5, switch on power and carry out electrophoresis, voltage 5V/cm;

C6, when the tetrabromophenol sulfonphthalein in sample loading buffer migrates to enough isolation of DNA fragments, stop electrophoresis; Whole glue is placed in gel imaging system observe, and record of taking pictures.

If there is the DNA band of 405bp in D, then prove detect in articles for use with banana streak virus.

Embodiment 3

The present invention detects the detection method of banana streak virus, comprises the following steps:

First Serologic detection is carried out to testing sample:

E1, take 50mg to show the plant tissue of suspect, use 50mg health tissues and tissue extraction damping fluid as negative control simultaneously, add 250 μ L Sample extraction damping fluids grindings and make analyte sample fluid;

E2, to be buffered the anti-BSV antibody of liquid dilution multi-clone rabbit with bag, in the well of elisa plate, then to add this dilution antibody of 90 μ L, 37 DEG C of insulation 4h;

E3, then use lavation buffer solution detersive enzyme yoke plate 3 times, every hole adds lavation buffer solution 300 μ L, each 5min;

E4, get analyte sample fluid 90 μ L and add in the well of elisa plate, and using health tissues and plant tissue extraction buffer as negative control, 4 DEG C of incubated overnight;

E5, use lavation buffer solution detersive enzyme yoke plate 3 times, every hole adds lavation buffer solution 300 μ L, each 5min;

E6, often hole add the second antibody of 90 μ L appropriate dilutions, i.e. mono-clonal BSV antibody, hatches 2h for 37 DEG C;

E7, use lavation buffer solution detersive enzyme yoke plate 3 times, every hole adds lavation buffer solution 300 μ L, each 5min;

E8, often hole add the sheep anti-mouse antibody of the alkali phosphatase enzyme mark of 90 μ L appropriate dilutions, hatch 2h for 37 DEG C;

E9, use lavation buffer solution detersive enzyme yoke plate 3 times, every hole adds lavation buffer solution 300 μ L, each 5min;

E10, every hole add the new substrate solution 90 μ L prepared, and then measure their OD respectively at different time ₄₀₅nm absorption value.

A, testing sample DNA extraction, obtain template DNA solution;

A1, get detected sample blade 0.1-0.2g, be positioned in the centrifuge tube of 1.5mL, liquid nitrogen freezing;

A2, by vibrator thermal agitation, with glass stick, blade to be ground;

A3, add the homogenate of 0.6mLDNA Extraction buffer, vibration mixing;

A4,65 DEG C of incubation 30min; Add 0.5mL chloroform again, mixing 5min;

The centrifugal 5min of a5,12000rpm, upper water moves in a new centrifuge tube mutually;

A6, add the Virahol of 0.6 times of volume, mix gently, room temperature places 30min;

The centrifugal 10min of a7,12000rpm, supernatant discarded;

A8,70% washing with alcohol precipitation, the centrifugal 2min of 12000rpm; Wash once with 100% second is pure again;

A9, supernatant discarded, vacuum-drying 5min;

A10, precipitation are dissolved in 30 μ LTE(pH8.0) among ,-20 DEG C save backup.

B, employing primer BSVPrimer-1 and BSVPrimer-2 carry out pcr amplification to the template DNA solution in steps A, obtain PCR reaction solution; Wherein said BSVPrimer-1 sequence is 5'-atgagtaattctatcacaag-3'; Described BSVPrimer-2 sequence is 5'-ttacttcaaatttctgagaa-3;

In 0.2mL centrifuge tube, add 10 × pcr amplification damping fluid 2.5 μ L, concentration is the MgCl of 25mmol/L ₂2 μ L, concentration is the dNTPs1 μ L of 10mmol/L, the Primer-150pmol of 1 μM, the Primer-250pmol of 1 μM, and sample DNA solution 1 μ L, adds water to 25 μ L, then adds Taq polysaccharase 0.5 μ L; 94 DEG C of sex change 3min; Then 94 DEG C of 40s, 44 DEG C of 40s, 72 DEG C of 1min, circulate 35 times; Last 72 DEG C extend 10min; Preserve reaction product for 4 DEG C.

