EP1137776A2 - Non-endogenous, constitutively activated human g protein-coupled receptors - Google Patents

Abstract

The invention disclosed in this patent document relates to transmembrane receptors, more particularly to a human G protein-coupled receptor for which the endogenous ligand is unknown ('orphan GPCR receptors'), and most particularly to mutated (non-endogenous) versions of the human GPCRs for evidence of constitutive activity.

Description

NON-ENDOGENOUS, CONSTITUTIVELY ACTIVATED HUMAN G PROTEIN-COUPLED RECEPTORS

This patent application is a continuation-in-part of, and claims priority from, U.S.

Serial Number 09/170,496, filed with the United States Patent and Trademark Office on

October 13, 1998. This application also claims the benefit of priority from the following

provisional applications, all filed via U.S. Express Mail with the United States Patent and

Trademark Office on the indicated dates: U.S. Provisional Number 60/110,060, filed

November 27, 1998; U.S. Provisional Number 60/120,416, filed February 16, 1999; U.S.

Provisional Number 60/121,852, filed February 26, 1999 claiming benefit of U.S.

Provisional Number 60/109,213, filed November 20, 1998; U.S. Provisional Number

60/123,944, filed March 12, 1999; U.S. Provisional Number 60/123,945, filed March 12,

1999; U.S. Provisional Number 60/123,948, filed March 12, 1999; U.S. Provisional

Number 60/123,951, filed March 12, 1999; U.S. Provisional Number 60/123,946, filed

March 12, 1999; U.S. Provisional Number 60/123,949, filed March 12, 1999; U.S.

Provisional Number 60/152,524, filed September 3, 1999, claiming benefit of U.S.

Provisional Number 60/151,114, filed August 27, 1999 and U.S. Provisional Number

60/108,029, filed November 12, 1998; U.S. Provisional Number 60/136,436, filed May 28,

1999; U.S. Provisional Number 60/136,439, filed May 28, 1999; U.S. Provisional Number

60/136,567, filed May 28, 1999; U.S. Provisional Number 60/137,127, filed May 28,

1999; U.S. Provisional Number 60/137,131, filed May 28, 1999; U.S. Provisional Number 60/141,448, filed June 29, 1999 claiming benefit of U.S. Provisional Number 60/136,437,

filed May 28, 1999; U.S. Provisional Number 60/156,633, filed September 29, 1999; U.S.

Provisional Number 60/156,555, filed September 29, 1999; U.S. Provisional Number

60/156,634, filed September 29, 1999;U.S. Provisional Number (Arena

Pharmaceuticals, Inc. docket number: CHNlO-l), filed September 29, 1999; U.S.

Provisional Number (Arena Pharmaceuticals, Inc. docket number: RUP6-1), filed

October 1, 1999; U.S. Provisional Number (Arena Pharmaceuticals, Inc. docket

number: RUP7-1), filed October 1, 1999; U.S. Provisional Number (Arena

Pharmaceuticals, Inc. docket number: CHN6-1), filed October 1, 1999; U.S. Provisional

Number (Arena Pharmaceuticals, Inc. docket number: RUP5-1), filed October 1, 1999;

and U.S. Provisional Number (Arena Pharmaceuticals, Inc. docket number: CHN9-1),

filed October 1, 1999. This application is also related to co-pending U.S. Serial Number

(Woodcock, Washburn, Kurtz, Makiewicz & Norris, LLP docket number AREN-

0050), filed on October 12, 1999 (via U.S. Express Mail) and U.S. Serial Number

09/364,425, filed on July 30, 1999, both incoφorated herein by reference. This

application also claims priority to U.S. Serial Number (Woodcock, Washburn,

Kurtz, Makiewicz & Norris, LLP docket number AREN-0054), filed on October 12, 1999

(via U.S. Express Mail), incorporated by reference herein in its entirety. Each of the

foregoing applications are incoφorated by reference herein in their entirety.

FIELD OF THE INVENTION

The invention disclosed in this patent document relates to transmembrane

receptors, and more particularly to human G protein-coupled receptors, and specifically to GPCRs that have been altered to establish or enhance constitutive activity of the receptor.

Preferably, the altered GPCRs are used for the direct identification of candidate compounds

as receptor agonists, inverse agonists or partial agonists having potential applicability as

therapeutic agents.

BACKGROUND OF THE INVENTION

Although a number of receptor classes exist in humans, by far the most

abundant and therapeutically relevant is represented by the G protein-coupled receptor (GPCR

or GPCRs) class. It is estimated that there are some 100,000 genes within the human genome,

and of these, approximately 2%, or 2,000 genes, are estimated to code for GPCRs. Receptors,

including GPCRs, for which the endogenous ligand has been identified are referred to as

"known" receptors, while receptors for which the endogenous ligand has not been identified

are referred to as "oφhan" receptors. GPCRs represent an important area for the development

of pharmaceutical products: from approximately 20 of the 100 known GPCRs, 60% of all

prescription pharmaceuticals have been developed.

GPCRs share a common structural motif. All these receptors have seven

sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each

of which spans the membrane (each span is identified by number, i. e., transmembrane- 1 (TM-

1), transmebrane-2 (TM-2), etc.). The transmembrane helices are joined by strands of amino

acids between transmembrane-2 and transmembrane-3 , transmembrane-4 and transmembrane-

5, and transmembrane-6 and transmembrane-7 on the exterior, or "extracellular" side, of the

cell membrane (these are referred to as "extracellular" regions 1 , 2 and 3 (EC- 1 , EC-2 and EC-

3), respectively). The transmembrane helices are also joined by strands of amino acids

between transmembrane- 1 and transmembrane-2, transmembrane-3 andtransmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular" side, of the cell

membrane (these are referred to as "intracellular" regions 1, 2 and 3 (IC-1, IC-2 and IC-3),

respectively). The "carboxy" ("C") terminus of the receptor lies in the intracellular space

within the cell, and the "amino" ("N") terminus of the receptor lies in the extracellular space

outside of the cell.

Generally, when an endogenous ligand binds with the receptor (often referred

to as "activation" of the receptor), there is a change in the conformation of the intracellular

region that allows for coupling between the intracellular region and an intracellular "G-

protein." It has been reported that GPCRs are "promiscuous" with respect to G proteins, i.e.,

that a GPCR can interact with more than one G protein. See, Kenakin, T., 43 Life Sciences

1095 (1988). Although other G proteins exist, currently, Gq, Gs, Gi, Gz and Go are G proteins

that have been identified. Endogenous ligand-activated GPCR coupling with the G-protein

begins a signaling cascade process (referred to as "signal transduction"). Under normal

conditions, signal transduction ultimately results in cellular activation or cellular inhibition.

It is thought that the IC-3 loop as well as the carboxy terminus of the receptor interact with

the G protein.

Under physiological conditions, GPCRs exist in the cell membrane in

equilibrium between two different conformations: an "inactive" state and an "active" state.

A receptor in an inactive state is unable to link to the intracellular signaling transduction

pathway to produce a biological response. Changing the receptor conformation to the active

state allows linkage to the transduction pathway (via the G-protein) and produces a biological

response.

