AU1769601A - Endogenous and non-endogenous versions of human G protein-coupled receptors - Google Patents

Description

WO 01/36471 PCT/USOO/31509 ENDOGENOUS AND NON-ENDOGENOUS VERSIONS OF HUMAN G PROTEIN-COUPLED RECEPTORS FIELD OF THE INVENTION 5 The invention disclosed in this patent document relates to transmembrane receptors, and more particularly to human G protein-coupled receptors, and specifically to endogenous human GPCRs with particular emphasis Ion non endogenous versions of the GPCRs that have been altered to establish or enhance 10 constitutive activity of the receptor. Preferably, the altered GPCRs are used for the direct identification of candidate compounds as receptor agonists, inverse agonists or partial agonists having potential applicability as therapeutic agents. 15 BACKGROUND OF THE INVENTION Although a number of receptor classes exist in humans, by far the most abundant and therapeutically relevant is represented by the G protein-coupled receptor (GPCR or GPCRs) class. It is estimated that there are some 100,000 genes within the human 20 genome, and of these, approximately 2%, or 2,000 genes, are estimated to code for GPCRs. Receptors, including GPCRs, for which the endogenous ligand has been identified are referred to as "known" receptors, while receptors for which the endogenous ligand has not been identified are referred to as "orphan" receptors. GPCRs represent an important area for the development of pharmaceutical products: from 25 approximately 20 of the 100 known GPCRs, approximately 60% of all prescription pharmaceuticals have been developed. GPCRs share a common structural motif. All these receptors have seven sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each of which spans the membrane (each span is identified by number, i.e., 30 transmembrane-1 (TM-1), transmebrane-2 (TM-2), etc.). The transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, QI ICTITI IT= QU-T IDI II = 9a WO 01/36471 PCT/USOO/31509 transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or "extracellular" side, of the cell membrane (these are referred to as "extracellular" regions 1, 2 and 3 (EC-1, EC-2 and EC-3), respectively). The transmembrane helices are also joined by strands of amino acids between 5 transmembrane-1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular" side, of the cell membrane (these are referred to as "intracellular" regions 1, 2 and 3 (IC-1, IC-2 and IC 3), respectively). The "carboxy" ("C") terminus of the receptor lies in the intracellular space within the cell, and the "amino" ("N") terminus of the receptor lies in the 10 extracellular space outside of the cell. Generally, when an endogenous ligand binds with the receptor (often referred to as "activation" of the receptor), there is a change in the conformation of the intracellular region that allows for coupling between the intracellular region and an intracellular "G protein." It has been reported that GPCRs are "promiscuous" with respect to G proteins, 15 i.e., that a GPCR can interact with more than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988). Although other G proteins exist, currently, Gq, Gs, Gi, Gz and Go are G proteins that have been identified. Endogenous ligand-activated GPCR coupling with the G-protein begins a signaling cascade process (referred to as "signal transduction"). Under normal conditions, signal transduction ultimately results in 20 cellular activation or cellular inhibition. It is thought that the IC-3 loop as well as the carboxy terminus of the receptor interact with the G protein. Under physiological conditions, GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" state and an "active" state. A receptor in an inactive state is unable to link to the intracellular signaling 25 transduction pathway to produce a biological response. Changing the receptor 2 WO 01/36471 PCT/USOO/31509 conformation to the active state allows linkage to the transduction pathway (via the G protein) and produces a biological response. A receptor may be stabilized in an active state by an endogenous ligand or a compound such as a drug. Recent discoveries, including but not exclusively limited to 5 modifications to the amino acid sequence of the receptor, provide means other than endogenous ligands or drugs to promote and stabilize the receptor in the active state conformation. These means effectively stabilize the receptor in an active state by simulating the effect of an endogenous ligand binding to the receptor. Stabilization by such ligand-independent means is termed "constitutive receptor activation." 10 SUMMARY OF THE INVENTION Disclosed herein are endogenous and non-endogenous versions of human GPCRs and uses thereof. 15 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 provides an illustration of second messenger IP 3 production from endogenous version RUP12 ("RUP 12") as compared with the control ("CMV"). Figure 2 is a graphic representation of the results of a second messenger cell based cyclic AMP assay providing comparative results for constitutive signaling of 20 endogenous RUP13 ("RUP 13") and a control vector ("CMV"). Figure 3 is a diagrammatic representation of the signal measured comparing CMV, endogenous RUP13 ("RUP13 wt") and non-endogenous, constitutively activated RUP13 ("RUP13(A268K)"), utilizing 8XCRE-Luc reporter plasmid. 3 WO 01/36471 PCT/USOO/31509 Figure 4 is a graphic representation of the results of a [ 35 S]GTPyS assay providing comparative results for constitutive signaling by RUP13:Gs Fusion Protein ("RUP13-Gs") and a control vector ("CMV"). Figure 5 is a diagrammatic representation of the signal measured comparing 5 CMV, endogenous RUP14 ("RUP14 wt") and non-endogenous, constitutively activated RUP13 ("RUP14(L246K)"), utilizing 8XCRE-Luc reporter plasmid. Figure 6 is a diagrammatic representation of the signal measured comparing CMV, endogenous RUP15 ("RUP15 wt") and non-endogenous, constitutively activated RUP15 ("RUP 15(A398K)"), utilizing 8XCRE-Luc reporter plasmid. 10 Figure 7 is a graphic representation of the results of a second messenger cell based cyclic AMP assay providing comparative results for constitutive signaling of endogenous RUP15 ("RUP15 wt"), non-endogenous, constitutively activated version of RUP 15 ("RUP 1 5(A398K)") and a control vector ("CMV"). Figure 8 is a graphic representation of the results of a [ 35 S]GTPyS assay 15 providing comparative results for constitutive signaling by RUP15:Gs Fusion Protein ("RUP1 5-Gs") and a control vector ("CMV"). Figure 9 provides an illustration of second messenger IP 3 production from endogenous version RUP17 ("RUP17") as compared with the control ("CMV"). Figure 10 provides an illustration of second messenger IP 3 production from 20 endogenous version RUP21 ("RUP2 1") as compared with the control ("CMV"). Figure 11 is a diagrammatic representation of the signal measured comparing CMV, endogenous RUP23 ("RUP23 wt") and non-endogenous, constitutively activated RUP23 ("RUP23(W275K)"), utilizing 8XCRE-Luc reporter plasmid. 4 WO 01/36471 PCT/USOO/31509 Figure 12 is a graphic representation of results from a primary screen of several candidate compounds against RUP13; results for "Compound A" are provided in well A2 and "Compound "B" are provided in well G9. 5 DETAILED DESCRIPTION The scientific literature that has evolved around receptors has adopted a number of terms to refer to ligands having various effects on receptors. For clarity and consistency, the following definitions will be used throughout this patent document. To the extent that these definitions conflict with other definitions for these terms, the 10 following definitions shall control: AGONISTS shall mean materials (e.g., ligands, candidate compounds) that activate the intracellular response when they bind to the receptor, or enhance GTP binding to membranes. AMINO ACID ABBREVIATIONS used herein are set out in Table A: TABLE A ALANINE ALA A ARGININE ARG R ASPARAGINE ASN N ASPARTIC ACID ASP D CYSTEINE CYS C GLUTAMIC ACID GLU E GLUTAMINE GLN Q GLYCINE GLY G HISTIDINE HIS H ISOLEUCINE ILE I LEUCINE LEU L LYSINE LYS K METHIONINE MET M 5 WO 01/36471 PCT/USOO/31509 PHENYLALANINE PHE F PROLINE PRO P SERINE SER S THREONINE THR T TRYPTOPHAN TRP W TYROSINE TYR Y VALINE VAL V PARTIAL AGONISTS shall mean materials (e.g., ligands, candidate compounds) that activate the intracellular response when they bind to the receptor to a lesser degree/extent than do agonists, or enhance GTP binding to membranes to a lesser 5 degree/extent than do agonists. ANTAGONIST shall mean materials (e.g., ligands, candidate compounds) that competitively bind to the receptor at the same site as the agonists but which do not activate the intracellular response initiated by the active form of the receptor, and can thereby inhibit the intracellular responses by agonists or partial agonists. 10 ANTAGONISTS do not diminish the baseline intracellular response in the absence of an agonist or partial agonist. CANDIDATE COMPOUND shall mean a molecule (for example, and not limitation, a chemical compound) that is amenable to a screening technique. Preferably, the phrase "candidate compound" does not include compounds which were publicly 15 known to be compounds selected from the group consisting of inverse agonist, agonist or antagonist to a receptor, as previously determined by an indirect identification process ("indirectly identified compound"); more preferably, not including an indirectly identified compound which has previously been determined to have therapeutic efficacy in at least one mammal; and, most preferably, not including an indirectly identified 20 compound which has previously been determined to have therapeutic utility in humans. 6 WO 01/36471 PCT/USOO/31509 COMPOSITION means a material comprising at least one component; a "pharmaceutical composition" is an example of a composition. COMPOUND EFFICACY shall mean a measurement of the ability of a compound to inhibit or stimulate receptor functionality, as opposed to receptor binding 5 affinity. Exemplary means of detecting compound efficacy are disclosed in the Example section of this patent document. CODON shall mean a grouping of three nucleotides (or equivalents to nucleotides) which generally comprise a nucleoside (adenosine (A), guanosine (G), cytidine (C), uridine (U) and thymidine (T)) coupled to a phosphate group and which, 10 when translated, encodes an amino acid. CONSTITUTIVELY ACTIVATED RECEPTOR shall mean a receptor subject to constitutive receptor activation. A constitutively activated receptor can be endogenous or non-endogenous. CONSTITUTIVE RECEPTOR ACTIVATION shall mean stabilization of a 15 receptor in the active state by means other than binding of the receptor with its endogenous ligand or a chemical equivalent thereof. CONTACT or CONTACTING shall mean bringing at least two moieties together, whether in an in vitro system or an in vivo system. DIRECTLY IDENTIFYING or DIRECTLY IDENTIFIED, in relationship to 20 the phrase "candidate compound", shall mean the screening of a candidate compound against a constitutively activated receptor, preferably a constitutively activated orphan receptor, and most preferably against a constitutively activated G protein-coupled cell surface orphan receptor, and assessing the compound efficacy of such compound. This phrase is, under no circumstances, to be interpreted or understood to be encompassed by 25 or to encompass the phrase "indirectly identifying" or "indirectly identified." 7 WO 01/36471 PCT/USOO/31509 ENDOGENOUS shall mean a material that a mammal naturally produces. ENDOGENOUS in reference to, for example and not limitation, the term "receptor," shall mean that which is naturally produced by a mammal (for example, and not limitation, a human) or a virus. By contrast, the term NON-ENDOGENOUS in this 5 context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human) or a virus. For example, and not limitation, a receptor which is not constitutively active in its endogenous form, but when manipulated becomes constitutively active, is most preferably referred to herein as a "non-endogenous, constitutively activated receptor." Both terms can be utilized to describe both "in vivo" 10 and "in vitro" systems. For example, and not limitation, in a screening approach, the endogenous or non-endogenous receptor may be in reference to an in vitro screening system. As a further example and not limitation, where the genome of a mammal has been manipulated to include a non-endogenous constitutively activated receptor, screening of a candidate compound by means of an in vivo system is viable. 15 G PROTEIN COUPLED RECEPTOR FUSION PROTEIN and GPCR FUSION PROTEIN, in the context of the invention disclosed herein, each mean a non endogenous protein comprising an endogenous, constitutively activate GPCR or a non endogenous, constitutively activated GPCR fused to at least one G protein, most preferably the alpha (cc) subunit of such G protein (this being the subunit that binds 20 GTP), with the G protein preferably being of the same type as the G protein that naturally couples with endogenous orphan GPCR. For example, and not limitation, in an endogenous state, if the G protein "Gsa" is the predominate G protein that couples with the GPCR, a GPCR Fusion Protein based upon the specific GPCR would be a non endogenous protein comprising the GPCR fused to Gsc; in some circumstances, as will 25 be set forth below, a non-predominant G protein can be fused to the GPCR. The G 8 WO 01/36471 PCT/USOO/31509 protein can be fused directly to the c-terminus of the constitutively active GPCR or there may be spacers between the two. HOST CELL shall mean a cell capable of having a Plasmid and/or Vector incorporated therein. In the case of a prokaryotic Host Cell, a Plasmid is typically 5 replicated as a autonomous molecule as the Host Cell replicates (generally, the Plasmid is thereafter isolated for introduction into a eukaryotic Host Cell); in the case of a eukaryotic Host Cell, a Plasmid is integrated into the cellular DNA of the Host Cell such that when the eukaryotic Host Cell replicates, the Plasmid replicates. Preferably, for the purposes of the invention disclosed herein, the Host Cell is eukaryotic, more preferably, 10 mammalian, and most preferably selected from the group consisting of 293, 293T and COS-7 cells. INDIRECTLY IDENTIFYING or INDIRECTLY IDENTIFIED means the traditional approach to the drug discovery process involving identification of an endogenous ligand specific for an endogenous receptor, screening of candidate 15 compounds against the receptor for determination of those which interfere and/or compete with the ligand-receptor interaction, and assessing the efficacy of the compound for affecting at least one second messenger pathway associated with the activated receptor. INHIBIT or INHIBITING, in relationship to the term "response" shall mean 20 that a response is decreased or prevented in the presence of a compound as opposed to in the absence of the compound. INVERSE AGONISTS shall mean materials (e.g., ligand, candidate compound) which bind to either the endogenous form of the receptor or to the constitutively activated form of the receptor, and which inhibit the baseline intracellular response 25 initiated by the active form of the receptor below the normal base level of activity which 9 WO 01/36471 PCT/USOO/31509 is observed in the absence of agonists or. partial agonists, or decrease GTP binding to membranes. Preferably, the baseline intracellular response is inhibited in the presence of the inverse agonist by at least 30%, more preferably by at least 50%, and most preferably by at least 75%, as compared with the baseline response in the absence of the inverse 5 agonist. KNOWN RECEPTOR shall mean an endogenous receptor for which the endogenous ligand specific for that receptor has been identified. LIGAND shall mean an endogenous, naturally occurring molecule specific for an endogenous, naturally occurring receptor. 10 MUTANT or MUTATION in reference to an endogenous receptor's nucleic acid and/or amino acid sequence shall mean a specified change or changes to such endogenous sequences such that a mutated form of an endogenous, non-constitutively activated receptor evidences constitutive activation of the receptor. In terms of equivalents to specific sequences, a subsequent mutated form of a human receptor is 15 considered to be equivalent to a first mutation of the human receptor if (a) the level of constitutive activation of the subsequent mutated form of a human receptor is substantially the same as that evidenced by the first mutation of the receptor; and (b) the percent sequence (amino acid and/or nucleic acid) homology between the subsequent mutated form of the receptor and the first mutation of the receptor is at least about 80%, 20 more preferably at least about 90% and most preferably at least 95%. Ideally, and owing - to the fact that the most preferred cassettes disclosed herein for achieving constitutive activation includes a single amino acid and/or codon change between the endogenous and the non-endogenous forms of the GPCR, the percent sequence homology should be at least 98%. 10 WO 01/36471 PCT/USOO/31509 NON-ORPHAN RECEPTOR shall mean an endogenous naturally occurring molecule specific for an endogenous naturally occurring ligand wherein the binding of a ligand to a receptor activates an intracellular signaling pathway. ORPHAN RECEPTOR shall mean an endogenous receptor for which the 5 endogenous ligand specific for that receptor has not been identified or is not known. PHARMACEUTICAL COMPOSITION shall mean a composition comprising at least one active ingredient, whereby the composition is amenable to investigation for a specified, efficacious outcome in a mammal (for example, and not limitation, a human). Those of ordinary skill in the art will understand and appreciate the 10 techniques appropriate for determining whether an active ingredient has a desired efficacious outcome based upon the needs of the artisan. PLASMID shall mean the combination of a Vector and cDNA. Generally, a Plasmid is introduced into a Host Cell for the purposes of replication and/or expression of the cDNA as a protein. 15 SECOND MESSENGER shall mean an intracellular response produced as a result of receptor activation. A second messenger can include, for example, inositol triphosphate (IP 3 ), diacycglycerol (DAG), cyclic AMP (cAMP), and cyclic GMP (cGMP). Second messenger response can be measured for a determination of receptor activation. In addition, second messenger response can be measured for the direct 20 identification of candidate compounds, including for example, inverse agonists, agonists, partial agonists and antagonists. STIMULATE or STIMULATING, in relationship to the term "response" shall mean that a response is increased in the presence of a compound as opposed to in the absence of the compound. 11 WO 01/36471 PCT/USOO/31509 VECTOR in reference to cDNA shall mean a circular DNA capable of incorporating at least one cDNA and capable of incorporation into a Host Cell. The order of the following sections is set forth for presentational efficiency and is not intended, nor should be construed, as a limitation on the disclosure or the claims to 5 follow. A. Introduction The traditional study of receptors has always proceeded from the a priori assumption (historically based) that the endogenous ligand must first be identified before 10 discovery could proceed to find antagonists and other molecules that could affect the receptor. Even in cases where an antagonist might have been known first, the search immediately extended to looking for the endogenous ligand. This mode of thinking has persisted in receptor research even after the discovery of constitutively activated receptors. What has not been heretofore recognized is that it is the active state of the 15 receptor that is most useful for discovering agonists, partial agonists, and inverse agonists of the receptor. For those diseases which result from an overly active receptor or an under-active receptor, what is desired in a therapeutic drug is a compound which acts to diminish the active state of a receptor or enhance the activity of the receptor, respectively, not necessarily a drug which is an antagonist to the endogenous ligand. 20 This is because a compound that reduces or enhances the activity of the active receptor state need not bind at the same site as the endogenous ligand. Thus, as taught by a method of this invention, any search for therapeutic compounds should start by screening compounds against the ligand-independent active state. 25 B. Identification of Human GPCRs 12 WO 01/36471 PCT/USOO/31509 The efforts of the Human Genome project has led to the identification of a plethora of information regarding nucleic acid sequences located within the human genome; it has been the case in this endeavor that genetic sequence information has been made available without an understanding or recognition as to whether or not any 5 particular genomic sequence does or may contain open-reading frame information that translate human proteins. Several methods of identifying nucleic acid sequences within the human genome are within the purview of those having ordinary skill in the art. For example, and not limitation, a variety of human GPCRs, disclosed herein, were discovered by reviewing the GenBankTM database. Table B, below, lists several 10 endogenous GPCRs that we have discovered, along with other GPCR's that are homologous to the disclosed GPCR. TABLE B Disclosed Accession Open Reading Reference To Per Cent Human Number Frame Homologous Homology Orphan GPCRs Identified (Base Pairs) GPCR To Designated GPCR hRUP8 AL121755 1,152bp NPY2R 27% hRUP9 AC01 13375 1,260bp GAL2R 22% hRUP1O AC008745 1,014bp C5aR 40% hRUP11 AC013396 1,272bp HM74 36% hRUP12 AP000808 966bp Masl 34% hRUP13 AC011780 1,356bp Fish GPRX- 43% ORYLA hRUP14 AL137118 1,041bp CysLT1R 35% hRUP15 AL016468 1,527bp RE2 30% hRUP16 AL136106 1,068bp GLR101 37% hRUP17 AC023078 969bp Masl 37% hRUP18 AC008547 1,305bp Oxytocin 31% hRUP19 AC026331 1,041bp HM74 52% hRUP20 AL161458 1,011bp GPR34 25% hRUP21 AC026756 1,014bp P2Y1R 37% hRUP22 AC027026 993bp RUP17 67% Mas1 37% 13 WO 01/36471 PCT/USOO/31509 hRUP23 AC007104 1,092bp Rat GPR26 31% hRUP24 AL355388 1,125bp SALPR 44% hRUP25 AC026331 1,092bp HM74 95% hRUP26 AC023040 1,044bp Rabbit 5HT1D 27% hRUP27 AC027643 158,700 MCH 38% Receptor homology is useful in terms of gaining an appreciation of a role of the receptors within the human body. As the patent document progresses, we will disclose techniques for mutating these receptors to establish non-endogenous, constitutively 5 activated versions of these receptors. The techniques disclosed herein have also been applied to other human, orphan GPCRs known to the art, as will be apparent as the patent document progresses. C. Receptor Screening 10 Screening candidate compounds against a non-endogenous, constitutively activated version of the human GPCRs disclosed herein allows for the direct identification of candidate compounds which act at this cell surface receptor, without requiring use of the receptor's endogenous ligand. Using routine, and often commercially available techniques, one can determine areas within the body where the 15 endogenous version of human GPCRs disclosed herein is expressed and/or over expressed. It is also possible using these techniques to determine related disease/disorder states which are associated with the expression and/or over-expression of the receptor; such an approach is disclosed in this patent document. With respect to creation of a mutation that may evidence constitutive activation 20 of the human GPCR disclosed herein is based upon the distance from the proline residue at which is presumed to be located within TM6 of the GPCR; this algorithmic technique is disclosed in co-pending and commonly assigned patent document PCT Application 14 WO 01/36471 PCT/USOO/31509 Number PCT/US99/23938, published as WO 00/22129 on April 20, 2000, which, along with the other patent documents listed herein, is incorporated herein by reference. The algorithmic technique is not predicated upon traditional sequence "alignment" but rather a specified distance from the aforementioned TM6 proline residue (or, of course, 5 endogenous constitutive substitutionf for such proline residue). By mutating the amino acid residue located 16 amino acid residues from this residue (presumably located in the IC3 region of the receptor) to, most preferably, a lysine residue, such activation may be obtained. Other amino acid residues may be useful in the mutation at this position to achieve this objective. 10 D. Disease/Disorder Identification and/or Selection As will be set forth in greater detail below, most preferably inverse agonists and agonists to the non-endogenous, constitutively activated GPCR can be identified by the methodologies of this invention. Such inverse agonists and agonists are ideal candidates 15 as lead compounds in drug discovery programs for treating diseases related to this receptor. Because of the ability to directly identify inverse agonists to the GPCR, thereby allowing for the development of pharmaceutical compositions, a search for diseases and disorders associated with the GPCR is relevant. For example, scanning both diseased and normal tissue samples for the presence of the GPCR now becomes 20 more than an academic exercise or one which might be pursued along the path of identifying an endogenous ligand to the specific GPCR. Tissue scans can be conducted across a broad range of healthy. and diseased tissues. Such tissue scans provide a preferred first step in associating a specific receptor with a disease and/or disorder. Preferably, the DNA sequence of the human GPCR is used to make a probe for 25 (a) dot-blot analysis against tissue-mRNA, and/or (b) RT-PCR identification of the expression of the receptor in tissue samples. The presence of a receptor in a tissue 15 WO 01/36471 PCT/USOO/31509 source, or a diseased tissue, or the presence of the receptor at elevated concentrations in diseased tissue compared to a normal tissue, can be preferably utilized to identify a correlation with a treatment regimen, including but not limited to, a disease associated with that disease. Receptors can equally well be localized to regions of organs by this 5 technique. Based on the known functions of the specific tissues to which the receptor is localized, the putative functional role of the receptor can be deduced. E. Screening of Candidate Compounds 1. Generic GPCR screening assay techniques 10 When a G protein receptor becomes constitutively active, it binds to a G protein (e.g., Gq, Gs, Gi, Gz, Go) and stimulates the binding of GTP to the G protein. The G protein then acts as a GTPase and slowly hydrolyzes the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated. However, constitutively activated receptors continue to exchange GDP to GTP. A non-hydrolyzable analog of 15 GTP, ["S]GTPyS, can be used to monitor enhanced binding to membranes which express constitutively activated receptors. It is reported that [ 35 S]GTPyS can be used to monitor G protein coupling to membranes in the absence and presence of ligand. An example of this monitoring, among other examples well-known and available to those in the art, was reported by Traynor and Nahorski in 1995. The preferred use of this assay 20 system is for initial screening of candidate compounds because the system is generically applicable to all G protein-coupled receptors regardless of the particular G protein that interacts with the intracellular domain of the receptor. 2. Specific GPCR screening assay techniques Once candidate compounds are identified using the "generic" G protein-coupled 25 receptor assay (i.e., an assay to select compounds that are agonists, partial agonists, or inverse agonists), further screening to confirm that the compounds have interacted at the 16 WO 01/36471 PCT/USOO/31509 receptor site is preferred. For example, a compound identified by the "generic" assay may not bind to the receptor, but may instead merely "uncouple" the G protein from the intracellular domain. a. Gs, Gz and Gi. 5 Gs stimulates the enzyme adenylyl cyclase. Gi (and Gz and Go), on the other hand, inhibit this enzyme. Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, constitutively activated GPCRs that couple the Gs protein are associated with increased cellular levels of cAMP. On the other hand, constitutively activated GPCRs that couple Gi (or Gz, Go) protein are associated with decreased cellular levels of cAMP. 10 See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain ( 3 rd Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992). Thus, assays that detect cAMP can be utilized to determine if a candidate compound is, e.g., an inverse agonist to the receptor (i.e., such a compound would decrease the levels of cAMP). A variety of approaches known in the art for measuring cAMP can be utilized; 15 a most preferred approach relies upon the use of anti-cAMP antibodies in an ELISA based format. Another type of assay that can be utilized is a whole cell second messenger reporter system assay. Promoters on genes drive the expression of the proteins that a particular gene encodes. Cyclic AMP drives gene expression by promoting the binding of a cAMP-responsive DNA binding protein or transcription 20 factor (CREB) that then binds to the promoter at specific sites called cAMP response elements and drives the expression of the gene. Reporter systems can be constructed which have a promoter containing multiple cAMP response elements before the reporter gene, e.g., p-galactosidase or luciferase. Thus, a constitutively activated Gs-linked receptor causes the accumulation of cAMP that then activates the gene and expression of 17 WO 01/36471 PCT/USOO/31509 the reporter protein. The reporter protein such as p-galactosidase or luciferase can then be detected using standard biochemical assays (Chen et al. 1995). b. Go and Gq. 5 Gq and Go are associated with activation of the enzyme phospholipase C, which in turn hydrolyzes the phospholipid PIP 2 , releasing two intracellular messengers: diacycloglycerol (DAG) and inistol 1,4,5-triphoisphate (IP 3 ). Increased accumulation of

