AU2021102683A4 - Gossypium hirsutum GhCM2 protein and its encoding gene and application - Google Patents

Abstract

The present invention discloses a Gossypium hirsutum GhCM2 protein and its encoding gene and application, which belongs to the technical field of molecular biology. Specifically disclosed is a protein comprising: 1) a protein comprising an amino acid sequence as shown in SEQ ID NO: 2; 2) a protein derived from SEQ ID NO: 2 by substituting and/or deleting and/or adding one or more amino acid residues to an amino acid sequence as shown in SEQ ID NO: 2 and associated with resistance to Verticillium dahliae. The present invention clones the cotton GhCM2 gene, a typical DCD super-protein family gene that mediates programmed cell death, and confirms by gene silencing and over-expression analysis that its synergistic presentation in the leaves and roots of highly Verticillium dahliae -resistant varieties can improve resistance to Verticillium dahliae, which is important for genetic improvement of Verticillium dahliae resistance in high-yielding susceptible cotton or other crop varieties.

Description

Gossypium hirsutum GhCM2 protein and its encoding gene and application

TECHNICAL FIELD The present invention relates to the technical field of molecular biology, to the Gossypium hirsutum GhCM2 protein and its encoding gene and application, and in particular to a GhCM2 protein associated with resistance to Verticillium dahliae of Gossypium hirsutum and its encoding gene and application. BACKGROUND

Cotton is an important crop of economic importance, has an important position in China economy. It is not only an important raw material for the textile, chemical, pharmaceutical and national defence industries, but also an important revenue-earning commodity from export. Among them, the Gossypium hirsutum is the main planting species, accounting for more than 99% of China's cotton area. Verticillium dahliae is one of the most important disease in cotton production. In 1930s, it came to China. During the early 1950s, a few areas of China's cotton-producing provinces were damaged. With the transfer of pathogen cotton seeds, the spread is very rapid; the early 1990s in China's main cotton-producing areas aggravated year by year. The main pathogen that causes Verticillium wilt is Verticillium dahliae. As Verticillium dahliae is a major soil-bome disease pathogen, its pathogenic bacteria host a wide range, easy to mutate, no specialized parasitic relationship, in adverse environmental conditions, can form a dormant body with long-term survival of microsclerotia and other characteristics. The control and prevention measures are extremely difficult, and are one of the main obstacles to sustainable development of cotton in China. Long-term studies at China and abroad have shown that integrated control is the most cost-effective measure to prevent and control Verticillium wilt, and breeding of resistant varieties is the most important, economic and ecological integrated control of the main elements. However, because its resistance is a quantitative trait controlled by multiple genes, coupled with the complexity of its epidemic damage, the difficulty of breeding resistant varieties has been the lack of resistant varieties (strains) in China, especially the 99.9% of China's planted area of Gossypium hirsutum is a strange lack of disease-resistant varieties, which is also an important reason for the epidemic damage of the disease from time to time.