A receptor may be stabilized in an active state by an endogenous ligand or a compound such as a drug. Recent discoveries, including but not exclusively limited to

modifications to the amino acid sequence of the receptor, provide means other than

endogenous ligands or drugs to promote and stabilize the receptor in the active state

conformation. These means effectively stabilize the receptor in an active state by

simulating the effect of an endogenous ligand binding to the receptor. Stabilization by

such ligand-independent means is termed "constitutive receptor activation."

SUMMARY OF THE INVENTION

Disclosed herein are non-endogenous versions of endogenous, human GPCRs and

uses thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a representation of 8XCRE-Luc reporter plasmid (see, Example

4(c)3.)

Figures 2A and 2B are graphic representations of the results of ATP and ADP

binding to endogenous TDAG8 (2A) and comparisons in serum and serum free media (2B).

Figure 3 is a graphic representation of the comparative signaling results of

CMV versus the GPCR Fusion Protein H9(F236K):Gsα.

DETAILED DESCRIPTION

The scientific literature that has evolved around receptors has adopted a

number of terms to refer to ligands having various effects on receptors. For clarity and

consistency, the following definitions will be used throughout this patent document. To the

extent that these definitions conflict with other definitions for these terms, the following

definitions shall control:

AGONISTS shall mean materials (e.g., ligands, candidate compounds) that activate the intracellular response when they bind to the receptor, or enhance GTP binding to

membranes.

AMINO ACID ABBREVIATIONS used herein are set out in Table A:

TABLE A

ALANINE ALA A

ARGININE ARG R

ASPARAGINE ASN N

ASPARTIC ACID ASP D

CYSTEINE CYS C GLUTAMIC ACID GLU E

GLUTAMINE GLN Q

GLYCINE GLY G

HISTIDINE HIS H

ISOLEUCINE ILE I LEUCINE LEU L

LYSINE LYS K

METHIONINE MET M

PHENYLALANINE PHE F

PROLINE PRO P SERINE SER S

THREONINE THR T

TRYPTOPHAN TRP W

TYROSINE TYR Y

VALINE VAL V

PARTIAL AGONISTS shall mean materials (e.g., ligands, candidate compounds)

that activate the intracellular response when they bind to the receptor to a lesser degree/extent

than do agonists, or enhance GTP binding to membranes to a lesser degree/extent than do

agonists.

ANTAGONIST shall mean materials (e.g., ligands, candidate compounds) that

competitively bind to the receptor at the same site as the agonists but which do not activate

the intracellular response initiated by the active form of the receptor, and can thereby inhibit

the intracellular responses by agonists or partial agonists. ANTAGONISTS do not diminish

the baseline intracellular response in the absence of an agonist or partial agonist.

CANDIDATE COMPOUND shall mean a molecule (for example, and not limitation, a chemical compound) that is amenable to a screening technique. Preferably, the phrase

"candidate compound" does not include compounds which were publicly known to be

compounds selected from the group consisting of inverse agonist, agonist or antagonist to a

receptor, as previously determined by an indirect identification process ("indirectly identified

compound"); more preferably, not including an indirectly identified compound which has

previously been determined to have therapeutic efficacy in at least one mammal; and, most

preferably, not including an indirectly identified compound which has previously been

determined to have therapeutic utility in humans.

COMPOSITION means a material comprising at least one component; a

"pharmaceutical composition" is an example of a composition.

COMPOUND EFFICACY shall mean a measurement of the ability of a compound

to inhibit or stimulate receptor functionality, as opposed to receptor binding affinity.

Exemplary means of detecting compound efficacy are disclosed in the Example section of this

patent document.

CODON shall mean a grouping of three nucleotides (or equivalents to nucleotides)

which generally comprise a nucleoside (adenosine (A), guanosine (G), cytidine (C), uridine

(U) and thymidine (T)) coupled to a phosphate group and which, when translated, encodes an

amino acid.

CONSTITUTIVELY ACTIVATED RECEPTOR shall mean a receptor subject to

constitutive receptor activation. A constitutively activated receptor can be endogenous or non-

endogenous.

CONSTITUTIVE RECEPTOR ACTIVATION shall mean stabilization of a

receptor in the active state by means other than binding of the receptor with its endogenous ligand or a chemical equivalent thereof.

CONTACT or CONTACTING shall mean bringing at least two moieties together,

whether in an in vitro system or an in vivo system.

DIRECTLY IDENTIFYING or DIRECTLY IDENTIFIED, in relationship to the

phrase "candidate compound", shall mean the screening of a candidate compound against a

constitutively activated receptor, preferably a constitutively activated oφhan receptor, and

most preferably against a constitutively activated G protein-coupled cell surface oφhan

receptor, and assessing the compound efficacy of such compound. This phrase is, under no

circumstances, to be inteφreted or understood to be encompassed by or to encompass the

phrase "indirectly identifying" or "indirectly identified."

ENDOGENOUS shall mean a material that a mammal naturally produces.

ENDOGENOUS in reference to, for example and not limitation, the term "receptor," shall

mean that which is naturally produced by a mammal (for example, and not limitation, a

human) or a virus. By contrast, the term NON-ENDOGENOUS in this context shall mean

that which is not naturally produced by a mammal (for example, and not limitation, a human)

or a virus. For example, and not limitation, a receptor which is not constitutively active in its

endogenous form, but when manipulated becomes constitutively active, is most preferably

referred to herein as a "non-endogenous, constitutively activated receptor." Both terms can

be utilized to describe both "in vivo" and "in vitro" systems. For example, and not limitation,

in a screening approach, the endogenous or non-endogenous receptor may be in reference to

an in vitro screening system. As a further example and not limitation, where the genome of

a mammal has been manipulated to include a non-endogenous constitutively activated

receptor, screening of a candidate compound by means of an in vivo system is viable. G PROTEIN COUPLED RECEPTOR FUSION PROTEIN and GPCR FUSION

PROTEIN, in the context of the invention disclosed herein, each mean a non-endogenous

protein comprising an endogenous, constitutively activate GPCR or a non-endogenous,

constitutively activated GPCR fused to at least one G protein, most preferably the alpha (α)

subunit of such G protein (this being the subunit that binds GTP), with the G protein

preferably being of the same type as the G protein that naturally couples with endogenous

oφhan GPCR. For example, and not limitation, in an endogenous state, if the G protein

"Gsα" is the predominate G protein that couples with the GPCR, a GPCR Fusion Protein

based upon the specific GPCR would be a non-endogenous protein comprising the GPCR

fused to Gsα; in some circumstances, as will be set forth below, a non-predominant G protein

can be fused to the GPCR. The G protein can be fused directly to the c-terminus of the

constitutively active GPCR or there may be spacers between the two.

HOST CELL shall mean a cell capable of having a Plasmid and/or Vector

incoφorated therein. In the case of a prokaryotic Host Cell, a Plasmid is typically replicated

as a autonomous molecule as the Host Cell replicates (generally, the Plasmid is thereafter

isolated for introduction into a eukaryotic Host Cell); in the case of a eukaryotic Host Cell,

a Plasmid is integrated into the cellular DNA of the Host Cell such that when the eukaryotic

Host Cell replicates, the Plasmid replicates. Preferably, for the puφoses of the invention

disclosed herein, the Host Cell is eukaryotic, more preferably, mammalian, and most

preferably selected from the group consisting of 293, 293T and COS-7 cells.