IP

3 is associated with activation of Gq- and Go-associated receptors. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain ( 3 rd 10 Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992). Assays that detect IP 3 accumulation can be utilized to determine if a candidate compound is, e.g., an inverse agonist to a Gq- or Go-associated receptor (i.e., such a compound would decrease the levels of IP 3 ). Gq-associated receptors can also been examined using an AP1 reporter assay in that Gq-dependent phospholipase C causes activation of genes containing AP1 15 elements; thus, activated Gq-associated receptors will evidence an increase in the expression of such genes, whereby inverse agonists thereto will evidence a decrease in such expression, and agonists will evidence an increase in such expression. Commercially available assays for such detection are available. 3. GPCR Fusion Protein 20 The use of an endogenous, constitutively activate orphan GPCR or a non endogenous, constitutively activated orphan GPCR, for use in screening of candidate compounds for the direct identification of inverse agonists, agonists and partial agonists provide an interesting screening challenge in that, by definition, the receptor is active even in the absence of an endogenous ligand bound thereto. Thus, in order to 25 differentiate between, e.g., the non-endogenous receptor in the presence of a candidate compound and the non-endogenous receptor in the absence of that compound, with an 18 WO 01/36471 PCT/USOO/31509 aim of such a differentiation to allow for an understanding as to whether such compound may be an inverse agonist, agonist, partial agonist or have no affect on such a receptor, it is preferred that an approach be utilized that can enhance such differentiation. A preferred approach is the use of a GPCR Fusion Protein. 5 Generally, once it is determined that a non-endogenous orphan GPCR has been constitutively activated using the assay techniques set forth above (as well as others), it is possible to determine the predominant G protein that couples with the endogenous GPCR. Coupling of the G protein to the GPCR provides a signaling pathway that can be assessed. Because it is most preferred that screening take place by use of a mammalian 10 expression system, such a system will be expected to have endogenous G protein therein. Thus, by definition, in such a system, the non-endogenous, constitutively activated orphan GPCR will continuously signal. In this regard, it is preferred that this signal be enhanced such that in the presence of, e.g., an inverse agonist to the receptor, it is more likely that it will be able to more readily differentiate, particularly in the context of 15 screening, between the receptor when it is contacted with the inverse agonist. The GPCR Fusion Protein is intended to enhance the efficacy of G protein coupling with the non-endogenous GPCR. The GPCR Fusion Protein is preferred for screening with a non-endogenous, constitutively activated GPCR because such an approach increases the signal that is most preferably utilized in such screening 20 techniques. This is important in facilitating a significant "signal to noise" ratio; such a significant ratio is import preferred for the screening of candidate compounds as disclosed herein. The construction of a construct useful for expression of a GPCR Fusion Protein is within the purview of those having ordinary skill in the art. Commercially available 25 expression vectors and systems offer a variety of approaches that can fit the particular 19 WO 01/36471 PCT/USOO/31509 needs of an investigator. The criteria of importance for such a GPCR Fusion Protein construct is that the endogenous GPCR sequence and the G protein sequence both be in frame (preferably, the sequence for the endogenous GPCR is upstream of the G protein sequence) and that the "stop" codon of the GPCR must be deleted or replaced such that 5 upon expression of the GPCR, the G protein can also be expressed. The GPCR can be linked directly to the G protein, or there can be spacer residues between the two (preferably, no more than about 12, although this number can be readily ascertained by one of ordinary skill in the art). We have a preference (based upon convenience) of use of a spacer in that some restriction sites that are not used will, effectively, upon 10 expression, become a spacer. Most preferably, the G protein that couples to the non endogenous GPCR will have been identified prior to the creation of the GPCR Fusion Protein construct. Because there are only a few G proteins that have been identified, it is preferred that a construct comprising the sequence of the G protein (i.e., a universal G protein construct) be available for insertion of an endogenous GPCR sequence therein; 15 this provides for efficiency in the context of large-scale screening of a variety of different endogenous GPCRs having different sequences. As noted above, constitutively activated GPCRs that couple to Gi, Gz and Go are expected to inhibit the formation of cAMP making assays based upon these types of GPCRs challenging (i.e., the cAMP signal decreases upon activation thus making the 20 direct identification of, e.g, inverse agonists (which would further decrease this signal), interesting. As will be disclosed herein, we have ascertained that for these types of receptors, it is possible to create a GPCR Fusion Protein that is not based upon the endogenous GPCR's endogenous G protein, in an effort to establish a viable cyclase based assay. Thus, for example, an endogenous Gi coupled receptor can be fused to a Gs 25 protein - we believe that such a fusion construct, upon expression, "drives" or "forces" 20 WO 01/36471 PCT/USOO/31509 the endogenous GPCR to couple with, e.g., Gs rather than the "natural" Gi protein, such that a cyclase-based assay can be established. Thus, for Gi, Gz and Go coupled receptors, we prefer that that when a GPCR Fusion Protein is used and the assay is based upon detection of adenylyl cyclase activity, that the fusion construct be established with 5 Gs (or an equivalent G protein that stimulates the formation of the enzyme adenylyl cyclase). Equally effective is a G Protein Fusion construct that utilizes a Gq Protein fused with a Gs, Gi, Gz or Go Protein. A most preferred fusion construct can be accomplished with a Gq Protein wherein the first six (6) amino acids of the G-protein c-subunit 10 ("Gcq") is deleted and the last five (5) amino acids at the C-terminal end of Gcq is replaced with the corresponding amino acids of the Gc of the G protein of interest. For example, a fusion construct can have a Gq (6 amino acid deletion) fused with a Gi Protein, resulting in a "Gq/Gi Fusion Construct". We believe that this fusion construct will force the endogenous Gi coupled receptor to couple to its non-endogenous G 15 protein, Gq, such that the second messenger, for example, inositol triphosphate or diacylgycerol, can be measured in lieu of cAMP production. 4. Co-transfection of a Target Gi Coupled GPCR with a Signal Enhancer Gs Coupled GPCR (cAMP Based Assays) 20 A Gi coupled receptor is known to inhibit adenylyl cyclase, and, therefore, decrease the level of cAMP production, which can make assessment of cAMP levels challenging. An effective technique in measuring the decrease in production of cAMP as an indication of constitutive activation of a receptor that predominantly couples Gi upon 25 activation can be accomplished by co-transfecting a signal enhancer, e.g., a non endogenous, constitutively activated receptor that predominantly couples with Gs upon activation (e.g., TSHR-A6231, disclosed below), with the Gi linked GPCR. As is 21 WO 01/36471 PCT/USOO/31509 apparent, constitutive activation of a Gs coupled receptor can be determined based upon an increase in production of cAMP. Constitutive activation of a Gi coupled receptor leads to a decrease in production cAMP. Thus, the co-transfection approach is intended to advantageously exploit these "opposite" affects. For example, co-transfection of a 5 non-endogenous, constitutively activated Gs coupled receptor (the "signal enhancer") with the endogenous Gi coupled receptor (the "target receptor") provides a baseline cAMP signal (i.e., although the Gi coupled receptor. will decrease cAMP levels, this "decrease" will be relative to the substantial increase in cAMP levels established by constitutively activated Gs coupled signal enhancer). By then co-transfecting the signal 10 enhancer with a constitutively activated version of the target receptor, cAMP would be expected to further decrease (relative to base line) due to the increased functional activity of the Gi target (i.e., which decreases cAMP). Screening of candidate compounds using a cAMP based assay can then be accomplished, with two provisos: first, relative to the Gi coupled target receptor, 15 "opposite" effects will result, i.e., an inverse agonist of the Gi coupled target receptor will increase the measured cAMP signal, while an agonist of the Gi coupled target receptor will decrease this signal; second, as would be apparent, candidate compounds that are directly identified using this approach should be assessed independently to ensure that these do not target the signal enhancing receptor (this can be done prior to or 20 after screening against the co-transfected receptors). F. Medicinal Chemistry Generally, but not always, direct identification of candidate compounds is preferably conducted in conjunction with compounds generated via combinatorial 25 chemistry techniques, whereby thousands of compounds are randomly prepared for such analysis. Generally, the results of such screening will be compounds having 22 WO 01/36471 PCT/USOO/31509 unique core structures; thereafter, these compounds are preferably subjected to additional chemical modification around a preferred core structure(s) to further enhance the medicinal properties thereof. Such techniques are known to those in the art and will not be addressed in detail in this patent document. 5 G. Pharmaceutical compositions Candidate compounds selected for further development can be formulated into pharmaceutical compositions using techniques well known to those in the art. Suitable pharmaceutically-acceptable carriers are available to those in the art; for example, see 10 Remington's Pharmaceutical Sciences, 16 th Edition, 1980, Mack Publishing Co., (Oslo et al., eds.). H. Other Utility Although a preferred use of the non-endogenous versions the human GPCRs 15 disclosed herein may be for the direct identification of candidate compounds as inverse agonists, agonists or partial agonists (preferably for use as pharmaceutical agents), these versions of human GPCRs can also be utilized in research settings. For example, in vitro and in vivo systems incorporating GPCRs can be utilized to further elucidate and understand the roles these receptors play in the human condition, both normal and 20 diseased, as well as understanding the role of constitutive activation as it applies to understanding the signaling cascade. The value in non-endogenous human GPCRs is that their utility as a research tool is enhanced in that, because of their unique features, non-endogenous human GPCRs can be used to understand the role of these receptors in the human body before the endogenous ligand therefore is identified. Other uses of the 25 disclosed receptors will become apparent to those in the art based upon, inter alia, a review of this patent document. 23 WO 01/36471 PCT/USOO/31509 EXAMPLES The following examples are presented for purposes of elucidation, and not limitation, of the present invention. While specific nucleic acid and amino acid sequences are disclosed herein, those of ordinary skill in the art are credited with the 5 ability to make minor modifications to these sequences while achieving the same or substantially similar results reported below. The traditional approach to application or understanding of sequence cassettes from one sequence to another (e.g. from rat receptor to human receptor or from human receptor A to human receptor B) is generally predicated upon sequence alignment techniques whereby the sequences are aligned in an 10 effort to determine areas of commonality. The mutational approach disclosed herein does not rely upon this approach but is instead based upon an algorithmic approach and a positional distance from a conserved proline residue located within the TM6 region of human GPCRs. Once this approach is secured, those in the art are credited with the ability to make minor modifications thereto to achieve substantially the same results (i.e., 15 constitutive activation) disclosed herein. Such modified approaches are considered within the purview of this disclosure. // // // 20 // Example 1 ENDOGENOUS HUMAN GPCRS 1. Identification of Human GPCRs The disclosed endogenous human GPCRs were identified based upon a review 25 of the GenBankTM database information. While searching the database, the following cDNA clones were identified as evidenced below (Table C). 