Pathogen associated molecular pattern Triggered Immunity (PTI) plays an important role in plant resistance to pathogen infestation, as plant Pattern Recognition Receptors (PRRs) recognize Pathogen Associated Molecular Patterns (PAMPs) on the surface of pathogens and promote PTI. The PRRs of the leucine-rich repeated sequence receptor kinase (LRR-RKS) class rely on the regulation of LRR-RK BAKI to transmit signals. BAKI (BRIl- associated receptor kinase1) also interacts with LRR-RK BRIl, and BAKI and BRIl (Brassinosteroidinsen- sitive 1) are the main receptors for the steroid hormone oleuropein (Brassinosteroid BR); it can promote BR signaling, and in the immune mechanism of plants, the signal of exogenous pathogen invasion can be received by BAKI, and after signaling progression, BR signaling activates the phosphatase PP2A, which dephosphorylates BZR1 and BES1 and binds to the promoters of a large number of genes, thus regulating the expression of these genes; BR is also a positive regulator mediating plant growth. BRs are hormones essential for a wide range of developmental and physiological processes in plant life history and also play an important role in plant growth and development as well as in response to adversity. In most of the past reports, genes related to biosynthesis or signals of BRs have been studied, which are associated with a range of phenotypes such as plant dwarfing, delayed flowering, and senescence. It has been shown that BES1/BZR1 is the only transcription factor of the BR signals' pathway. BR also plays an important role in pathogen infestation of plants. Albrecht et al. found that BR signals may play an important immunoregulatory role in plant growth by regulating immune signaling downstream of the leucine-rich repeated sequence receptor-like kinase (LRR RLK) BAKI, which is a potential regulatory site during pathogen infestation. Physiological studies have also shown that BRs promote cell elongation, enhance tolerance to environmental stress and resistance to pathogen infestation, and thus increase crop yield. A study by Lozano-Duran R et al. on Arabidopsis found that BZR1 induces the presentation of several WRKY transcription factors (WRKY15, WRKY18, WRKYll) and HBI, which have a negative control over early immune responses; in addition, BZR1 binds to WRKY40 and mediates antagonistic effects between BR and immune signaling, and ultimately BZR-mediated transcriptional alterations will lead to inhibition of PTI signaling. It is evident that BZR1 is an important regulator of BR signaling and can induce the expression of negative regulators of PTI to suppress the immune defence of plants, thus facilitating the invasion of pathogens. Therefore, a regulator related to the resistance to Verticillium dahliae of Gossypium hirsutum is urgently needed for addressing the losses caused by Gossypium hirsutum epidemics for land cotton from time to time. SUMMARY

The purpose of the present invention is to provide Gossypium hirsutum GhCM2 protein and its encoding gene and application to solve the problems of the prior art described above. Using gene silencing (VIGS) and over-expression in Arabidopsis thaliana, it was confirmed that synergistic presentation of this gene in leaves and roots of highly Verticillium dahliae-resistant varieties can improve resistance to Verticillium dahliae, which is important for genetic improvement of Verticillium dahliae-resistance in high-yielding susceptible cotton or other crop. To achieve the above-mentioned goal, the present invention provides the following embodiments. The present invention provides a protein comprising a protein shown as any one of the following. 1) A protein comprising an amino acid sequence as shown in SEQ ID NO: 2. 2) A protein derived from SEQ ID NO: 2 by substituting and/or deleting and/or adding one or more amino acid residues to an amino acid sequence as shown in SEQ ID NO: 2 and associated with resistance to Verticillium dahliae The invention also provides genes encoding the proteins. Preferably, the gene comprises a DNA molecule as shown in any of the following. 1) A DNA molecule as shown in SEQ ID NO: 1. 2) A DNA molecule as shown by the sequence shown in SEQ ID NO: 1 from the 5' terminal nucleotide sequence at position 138. 3) A DNA molecule having at least 70% homology with the DNA sequence defined by 1) or 2) and encoding a protein associated with Verticillium dahliae The invention also provides primer pairs amplifying the full length or any fragment of the gene described, including the nucleotide sequences as shown in SEQ ID NO: 3 and SEQID NO: 4.

The invention also provides applications of said protein or said gene, comprising 1) or 2). 1) promoting the presentation of the plant leaf and root system. 2) improving plant resistance to Verticillium dahliae. Wherein the plant is a dicotyledonous plant or a monocotyledonous plant. Preferably, the dicotyledonous plant is Gossypium hirsutum or Arabidopsis thaliana. The present invention further provides a method for breeding transgenic plants comprising the step of obtaining a transgenic plant by introducing a gene encoding the protein into a target plant, said transgenic plant having a phenotype in 1) or 2) as follows. 1) Synergistic presentation in the leaves and roots of the transgenic plant. 2) The transgenic plant has reduced incidence and disease index of Verticillium dahliae. Wherein the plant is a dicotyledonous plant or a monocotyledonous plant. Preferably, the dicotyledonous plant is Gossypium hirsutum or Arabidopsis thaliana. The present invention discloses the following technical effects. The present invention provides a GhCM2 protein, a gene associated with Verticillium dahliae resistance in Gossypium hirsutum, obtained by cloning from cotton leaves, the GhCM2 gene associated with Verticillium dahliae resistance in Gossypium hirsutum, its synergistic presentation in leaves and roots of Verticillium dahliae resistant cotton varieties confirmed by RT-PCR, and its ability to improve Verticillium dahliae resistance based on the evaluation of Verticillium dahliae resistance in transgenic Arabidopsis thaliana. Therefore, if the gene provided by the present invention is transferred into Gossypium hirsutum or other crops, it can improve the genetic improvement of Verticillium dahliae resistance in high quality and high yielding susceptible cotton or other crop varieties, which is important for obtaining new Gossypium hirsutum or other crop varieties with excellent fiber quality and high yielding and high resistance to Verticillium dahliae. BRIEF DESCRIPTION OF THE FIGURES