INDIRECTLY IDENTIFYING or INDIRECTLY IDENTIFIED means the

traditional approach to the drug discovery process involving identification of an endogenous

ligand specific for an endogenous receptor, screening of candidate compounds against the receptor for determination of those which interfere and/or compete with the ligand-receptor

interaction, and assessing the efficacy of the compound for affecting at least one second

messenger pathway associated with the activated receptor.

INHIBIT or INHIBITING, in relationship to the term "response" shall mean that a

response is decreased or prevented in the presence of a compound as opposed to in the

absence of the compound.

INVERSE AGONISTS shall mean materials (e.g., ligand, candidate compound)

which bind to either the endogenous form of the receptor or to the constitutively activated

form of the receptor, and which inhibit the baseline intracellular response initiated by the

active form of the receptor below the normal base level of activity which is observed in the

absence of agonists or partial agonists, or decrease GTP binding to membranes. Preferably,

the baseline intracellular response is inhibited in the presence of the inverse agonist by at least

30%, more preferably by at least 50%, and most preferably by at least 75%, as compared with

the baseline response in the absence of the inverse agonist.

KNOWN RECEPTOR shall mean an endogenous receptor for which the endogenous

ligand specific for that receptor has been identified.

LIGAND shall mean an endogenous, naturally occurring molecule specific for an

endogenous, naturally occurring receptor.

MUTANT or MUTATION in reference to an endogenous receptor's nucleic acid

and/or amino acid sequence shall mean a specified change or changes to such endogenous

sequences such that a mutated form of an endogenous, non-constitutively activated receptor

evidences constitutive activation of the receptor. In terms of equivalents to specific

sequences, a subsequent mutated form of a human receptor is considered to be equivalent to a first mutation of the human receptor if (a) the level of constitutive activation of the

subsequent mutated form of a human receptor is substantially the same as that evidenced by

the first mutation of the receptor; and (b) the percent sequence (amino acid and/or nucleic

acid) homology between the subsequent mutated form of the receptor and the first mutation

of the receptor is at least about 80%, more preferably at least about 90% and most preferably

at least 95%. Ideally, and owing to the fact that the most preferred cassettes disclosed herein

for achieving constitutive activation includes a single amino acid and/or codon change

between the endogenous and the non-endogenous forms of the GPCR, the percent sequence

homology should be at least 98%.

NON-ORPHAN RECEPTOR shall mean an endogenous naturally occurring

molecule specific for an endogenous naturally occurring ligand wherein the binding of a

ligand to a receptor activates an intracellular signaling pathway.

ORPHAN RECEPTOR shall mean an endogenous receptor for which the

endogenous ligand specific for that receptor has not been identified or is not known.

PHARMACEUTICAL COMPOSITION shall mean a composition comprising at

least one active ingredient, whereby the composition is amenable to investigation for a

specified, efficacious outcome in a mammal (for example, and not limitation, a human). Those

of ordinary skill in the art will understand and appreciate the techniques appropriate for

determining whether an active ingredient has a desired efficacious outcome based upon the

needs of the artisan.

PLASMID shall mean the combination of a Vector and cDNA. Generally, a Plasmid

is introduced into a Host Cell for the puφoses of replication and/or expression of the cDNA

as a protein. STIMULATE or STIMULATING, in relationship to the term "response" shall mean

that a response is increased in the presence of a compound as opposed to in the absence of the

compound.

VECTOR in reference to cDNA shall mean a circular DNA capable of incoφorating

at least one cDNA and capable of incoφoration into a Host Cell.

The order of the following sections is set forth for presentational efficiency and is not

intended, nor should be construed, as a limitation on the disclosure or the claims to follow.

A. Introduction

The traditional study of receptors has always proceeded from the a priori assumption

(historically based) that the endogenous ligand must first be identified before discovery could

proceed to find antagonists and other molecules that could affect the receptor. Even in cases

where an antagonist might have been known first, the search immediately extended to looking

for the endogenous ligand. This mode of thinking has persisted in receptor research even after

the discovery of constitutively activated receptors. What has not been heretofore recognized

is that it is the active state of the receptor that is most useful for discovering agonists, partial

agonists, and inverse agonists of the receptor. For those diseases which result from an overly

active receptor or an under-active receptor, what is desired in a therapeutic drug is a

compound which acts to diminish the active state of a receptor or enhance the activity of the

receptor, respectively, not necessarily a drug which is an antagonist to the endogenous ligand.

This is because a compound that reduces or enhances the activity of the active receptor state

need not bind at the same site as the endogenous ligand. Thus, as taught by a method of this

invention, any search for therapeutic compounds should start by screening compounds against

the ligand-independent active state. B. Identification of Human GPCRs

The efforts of the Human Genome project has led to the identification of a plethora of

information regarding nucleic acid sequences located within the human genome; it has been

the case in this endeavor that genetic sequence information has been made available without

an understanding or recognition as to whether or not any particular genomic sequence does

or may contain open-reading frame information that translate human proteins. Several

methods of identifying nucleic acid sequences within the human genome are within the

purview of those having ordinary skill in the art. For example, and not limitation, a variety

of human GPCRs, disclosed herein, were discovered by reviewing the GenBank™ database,

while other GPCRs were discovered by utilizing a nucleic acid sequence of a GPCR,

previously sequenced, to conduct a BLAST™ search of the EST database. Table B, below,

lists several endogenous GPCRs that we have discovered, along with a GPCR's respective

homologous receptor.

TABLE B

Disclosed Accession Open Reading Per Cent Reference To

Human Number Frame Homology Homologous

Orphan Identified (Base Pairs) To Designated GPCR

GPCRs GPCR (Accession No.) hARE-3 AL033379 1,260 bp 52.3% LPA-R U92642 hARE-4 AC006087 1,119 bp 36% P2Y5 AF000546 hARE-5 AC006255 1,104 bp 32% Oryzias D43633 latipes hGPR27 AA775870 1,128 bp hARE-1 AI090920 999 bp 43% D13626 KIAA0001 hARE-2 AA359504 1,122 bp 53% GPR27 hPPRl H67224 1,053 bp 39% EBI1 L31581 hG2A AA754702 1,113 bp 31% GPR4 L36148 hRTJP3 AL035423 1,005 bp 30% 2133653

Drosophila melanogaster hRUP4 AI307658 1,296 bp 32% pNPGPR NP 004876 28% and 29 % AAC41276 Zebra fish Ya and and Yb, AAB94616 respectively hRUP5 AC005849 1,413 bp 25% DEZ Q99788 23% FMLPR P21462 hRUP6 AC005871 1,245 bp 48% GPR66 NP_006047 hRUP7 AC007922 1,173 bp 43% H3R AF 140538 hCHN3 EST 36581 1,113 bp 53% GPR27 hCHN4 AA804531 1,077 bp 32% thrombin 4503637 hCHN6 EST 2134670 1,503 bp 36% edg-l NP_001391 hCHN8 EST 764455 1,029 bp 47% D13626 KIAA0001 hCHN9 EST 1541536 1,077 bp 41% LTB4R NM 000752 hCHNIO EST 1365839 1,055 bp 35% P2Y NM_002563

Receptor homology is useful in terms of gaining an appreciation of a role of the

receptors within the human body. As the patent document progresses, we will disclose

techniques for mutating these receptors to establish non-endogenous, constitutively activated

versions of these receptors.