24 WO 01/36471 PCT/USOO/31509 TABLE C Disclosed Accession Complete DNA Open Reading Nucleic Amino Human Number Sequence Frame Acid Acid Orphan Identified (Base Pairs) (Base Pairs) SEQ.ID. SEQ.ID. GPCRs NO. NO. hRUP8 AL121755 147,566bp 1,152bp 1 2 hRUP9 AC0113375 143,181bp 1,260bp 3 4 hRUP10 AC008745 94,194bp 1,014bp 5 6 hRUP11 AC013396 155,086bp 1,272bp 7 8 hRUP12 AP000808 177,764bp 966bp 9 10 hRUP13 AC011780 167,819bp 1,356bp 11 12 hRUP14 AL137118 168,297bp 1,041bp 13 14 hRUP15 AL016468 138,828bp 1,527bp 15 16 hRUP16 AL136106 208,042bp 1,068bp 17 18 hRUP17 AC023078 161,735bp 969bp 19 20 hRUP18 AC008547 117,304bp 1,305bp 21 22 hRUP19 AC026331 145,183bp 1,041bp 23 24 hRUP20 AL161458 163,51lbp 1,011bp 25 26 hRUP21 AC026756 156,534bp 1,014bp 27 28 hRUP22 AC027026 151,811bp 993bp 29 30 hRUP23 AC007104 200,000bp 1,092bp 31 32 hRUP24 AL355388 190,538bp 1,125bp 33 34 hRUP25 AC026331 145,183bp 1,092bp 35 36 hRUP26 AC023040 178,508bp 1,044bp 37 38 hRUP27 AC027643 158,700bp 1,020bp 39 40 5 2. Full Length Cloning a. hRUP8 (Seq. Id. Nos. 1 & 2) The disclosed human RUP8 was identified based upon the use of EST database (dbEST) information. While searching the dbEST, a cDNA clone with accession number 25 WO 01/36471 PCT/USOO/31509 AL121755 was identified to encode a novel GPCR. The following PCR primers were used for RT-PCR with human testis Marathon-Ready cDNA (Clontech) as templates: 5'-CTTGCAGACATCACCATGGCAGCC-3' (SEQ.ID.NO.:41; sense) and 5'-GTGATGCTCTGAGTACTGGACTGG-3' (SEQ.ID.NO.: 42; antisense). 5 PCR was performed using Advantage cDNA polymerase (Clontech; manufacturing instructions will be followed) in 50ul reaction by the following cycles: 94*C for 30 sec; 94*C for 10 sec; 65'C for 20 sec, 72*C for 1.5 min, and 72*C for 7 min. Cycles 2 through 4 were repeated 35 times. A 1.2kb PCR fragment was isolated and cloned into the pCRII-TOPO vector 10 (Invitrogen) and sequenced using the ABI Big Dye Terminator kit (P.E. Biosystem). See, SEQ.ID.NO.:1. The putative amino acid sequence for RUP8 is set forth in SEQ.ID.NO.:2. b. hRUP9 (Seq. Id. Nos. 3 & 4) The disclosed human RUP9 was identified based upon the use of GeneBank 15 database information. While searching the database, a cDNA clone with Accession Number ACO11375 was identified as a human genomic sequence from chromosome 5. The full length RUP9 was cloned by PCR using primers: 5'-GAAGCTGTGAAGAGTGATGC-3' (SEQ.ID.NO.:43; sense), 5'-GTCAGCAATATTGATAAGCAGCAG-3' (SEQ.ID.NO.:44; antisense) 20 and human genomic DNA (Promega) as a template. Taq Plus Precision polymerase (Stratagene) was used for the amplification in a 100 1 reaction with 5% DMSO by the following cycle with step 2 to step 4 repeated 35 times: 94*C for 1 minute; 94*C for 30 seconds; 56*C for 30 seconds; 72*C for 2 minutes; 72*C for 5 minutes. A 1.3 Kb PCR fragment was isolated and cloned into the pCRII-TOPO vector 25 (Invitrogen) from 1% agarose gel and completely sequenced using the ABI Big Dye 26 WO 01/36471 PCT/USOO/31509 Terminator kit (P.E. Biosystem). See, SEQ.ID.NO.:3. The putative amino acid sequence for RUP8 is set forth in SEQ.ID.NO.:4. The sequence of RUP9 clones isolated from human genomic DNA matched with the sequence obtained from data base. c. hRUP10 (Seq. Id. Nos. 5 & 6) 5 The disclosed human RUP10 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with accession number AC008754 was identified as a human genomic sequence from chromosome 19. The full length RUP10 was cloned by RT-PCR using primers: 5'-CCATGGGGAACGATTCTGTCAGCTACG-3' (SEQ.ID.NO.:45; sense) and 10 5'-GCTATGCCTGAAGCCAGTCTTGTG-3' (SEQ.ID.NO.:46; antisense) and human leukocyte Marathon-Ready cDNA (Clontech) as a template. Advantage cDNA polymerase (Clontech) was used for the amplification in a 50LIl reaction by the following cycle with step 2 to step 4 repeated 35 times: 94'C for 30 seconds; 94*C for 10 seconds; 62*C for 20 seconds; 72*C for 1.5 minutes; 72*C for 7 minutes. A 1.0 15 Kb PCR fragment was isolated and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Terminator kit (P.E. Biosystem). The nucleic acid sequence of the novel human receptor RUP1O is set forth in SEQ.ID.NO.:5 and the putative amino acid sequence thereof is set forth in SEQ.ID.NO.:6. 20 d. hRUP11 (Seq. Id. Nos. 7 & 8) The disclosed human RUP 11 was identified based upon the use of GenBank database information. While searching the database, a cDNA clone with accession 25 number ACO 13396 was identified as a human genomic sequence from chromosome 2. 27 WO 01/36471 PCT/USOO/31509 The full length RUP11 was cloned by PCR using primers: 5'-CCAGGATGTTGTGTCACCGTGGTGGC-3' (SEQ.ID.NO.:47; sense), 5'-CACAGCGCTGCAGCCCTGCAGCTGGC-3' (SEQ.ID.NO.:48; antisense) and human genomic DNA (Clontech) as a template. TaqPlus Precision DNA 5 polymerase (Stratagene) was used for the amplification in a 50[d reaction by the following cycle with step 2 to step 4 repeated 35 times: 94*C for 3 minutes; 94*C for 20 seconds; 67*C for 20 seconds; 72*C for 1.5 minutes; 72*C for 7 minutes. A 1.3 Kb PCR fragment was isolated and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Terminator kit (P.E. Biosystem). The 10 nucleic acid sequence of the novel human receptor RUP 11 is set forth in SEQ.ID.NO.:7 and the putative amino acid sequence thereof is set forth in SEQ.ID.NO.:8. e. hRUP12 (Seq. Id. Nos. 9 & 10) The disclosed human RUP12 was identified based upon the use of GenBank database. While searching the database, a cDNA clone with accession number 15 AP000808 was identified to encode a new GPCR, having significant homology with rat RTA and human mas1 oncogene GPCRs. The full length RUP12 was cloned by PCR using prnmers: 5'-CTTCCTCTCGTAGGGATGAACCAGAC-3' (SEQ.ID.NO.:49; sense) 5'-CTCGCACAGGTGGGAAGCACCTGTGG-3' (SEQ.ID.NO.:50; antisense) 20 and human genomic DNA (Clontech) as template. TaqPlus Precision DNA polymerase (Stratagene) was used for the amplification by the following cycle with step 2 to step 4 repeated 35 times: 94'C for 3 min; 94'C for 20 sec; 65'C for 20sec; 72'C for 2 min and 72*C for 7 min. A 1.0kb PCR fragment was isolated and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Terminator kit 28 WO 01/36471 PCT/USOO/31509 (P.E. Biosystem) (see, SEQ.ID.NO.:9 for nucleic acid sequence and SEQ.ID.NO.: 10 for deduced amino acid sequence). f. hRUP13 (Seq. Id. Nos. 11 & 12) The disclosed human RUP13 was identified based upon the use of 5 GenBank database. While searching the database, a cDNA clone with accession number ACO 1780 was identified to encode a new GPCR, having significant homology with GPCR fish GPRX-ORYLA. The full length RUP13 was cloned by PCR using primers: 5'-GCCTGTGACAGGAGGTACCCTGG-3' (SEQ.ID.NO.:51; sense) 5'-CATATCCCTCCGAGTGTCCAGCGGC-3' (SEQ.ID.NO.:52; antisense) 10 and human genomic DNA (Clontech) as template. TaqPlus Precision DNA polymerase (Stratagene) was used for the amplification by the following cycle with step 2 to step 4 repeated 35 times: 94'C for 3 min; 94'C for 20 sec; 65*C for 20sec; 72*C for 2 min and 72*C for 7 min. A 1.35kb PCR fragment was isolated and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Terminator kit 15 (P.E. Biosystem) (see, SEQ.ID.NO.:11 for nucleic acid sequence and SEQ.ID.NO.:12 for deduced amino acid sequence). g. hRUP14 (Seq. Id. Nos. 13 & 14) The disclosed human RUP14 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession 20 Number AL137118 was identified as a human genomic sequence from chromosome 13. The full length RUTP14 was cloned by PCR using primers: 5'-GCATGGAGAGAAAATTTATGTCCTTGCAACC-3' (SEQ.ID.NO.:53; sense) 5'-CAAGAACAGGTCTCATCTAAGAGCTCC-3' (SEQ.ID.NO.:54; antisense) and human genomic DNA (Promega) as a template. Taq Plus Precision polymerase 25 (Stratagene) and 5% DMSO were used for the amplification by the following cycle 29 WO 01/36471 PCT/USOO/31509 with step 2 and step 3 repeated 35 times: 94*C for 3 minute; 94*C for 20 seconds; 58*C for 2 minutes; 72*C for 10 minutes. A 1.1 Kb PCR fragment was isolated and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Terminator kit (P.E. 5 Biosystem) (see, SEQ.ID.NO.:13 for nucleic acid sequence and SEQ.ID.NO.:14 for deduced amino acid sequence). The sequence of RUP14 clones isolated from human genomic DNA matched with the sequence obtained from database. h. hRUP15 (Seq. Id. Nos. 15 & 16) The disclosed human RUP15 was identified based upon the use of GeneBank 10 database information. While searching the database, a cDNA clone with Accession Number AC016468 was identified as a human genomic sequence. The full length RUP15 was cloned by PCR using primers: 5'-GCTGTTGCCATGACGTCCACCTGCAC-3' (SEQ.ID.NO.:55; sense) 5'-GGACAGTTCAAGGTTTGCCTTAGAAC-3' (SEQ.ID.NO.:56; antisense) 15 and human genomic DNA (Promega) as a template. Taq Plus Precision polymerase (Stratagene) was used for the amplification by the following cycle with step 2 to 4 repeated 35 times: 94*C for 3 minute; 94*C for 20 seconds; 65*C for 20 seconds; 72'C for 2 minutes and 72*C for 7 minutes. A 1.5 Kb PCR fragment was isolated and cloned into the pCRII-TOPO vector 20 (Invitrogen) and completely sequenced using the ABI Big Dye Terminator kit (P.E. Biosystem). See, SEQ.I]D.NO.:15 for nucleic acid sequence and SEQ.ID.NO.:16 for deduced amino acid sequence. The sequence of RUP15 clones isolated from human genomic DNA matched with the sequence obtained from database. i. hRUP16 (Seq. Id. Nos. 17 & 18) 30 WO 01/36471 PCT/USOO/31509 The disclosed human RUP16 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession Number AL136106 was identified as a human genomic sequence from chromosome 13. The full length RUP16 was cloned by PCR using primers: 5 5'-CTTCGATACTGCTCCTATGCTC-3' (SEQ.ID.NO.:57; sense, 5' of initiation codon), 5'-GTAGTCCACTGAAAGTCCAGTGATCC-3' (SEQ.ID.NO.:58; antisense, 3' of stop codon) and human skeletal muscle Marathon-Ready cDNA (Clontech) as template. Advantage cDNA polymerase (Clontech) was used for the amplification in a 50ul reaction by the following cycle with step 2 to 4 repeated 35 times: 94*C for 30 seconds; 94*C for 5 10 seconds; 69*C for 15 seconds; 72'C for 1 minute and 72*C for 5 minutes. A 1.1 Kb PCR fragment was isolated and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the T7 sequenase kit (Amsham). See, SEQ.ID.NO.: 17 for nucleic acid sequence and SEQ.ID.NO.: 18 for deduced amino acid sequence. The sequence of RUP16 clones matched with four unordered segments of 15 AL136106, indicating that the RUP16 cDNA is composed of 4 exons. j. hRUP17 (Seq. Id. Nos. 19 & 20) The disclosed human RUP17 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession Number AC023078 was identified as a human genomic sequence from chromosome 20 11. The full length RUP 17 was cloned by PCR using primers: 5'-TTTCTGAGCATGGATCCAACCATCTC-3' (SEQ.ID.NO.:59; sense, containing initiation codon) 5'-CTGTCTGACAGGGCAGAGGCTCTC-3' (SEQ.ID.NO.:60; antisense, 3' of stop codon) and human genomic DNA (Promega) as template. Advantage cDNA polymerase mix 25 (Clontech) was used for the amplification in a 100ul reaction with 5% DMSO by the 31 WO 01/36471 PCT/USOO/31509 following cycle with step 2 to 4 repeated 30 times: 94*C for 1 min; 94*C for 15 see; 67*C for 20 see; 72*C for 1 min and 30 see; and 72*C for 5 min. A 970bp PCR fragment was isolated from 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye 5 Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:19 for nucleic acid sequence and SEQ.ID.NO.:20 for deduced amino acid sequence. k. hRUP18 (Seq. Id. Nos. 21 & 22) The disclosed human RUP18 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession 10 Number AC008547 was identified as a human genomic sequence from chromosome 5. The full length RUP18 was cloned by PCR using primers: 5'-GGAACTCGTATAGACCCAGCGTCGCTCC-3' (SEQ.ID.NO.:61; sense, 5' of the initiation codon), 5'-GGAGGTTGCGCCTTAGCGACAGATGACC-3' (SEQ.ID.NO.:62; antisense, 3' of stop 15 codon) and human genomic DNA (Promega) as template. TaqPlus precision DNA polymerase (Stratagene) was used for the amplification in a 100ul reaction with 5% DMSO by the following cycle with step 2 to 4 repeated 35 times: 95*C for 5 min; 95*C for 30 sec; 65'C for 30 sec; 72*C for 2 min; and 72*C for 5 min. 20 A 1.3kb PCR fragment was isolated from 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:21 for nucleic acid sequence and SEQ.ID.NO.:22 for deduced amino acid sequence. 