In order to more clearly illustrate the technical solutions in the embodiments or prior art of the present invention, the following is a brief description of the accompanying drawings that need to be used in the embodiments, and it is obvious that the accompanying drawings in the following description are only some embodiments of the present invention, and other accompanying drawings can be obtained based on them without any creative labour for those of ordinary skill in the art. Figure. 1 shows the silencing of the GhCM2 gene of the disease-resistant variety of cotton KV3 by VIGS technology in Example 2, and the disease of each silenced plant after 3 weeks of inoculation with Verticillium dahliaeV991; wherein, (i) uninoculated wild-type cotton KV-3; (ii) inoculated wild-type cotton KV-3; (iii) transformed empty vector (CLCrV-00) cotton KV-3 inoculated with V991; (19) silenced GhCM2 gene of disease resistant variety of cotton KV3 inoculated with V991. Figure 2 shows the full-length sequence of GhCM2 (including promoter and terminator and the sequence shown in SEQ ID NO: 1). DESCRIPTION OF THE INVENTION

The technical solution of the present invention is now specified by way of embodiment, but it should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present invention. The test methods used in the following embodiments are conventional, if not specifically described, and the materials and reagents used are those commercially available if not specifically described.

Example 1: Cloning of land cotton GhCM2 gene 1. Extraction of RNA RNA of cotton plant KV3 leaf samples was extracted from cotton varieties using RNA prep Pure plant polyphenol polysaccharide total RNA extraction kit respectively. 2. cDNA synthesis 2.1 Synthesis of intermediate fragment cDNA Intermediate fragment cDNA was synthesized by reverse transcription of cDNA using Fast Quant cDNA First Strand Synthesis Kit. 2.2 Synthesis of 3'cDNA The synthesis system for 3' cDNA is shown in Table 1. Table 1

Reagents Amount

RNase Inhibitor (200U/[l) 0.25[tL

3'RACE Adaptor (5mM) lpL

dNTP mixture(10mM each) 1 L

5x Prime Script Buffer 2[tL

cDNA 3.5 L

ddH20 2L

Total RNA 0.25 L

Prime Script RTase (200U/ml) 10ptL

Total 10 L

Mix the system as above, centrifuge and place on PCR instrument at 42°C for 60min, °C for 15min, cooling the amplified mixture on ice after reaction, and storing at -20°C. 3.3. Synthesis of 5' cDNA The synthesis system of cDNA for 5' RACE is as follows(Table 2). The first step:

Table 2 Reagents Amount DTT(100 mM) 0.5 L 5x First-Strand Buffer 4.0 L dNTP(20 mM) 1.0 L Total 5.5 L Mix, and centrifuge briefly and place on ice. The second step: adding the reagents shown in Table 3. Table 3 Reagents Amount Total RNA 2 L

5'-CDS Primer A 1 L

Sterile H20 8 L

Total 11 L

After thorough mixing, the 11 1 of product was placed in the PCR instrument and the program of the reaction was set: 72°C for 3 min -- 42°C for 2 min. After that, the reaction was cooled for 1 min and prepared for later use. Step 3: adding the reagents shown in Table 4. Table 4 Reagents Amount