C, get PCR reaction solution and carry out agarose gel electrophoresis analysis;

C1, with 1 × TAE damping fluid and agarose by 1.5% concentration prepare, in microwave oven, fusing evenly, is cooled to 50-60 DEG C;

C2, to add i nucleic acid dye or concentration are the ethidium bromide of 1 μ g/mL, mix, and pour on gel platform, plug sample comb;

C3, after gel sets, extract comb, add appropriate TAE buffering;

C4, get 1 μ L sample loading buffer and mix with 5 μ LPCR reaction solutions, then respectively itself and suitable DNA molecular amount standard substance are added in sample well;

C5, switch on power and carry out electrophoresis, voltage 5V/cm;

C6, when the tetrabromophenol sulfonphthalein in sample loading buffer migrates to enough isolation of DNA fragments, stop electrophoresis; Whole glue is placed in gel imaging system observe, and record of taking pictures.

If there is the DNA band of 405bp in D, then prove detect in articles for use with banana streak virus.

Claims (1)

1. detect a detection method for banana streak virus, comprise the following steps:

A, testing sample DNA extraction, obtain template DNA solution;

A1, get detected sample blade 0.1-0.2g, be positioned in the centrifuge tube of 1.5mL, liquid nitrogen freezing;

A2, by vibrator thermal agitation, with glass stick, blade to be ground;

A3, add the homogenate of 0.6mLDNA Extraction buffer, vibration mixing;

A4,65 DEG C of incubation 30min; Add 0.5mL chloroform again, mixing 5min;

The centrifugal 5min of a5,12000rpm, upper water moves in a new centrifuge tube mutually;

A6, add the Virahol of 0.6 times of volume, mix gently, room temperature places 30min;

The centrifugal 10min of a7,12000rpm, supernatant discarded;

A8,70% washing with alcohol precipitation, the centrifugal 2min of 12000rpm; Wash once with 100% ethanol again;

A9, supernatant discarded, vacuum-drying 5min;

A10, precipitation are dissolved in 30 μ LTE, and among pH8.0 ,-20 DEG C save backup;

B, employing primer BSVPrimer-1 and BSVPrimer-2 carry out pcr amplification to the template DNA solution in steps A, obtain PCR reaction solution; Wherein said BSVPrimer-1 sequence is 5'-atgagtaattctatcacaag-3'; Described BSVPrimer-2 sequence is 5'-ttacttcaaatttctgagaa-3;

In 0.2mL centrifuge tube, add 10 × pcr amplification damping fluid 2.5 μ L, concentration is the MgCl of 25mmol/L ₂2 μ L, concentration is the dNTPs1 μ L of 10mmol/L, the Primer-150pmol of 1 μM, the Primer-250pmol of 1 μM, and sample DNA solution 1 μ L, adds water to 25 μ L, then adds Taq polysaccharase 0.5 μ L; 94 DEG C of sex change 3min; Then 94 DEG C of 40s, 44 DEG C of 40s, 72 DEG C of 1min, circulate 35 times; Last 72 DEG C extend 10min; Preserve reaction product for 4 DEG C;

C, get PCR reaction solution and carry out agarose gel electrophoresis analysis;

C1, with 1 × TAE damping fluid and agarose by 1.5% concentration prepare, in microwave oven, fusing evenly, is cooled to 50-60 DEG C;

C2, to add i nucleic acid dye or concentration are the ethidium bromide of 1 μ g/mL, mix, and pour on gel platform, plug sample comb;

C3, after gel sets, extract comb, add appropriate TAE buffering;

C4, get 1 μ L sample loading buffer and mix with 5 μ LPCR reaction solutions, then respectively itself and suitable DNA molecular amount standard substance are added in sample well;

C5, switch on power and carry out electrophoresis, voltage 5V/cm;

C6, when the tetrabromophenol sulfonphthalein in sample loading buffer migrates to enough isolation of DNA fragments, stop electrophoresis; Whole glue is placed in gel imaging system observe, and record of taking pictures;

If there is the DNA band of 405bp in D, then prove detect in articles for use with banana streak virus.