1. hRUP19 (Seq. Id. Nos. 23 & 24) 32 WO 01/36471 PCT/USOO/31509 The disclosed human RUP19 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession Number AC026331 was identified as a human genomic sequence from chromosome 12. The full length RUP19 was cloned by PCR using primers: 5 5'-CTGCACCCGGACACTTGCTCTG-3' (SEQ.ID.NO.:63; sense, 5' of initiation codon), 5'-GTCTGCTTGTTCAGTGCCACTCAAC-3' (SEQ.ID.NO.:64; antisense, containing the stop codon) and human genomic DNA (Promega) as template. TaqPlus Precision DNA polymerase (Stratagene) was used for the amplification with 5% DMSO by the 10 following cycle with step 2 to 4 repeated 35 times: 94*C for 1 min; 94*C for 15 sec; 70*C for 20 sec; 72*C for 1 min and 30 sec; and 72*C for 5 min. A 1.lkp PCR fragment was isolated from 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:23 for nucleic acid sequence and 15 SEQ.ID.NO.:24 for deduced amino acid sequence. m. hRUP20 (Seq. Id. Nos. 25 & 26) The disclosed human RUP20 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession Number AL161458 was identified as a human genomic sequence from chromosome 20 1. The full length RUP20 was cloned by PCR using primers: 5'-TATCTGCAATTCTATTCTAGCTCCTG-3' (SEQ.ID.NO.:65; sense, 5' of initiation codon), 5'-TGTCCCTAATAAAGTCACATGAATGC-3' (SEQ.ID.NO.:66; antisense, 3' of stop codon) and human genomic DNA (Promega) as template. Advantage cDNA polymerase mix (Clonetech) was used for the amplification with 5% DMSO by the following cycle with 33 WO 01/36471 PCT/USOO/31509 step 2 to 4 repeated 35 times: 94*C for 1 min; 94*C for 15 sec; 60 0 C for 20 sec; 72*C for 1 min and 30 sec; and 72*C for 5 min. A 1.0 kp PCR fragment was isolated from 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye 5 Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:25 for nucleic acid sequence and SEQ.ID.NO.:26 for deduced amino acid sequence. n. hRUP21 (Seq. Id. Nos. 27 & 28) The disclosed human RUP21 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession 10 Number AC026756 was identified as a human genomic sequence from chromosome 13. The full length RUP21 was cloned by PCR using primers: 5'- GGAGACAACCATGAATGAGCCAC -3' (SEQ.ID.NO.:67; sense) 5'- TA1TTCAAGGGTTGTITGAGTAAC -3' (SEQ.ID.NO.:68; antisense) and human genomic DNA (Promega) as template. Taq Plus Precision polymerase 15 (Stratagene) was used for the amplification in a 100ul reaction with 5% DMSO by the following cycle with step 2 to 4 repeated 30 times: 94*C for 1 min; 94*C for 15 sec; 55"C for 20 sec; 72*C for 1 min and 30 sec; and 72*C for 5 min. A 1,014 bp PCR fragment was isolated from 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye 20 Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:27 for nucleic acid sequence and SEQ.ID.NO.:28 for deduced amino acid sequence. o. hRUP22 (Seq. Id. Nos. 29 & 30) The disclosed human RUP22 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession 34 WO 01/36471 PCT/USOO/31509 Number AC027026 was identified as a human genomic sequence from chromosome 11. The full length RUP22 was cloned by PCR using primers: 5'- GGCACCAGTGGAGGTITCTGAGCATG -3' (SEQ.ID.NO.:69; sense, containing initiation codon) 5 5'-CTGATGGAAGTAGAGGCTGTCCATCTC-3' (SEQ.ID.NO.:70; antisense, 3' of stop codon) and human genomic DNA (Promega) as template. TaqPlus Precision DNA polymerase (Stratagene) was used for the amplification in a 100ul reaction with 5% DMSO by the following cycle with step 2 to 4 repeated 30 times: 94'C, 1 minutes 94'C, 15 seconds 10 55"C, 20 seconds 72 0 C, 1.5 minute 72 0 C, 5 minutes. A 970bp PCR fragment was isolated from 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:29 for nucleic acid sequence and SEQ.ID.NO.:30 for deduced amino acid sequence. 15 p. hRUP23 (Seq. Id. Nos. 31 & 32) The disclosed human RUP23 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession Number AC007104 was identified as a human genomic sequence from chromosome 4. The full length RUP23 was cloned by PCR using primers: 20 5'-CCTGGCGAGCCGCTAGCGCCATG-3' (SEQ.ID.NO.:71; sense, ATG as the initiation codon), 5'-ATGAGCCCTGCCAGGCCCTCAGT-3' (SEQ.ID.NO.:72; antisense, TCA as the stop codon) and human placenta Marathon-Ready cDNA (Clontech) as template. Advantage cDNA 25 polymerase (Clontech) was used for the amplification in a 50ul reaction by the following 35 WO 01/36471 PCT/USOO/31509 cycle with step 2 to 4 repeated 35 times: 95*C for 30 sec; 95'C for 15 see; 66*C for 20 sec; 72*C for 1 min and 20 see; and 72*C for 5 min. A 1.0 kb PCR fragment was isolated and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Terminator Kit (P.E. 5 Biosystem). See, SEQ.ID.NO.:31 for nucleic acid sequence and SEQ.ID.NO.:32 for deduced amino acid sequence. q. hRUP24 (Seq. Id. Nos. 33 & 34) The disclosed human RUP25 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession 10 Number AC026331 was identified as a human genomic sequence from chromosome 12. The full length RUP25 was cloned by PCR using primers: 5'-GCTGGAGCATTCACTAGGCGAG-3' (SEQ.ID.NO.:73; sense, 5'of initiation codon), 5'-AGATCCTGGTITCTTGGTGACAATG-3' (SEQ.ID.NO.:74; antisense, 3' of stop codon) and human genomic DNA (Promega) as template. Advantage cDNA polymerase mix 15 (Clontech) was used for the amplification with 5% DMSO by the following cycle with step 2 to 4 repeated 35 times: 94 0 C for 1 minute; 94"C for 15 seconds; 56*C for 20 seconds 72 0 C for 1 minute 30 seconds and 72"C for 5 minutes. A 1.2kb PCR fragment was isolated from 1% agarose gel and cloned into the pCRI-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye 20 Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:33 for nucleic acid sequence and SEQ.ID.NO.:34 for deduced amino acid sequence. r. hRUP25 (Seq. Id. Nos. 35 & 36) The disclosed human RUP25 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession 36 WO 01/36471 PCT/USOO/31509 Number AC026331 was identified as a human genomic sequence from chromosome 12. The full length RUP25 was cloned by PCR using primers: 5'-GCTGGAGCATT'CACTAGGCGAG-3' (SEQ.ID.NO.:75; sense, 5'of initiation codon), 5'-AGATCCTGGTTCTTGGTGACAATG-3' (SEQ.ID.NO.:76; antisense, 3' of stop codon) 5 and human genomic DNA (Promega) as template. Advantage cDNA polymerase mix (Clontech) was used for the amplification with 5% DMSO by the following cycle with step 2 to 4 repeated 35 times: 94 0 C for 1 minute; 94'C for 15 seconds; 56*C for 20 seconds 72 0 C for 1 minute 30 seconds and 72 0 C for 5 minutes. A 1.2kb PCR fragment was isolated from 1% agarose gel and cloned into the 10 pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:35 for nucleic acid sequence and SEQ.ID.NO.:36 for deduced amino acid sequence. s. hRUP26 (Seq. Id. Nos. 37 & 38) The disclosed human RUP26 was identified based upon the use of GeneBank 15 database information. While searching the database, a cDNA clone with Accession Number AC023040 was identified as a human genomic sequence from chromosome 2. The full length RUP26 was cloned by RT-PCR using RUP26 specific primers: 5'-AGCCATCCCTGCCAGGAAGCATGG-3' (SEQ.ID.NO.:77; sense, containing initiation codon) 20 5'-CCAGACTGTGGACTCAAGAACTCTAGG-3' (SEQ.ID.NO.:78; antisense, containing stop codon) and human pancreas Marathon - Ready cDNA (Clontech) as template. Advantage cDNA polymerase mix (Clontech) was used for the amplification in a 100pl reaction with 5% DMSO by the following cycle with step 2 to 4 repeated 35 times: 94'C for 5 minute; 25 95'C for 30 seconds; 65*C for 30 seconds 72'C for 2 minute and 72"C for 5 minutes. 37 WO 01/36471 PCT/USOO/31509 A 1.1kb PCR fragment was isolated from 1% agarose gel and cloned into the pCRII-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:37 for nucleic acid sequence and SEQ.ID.NO.:38 for deduced amino acid sequence. 5 t. hRUP27 (Seq. Id. Nos. 39 & 40) The disclosed human RUP27 was identified based upon the use of GeneBank database information. While searching the database, a cDNA clone with Accession Number AC027643 was identified as a human genomic sequence from chromosome 12. The full length RUP27 was cloned by PCR using RUP27 specific primers: 10 5'-AGTCCACGAACAATGAATCCATITCATG-3' (SEQ.ID.NO.:79; sense, containing initiation codon), 5'-ATCATGTCTAGACTCATGGTGATCC-3' (SEQ.ID.NO.:80; antisense, 3' of stop codon) and the human adult brain Marathon-Ready cDNA (Clontech) as template. Advantage cDNA polymerase mix (Clontech) was used for the amplification in a 50pl reaction with 5% 15 DMSO by the following cycle with step 2 to 4 repeated 35 times: 94'C for 1 minute; 94'C for 10 seconds; 58*C for 20 seconds 72'C for 1 minute 30 seconds and 72'C for 5 minutes. A 1.1kb PCR fragment was isolated from 1% agarose gel and cloned into the pCRI-TOPO vector (Invitrogen) and completely sequenced using the ABI Big Dye 20 Termiantor Kit (P.E. Biosystem). See, SEQ.ID.NO.:35 for nucleic acid sequence and SEQ.ID.NO.:36 for deduced amino acid sequence. The sequence of RUP27 cDNA clone isolated from human brain was determined to match with five unordered segments of AC027643, indicating that the RUP27 cDNA is composed of 5 exons. 38 WO 01/36471 PCT/USOO/31509 Example 2 PREPARATION OF NON-ENDOGENOUS, CONSTITUTIVELY ACTIVATED GPCRS Those skilled in the art are credited with the ability to select techniques for mutation of a nucleic acid sequence. Presented below are approaches utilized to 5 create non-endogenous versions of several of the human GPCRs disclosed above. The mutations disclosed below are based upon an algorithmic approach whereby the 16th amino acid (located in the IC3 region of the GPCR) from a conserved proline (or an endogenous, conservative substitution therefore) residue (located in the TM6 region of the GPCR, near the TM6/IC3 interface) is mutated, preferably to an alanine, 10 histidine, arginine or lysine amino acid residue, most preferably to a lysine amino acid residue. 1. Transformer Site-Directed TM Mutagenesis Preparation of non-endogenous human GPCRs may be accomplished on human GPCRs using Transformer Site-DirectedTM Mutagenesis Kit (Clontech) according to the 15 manufacturer instructions. Two mutagenesis primers are utilized, most preferably a lysine mutagenesis oligonucleotide that creates the lysine mutation, and a selection marker oligonucleotide. For convenience, the codon mutation to be incorporated into the human GPCR is also noted, in standard form (Table D): 20 TABLE D Receptor Identifier Codon Mutation hRUP8 V274K hRUP9 T249K hRUP10 R232K hRUP11 M294K hRUP12 F220K hRUP16 A238K 39 WO 01/36471 PCT/USOO/31509 hRUP17 Y215K hRUP18 L294K hRUP19 T219K hRUP20 K248A K248H K248R hRUP21 R240K hRIUP22 Y222K hRUP24 A245K hRUP25 1230K hRUP26 V285K hRUP27 T248K 2. QuikChange T M Site-DirectedTM Mutagenesis Preparation of non-endogenous human GPCRs can also be accomplished by 5 using QuikChangeTM SiteDirectedTM Mutagenesis Kit (Stratagene, according to manufacturer's instructions). Endogenous GPCR is preferably used as a template and two mutagenesis primers utilized, as well as, most preferably, a lysine mutagenesis oligonucleotide and a selection marker oligonucleotide (included in kit). For convenience, the codon mutation incorporated into the novel human GPCR and the 10 respective oligonucleotides are noted, in standard form (Table E): TABLE E Receptor Codon 5'-3' orientation (sense), 5'-3' orientation Cycle Conditions Identifier Mutation (SEQ.ID.NO.) mutation (antisense) (SEQ.ID.NO.) Min ('), Sec (") underlined Cycles 2-4 repeated 16 times hRUP13 A268K GGGGAGGGAAAGCAA CCAGGAGAACCACCT 980 for 2' AGGTGGTCCTCCTGG TTGCTTTCCCTCCCC 98* for 30" (81) (82) 56 0 C for 30" 72* for 11' 40" 72" for 5' hRUP14 L246K CAGGAAGGCAAAGAC GATGATGATGGTGGT 980 for 2' CACCATCATCATC (85) _C'TTGCCTTCCTG (86) 980 for 30" 55 0 C for 30" 720 for 11' 40" 720 for 5' 40 WO 01/36471 PCT/USOO/31509 hRUP15 A398K CCAGTGCAAAGCTAAG GAAGATCACTCTTA 980 for 2' AAAGTGATCTTC (89) GCTITGCACTGG (90) 980 for 30" 55 0 C for 30" 720 for 11' 40" 72* for 5' hRUP23 W275K GCCGCCACCGCGCCAA GCCAATCTTCCTCTTG 980 for 2' GAGGAAGATTGGC (93) GCGCGGTGGCGGC 980 for 30" (94) 56*C for 30" 720 for 1l' 40" 72* for 5' The non-endogenous human GPCRs were then sequenced and the derived and verified nucleic acid and amino acid sequences are listed in the accompanying 5 "Sequence Listing" appendix to this patent document, as summarized in Table F below: TABLE F Non Endogenous Human Nucleic Acid Sequence Listing Amino Acid Sequence GPCR Listing hRUP13 SEQ.ID.NO.:83 SEQ.ID.NO.:84 hRUP14 SEQ.ID.NO.:87 SEQ.ID.NO.:88 hRUP15 SEQ.ID.NO.:91 SEQ.ID.NO.:92 hRUP23 SEQ.ID.NO.:95 SEQ.ID.NO.:96 Example 3 10 RECEPTOR EXPRESSION Although a variety of cells are available to the art for the expression of proteins, it is most preferred that mammalian cells be utilized. The primary reason for this is predicated upon practicalities, i.e., utilization of, e.g., yeast cells for the 15 expression of a GPCR, while possible, introduces into the protocol a non-mammalian cell which may not (indeed, in the case of yeast, does not) include the receptor coupling, genetic-mechanism and secretary pathways that have evolved for mammalian systems - thus, results obtained in non-mammalian cells, while of 41 WO 01/36471 PCT/USOO/31509 potential use, are not as preferred as that obtained from mammalian cells. Of the mammalian cells, COS-7, 293 and 293T cells are particularly preferred, although the specific mammalian cell utilized can be predicated upon the particular needs of the artisan. 5 a. Transient Transfection On day one, 6x10 6 / 10 cm dish of 293 cells well were plated out. On day two, two reaction tubes were prepared (the proportions to follow for each tube are per plate): tube A was prepared by mixing 4ptg DNA (e.g., pCMV vector; pCMV vector with receptor cDNA, etc.) in 0.5 ml serum free DMEM (Gibco BRL); tube B was prepared by 10 mixing 24ptl lipofectamine (Gibco BRL) in 0.5ml serum free DMEM. Tubes A and B were admixed by inversions (several times), followed by incubation at room temperature for 30-45min. The admixture is referred to as the "transfection mixture". Plated 293 cells were washed with 1XPBS, followed by addition of 5 ml serum free DMEM. 1 ml of the transfection mixture were added to the cells, followed by incubation for 4hrs at 15 37*C/5% CO 2 . The transfection mixture was removed by aspiration, followed by the addition of 10ml of DMEM/10% Fetal Bovine Serum. Cells were incubated at 37*C/5%