Mix from Step 1 5.5 L

RNase Inhibitor (40U) 0.5 L

SMARTScribe Reverse Transcriptase 8 L

Total 14 L

Mix and centrifuge briefly. Step 4: adding the reagents shown in Table 5. Table 5 Reagents Amount

Mix from Step 2 11 L

SMARTer | A Oligonucleotide 1 L

Mix from Step 3 8 L

Total 20tL

Mix gently by pipetting with a pipette gun and centrifuge briefly. Place in PCR instrument and set the program: 42°C for 90 min and 70°C for 10 min. Dilute the cDNA with appropriate amount of Tricine-EDTA Buffer and store at -20°C. 3. 3. Primer design The RACE primers (Table6) were all designed by primer 5.0, GSP and UPM primer kits are contained, and the designed primers were sent to biotech for synthesis.

Table 6 RACE Primer Name Primer (5'--3') Application

GhCM2-F ATGGCGAAAGCAGAACAC Middle segment sequence GhCM2-R TCAATTGAGGCGACGGAG Middle segment sequence 3'OGhCM2 TTCCCTTTGAACCCTCCCACCTA 3'RACE Outor 3'IGhCM2 AAACAGAGGCCGTACAAGCTAAG 3'RACE Inner 'OGhCM2 GATTACGCCAAGCTTGCCAAATGTCATCGCCTTCTTCG 5'RACE Outer 'IGhCM2 GATTACGCCAAGCTTTCTTCTTTACCGCTTCTTCAACG 5'RACE Inner qGhCM2-F AAATTTGAGAGAGAGAGAGATCATTTG Full-length gene qGhCM2-R AAAGCATAATCAAAAGAGTACTACTT Full-length gene 4. Full-length cloning of GhCM2 4.1. Target gene intermediate fragment cloning Based on the known cDNA fragment, the intermediate fragment primers were designed and mixed according to the following system (Table 7) for PCR amplification. Table 7

Reagents Amount lOxLAPCRbuffer 2.5 L dNTP 2.5 L GhCM2-F (10 M) 1 L GhCM2-R (10 M) 1 L cDNA 1 tL LA Taq Enzymes 0.25 L ddH20 16.75 L Total 25[tL PCR program: 94°C for 3min; 94°C for 30s, 58°C for 30s, 72°C for 1min, 35 cycles; 72°C for 10min; stored at 4°C. The amplification products were analyzed by agar gel electrophoresis.

4.2. Target gene 3' end cloning 3'RACE was amplified by nested PCR method. The first PCR amplification system for 3'RACE (Table 8). Table 8

Reagents Amount cDNA 2 [L 1xcDNA Dilution Buffer II 8 L GSP Outer 2L 3'OGhCM2 2L lOx LAPCR buffer II (Mg2+ plus) 4pL LA Taq(5U/4L) 0.25[L ddH20 31.75[L Total 50tL Mix the system as described above, centrifuge briefly and then perform PCR amplification. PCR program: 94°C for 3min; 94°C for 30s, 55°C for 30s, 72°C for 2min, 20 cycles; 72°C for 10min; stored at 4°C. The amplification products were analysed by agar gel electrophoresis. After that, the first round PCR amplification products were diluted 50 times and the second round PCR amplification was performed. Second round PCR amplification system for 3'RACE(Table 9). Table 9

Reagents Amount Outer PCR Production 2 L dNTP mixture (2.5mM each) 8 L GSP inner 2[L 3'IGhCM2 2[L lOx LAPCR buffer II (Mg2+ plus) 4pL LA Taq(5U/4L) 0.25 L ddH20 31.75 L Total 50 L Mix the system as described above, centrifuge briefly and then perform PCR amplification.