The techniques disclosed herein have also been applied to other human, oφhan

GPCRs known to the art, as will be apparent as the patent document progresses.

C. Receptor Screening

Screening candidate compounds against a non-endogenous, constitutively activated

version of the human GPCRs disclosed herein allows for the direct identification of candidate

compounds which act at this cell surface receptor, without requiring use of the receptor's

endogenous ligand. By determining areas within the body where the endogenous version of

human GPCRs disclosed herein is expressed and/or over-expressed, it is possible to determine

related disease/disorder states which are associated with the expression and/or over-expression of the receptor; such an approach is disclosed in this patent document.

With respect to creation of a mutation that may evidence constitutive activation of the

human GPCR disclosed herein is based upon the distance from the proline residue at which

is presumed to be located within TM6 of the GPCR; this algorithmic technique is disclosed

in co-pending and commonly assigned patent document U.S. Serial Number 09/170,496,

incoφorated herein by reference. The algorithmic technique is not predicated upon traditional

sequence "alignment" but rather a specified distance from the aforementioned TM6 proline

residue. By mutating the amino acid residue located 16 amino acid residues from this residue

(presumably located in the IC3 region of the receptor) to, most preferably, a lysine residue,

such activation may be obtained. Other amino acid residues may be useful in the mutation

at this position to achieve this objective.

D. Disease/Disorder Identification and/or Selection

As will be set forth in greater detail below, most preferably inverse agonists to the

non-endogenous, constitutively activated GPCR can be identified by the methodologies of this

invention. Such inverse agonists are ideal candidates as lead compounds in drug discovery

programs for treating diseases related to this receptor. Because of the ability to directly

identify inverse agonists to the GPCR, thereby allowing for the development of

pharmaceutical compositions, a search for diseases and disorders associated with the GPCR

is relevant. For example, scanning both diseased and normal tissue samples for the presence

of the GPCR now becomes more than an academic exercise or one which might be pursued

along the path of identifying an endogenous ligand to the specific GPCR. Tissue scans can

be conducted across a broad range of healthy and diseased tissues. Such tissue scans provide

a preferred first step in associating a specific receptor with a disease and/or disorder. See, for example, co-pending application (docket number ARE-0050) for exemplary dot-blot and RT-

PCR results of several of the GPCRs disclosed herein.

Preferably, the DNA sequence of the human GPCR is used to make a probe for (a)

dot-blot analysis against tissue-mRNA, and/or (b) RT-PCR identification of the expression

of the receptor in tissue samples. The presence of a receptor in a tissue source, or a

diseased tissue, or the presence of the receptor at elevated concentrations in diseased tissue

compared to a normal tissue, can be preferably utilized to identify a correlation with a

treatment regimen, including but not limited to, a disease associated with that disease.

Receptors can equally well be localized to regions of organs by this technique. Based on

the known functions of the specific tissues to which the receptor is localized, the putative

functional role of the receptor can be deduced.

E. Screening of Candidate Compounds

1. Generic GPCR screening assay techniques

When a G protein receptor becomes constitutively active, it binds to a G protein (e.g.,

Gq, Gs, Gi, Gz, Go) and stimulates the binding of GTP to the G protein. The G protein then

acts as a GTPase and slowly hydrolyzes the GTP to GDP, whereby the receptor, under normal

conditions, becomes deactivated. However, constitutively activated receptors continue to

exchange GDP to GTP. A non-hydrolyzable analog of GTP, [³⁵S]GTPγS, can be used to

monitor enhanced binding to membranes which express constitutively activated receptors.

It is reported that [³⁵S] GTPγS can be used to monitor G protein coupling to membranes in the

absence and presence of ligand. An example of this monitoring, among other examples well-

known and available to those in the art, was reported by Traynor and Nahorski in 1995. The

preferred use of this assay system is for initial screening of candidate compounds because the system is generically applicable to all G protein-coupled receptors regardless of the particular

G protein that interacts with the intracellular domain of the receptor.

2. Specific GPCR screening assay techniques

Once candidate compounds are identified using the "generic" G protein-coupled

receptor assay (/. e., an assay to select compounds that are agonists, partial agonists, or inverse

agonists), further screening to confirm that the compounds have interacted at the receptor site

is preferred. For example, a compound identified by the "generic" assay may not bind to the

receptor, but may instead merely "uncouple" the G protein from the intracellular domain.

a. Gs, Gz and Gi.

Gs stimulates the enzyme adenylyl cyclase. Gi (and Gz and Go), on the other hand,

inhibit this enzyme. Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus,

constitutively activated GPCRs that couple the Gs protein are associated with increased

cellular levels of cAMP. On the other hand, constitutively activated GPCRs that couple Gi

(or Gz, Go) protein are associated with decreased cellular levels of cAMP. See, generally,

"Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3^rd Ed.)

Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992). Thus, assays that detect cAMP can

be utilized to determine if a candidate compound is, e.g., an inverse agonist to the receptor

(i.e., such a compound would decrease the levels of c AMP). A variety of approaches known

in the art for measuring cAMP can be utilized; a most preferred approach relies upon the use

of anti-cAMP antibodies in an ELISA-based format. Another type of assay that can be

utilized is a whole cell second messenger reporter system assay. Promoters on genes drive

the expression of the proteins that a particular gene encodes. Cyclic AMP drives gene

expression by promoting the binding of a cAMP -responsive DNA binding protein or transcription factor (CREB) that then binds to the promoter at specific sites called cAMP

response elements and drives the expression of the gene. Reporter systems can be constructed

which have a promoter containing multiple cAMP response elements before the reporter gene,

e.g., β-galactosidase or luciferase. Thus, a constitutively activated Gs-linked receptor causes

the accumulation of cAMP that then activates the gene and expression of the reporter protein.

The reporter protein such as β-galactosidase or luciferase can then be detected using standard

biochemical assays (Chen et al. 1995).

b. Go and Gq.