CO

2 . After 48hr incubation, cells were harvested and utilized for analysis. b. Stable Cell Lines: Gs Fusion Protein Approximately 12x10 6 293 cells are plated on a 15cm tissue culture plate. 20 Grown in DME High Glucose Medium containing ten percent fetal bovine serum and one percent sodium pyruvate, L-glutamine, and anti-biotics. Twenty-four hours following plating of 293 cells to ~80% confluency, the cells are transfected using 12pig of DNA. The 12ptg of DNA is combined with 60ul of lipofectamine and 2mL of DME High Glucose Medium without serum. The medium is aspirated from the plates and the 25 cells are washed once with medium without serum. The DNA, lipofectamine, and 42 WO 01/36471 PCT/USOO/31509 medium mixture is added to the plate along with lOmL of medium without serum. Following incubation at 37 degrees Celsius for four to five hours, the medium is aspirated and 25ml of medium containing serum is added. Twenty-four hours following transfection, the medium is aspirated again, and fresh medium with serum is added. 5 Forty-eight hours following transfection, the medium is aspirated and medium with serum is added containing geneticin (G418 drug) at a final concentration of 500ptg/mL. The transfected cells now undergo selection for positively transfected cells containing the G418 resistant gene. The medium is replaced every four to five days as selection occurs. During selection, cells are grown to create stable pools, or split for stable clonal 10 selection. Example 4 ASSAYS FOR DETERMINATION OF CONSTITUTIVE ACTIVITY OF NON-ENDOGENOUS GPCRS 15 A variety of approaches are available for assessment of constitutive activity of the non-endogenous human GPCRs. The following are illustrative; those of ordinary skill in the art are credited with the ability to determine those techniques that are preferentially beneficial for the needs of the artisan. 1. Membrane Binding Assays: [ 35 S]GTPyS Assay 20 When a G protein-coupled receptor is in its active state, either as a result of ligand binding or constitutive activation, the receptor couples to a G protein and stimulates the release of GDP and subsequent binding of GTP to the G protein. The alpha subunit of the G protein-receptor complex acts as a GTPase and slowly hydrolyzes 25 the GTP to GDP, at which point the receptor normally is deactivated. Constitutively activated receptors continue to exchange GDP for GTP. The non-hydrolyzable GTP analog, [ 35 S]GTPyS, can be utilized to demonstrate enhanced binding of [ 35 S]GTPyS to membranes expressing constitutively activated receptors. The advantage of using 43 WO 01/36471 PCT/USOO/31509

[

35 S]GTPyS binding to measure constitutive activation is that: (a) it is generically applicable to all G protein-coupled receptors; (b) it is proximal at the membrane surface making it less likely to pick-up molecules which affect the intracellular cascade. The assay utilizes the ability of G protein coupled receptors to stimulate 5 ["S]GTPyS binding to membranes expressing the relevant receptors. The assay can, therefore, be used in the direct identification method to screen candidate compounds to known, orphan and constitutively activated G protein-coupled receptors. The assay is generic and has application to drug discovery at all G protein-coupled receptors. The [ 35 S]GTPyS assay was incubated in 20 mM HEPES and between 1 and 10 about 20mM MgCl 2 (this amount can be adjusted for optimization of results, although 20mM is preferred) pH 7.4, binding buffer with between about 0.3 and about 1.2 nM