PCR procedure: 94°C for 3min; 94°C for 30s, 55°C for 30s, 72°C for 1min, 30 cycles; 72°C for 10min; stored at 4°C. The amplification products were analysed by agar gel electrophoresis, followed by gel recovery, ligation and transformation, and positive clones were picked and sent to biotech for sequencing. 4.3. Target gene 5' end cloning After diluting the 5'RACE cDNA obtained from the reaction with appropriate amount of Tricine-EDTA Buffer, PCR amplification of 5'RACE was carried out, and the PCR system was as follows:

Step 1: adding the reagents shown in Table 10. Table 10 Reagent Amount 2x Seq Amp Buffer 25[L Seq Amp DNA Polymerase 1 L ddH20 15.5 L Total 41.5 L Mix gently, centrifuge briefly and place on ice. Step 2: adding the reagents shown in Table 11. Table 11

Reagent Amount Mix from Step 1 41.5 L 5'RACE cDNA 1 L 10xUPM 15.5 L 5'OGhCM2 1 L Total 50 L After the system was prepared according to the above procedure, it was gently mixed, briefly centrifuged, and the PCR was amplified according to the following procedure PCR procedure: (Table 12).

Table 12 Temperature and Number of Time for Reaction Amplifications 94°C 30s 5 cycles 72°C 3min 94°C 30s 5 cycles

70°C 30s 72°C 3min 94°C 30s 68°C 30s 25 cycles 72°C 3min After the reaction, gel agarose electrophoresis was performed to observe the bands, and if diffuse bands or no bands were present, the following actions were taken. (1) This template is the 50-fold dilution product of the previous PCR amplification product (Tricine-EDTA buffer) (2) The primers were UPMS and 1 L of 5' GhEBF1 were used as primers, the above PCR system was adopted, and the reaction procedure was set as follows: 20 cycles at 94°C for 3s, 65°C for 30s, 72°C for 1min, 20 cycles; stored at 4°C. After the reaction, gel agarose electrophoresis analysis was performed, followed by gel recovery, ligation and transformation, and the positive clones were picked and sent to biotech for sequencing. 4.4. Full-length cloning of GhCM2 The middle fragment, 3' RACE fragment and 5' RACE fragment were spliced by DNAman, and full-length primers qGhCM2-F , qGhCM2-R (Table 6) were designed for full-length PCR amplification of GhCM2. The 5' synthetic cDNA was selected and diluted -fold with Tricine-EDTA Buffer as the template. Reaction system: (Table 13). Table 13

Reagent Amount 10x Pyrobest buffer 2.5 L Pyrobest DNA polymerase 1 L dNTP 2L cDNA 2L qGhCM2-F 1 L qGhCM2-R 1 L ddH20 15.5 L Total 25 L

PCR procedure: 94°C for 3 min; 94°C for 30s, 55°C for 30s, 72°C for 2 min, 30 cycles; 72°C for 10 min; stored at 4°C. The amplification products were analysed by agar gel electrophoresis for gel recovery, with A-tail, and the system was as follows(Table 14). Table 14

Reagent Amount PCR Buffer 2.5 L rTaq 0.25 L Product from 20 L Rubber Cutting dd H20 1 L dNTP (2.5mM) 1.25 L Total 25[tL Reaction conditions: 72°C for 30min The full-length PCR reaction solution was ligated onto T simple vector, transformed E. coli DH5a, and the positive clones were picked and sent to Sangon Biotech for sequencing. The results were identified as shown in Figure 2: the full-length cDNA sequence of GhCM2 was 1007bp (as shown in Figure 2), the UTR at the 5' end was 137bp, the UTR region at the 3' end was 105bp, and the open reading frame (ORF) was 765bp, encoding a total of 255aa, and the sequence was shown in SEQ ID No: 1.