Gq and Go are associated with activation of the enzyme phospholipase C, which in

turn hydrolyzes the phospholipid PIP₂, releasing two intracellular messengers:

diacycloglycerol (DAG) and inistol 1,4,5-triphoisphate (IP₃). Increased accumulation of IP₃

is associated with activation of Gq- and Go-associated receptors. See, generally, "Indirect

Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3^rd Ed.) Nichols,

J.G. et al eds. Sinauer Associates, Inc. (1992). Assays that detect IP₃ accumulation can be

utilized to determine if a candidate compound is, e.g., an inverse agonist to a Gq- or Go-

associated receptor (i.e., such a compound would decrease the levels of IP₃). Gq-associated

receptors can also been examined using an API reporter assay in that Gq-dependent

phospholipase C causes activation of genes containing API elements; thus, activated Gq-

associated receptors will evidence an increase in the expression of such genes, whereby

inverse agonists thereto will evidence a decrease in such expression, and agonists will

evidence an increase in such expression. Commercially available assays for such detection

are available. 3. GPCR Fusion Protein

The use of an endogenous, constitutively activate oφhan GPCR or anon-endogenous,

constitutively activated oφhan GPCR, for use in screening of candidate compounds for the

direct identification of inverse agonists, agonists and partial agonists provide an interesting

screening challenge in that, by definition, the receptor is active even in the absence of an

endogenous ligand bound thereto. Thus, in order to differentiate between, e.g., the non-

endogenous receptor in the presence of a candidate compound and the non-endogenous

receptor in the absence of that compound, with an aim of such a differentiation to allow for

an understanding as to whether such compound may be an inverse agonist, agonist, partial

agonist or have no affect on such a receptor, it is preferred that an approach be utilized that

can enhance such differentiation. A preferred approach is the use of a GPCR Fusion Protein.

Generally, once it is determined that a non-endogenous oφhan GPCR has been

constitutively activated using the assay techniques set forth above (as well as others), it is

possible to determine the predominant G protein that couples with the endogenous GPCR.

Coupling of the G protein to the GPCR provides a signaling pathway that can be assessed.

Because it is most preferred that screening take place by use of a mammalian expression

system, such a system will be expected to have endogenous G protein therein. Thus, by

definition, in such a system, the non-endogenous, constitutively activated oφhan GPCR will

continuously signal. In this regard, it is preferred that this signal be enhanced such that in the

presence of, e.g., an inverse agonist to the receptor, it is more likely that it will be able to more

readily differentiate, particularly in the context of screening, between the receptor when it is

contacted with the inverse agonist.

The GPCR Fusion Protein is intended to enhance the efficacy of G protein coupling with the non-endogenous GPCR. The GPCR Fusion Protein is preferred for screening with

a non-endogenous, constitutively activated GPCR because such an approach increases the

signal that is most preferably utilized in such screening techniques. This is important in

facilitating a significant "signal to noise" ratio; such a significant ratio is import preferred for

the screening of candidate compounds as disclosed herein.

The construction of a construct useful for expression of a GPCR Fusion Protein is

within the purview of those having ordinary skill in the art. Commercially available

expression vectors and systems offer a variety of approaches that can fit the particular needs

of an investigator. The criteria of importance for such a GPCR Fusion Protein construct is

that the endogenous GPCR sequence and the G protein sequence both be in-frame (preferably,

the sequence for the endogenous GPCR is upstream of the G protein sequence) and that the

"stop" codon of the GPCR must be deleted or replaced such that upon expression of the

GPCR, the G protein can also be expressed. The GPCR can be linked directly to the G

protein, or there can be spacer residues between the two (preferably, no more than about 12.

although this number can be readily ascertained by one of ordinary skill in the art). We have

a preference (based upon convenience) of use of a spacer in that some restriction sites that are

not used will, effectively, upon expression, become a spacer. Most preferably, the G protein

that couples to the non-endogenous GPCR will have been identified prior to the creation of

the GPCR Fusion Protein construct. Because there are only a few G proteins that have been

identified, it is preferred that a construct comprising the sequence of the G protein (i.e., a

universal G protein construct) be available for insertion of an endogenous GPCR sequence

therein; this provides for efficiency in the context of large-scale screening of a variety of

different endogenous GPCRs having different sequences. As noted above, constitutively activated GPCRs that couple to Gi, Gz and Go are

expected to inhibit the formation of c AMP making assays based upon these types of GPCRs

challenging (i.e., the cAMP signal decreases upon activation thus making the direct

identification of, e.g. inverse agonists (which would further decrease this signal), interesting).

As will be disclosed herein, we have ascertained that for these types of receptors, it is possible

to create a GPCR Fusion Protein that is not based upon the endogenous GPCR's endogenous

G protein, in an effort to establish a viable cyclase-based assay. Thus, for example, a Gz

coupled receptor such as H9, a GPCR Fusion Protein can be established that utilizes a Gs

fusion protein - we believe that such a fusion construct, upon expression, "drives" or "forces"

the non-endogenous GPCR to couple with, e.g., Gs rather than the "natural" Gz protein, such

that a cyclase-based assay can be established. Thus, for Gi, Gz and Go coupled receptors, we

prefer that that when a GPCR Fusion Protein is used and the assay is based upon detection of

adenyl cyclase activity, that the fusion construct be established with Gs (or an equivalent G

protein that stimulates the formation of the enzyme adenylyl cyclase).

F. Medicinal Chemistry

Generally, but not always, direct identification of candidate compounds is preferably

conducted in conjunction with compounds generated via combinatorial chemistry techniques,

whereby thousands of compounds are randomly prepared for such analysis. Generally, the

results of such screening will be compounds having unique core structures; thereafter, these

compounds are preferably subjected to additional chemical modification around a preferred

core structure(s) to further enhance the medicinal properties thereof. Such techniques are

known to those in the art and will not be addressed in detail in this patent document. G. Pharmaceutical compositions

Candidate compounds selected for further development can be formulated into

pharmaceutical compositions using techniques well known to those in the art. Suitable

pharmaceutically-acceptable carriers are available to those in the art; for example, see

Remington's Pharmaceutical Sciences, 16^th Edition, 1980, Mack Publishing Co., (Oslo et al.,

eds.)

H. Other Utility

Although a preferred use of the non-endogenous versions the human GPCRs disclosed

herein may be for the direct identification of candidate compounds as inverse agonists,

agonists or partial agonists (preferably for use as pharmaceutical agents), these versions of

human GPCRs can also be utilized in research settings. For example, in vitro and in vivo

systems incoφorating GPCRs can be utilized to further elucidate and understand the roles

these receptors play in the human condition, both normal and diseased, as well as

understanding the role of constitutive activation as it applies to understanding the signaling

cascade. The value in non-endogenous human GPCRs is that their utility as a research tool

is enhanced in that, because of their unique features, non-endogenous human GPCRs can be

used to understand the role of these receptors in the human body before the endogenous

ligand therefor is identified. Other uses of the disclosed receptors will become apparent to

those in the art based upon, inter alia, a review of this patent document.

EXAMPLES

The following examples are presented for puφoses of elucidation, and not limitation, of

the present invention. While specific nucleic acid and amino acid sequences are disclosed

herein, those of ordinary skill in the art are credited with the ability to make minor modifications to these sequences while achieving the same or substantially similar results

reported below. The traditional approach to application or understanding of sequence

cassettes from one sequence to another (e.g. from rat receptor to human receptor or from

human receptor A to human receptor B) is generally predicated upon sequence alignment

techniques whereby the sequences are aligned in an effort to determine areas of commonality .