[

35 S]GTPyS (this amount can be adjusted for optimization of results, although 1.2 is preferred) and 12.5 to 75 tg membrane protein (e.g, 293 cells expressing the Gs Fusion Protein; this amount can be adjusted for optimization) and 10 pM GDP (this amount can 15 be changed for optimization) for 1 hour. Wheatgerm agglutinin beads (25 pLl; Amersham) were then added and the mixture incubated for another 30 minutes at room temperature. The tubes were then centrifuged at 1500 x g for 5 minutes at room temperature and then counted in a scintillation counter. 2. Adenylyl Cyclase 20 A Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) designed for cell-based assays can be modified for use with crude plasma membranes. The Flash Plate wells can contain a scintillant coating which also contains a specific antibody recognizing cAMP. The cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP 44 WO 01/36471 PCT/USOO/31509 antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express the receptors. Transfected cells were harvested approximately twenty four hours after transient transfection. Media is carefully aspirated off and discarded. 10ml of PBS is gently 5 added to each dish of cells followed by careful aspiration. 1ml of Sigma cell dissociation buffer and 3ml of PBS are added to each plate. Cells were pipeted off the plate and the cell suspension was collected into a 50ml conical centrifuge tube. Cells were then centrifuged at room temperature at 1,100 rpm for 5 min. The cell pellet was carefully re-suspended into an appropriate volume of PBS (about 3ml/plate). The cells 10 were then counted using a hemocytometer and additional PBS was added to give the appropriate number of cells (with a final volume of about 50 pl/well). cAMP standards and Detection Buffer (comprising 1 gCi of tracer [125 cAMP (50 l] to 11 ml Detection Buffer) was prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer was prepared fresh for screening and 15 contained 50pl of Stimulation Buffer, 3ul of test compound (12uM final assay concentration) and 50pl cells, Assay Buffer was stored on ice until utilized. The assay was initiated by addition of 50pl of cAMP standards to appropriate wells followed by addition of 50ul of PBSA to wells H-1l and H12. 50pl of Stimulation Buffer was added to all wells. DMSO (or selected candidate compounds) was added to appropriate wells 20 using a pin tool capable of dispensing 3 pl of compound solution, with a final assay concentration of 12pM test compound and 100pl total assay volume. The cells were then added to the wells and incubated for 60 min at room temperature. 100pl of Detection Mix containing tracer cAMP was then added to the wells. Plates were then incubated additional 2 hours followed by counting in a Wallac MicroBeta scintillation 45 WO 01/36471 PCT/USOO/31509 counter. Values of cAMP/well were then extrapolated from a standard cAMP curve which was contained within each assay plate. 3. Cell-Based cAMP for Gi Coupled Target GPCRs 5 TSHR is a Gs coupled GPCR that causes the accumulation of cAMP upon activation. TSHR will be constitutively activated by mutating amino acid residue 623 (i.e., changing an alanine residue to an isoleucine residue). A Gi coupled receptor is expected to inhibit adenylyl cyclase, and, therefore, decrease the level of cAMP production, which can make assessment of cAMP levels challenging. An effective 10 technique for measuring the decrease in production of cAMP as an indication of constitutive activation of a Gi coupled receptor can be accomplished by co-transfecting, most preferably, non-endogenous, constitutively activated TSHR (TSHR-A6231) (or an endogenous, constitutively active Gs coupled receptor) as a "signal enhancer" with a Gi linked target GPCR to establish a baseline level of cAMP. Upon creating a non 15 endogenous version of the Gi coupled receptor, this non-endogenous version of the target GPCR is then co-transfected with the signal enhancer, and it is this material that can be used for screening. We will utilize such approach to effectively generate a signal when a cAMP assay is used; this approach is preferably used in the direct identification of candidate compounds against Gi coupled receptors. It is noted that for a Gi coupled 20 GPCR, when this approach is used, an inverse agonist of the target GPCR will increase the cAMP signal and an agonist will decrease the cAMP signal. On day one, 2X10 4 293 and 293 cells/well will be plated out. On day two, two reaction tubes will be prepared (the proportions to follow for each tube are per plate): tube A will be prepared by mixing 2ptg DNA of each receptor transfected into the 25 mammalian cells, for a total of 4ptg DNA (e.g., pCMV vector; pCMV vector with mutated THSR (TSHR-A6231); TSHR-A6231 and GPCR, etc.) in 1.2ml serum free 46 WO 01/36471 PCT/USOO/31509 DMEM (Irvine Scientific, Irvine, CA); tube B will be prepared by mixing 120pl lipofectamine (Gibco BRL) in 1.2ml serum free DMEM. Tubes A and B will then be admixed by inversions (several times), followed by incubation at room temperature for 30-45min. The admixture is referred to as the "transfection mixture". Plated 293 cells 5 will be washed with 1XPBS, followed by addition of 10ml serum free DMEM. 2.4ml of the transfection mixture will then be added to the cells, followed by incubation for 4hrs at 37*C/5% CO 2 . The transfection mixture will then be removed by aspiration, followed by the addition of 25ml of DMEM/10% Fetal Bovine Serum. Cells will then be incubated at 37*C/5% CO 2 . After 24hr incubation, cells will then be harvested and 10 utilized for analysis. A Flash Plate T M Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) is designed for cell-based assays, however, can be modified for use with crude plasma membranes depending on the need of the skilled artisan. The Flash Plate wells will contain a scintillant coating which also contains a specific antibody 15 recognizing cAMP. The cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express the receptors. Transfected cells will be harvested approximately twenty four hours after 20 transient transfection. Media will be carefully aspirated off and discarded. 10ml of PBS will be gently added to each dish of cells followed by careful aspiration. lml of Sigma cell dissociation buffer and 3ml of PBS will be added to each plate. Cells will be pipeted off the plate and the cell suspension will be collected into a 50ml conical centrifuge tube. Cells will then be centrifuged at room temperature at 1,100 rpm for 5 min. The cell 25 pellet will be carefully re-suspended into an appropriate volume of PBS (about 47 WO 01/36471 PCT/USOO/31509 3ml/plate). The cells will then be counted using a hemocytometer and additional PBS is added to give the appropriate number of cells (with a final volume of about 501/well). cAMP standards and Detection Buffer (comprising 1 pCi of tracer [125I cAMP 5 (50 1l] to 11 ml Detection Buffer) will be prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer should be prepared fresh for screening and contained 50l of Stimulation Buffer, 3ul of test compound (12uM final assay concentration) and 50pl cells, Assay Buffer can be stored on ice until utilized. The assay can be initiated by addition of 50pl of cAMP standards to appropriate wells followed by 10 addition of 50pl of PBSA to wells H-11 and H12. 50ul of Stimulation Buffer will be added to all wells. Selected compounds (e.g., TSH) will be added to appropriate wells using a pin tool capable of dispensing 3pl of compound solution, with a final assay concentration of 12gM test compound and 1 00pl total assay volume. The cells will then be added to the wells and incubated for 60 min at room temperature. 100gl of Detection 15 Mix containing tracer cAMP will then be added to the wells. Plates were then incubated additional 2 hours followed by counting in a Wallac MicroBeta scintillation counter. Values of cAMP/well will then be extrapolated from a standard cAMP curve which is contained within each assay plate. 4. Reporter-Based Assays 20 a. CRE-Luc Reporter Assay (Gs-associated receptors) 293 and 293T cells are plated-out on 96 well plates at a density of 2 x 104 cells per well and were transfected using Lipofectamine Reagent (BRL) the following day according to manufacturer instructions. A DNA/lipid mixture is prepared for each 6 well transfection as follows: 260ng of plasmid DNA in 100pl of DMEM were gently 25 mixed with 2 pl of lipid in 1 00gl of DMEM (the 260ng of plasmid DNA consisted of 48 WO 01/36471 PCT/USOO/31509 200ng of a 8xCRE-Luc reporter plasmid, 50ng of pCMV comprising endogenous receptor or non-endogenous receptor or pCMV alone, and 1 Ong of a GPRS expression plasmid (GPRS in pcDNA3 (Invitrogen)). The 8XCRE-Luc reporter plasmid was prepared as follows: vector SRIF-p-gal was obtained by cloning the rat somatostatin 5 promoter (-71/+51) at BglV-HindIII site in the ppgal-Basic Vector (Clontech). Eight (8) copies of cAMP response element were obtained by PCR from an adenovirus template AdpCF126CCRE8 (see, 7 Human Gene Therapy 1883 (1996)) and cloned into the SRIF-p-gal vector at the Kpn-BglV site, resulting in the 8xCRE-p-gal reporter vector. The 8xCRE-Luc reporter plasmid was generated by replacing the 10 beta-galactosidase gene in the 8xCRE-p-gal reporter vector with the luciferase gene obtained from the pGL3-basic vector (Promega) at the HindIll-BamHI site. Following 30 min. incubation at room temperature, the DNA/lipid mixture was diluted with 400 pl of DMEM and 100pl of the diluted mixture was added to each well. 100 j1 of DMEM with 10% FCS were added to each well after a 4hr incubation 15 in a cell culture incubator. The following day the transfected cells were changed with 200 pl/well of DMEM with 10% FCS. Eight (8) hours later, the wells were changed to 100 1 /well of DMEM without phenol red, after one wash with PBS. Luciferase activity were measured the next day using the LucLiteTM reporter gene assay kit (Packard) following manufacturer instructions and read on a 1450 MicroBetaTM 20 scintillation and luminescence counter (Wallac). b. AP1 reporter assay (Gq-associated receptors) A method to detect Gq stimulation depends on the known property of Gq dependent phospholipase C to cause the activation of genes containing AP1 elements 25 in their promoter. A PathdetectTM AP-1 cis-Reporting System (Stratagene, Catalogue # 219073) can be utilized following the protocol set forth above with respect to the 49 WO 01/36471 PCT/USOO/31509 CREB reporter assay, except that the components of the calcium phosphate precipitate were 410 ng pAP1-Luc, 80 ng pCMV-receptor expression plasmid, and 20 ng CMV SEAP. c. SRF-Luc Reporter Assay (Gq- associated receptors) 5 One method to detect Gq stimulation depends on the known property of Gq dependent phospholipase C to cause the activation of genes containing serum response factors in their promoter. A PathdetectTM SRF-Luc-Reporting System (Stratagene) can be utilized to assay for Gq coupled activity in, e.g., COS7 cells. Cells are transfected with the plasmid components of the system and the indicated 10 expression plasmid encoding endogenous or non-endogenous GPCR using a Mammalian TransfectionTM Kit (Stratagene, Catalogue #200285) according to the manufacturer's instructions. Briefly, 410 ng SRF-Luc, 80 ng pCMV-receptor expression plasmid and 20 ng CMV-SEAP (secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to 15 control for variations in transfection efficiency between samples) are combined in a calcium phosphate precipitate as per the manufacturer's instructions. Half of the precipitate is equally distributed over 3 wells in a 96-well plate, kept on the cells in a serum free media for 24 hours. The last 5 hours the cells are incubated with 1 IM Angiotensin, where indicated. Cells are then lysed and assayed for luciferase activity 20 using a Luclite T M Kit (Packard, Cat. # 6016911) and "Trilux 1450 Microbeta" liquid scintillation and luminescence counter (Wallac) as per the manufacturer's instructions. The data can be analyzed using GraphPad PrismTM 2.Oa (GraphPad Software Inc.). 25 50 WO 01/36471 PCT/USOO/31509 d. Intracellular IP 3 Accumulation Assay (Gq-associated receptors) On day 1, cells comprising the receptors endogenouss and/or non-endogenous) 5 can be plated onto 24 well plates, usually 1x105 cells/well (although his umber can be optimized. On day 2 cells can be transfected by firstly mixing 0.25tg DNA in 50 pl serum free DMEM/well and 2 pl lipofectamine in 50 p1 serumfree DMEM/well. The solutions are gently mixed and incubated for 15-30 min at room temperature. Cells are washed with 0.5 ml PBS and 400 pl of serum free media is mixed with the transfection 10 media and added to the cells. The cells are then incubated for 3-4 hrs at 37*C/5%CO2 and then the transfection media is removed and replaced with 1ml/well of regular growth media. On day 3 the cells are labeled with 3 H-myo-inositol. Briefly, the media is removed and the cells are washed with 0.5 ml PBS. Then 0.5 ml inositol-free/serum free media (GIBCO BRL) is added/well with 0.25 pCi of 3 H-myo-inositol/ well and the cells 15 are incubated for 16-18 hrs o/n at 37*C/5%CO 2 .On Day 4 the cells are washed with 0.5 ml PBS and 0.45 ml of assay medium is added containing inositol-free/serum free media 10 pM pargyline 10 mM lithium chloride or 0.4 ml of assay medium and 50RI of lOx ketanserin (ket) to final concentration of 1ORM. The cells are then incubated for 30 min at 37*C. The cells are then washed with 0.5 ml PBSand 200pl of fresh/icecold stop 20 solution (IM KOH; 18 mM Na-borate; 3.8 mM EDTA) is added/well. The solution is kept on ice for 5-10 min or until cells were lysed and then neutralized by 200 g1 of fresh/ice cold neutralization sol. (7.5 % HCL). The lysate is then transferred into 1.5 ml eppendorf tubes and 1 ml of chloroform/methanol (1:2) is added/tube. The solution is vortexed for 15 sec and the upper phase is applied to a Biorad AG1-X8TM anion 25 exchange resin (100-200 mesh). Firstly, the resin is washed with water at 1:1.25 W/V and 0.9 ml of upper phase is loaded onto the column. The column is washed with 10 mls of 5 mM myo-inositol and 10 ml of 5 mM Na-borate/60mM Na-formate. The inositol 51 WO 01/36471 PCT/USOO/31509 tris phosphates are eluted into scintillation vials containing 10 ml of scintillation cocktail with 2 ml of 0.1 M formic acid/ 1 M ammonium formate. The columns are regenerated by washing with 10 ml of 0.1 M formic acid/3M ammonium formate and rinsed twice with dd H 2 0 and stored at 4'C in water. 5 Exemplary results are presented below in Table G: TABLE G Receptor Mutation Assay Signal Signal Signal Difference Utilized Generated: Generated: Generated: (<C() Figure No.) CMV Endogenous Non- Between Version Endogenous . CMV v. (Relative Light Version Wild-type Units) (Relative . Wild-type Light Units) v. Mutant hRUP12 N/A IP 3 317.03 3463.29 - (Figure 1) cpm/mg protein cpm/mg protein 1. 11 Fold hRUP13 N/A cAMP 8.06 19.10 - (Figure 2) pmol/cAMP/mg pmol/cAMP/mg 1. 2.4 Fold < protein protein A268K 8XCRE- 3665.43 83280.17 61713.6 1. 23 Fold LUC LCPS LPCS LCPS < (Figure 3) 2. 26%( hRUP14 L246K 8XCRE- 86.07 1962.87 789.73 1. 23 Fold e LUC LCPS LCPS LCPS (Figure 5) 2. 60%( hRUP15 A398K 8XCRE- 86.07 18286.77 17034.83 1. 