Example 2: Silencing the gene GhCM2 of resistant variety KV3 reduce plant Verticillium dahliae -resistance (1) Materials The wild type Verticillium dahliae resistantGossypium hirsutum variety KV3 and the Verticillium dahliae resistant land cotton variety KV3 with silent GhCM2 gene were used as experimental materials. (2) Experimental groups Control group: Verticillium dahliae -resistant Gossypium hirsutum variety KV3 (provided by Institute of Plant Protection, Chinese Academy of Agricultural Sciences). Experimental group: silenced GhCM2 gene of Verticillium dahliae -resistant Gossypium hirsutum variety KV3, transformed empty vector (CLCrV-00) KV3 (obtained by referring to Zhang Huachong's master thesis "IGS Technology to Resolve the Preliminary Functional Identification of Gossypium hirsutum Verticillium dahliae resistance Related Gene, i.e. GHB2", Chinese Academy of Agricultural Sciences Graduate School, 2016; and Ren Yuhong's M.S. thesis, "Cotton Verticillium wilt Control Technology and Functional Study of Two Disease-resistant Related Genes," Graduate School, Chinese Academy of Agricultural Sciences, 2018). (3) Experimental design and trait determination After seeds were treated with sulfuric acid for delinting before sowing, all full-sized seeds were selected for subsequent tests, and the seeds were soaked in 70% ethanol for 5 min for surface sterilization, and then soaked in 3% hydrogen peroxide for 2 h. Finally, the seeds were rinsed with sterile water. The sterilized seeds were planted in pots (nutrient soil: vermiculite = 2:1) and placed in a greenhouse at a temperature of 24°C, 16h light, 8h dark, and 70% relative humidity. When the cotton plants developed 1 leaves, they were transferred to beakers and cultured using the nutrient cultivation method. The strain for determining the resistance to Verticillium dahliae was the deciduous type strongly pathogenic strain V991. first, the preserved V991 was inoculated in PDA medium and incubated at 26°C for one week, and the activated V991 was incubated in Chia medium at 26°C, 200 rpm for 5-6 d; the bacterial solution that reached the desired concentration was filtered into sterilized beakers, and the concentration of spore suspension was determined by hemocytometer plate, and the dilution concentration of spore suspension to 107 spores/mL. The roots of both wild-type and transgenic plants grown in vermiculite culture pots containing nutrient soil grew well. After one month of growth of cotton seedlings, the Verticillium dahliae was inoculated with a suspension of spores (concentration 107 spores/mL) of the strongly pathogenic strain V991 of the deciduous type using the root dipping method, and the incidence of Verticillium wilt was investigated on 5, 10, 15 and 21 days after inoculation. (4) Measurement results The results showed that silencing the GhCM2 gene could significantly reduce plant disease resistance (shown in Figure 1), and its incidence and disease index are shown in Table 15. silencing the GhCM2 gene of cotton plant KV3 in the Verticillium dahliae- resistant Gossypium hirsutum variety, the incidence of Verticillium dahliae was as high as 82.5±2.3%, and the disease index was as high as 62.12.6, which was extremely significantly higher than the incidence of 21.3+1.2% in the wild type, and the disease index was 9.5+1.2. The results indicated that the disease resistance of cotton plant KV-3 in the disease resistant varieties decreased linearly after silencing the GhCM2 gene, basically, its resistance to Verticillium dahliae was lost. Capital letters in the table represent significant differences at the 1% level.

Table 15 Comparisons of Disease Indices of Verticillium dahliae in Different Treatment Groups Silencing Type Incidence Disease Index V991 inoculation of cotton KV-3 in wild type 21.3±1.2B 9.5±1.2B V991 inoculated with cotton KV-3 in transformed 23.3±1.3B 10.3±1.2B empty vector ( CLCrV-00 )

V991 inoculation of cotton KV-3 in silencing 82.5±2.3A 62.1±2.6A GhCM2

Example 3 Detection of Verticillium dahliae resistance of over expression GhCM2 transgenic Arabidopsis under Verticillium dahliae stress (1)Materials The second generation of over expression GhCM2 transgenic Arabidopsis thaliana and wild-type Col-O Arabidopsis thalianawere used as experimental materials (obtained by referring to Zhang Huachong's master thesis WIGS Technology to Resolve the Preliminary Functional Identification of Gossypium hirsutum Verticillium dahliae resistance Related Gene, i.e. GHB2", Chinese Academy of Agricultural Sciences Graduate School, 2016; and Ren Yuhong's M.S. thesis, "Cotton Verticillium wilt Control Technology and Functional Study of Two Disease-resistant Related Genes," Graduate School, Chinese Academy of Agricultural Sciences, 2018). (2) Cultivation substrate Medium: 1/2MS medium. 1/2MS+50mg/Lkanamycinmedium Culture medium: vermiculite + 1 / 4MS nutrient solution (3) Test design and disease resistance determination