The mutational approach disclosed herein does not rely upon this approach but is instead

based upon an algorithmic approach and a positional distance from a conserved proline

residue located within the TM6 region of human GPCRs. Once this approach is secured,

those in the art are credited with the ability to make minor modifications thereto to achieve

substantially the same results (i.e., constitutive activation) disclosed herein. Such modified

approaches are considered within the purview of this disclosure

Example 1

ENDOGENOUS HUMAN GPCRS

1. Identification of Human GPCRs

Certain of the disclosed endogenous human GPCRs were identified based upon a

review of the GenBank™ database information. While searching the database, the following

cDNA clones were identified as evidenced below (Table C).

TABLE C

Disclosed Accession Complete DNA Open Reading Nucleic Amino

Human Number Sequence Frame Acid Acid

Orphan (Base Pairs) (Base Pairs) SEQ.ID. SEQ.ID.

GPCRs NO. NO. hARE-3 AL033379 111,389 bp 1,260 bp 1 2 hARE-4 AC006087 226,925 bp 1,119 bp 4 hARE-5 AC006255 127,605 bp 1,104 bp 5 6 hRUP3 AL035423 140,094 bp 1,005 bp 7 8 hRUP5 AC005849 169,144 bp 1,413 bp 9 10 hRUP6 AC005871 218,807 bp 1 ,245 bp 11 12 hRUP7 AC007922 158,858 bp 1,173 bp 13 14

Other disclosed endogenous human GPCRs were identified by conducting a BLAST™

search of EST database (dbest) using the following EST clones as query sequences. The

following EST clones identified were then used as a probe to screen a human genomic library

(Table D).

TABLE D

Disclosed Query EST Clone/ Open Nucleic Acid Amino Acid

Human (Sequence) Accession No. Reading SEQ.ID.NO. SEQ.ID.NO.

Orphan Identified Frame

GPCRs (Base Pairs) hGPCR27 Mouse AA775870 1,125 bp 17 18 GPCR27 hARE-1 TDAG 1689643 999 bp 19 20 AI090920 hARE-2 GPCR27 68530 1,122 bp 21 22 AA359504 hPPRl Bovine 238667 1 ,053 bp 23 24 PPR1 H67224 hG2A Mouse See Example 2(a), 1,113 bp 25 26 1 179426 below hCHN3 N.A. EST 36581 1.113 bp 27 28 (full length) hCHN4 TDAG 1184934 1 ,077 bp 29 30 AA804531 hCHN6 N.A. EST 2134670 1 ,503 bp 31 32 (full length) hCHN8 KIAA0001 EST 764455 1,029 bp 33 34 hCHN 9 1365839 EST 1541536 1 ,077 bp 35 36 hCHNIO Mouse EST Human 1365839 1,005 bp 37 38 1365839 hRUP4 N.A. AI307658 1,296 bp 39 40

N.A. = "not applicable".

2. Full Length Cloning

a. Human G2A

Mouse EST clone 1179426 was used to obtain a human genomic clone containing all but three amino acid G2A coding sequences. The 5 'of this coding sequence was obtained by

using 5 'RACE, and the template for PCR was Clontech' s Human Spleen Marathon-Ready™

cDNA. The disclosed human G2A was amplified by PCR using the G2A cDNA specific

primers for the first and second round PCR as shown in SEQ.ID.NO.: 41 and SEQ.ID.NO. :42

as follows:

5'-CTGTGTACAGCAGTTCGCAGAGTG-3' (SEQ.ID.NO.: 41 ; 1^st round PCR)

5'-GAGTGCCAGGCAGAGCAGGTAGAC-3' (SEQ.ID.NO.: 42; second round PCR).

PCR was performed using Advantage GC Polymerase Kit (Clontech; manufacturing

instructions will be followed), at 94°C for 30 sec followed by 5 cycles of 94 °C for 5 sec and

72°C for 4 min; and 30 cycles of 94° for 5 sec and 70° for 4 min. An approximate 1.3 Kb

PCR fragment was purified from agarose gel, digested with Hind III and Xba I and cloned into

the expression vector pRC/CMV2 (Invitrogen). The cloned-insert was sequenced using the

T7 Sequenase™ kit (USB Amersham; manufacturer instructions followed) and the sequence

was compared with the presented sequence. Expression of the human G2A was detected by

probing an RNA dot blot (Clontech; manufacturer instructions followed) with the P³²-labeled

fragment.

b. CHN9

Sequencing of the EST clone 1541536 showed CHN9 to be a partial cDNA clone

having only an initiation codon; i.e., the termination codon was missing. When CHN9

was used to blast against data base (nr), the 3' sequence of CHN9 was 100% homologous

to the 5' untranslated region of the leukotriene B4 receptor cDNA, which contained a

termination codon in the frame with CHN9 coding sequence. To determine whether the 5'

untranslated region of LTB4R cDNA was the 3' sequence of CHN9, PCR was performed

using primers based upon the 5' sequence flanking the initiation codon found in CHN9 and the 3' sequence around the termination codon found in the LTB4R 5' untranslated region.

The 5' primer sequence utilized was as follows:

5'-CCCGAATTCCTGCTTGCTCCCAGCTTGGCCC-3' (SEQ.ID.NO.: 43; sense) and 5'-TGTGGATCCTGCTGTCAAAGGTCCCATTCCGG-3' (SEQ.ID.NO.: 44; antisense). PCR was performed using thymus cDNA as a template and rTth polymerase (Perkin Elmer)

with the buffer system provided by the manufacturer, 0.25 uM of each primer, and 0.2 mM

of each 4 nucleotides. The cycle condition was 30 cycles of 94°C for 1 min, 65°C for lmin

and 72 °C for 1 min and 10 sec. A 1.1 kb fragment consistent with the predicted size was

obtained from PCR. This PCR fragment was subcloned into pCMV (see below) and

sequenced (see, SEQ.ID.NO.: 35).

c. RUP 4

The full length RUP4 was cloned by RT-PCR with human brain cDNA (Clontech) as

templates:

5'-TCACAATGCTAGGTGTGGTC-3' (SEQ.ID.NO.: 45; sense) and

5'-TGCATAGACAATGGGATTACAG-3' (SEQ.ID.NO.: 46; antisense).

PCR was performed using TaqPlus Precision™ polymerase (Stratagene; manufacturing

instructions followed) by the following cycles: 94°C for 2 min; 94°C 30 sec; 55 °C for 30 sec,

72°C for 45 sec, and 72°C for 10 min. Cycles 2 through 4 were repeated 30 times.