212 Fold LUC LCPS LCPS LCPS (Figure 6) 2. 1%( A398K cAMP 15.00 164.4 117.5 1. 11 Fold (Figure 7) pmol/cAMP/mg pmol/cAMP/mg pmol/cAMP/ < protein protein mg protein 2. 29%( hRUP17 N/A IP 3 317.03 741.07 -- 1. 2.3 Fold (Figure 9) cpm/mg protein cpm/mg protein I hRUP21 N/A IP 3 730.5 1421.9 - 1. 2 Fold c (Figure 10) cpm/mg protein cpm/mg protein hRUP23 W275K 8XCRE- 311.73 13756.00 9756.87 1. 44 Fold < LUC pmol/cAMP/mg pmol/cAMP/mg pmol/cAMP/ (Figure 11) protein protein mg protein 2. 30% ( N/A = not applied 52 WO 01/36471 PCT/USOO/31509 Exemplary results of GTPyS assay for detecting constitutive activation, as disclosed in Example 4(1) above, was accomplished utilizing Gs:Fusion Protein Constructs on human RUP13 and RUP15. Table H below lists the signals generated from this assay and the difference in signals as indicated: 5 TABLE H Receptor: Assay Signal Signal Signal Signal Difference Gs Fusion Utilized Generated: Generated: Generated: Generated: Between: Protein CMV Fusion CMV+ Fusion 1. CMV v. Fusion (cpm bound Protein 10pMGDP Protein + Protein GTP) (cpm bound (cpm bound 10pM GDP 2. CMV+GDP GTP) GTP) (cpm bound vs. GTP) Fusion+GDP 3. Fusion vs. Fusion+GDP (cpm bound GTP) hRUP13-Gs GTPyS 32494.0 49351.30 11148.30 28834.67 1. 1.5 Fold < (Figure 4) 2. 2.6 Fold < 3. 42%( hRUP15-Gs GTPyS 30131.67 32493.67 7697.00 14157.33 1. 1.1 Fold < (Figure 8) 2. 1.8 Fold < 3. 56%( Example 5 FUSION PROTEIN PREPARATION 10 a. GPCR:Gs Fusion Constuct The design of the constitutively activated GPCR-G protein fusion construct was accomplished as follows: both the 5' and 3' ends of the rat G protein Gsax (long form; Itoh, H. et al., 83 PNAS 3776 (1986)) were engineered to include a HindIl (5' 15 AAGCTT-3') sequence thereon. Following confirmation of the correct sequence (including the flanking HindI sequences), the entire sequence was shuttled into pcDNA3.1(-) (Invitrogen, cat. no. V795-20) by subcloning using the HindIII restriction site of that vector. The correct orientation for the Gsca sequence was determined after 53 WO 01/36471 PCT/USOO/31509 subcloning into pcDNA3.1(-). The modified pcDNA3.1(-) containing the rat Gsa gene at HindIII sequence was then verified; this vector was now available as a "universal" Gsa protein vector. The pcDNA3.1(-) vector contains a variety of well-known restriction sites upstream of the HindII site, thus beneficially providing the ability to 5 insert, upstream of the Gs protein, the coding sequence of an endogenous, constitutively active GPCR. This same approach can be utilized to create other "universal" G protein vectors, and, of course, other commercially available or proprietary vectors known to the artisan can be utilized - the important criteria is that the sequence for the GPCR be upstream and in-frame with that of the G protein. 10 RUP13 couples via Gs. For the following exemplary GPCR Fusion Proteins, fusion to Gsa was accomplished. A RUP13-Gsa Fusion Protein construct was made as follows: primers were designed as follows: 5'-gatc[TCTAGAAT]GGAGTCCTCACCCATCCCCCAG -3' (SEQ.ID.NO.:97; sense) 15 5'-gatc[GATATC]CGTGACTCCAGCCGGGGTGAGGCGGC-3' (SEQ.ID.NO.:98; antisense). Nucleotides in lower caps are included as spacers in the restriction sites (designated in brackets) between the G protein and RUP13. The sense and anti-sense primers included the restriction sites for XbaI and EcoRV, respectively, such that spacers (attributed to the restriction sites) exists between the G protein and RUP 15. 20 PCR was then utilized to secure the respective receptor sequences for fusion within the Gsa universal vector disclosed above, using the following protocol for each: 100ng cDNA for RUP15 was added to separate tubes containing 2pl of each primer (sense and anti-sense), 3pL of 10mM dNTPs, 10IL of 1OXTaqPlus T M Precision buffer, l L of TaqPlusT M Precision polymerase (Stratagene: #600211), and 80pL of water. 25 Reaction temperatures and cycle times for RUP15 were as follows with cycle steps 2 54 WO 01/36471 PCT/USOO/31509 through 4 were repeated 35 times: 94*C for 1 min; 94*C for 30 seconds; 62*C for 20 sec; 72'C 1 min 40sec; and 720 C 5 min. PCR product for was run on a 1% agarose gel and then purified (data not shown). The purified product was digested with XbaI and EcoRV and the desired inserts purified and ligated into the Gs universal vector at the 5 respective restriction site. The positive clones was isolated following transformation and determined by restriction enzyme digest; expression using 293 cells was accomplished following the protocol set forth infra. Each positive clone for RUP15-Gs Fusion Protein was sequenced to verify correctness. (See, SEQ.ID.NO.:99 for nucleic acid sequence and SEQ.ID.NO.: 100 for amino acid sequence). 10 RUP15 couples via Gs. For the following exemplary GPCR Fusion Proteins, fusion to Gso was accomplished. A RUP15-Gsa Fusion Protein construct was made as follows: primers were designed as follows: 5'-TCTAGAATGACGTCCACCTGCACCAACAGC-3' (SEQ.ID.NO.:101; sense) 15 5'-gatatcGCAGGAAAAGTAGCAGAATCGTAGGAAG-3' (SEQ.ID.NO.:102; antisense). Nucleotides in lower caps are included as spacers in the restriction sites between the G protein and RUP15. The sense and anti-sense primers included the restriction sites for EcoRV and Xbal, respectively, such that spacers (attributed to the restriction sites) exists between the G protein and RUP15. 20 PCR was then utilized to secure the respective receptor sequences for fusion within the Gsca universal vector disclosed above, using the following protocol for each: 100ng cDNA for RUP15 was added to separate tubes containing 2pl of each primer (sense and anti-sense), 3ptL of 10mM dNTPs, 10pL of 1OXTaqPlusTM Precision buffer, luL of TaqPlus T M Precision polymerase (Stratagene: #600211), and 80pL of water. 25 Reaction temperatures and cycle times for RUP15 were as follows with cycle steps 2 55 WO 01/36471 PCT/USOO/31509 through 4 were repeated 35 times: 94*C for 1 min; 94*C for 30 seconds; 62*C for 20 sec; 72*C 1 min 40sec; and 720 C 5 min. PCR product for was run on a 1% agarose gel and then purified (data not shown). The purified product was digested ). The purified product was digested with EcoRV and Xbal and the desired inserts purified and 5 ligated into the Gs universal vector at the respective restriction site. The positive clones was isolated following transformation and determined by restriction enzyme digest; expression using 293 cells was accomplished following the protocol set forth infra. Each positive clone for RUP15-Gs Fusion Protein was sequenced to verify correctness. (See, SEQ.ID.NO.:103 for nucleic acid sequence and SEQ.ID.NO.:104 for amino acid 10 sequence). b. Gq(6 amino acid deletion)/Gi Fusion Construct The design of a Gq (del)/Gi fusion construct can be accomplished as follows: the N-terminal six (6) amino acids (amino acids 2 through 7, having the sequence of TLESIM (SEQ.ID.NO.: 129) Gaq-subunit will be deleted and the C-terminal five (5) 15 amino acids, having the sequence EYNLV (SEQ.ID.NO.: 130) will be replace with the corresponding amino acids of the Gcd Protein, having the sequence DCGLF (SEQ.ID.NO.: 131). This fusion construct will be obtained by PCR using the following pnmers: 5'-gatcaagcttcCATGGCGTGCTGCCTGAGCGAGGAG-3' (SEQ.ID.NO.:132) and 20 5'-gatcggatecTTAGAACAGGCCGCAGTCCTTCAGGTI'CAGCTGCAGGATGGTG-3' (SEQ.ID.NO.: 133) and Plasmid 63313 which contains the mouse Gaxq-wild type version with a 25 hemagglutinin tag as template. Nucleotides in lower caps are included as spacers. TaqPlus Precision DNA polymerase (Stratagene) will be utilized for the amplification by the following cycles, with steps 2 through 4 repeated 35 times: 95'C 56 WO 01/36471 PCT/USOO/31509 for 2 min; 95*C for 20 sec; 56'C for 20 sec; 72*C for 2 min; and 72*C for 7 min. The PCR product will be cloned into a pCRII-TOPO vector (Invitrogen) and sequenced using the ABI Big Dye Terminator kit (P.E. Biosystem). Inserts from a TOPO clone containing the sequence of the fusion construct will be shuttled into the expression 5 vector pcDNA3.1(+) at the HindIII/BamHI site by a 2 step cloning process. Example 6 TISSUE DISTRIBUTION OF THE DISCLOSED HUMAN GPCRs: RT-PCR RT-PCR was applied to confirm the expression and to determine the tissue 10 distribution of several novel human GPCRs. Oligonucleotides utilized were GPCR specific and the human multiple tissue cDNA panels (MTC, Clontech) as templates. Taq DNA polymerase (Stratagene) were utilized for the amplification in a 40g1 reaction according to the manufacturer's instructions. 2 011 of the reaction will be loaded on a 1.5% agarose gel to analyze the RT-PCR products. Table J below lists the 15 receptors, the cycle conditions and the primers utizilized. TABLE J Receptor Cycle 5' Primer 3' Primer DNA Fragment Tissue Identifier Conditions (SEQ.ID.NO.) (SEQ.LD.NO.) Expression Min ('), Sec (") Cycles 2-4 repeated 30 times hRUP10 940 for 30" CATGTATGC GCTATGCCTG 730bp Kidney, 940 for 10" CAGCGTCCT AAGCCAGTC leukocyte, liver, 62 0 C for 20" GCTCC (105) TTGTG (106) placenta and 720 for l' spleen 720 for 7' *cycles 2-4 repeated 35 times hRUP11 940 for 2' GCACCTGCT CACAGCGCT 630bp Liver, kidney, 940 for 15" CCTGAGCAC GCAGCCCTG pancreas, colon, 67 0 C for 15" CTTCTCC CAGCTGGC small intestinal, 72* for 45" (107) (108) spleen and 720 for 5' prostate 57 WO 01/36471 PCT/USOO/31509 hRUP12 940 for 2' CCAGTGATG CAGACACTr 490bp Brain, colon, 94* for 15" ACTCTGTCC GGCAGGGAC heart, kidney, 66*C for 15" AGCCTG (109) GAGGTG (110) leukocyte, 720 for 45" pancreas, 72* for 5' prostate, small intestinal, spleen, testis, and thymus 58 WO 01/36471 PCT/USOO/31509 hRUP13 940 for 1' CTTGTGGTCT CATATCCCTC 700bp Placenta and 940 for 15" ACTGCAGCA CGAGTGTCC lung 68*C for 20" TGTTCCG AGCGGC (112) 72*for1'45" (111) 72* for 5' hRUP14 940 for l' ATGGATCCT CAAGAACAG 700bp Not yet 940 for 15" TATCATGGC GTCTCATCTA determined 68 0 C for 20" TTJCCTC (113) AGAGCTCC 720 for 1'45" (114) 720 for 5' hRUP16 940 for 30" CTCTGATGC GTAGTCCACT 370bp Fetal brain, fetal 940 for 5" CATCTGCTG GAAAGTCCA kidney and fetal 69 0 C for 15" GATTCCTG GTGATCC skeletal muscle 72* for 30" (115) (116) 720 for 5' hRUP18 940 for 2' TGGTGGCGA GTTGCGCCTT 330bp Pancreas 940 for 15" TGGCCAACA AGCGACAGA 60'C for 20" GCGCTC (117) TGACC (118) 720 for 1' 720 for 5' hRUP21 940 for 1' TCAACCTGT AAGGAGTAG Kidney, lung 940 for 15" ATAGCAGCA CAGAATGGT and testis 56 0 C for 20" TCCTC (119) TAGCC (120) 720 for 40" *cycles 2-3 repeated 30 times hRUP22 940 for 30" GACACCTGT CTGATGGAA Testis, thymus 940 for 15" CAGCGGTCG GTAGAGGCT and spleen 69 0 C for 20" TGTGTG (121) GTCCATCTC 720 for 40" (122) *cycles 2-3 repeated 30 times hRUP23 940 for 2' GCGCTGAGC CACGGTGAC 520bp Placenta 940 for 15" GCAGACCAG GAAGGGCAC 60 0 C for 20" TGGCTG (123) GAGCTC (124) 720 for 1' 720 for 5' hRUP26 940 for 2' AGCCATCCC CCAGGTAGG 470bp Pancreas 940 for 15" TGCCAGGAA TGTGCAGCA 65 0 C for 20" GCATGG (125) CAATGGC 72 0 for l' (126) 720 for 5' hRUP27 940 for 30" CTGTFCAAC ATCATGTCTA 890bp Brain 940 for 10" AGGGCTGGT GACTCATGGT 55 0 C for 20" TGGCAAC GATCC (128) 72* for ' (127) 720 for 3' *cycles 2-4 repeated 35 times 59 WO 01/36471 PCT/USOO/31509 Example 7 Protocol: Direct Identification of Inverse Agonists and Agonists A. [ 35S]GTPyS Assay 5 Although we have utilized endogenous, constitutively active GPCRs for the direct identification of candidate compounds as, e.g., inverse agonists, for reasons that are not altogether understood, intra-assay variation can become exacerbated. Preferably, then, a GPCR Fusion Protein, as disclosed above, is also utilized with a non endogenous, constitutively activated GPCR. We have determined that when such a 10 protein is used, intra-assay variation appears to be substantially stabilized, whereby an effective signal-to-noise ratio is obtained. This has the beneficial result of allowing for a more robust identification of candidate compounds. Thus, it is preferred that for direct identification, a GPCR Fusion Protein be used and that when utilized, the following assay protocols be utilized. 15 1. Membrane Preparation Membranes comprising the constitutively active orphan GPCR Fusion Protein of interest and for use in the direct identification of candidate compounds as inverse agonists, agonists or partial agonists are preferably prepared as follows: a. Materials 20 "Membrane Scrape Buffer" is comprised of 20mM HEPES and 10mM EDTA, pH 7.4; "Membrane Wash Buffer" is comprised of 20 mM HEPES and 0.1 mM EDTA, pH 7.4; "Binding Buffer" is comprised of 20mM HEPES, 100 mM NaCl, and 10 mM MgCl 2 , pH 7.4 b. Procedure 25 All materials will be kept on ice throughout the procedure. Firstly, the media will be aspirated from a confluent monolayer of cells, followed by rinse with 10ml cold 60 WO 01/36471 PCT/USOO/31509 PBS, followed by aspiration. Thereafter, 5ml of Membrane Scrape Buffer will be added to scrape cells; this will be followed by transfer of cellular extract into 50ml centrifuge tubes (centrifuged at 20,000 rpm for 17 minutes at 4*C). Thereafter, the supernatant will be aspirated and the pellet will be resuspended in 30ml Membrane Wash Buffer 5 followed by centrifuge at 20,000 rpm for 17 minutes at 4*C. The supernatant will then be aspirated and the pellet resuspended in Binding Buffer. This will then be homogenized using a Brinkman polytronTM homogenizer (15-20 second bursts until the all material is in suspension). This is referred to herein as "Membrane Protein". 2. Bradford Protein Assay 10 Following the homogenization, protein concentration of the membranes will be determined using the Bradford Protein Assay (protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-80*C) for later use; when frozen, protocol for use will be as follows: on the day of the assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then homogenized with a polytron at about 15 12 x 1,000 rpm for about 5-10 seconds; it was noted that for multiple preparations, the homogenizor should be thoroughly cleaned between homoginezation of different preparations). a. Materials Binding Buffer (as per above); Bradford Dye Reagent; Bradford Protein 20 Standard will be utilized, following manufacturer instructions (Biorad, cat. no. 500 0006). b. Procedure Duplicate tubes will be prepared, one including the membrane, and one as a control "blank". Each contained 800ul Binding Buffer. Thereafter, 1Opl of Bradford 25 Protein Standard (1mg/ml) will be added to each tube, and lOIl of membrane Protein 61 WO 01/36471 PCT/USOO/31509 will then be added to just one tube (not the blank). Thereafter, 200ul of Bradford Dye Reagent will be added to each tube, followed by vortex of each. After five (5) minutes, the tubes will be re-vortexed and the material therein will be transferred to cuvettes. The cuvettes will then be read using a CECIL 3041 spectrophotometer, at 5 wavelength 595. 3. Direct Identification Assay a. Materials GDP Buffer consisted of 37.5 ml Binding Buffer and 2mg GDP (Sigma, cat. no. G-7127), followed by a series of dilutions in Binding Buffer to obtain 0.2 pM GDP 10 (final concentration of GDP in each well was 0.1 gM GDP); each well comprising a candidate compound, has a final volume of 200ul consisting of 1 0 0 g 1 GDP Buffer (final concentration, 0.1pM GDP), 50ul Membrane Protein in Binding Buffer, and 50pl