The wild-type Arabidopsis thaliana was cultured in 1 / 2MS medium, and the transgenic Arabidopsis thalianawas cultured in 1 / 2MS + 50 mg / L kanamycin medium. When the seedlings grew to 2-3 true leaves, they were transplanted to the nutrient bowl. After 7 days of transplanting, Verticillium dahliae was treated; Over- expression plants were inoculated with Verticillium dahliae V991 by root dipping method. Three treatment conditions were set up:( 1) Control ( CK) : wild-type Col-O Arabidopsis and transformed empty vector Arabidopsis were inoculated with V991, respectively, as positive and negative controls. (2) Over- expression of GhCM2 plants (second generation ). were inoculated with V991 ( spore suspension concentration 105/ mL ) was inoculated by root irrigation method. After 15 days of inoculation, take photos and determine the incidence. (4) Assay results The incidence and disease index of wild-type Col- Arabidopsis and transformed empty vector were not significantly different after inoculation with V991, respectively, but the incidence and disease index of Verticillium dahliae in over- expression GhCM2 plants were highly significantly lower than those of wild-type Col-O Arabidopsis and transformed empty vector. The incidence of transformed GhCM2 under Verticillium dahliae stress was extremely significantly lower than that of the wild type (Table 16). The incidence and disease index of plants over expression GhCM2 were extremely significantly lower than those of the wild type. This implies that GhCM2 gene plays an important role in plant response to Verticillium dahliae, which implies that GhCM2 gene has the ability to improve plant resistance to Verticillium dahliae and functionally proves that GhCM2 gene plays on important role in Gossypium hirsutum resistance to Verticillium dahliae performance.

Table 16 Comparison of disease index of Verticillium wilt in different treatment Silencing Type Incidence Disease Index Wild-type Col-O Arabidopsis thaliana 35.3±3.6B 29.4±2.2B inoculated with V991 Transformation of empty vector 36.2+2.2B 28.9+2.6B Arabidopsis thaliana inoculated with V991

Over-presentation of GhCM2 in 6.3+1.4A 3.7+0.8A Arabidopsis thaliana inoculated with V991

The above described embodiments are only a description of the preferred way of the present invention, not a limitation of the scope of the present invention. Without departing from the spirit of the design of the present invention, all kinds of deformations and improvements made to the technical solutions of the present invention by a person of ordinary skill in the art shall fall within the scope of protection determined by the claims of the present invention.

Claims (7)

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

1. A protein, characterized in that it comprises a protein shown as any one of the following.

1) A protein comprising an amino acid sequence as shown in SEQ ID NO: 2.

2) A protein derived from SEQ ID NO: 2 by substituting and/or deleting and/or adding one

or more amino acid residues to an amino acid sequence as shown in SEQ ID NO: 2..

2. A gene encoding a protein as claimed in claim 1.

3. The gene as claimed in claim 2, characterized in that gene comprises a DNA molecule

as indicated by any of the following.

1) A DNA molecule as shown in SEQ ID NO: 1.

2) A DNA molecule as shown by the sequence shown in SEQ ID NO: 1 from the 5'terminal

nucleotide sequence at position 138.

3) A DNA molecule having at least 70% homology with the DNA sequence defined in 1)

or 2) and encoding a protein associated with Verticillium dahliae.

4. A primer pair for amplifying the full length or any fragment of the gene of claim 2 or 3,

characterized in that it comprises a nucleotide sequence as shown in SEQ ID NO: 3 and

SEQID NO: 4.

5. Application of the protein as claimed in claim 1 or the gene as claimed in any one of

claims 2-3.

Wherein the plant is a dicotyledonous plant or a monocotyledonous plant.

6. The application as claimed in claim 5, characterized in that the dicotyledonous plant is

Gossypium hirsutum or Arabidopsis thaliana and other Verticillium dahliae.host crops.

7. A method of observing a plant by introducing a protein.