The PCR products were separated on a 1% agarose gel and a 500 bp PCR fragment

was isolated and cloned into the pCRII-TOPO™ vector (Invitrogen) and sequenced using the

T7 DNA Sequenase™ kit (Amsham) and the SP6/T7 primers (Stratagene). Sequence analysis

revealed that the PCR fragment was indeed an alternatively spliced form of AI307658 having

a continuous open reading frame with similarity to other GPCRs. The completed sequence

of this PCR fragment was as follows: 5'-TCACAATGCTAGGTGTGGTCTGGCTGGTGGCAGTCATCGTAGGATCACCCATGTGGCAC GTGCAACAACTTGAGATCAAATATGACTTCCTATATGAAAAGGAACACATCTGCTGCTTAAGA GTGGACCAGCCCTGTGCACCAGAAGATCTACACCACCTTCATCCTTGTCATCCTCTTCCTCCTGC CTCTTATGGTGATGCTTATTCTGTACGTAAAATTGGTTATGAACTTTGGATAAAGAAAAGAGTT GGGGATGGTTCAGTGCTTCGAACTATTCATGGAAAAGAAATGTCCAAAATAGCCAGGAAGAAG AAACGAGCTGTCATTATGATGGTGACAGTGGTGGCTCTCTTTGCTGTGTGCTGGGCACCATTCC ATGTTGTCCATATGATGATTGAATACAGTAATTTTGAAAAGGAATATGATGATGTCACAATCAA GATGATTTTTGCTATCGTGCAAATTATTGGATTTTCCAACTCCATCTGTAATCCCATTGTCTATGCA- 3' (SEQ.ID.NO.: 47)

Based on the above sequence, two sense oligonucleotide primer sets:

5'-CTGCTTAGAAGAGTGGACCAG-3' (SEQ.ID.NO.: 48; oligo 1),

5'-CTGTGCACCAGAAGATCTACAC-3' (SEQ.IDNO.: 49; oligo 2) and

two antisense oligonucleotide primer sets:

5'-CAAGGATGAAGGTGGTGTAGA-3' (SEQ.ID.NO.: 50; oligo 3) 5'-GTGTAGATCTTCTGGTGCACAGG-3' (SEQ.ID.NO.: 51; oligo 4) were used for 3'- and 5 '-RACE PCR with a human brain Marathon-Ready™ cDNA

(Clontech, Cat# 7400-1) as template, according to manufacture's instructions. DNA

fragments generated by the RACE PCR were cloned into the pCRII-TOPO™ vector

(Invitrogen) and sequenced using the SP6/T7 primers (Stratagene) and some internal primers.

The 3' RACE product contained a poly(A) tail and a completed open reading frame ending

at a TAA stop codon. The 5' RACE product contained an incomplete 5' end; i.e., the ATG

initiation codon was not present.

Based on the new 5' sequence, oligo 3 and the following primer:

5'-GCAATGCAGGTCATAGTGAGC -3' (SEQ.ID.NO.: 52; oligo 5) were used for the second round of 5 ' race PCR and the PCR products were analyzed as above.

A third round of 5' race PCR was carried out utilizing antisense primers:

5'-TGGAGCATGGTGACGGGAATGCAGAAG-3' (SEQ.ID.NO.: 53: oligo 6) and

5'-GTGATGAGCAGGTCACTGAGCGCCAAG-3' (SEQ.ID.NO.: 54: oligo7). The sequence of the 5' RACE PCR products revealed the presence of the initiation codon ATG, and further round of 5' race PCR did not generate any more 5' sequence. The

completed 5' sequence was confirmed by RT-PCR using sense primer 5'-GCAATGCAGGCGCTTAACATTAC-3' (SEQ.ID.NO.: 55; oligo 8) and oligo 4 as primers and sequence analysis of the 650 bp PCR product generated from

human brain and heart cDNA templates (Clontech, Cat# 7404- 1 ) . The completed 3 ' sequence

was confirmed by RT-PCR using oligo 2 and the following antisense primer: 5'-TTGGGTTACAATCTGAAGGGCA-3' (SEQ.ID.NO.:56; oligo 9) and sequence analysis of the 670 bp PCR product generated from human brain and heart

cDNA templates. (Clontech, Cat# 7404-1).

d. RUP5

The full length RUP5 was cloned by RT-PCR using a sense primer upstream from

ATG, the initiation codon (SEQ.ID.NO.:57), and an antisense primer containing TCA as the

stop codon (SEQ.ID.NO. :58), which had the following sequences:

5'-ACTCCGTGTCCAGCAGGACTCTG-3' (SEQ.ID.NO.: 57) 5'-TGCGTGTTCCTGGACCCTCACGTG-3' (SEQ.ID.NO.: 58) and human peripheral leukocyte cDNA (Clontech) as a template. Advantage™ cDNA

polymerase (Clontech) was used for the amplification in a 50ul reaction by the following cycle

with step 2 through step 4 repeated 30 times: 94°C for 30 sec; 94° for 15 sec; 69° for 40 sec;

72°C for 3 min; and 72°C fro 6 min. A 1.4kb PCR fragment was isolated and cloned with

the pCRII-TOPO™ vector (Invitrogen) and completely sequenced using the T7 DNA

Sequenase™ kit (Amsham). See, SEQ.ID.NO.: 9.

e. RUP6

The full length RUP6 was cloned by RT-PCR using primers:

5'-CAGGCCTTGGATTTTAATGTCAGGGATGG-3' (SEQ.ID.NO.: 59) and 5'-GGAGAGTCAGCTCTGAAAGAATTCAGG-3' (SEQ.ID.NO.: 60); and human thymus Marathon-Ready™ cDNA (Clontech) as a template. Advantage cDNA

polymerase (Clontech, according to manufacturer's instructions) was used for the

amplification in a 50ul reaction by the following cycle: 94°C for 30sec; 94°C for 5 sec; 66°C

for 40sec; 72 °C for 2.5 sec and 72 °C for 7 min. Cycles 2 through 4 were repeated 30 times.

A 1.3 Kb PCR fragment was isolated and cloned into the pCRII-TOPO™ vector (Invitrogen)

and completely sequenced (see, SEQ.ID.NO.: 11) using the ABI Big Dye Terminator™ kit

(P.E. Biosystem).

f. RUP7

The full length RUP7 was cloned by RT-PCR using primers:

5'-TGATGTGATGCCAGATACTAATAGCAC-3' (SEQ.ID.NO.: 61 ; sense) and

5'-CCTGATTCATTTAGGTGAGATTGAGAC-3' (SEQ.ID.NO.: 62; antisense) and human peripheral leukocyte cDNA (Clontech) as a template. Advantage™ cDNA

polymerase (Clontech) was used for the amplification in a 50 ul reaction by the following

cycle with step 2 to step 4 repeated 30 times: 94 °C for 2 minutes; 94 °C for 15 seconds; 60°C

for 20 seconds; 72 °C for 2 minutes; 72 °C for 10 minutes. A 1.25 Kb PCR fragment was

isolated and cloned into the pCRII-TOPO™ vector (Invitrogen) and completely sequenced

using the ABI Big Dye Terminator™ kit (P.E. Biosystem). See, SEQ.ID.NO.: 13.

3. Angiotensin II Type 1 Receptor ("ATI")

The endogenous human angiotensin II type 1 receptor ("ATI ") was obtained by PCR

using genomic DNA as template and rTth polymerase (Perkin Elmer) with the buffer system

provided by the manufacturer, 0.25 μM of each primer, and 0.2 mM of each 4 nucleotides.

The cycle condition was 30 cycles of 94°C for 1 min, 55°C for lmin and 72 °C for 1.5 min.

The 5' PCR primer contains a Hindlll site with the sequence: 5'-CCCAAGCTTCCCCAGGTGTATTTGAT-3' (SEQ.ID.NO.: 63) and the 3' primer contains a BamHl site with the following sequence:

5'-GTTGGATCCACATAATGCATTTTCTC-3' (SEQ.ID.NO.: 64).