[

3 sS]GTPyS (0.6 nM) in Binding Buffer (2.5 P1 [ 35 S]GTPyS per 10ml Binding Buffer). b. Procedure 15 Candidate compounds will be preferably screened using a 96-well plate format (these can be frozen at -80*C). Membrane Protein (or membranes with expression vector excluding the GPCR Fusion Protein, as control), will be homogenized briefly until in suspension. Protein concentration will then be determined using the Bradford Protein Assay set forth above. Membrane Protein (and control) will then be diluted to 20 0.25mg/ml in Binding Buffer (final assay concentration, 12.5pg/well). Thereafter, 100 l GDP Buffer was added to each well of a Wallac Scintistrip TM (Wallac). A 5ul pin tool will then be used to transfer 5 j1d of a candidate compound into such well (i.e., 5pLI in total assay volume of 200 pl is a 1:40 ratio such that the final screening concentration of the candidate compound is 10gM). Again, to avoid contamination, after each transfer 25 step the pin tool should be rinsed in three reservoirs comprising water (1X), ethanol (lX) 62 WO 01/36471 PCT/USOO/31509 and water (2X) - excess liquid should be shaken from the tool after each rinse and dried with paper and kimwipes. Thereafter, 50 pl of Membrane Protein will be added to each well (a control well comprising membranes without the GPCR Fusion Protein was also utilized), and pre-incubated for 5-10 minutes at room temperature. Thereafter, 50[1 of 5 [ 3 sS]GTPyS (0.6 nM) in Binding Buffer will be added to each well, followed by incubation on a shaker for 60 minutes at room temperature (again, in this example, plates were covered with foil). The assay will then be stopped by spinning of the plates at 4000 RPM for 15 minutes at 22*C. The plates will then be aspirated with an 8 channel manifold and sealed with plate covers. The plates will then be read on a Wallacc 1450 10 using setting 'Trot. #37" (as per manufacturer instructions). B. Cyclic AMP Assay Another assay approach to directly identified candidate compound was accomplished by utilizing a cyclase-based assay. In addition to direct identification, this 15 assay approach can be utilized as an independent approach to provide confirmation of the results from the [ 35 S]GTPyS approach as set forth above. A modified Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) was preferably utilized for direct identification of candidate compounds as inverse agonists and agonists to constitutively activated orphan GPCRs in accordance 20 with the following protocol. Transfected cells were harvested approximately three days after transfection. Membranes were prepared by homogenization of suspended cells in buffer containing 20mM HEPES, pH 7.4 and 10mM MgCl 2 . Homogenization was performed on ice using a Brinkman Polytron T M for approximately 10 seconds. The resulting homogenate is 25 centrifuged at 49,000 X g for 15 minutes at 4'C. The resulting pellet was then resuspended in buffer containing 20mM HEPES, pH 7.4 and 0.1 mM EDTA, 63 WO 01/36471 PCT/USOO/31509 homogenized for 10 seconds, followed by centrifugation at 49,000 X g for 15 minutes at 4 0 C. The resulting pellet was then stored at -80*C until utilized. On the day of direct identification screening, the membrane pellet as slowly thawed at room temperature, resuspended in buffer containing 20mM HEPES, pH 7.4 and 10mM MgCL2, to yield a 5 final protein concentration of 0.60mg/ml (the resuspended membranes are placed on ice until use). cAMP standards and Detection Buffer (comprising 2 gCi of tracer [125I cAMP (100 ptl] to 11 ml Detection Buffer) were prepared and maintained in accordance with the manufacturer's instructions. Assay Buffer was prepared fresh for screening and 10 contained 20mM HEPES, pH 7.4, 10mM MgCl 2 , 20mM phospocreatine (Sigma), 0.1 units/ml creatine phosphokinase (Sigma), 50 ptM GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer was then stored on ice until utilized. Candidate compounds identified as per above (if frozen, thawed at room temperature) were added, preferably, to 96-well plate wells (3gI/well; l2pM final assay 15 concentration), together with 40 pl Membrane Protein (30pg/well) and 50gl of Assay Buffer. This admixture was then incubated for 30 minutes at room temperature, with gentle shaking. Following the incubation, 100pl of Detection Buffer was added to each well, followed by incubation for 2-24 hours. Plates were then counted in a Wallac 20 MicroBetaTM plate reader using "Prot. #31" (as per manufacturer instructions). A representative screening assay plate (96 well format) result is presented in Figure 12. Each bar represents the results for a different compound in each well, plus RUP13-Gsca Fusion Protein construct, as prepared in Example 5(a) above. The representative results presented in Figure 12 also provide standard deviations based upon 25 the mean results of each plate ("m") and the mean plus two arbitrary preference for 64 WO 01/36471 PCT/USOO/31509 selection of inverse agonists as "leads" from the primary screen involves selection of candidate compounds that that reduce the per cent response by at least the mean plate response, minus two standard deviations. Conversely, an arbitrary preference for selection of an agonists as "leads" from the primary screen involves selection of 5 candidate compounds that increase the per cent response by at least the mean plate response, plus the two standard deviations. Based upon these selection processes, the candidate compounds in the following wells were directly identified as putative inverse agonist (Compound A) and agonist (Compound B) to RUP13 in wells A2 and G9, respectively. See, Figure 12. It is noted for clarity: these compounds have been directly 10 identified without any knowledge of the endogenous ligand for this GPCR. By focusing on assay techniques that are based upon receptor function, and not compound binding affinity, we are able to ascertain compounds that are able to reduce the functional activity of this receptor (Compound A) as well as increase the functional activity of the receptor (Compound B). Based upon the location of these receptor in lung tissue (see, 15 for example, hRUP13 and hRUP21 in Example 6), pharmaceutical agents can be developed for potential therapeutic treatment of lung cancer. References cited throughout this patent document, including co-pending and related patent applications, unless otherwise indicated, are fully incorporated herein by reference. Modifications and extension of the disclosed inventions that are within the 20 purview of the skilled artisan are encompassed within the above disclosure and the claims that follow. Although a variety of expression vectors are available to those in the art, for purposes of utilization for both the endogenous and non-endogenous human GPCRs, it is most preferred that the vector utilized be pCMV. This vector was deposited with the 25 American Type Culture Collection (ATCC) on October 13, 1998 (10801 University 65 WO 01/36471 PCT/USOO/31509 Blvd., Manassas, VA 20110-2209 USA) under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure. The DNA was tested by the ATCC and determined to be viable. The ATCC has assigned the following deposit number to pCMV: ATCC #20335 1. 5 // // // 10 // // // 15 // 20 // // 25 // 66

Claims (80)

1. A G protein-coupled receptor encoded by an amino acid sequence of 5 SEQ.ID.NO.:2.

2. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 1.

3. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:1.

4. A host cell comprising the plasmid of claim 3. 10

5. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:4.

6. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 5.

7. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:3. 15

8. A host cell comprising the plasmid of claim 7.

9. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:6.

10. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 9. 20

11. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:5.

12. A host cell comprising the plasmid of claim 11.

13. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:8.

14. A non-endogenous, constitutively activated version of the G protein-coupled 25 receptor of claim 13. 67 WO 01/36471 PCT/USOO/31509

15. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:7.

16. A host cell comprising the plasmid of claim 15.

17. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 10. 5

18. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 17.

19. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:9.

20. A host cell comprising the plasmid of claim 19.

21. A G protein-coupled receptor encoded by an amino acid sequence of 10 SEQ.ID.NO.:12.

22. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 21 comprising an amino acid sequence of SEQ.ID.NO.84.

23. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:11.

24. A host cell comprising the plasmid of claim 23. 15

25. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 14.

26. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 25 comprising an amino acid sequence of SEQ.ID.NO.88.

27. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.: 13. 20

28. A host cell comprising the plasmid of claim 27.

29. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 16.

30. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 29 comprising an amino acid sequence of SEQ.ID.NO.:92. 25

31. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:15. 68 WO 01/36471 PCT/USOO/31509

32. A host cell comprising the plasmid of claim 31.

33. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.: 18.

34. A non-endogenous, constitutively activated version of the G protein-coupled 5 receptor of claim 33.

35. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:17.

36. A host cell comprising the plasmid of claim 35.

37. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:20. 10

38. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 37.

39. A plasmid comprising a vector and the cDNA of SE.ID.NO.: 19.

40. A host cell comprising the plasmid of claim 39.

41. A G protein-coupled receptor encoded by an amino acid sequence of 15 SEQ.ID.NO.:22.

42. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 41.

43. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:21.

44. A host cell comprising the plasmid of claim 43. 20

45. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:24.

46. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 45.

47. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:23. 25

48. A host cell comprising the plasmid of claim 47. 69 WO 01/36471 PCT/USOO/31509

49. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:26.

50. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 49. 5

51. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:25.

52. A host cell comprising the plasmid of claim 51.

53. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:28.

54. A non-endogenous, constitutively activated version of the G protein-coupled 10 receptor of claim 53.

55. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:27.

56. A host cell comprising the plasmid of claim 55.

57. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:30. 15

58. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 57.

59. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:29.

60. A host cell comprising the plasmid of claim 59.

61. A G protein-coupled receptor encoded by an amino acid sequence of 20 SEQ.ID.NO.:32.

62. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 61 comprising an amino acid sequence of SEQ.ID.NO.:96.

63. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:95.

64. A host cell comprising the plasmid of claim 63. 70 WO 01/36471 PCT/USOO/31509

65. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:34.

66. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 65. 5

67. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:33.

68. A host cell comprising the plasmid of claim 67.

69. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:36.

70. A non-endogenous, constitutively activated version of the G protein-coupled 10 receptor of claim 69.

71. A plasmid comprising a vector and the cDNA of SEQ.ID.NO. :35.

72. A host cell comprising the plasmid of claim 71.

73. A G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:38. 15

74. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 73.

75. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:37.

76. A host cell comprising the plasmid of claim 75.

77. A G protein-coupled receptor encoded by an amino acid sequence of 20 SEQ.ID.NO.:40.

78. A non-endogenous, constitutively activated version of the G protein-coupled receptor of claim 77.

79. A plasmid comprising a vector and the cDNA of SEQ.ID.NO.:39.

80. A host cell comprising the plasmid of claim 79. 25 71