The resulting 1.3 kb PCR fragment was digested with Hindlll and BamHl and cloned into

Hindlll-BamHI site of pCMV expression vector. The cDNA clone was fully sequenced.

Nucleic acid (SEQ.ID.NO.: 65) and amino acid (SEQ.ID.NO.: 66) sequences for human ATI

were thereafter determined and verified.

4. GPR38

To obtain GPR38, PCR was performed by combining two PCR fragments, using

human genomic cDNA as template and rTth poymerase (Perkin Elmer) with the buffer system

provided by the manufacturer, 0.25uM of each primer, and 0.2 mM of each 4 nucleotides.

The cycle condition for each PCR reaction was 30 cycles of 94 °C for 1 min, 62 °C for lmin

and 72 °C for 2 min.

The first fragment was amplified with the 5' PCR primer that contained an end site

with the following sequence:

5'-ACCATGGGCAGCCCCTGGAACGGCAGC-3' (SEQ.ID.NO.:67) and a 3' primer having the following sequence:

5'-AGAACCACCACCAGCAGGACGCGGACGGTCTGCCGGTGG-3' (SEQ.ID.NO.:68).

The second PCR fragment was amplified with a 5' primer having the following sequence: 5'-GTCCGCGTCCTGCTGGTGGTGGTTCTGGCATTTATAATT-3' (SEQ.ID.NO.: 69) and a 3' primer that contained a BamHl site and having the following sequence:

5'-CCTGGATCCTTATCCCATCGTCTTCACGTTAGC-3' (SEQ.ID.NO.: 70).

The two fragments were used as templates to amplify GPR38, using SEQ.ID.NO.: 67 and

SEQ.ID.NO.: 70 as primers (using the above-noted cycle conditions). The resulting 1.44kb PCR fragment was digested with BamHl and cloned into Blunt-BamHI site of pCMV

expression vector.

5. MC4

To obtain MC4, PCR was performed using human genomic cDNA as template and

rTth poymerase (Perkin Elmer) with the buffer system provided by the manufacturer, 0.25uM

of each primer, and 0.2 mM of each 4 nucleotides. The cycle condition for each PCR reaction

was 30 cycles of 94°C for 1 min, 54°C for lmin and 72°C for 1.5 min.

The 5' PCR contained an EcoRI site with the sequence:

5'-CTGGAATTCTCCTGCCAGCATGGTGA-3' (SEQ.ID.NO.: 71) and the 3' primer contained a BamHl site with the sequence:

5'-GCAGGATCCTATATTGCGTGCTCTGTCCCC'-3 (SEQ.ID.NO.: 72).

The 1.0 kb PCR fragment was digest with EcoRI and BamHl and cloned into EcoRI -BamHl

site of pCMV expression vector. Nucleic acid (SEQ.ID.NO.: 73) and amino acid

(SEQ.ID.NO.: 74) sequences for human MC4 were thereafter determined.

6. CCKB

To obtain CCKB, PCR was performed using human stomach cDNA as template and

rTth poymerase (Perkin Elmer) with the buffer system provided by the manufacturer, 0.25uM

of each primer, and 0.2 mM of each 4 nucleotides. The cycle condition for each PCR reaction

was 30 cycles of 94°C for 1 min, 65°C for lmin and 72°C for 1 min and 30 sec.

The 5' PCR contained a Hindlll site with the sequence:

5'-CCGAAGCTTCGAGCTGAGTAAGGCGGCGGGCT-3' (SEQ.ID.NO.: 75) and the 3' primer contained an EcoRI site with the sequence:

5'-GTGGAATTCATTTGCCCTGCCTCAACCCCCA-3 (SEQ.ID.NO.: 76).

The resulting 1.44 kb PCR fragment was digest with Hindlll and EcoRI and cloned into Hindlll-EcoRI site of pCMV expression vector. Nucleic acid (SEQ.ID.NO.: 77) and amino

acid (SEQ.ID.NO.: 78) sequences for human CCKB were thereafter determined.

7. TDAG8

To obtain TDAG8, PCR was performed using genomic DNA as template and rTth

polymerase (Perkin Elmer) with the buffer system provided by the manufacturer, 0.25 μM of

each primer, and 0.2 mM of each 4 nucleotides. The cycle condition was 30 cycles of 94°C

for 1 min, 56°C for lmin and 72 °C for 1 min and 20 sec. The 5' PCR primer contained a

Hindlll site with the following sequence:

5'-TGCAAGCTTAAAAAGGAAAAAATGAACAGC-3' (SEQ.ID.NO.: 79) and the 3' primer contained a BamHl site with the following sequence:

5'-TAAGGATCCCTTCCCTTCAAAACATCCTTG -3' (SEQ.ID.NO.: 80).

The resulting 1.1 kb PCR fragment was digested with Hindlll and BamHl and cloned into

Hindlll -BamHl site of pCMV expression vector. Three resulting clones sequenced contained

three potential polymoφhisms involving changes of amino acid 43 from Pro to Ala, amino

acid 97 from Lys to Asn and amino acid 130 from He to Phe. Nucleic acid (SEQ.ID.NO.: 81)

and amino acid (SEQ.ID.NO.: 82) sequences for human TDAG8 were thereafter determined.

8. H9

To obtain H9, PCR was performed using pituitary cDNA as template and rTth

polymerase (Perkin Elmer) with the buffer system provided by the manufacturer, 0.25 μM of

each primer, and 0.2 mM of each 4 nucleotides. The cycle condition was 30 cycles of 94°C

for 1 min, 62°C for 1 min and 72°C for 2 min. The 5' PCR primer contained a Hindlll site

with the following sequence:

5'-GGAAAGCTTAACGATCCCCAGGAGCAACAT-3' (SEQ.ID.NO.: 15)

and the 3' primer contained a BamHl site with the following sequence: 5'-CTGGGATCCTACGAGAGCATTTTTCACACAG-3' (SEQ.ID.NO.:16).

The resulting 1.9 kb PCR fragment was digested with Hindlll and BamHl and cloned into

Hindlll-BamHI site of pCMV expression vector. H9 contained three potential polymoφhisms

involving changes of amino acid P320S, S493N and amino acid G448A. Nucleic acid

(SEQ.ID.NO.: 139) and amino acid (SEQ.ID.NO.: 140) sequences for human H9 were

thereafter determined and verified.

Example 2

PREPARATION OF NON-ENDOGENOUS, CONSTITUTIVELY ACTIVATED GPCRS

Those skilled in the art are credited with the ability to select techniques for

mutation of a nucleic acid sequence. Presented below are approaches utilized to create

non-endogenous versions of several of the human GPCRs disclosed above. The mutations

disclosed below are based upon an algorithmic approach whereby the 16^th amino acid

(located in the IC3 region of the GPCR) from a conserved proline residue (located in the

TM6 region of the GPCR, near the TM6/IC3 interface) is mutated, most preferably to a

lysine amino acid residue.

1. Tranformer Site-Directed ™ Mutagenesis

Preparation of non-endogenous human GPCRs may be accomplished on human

GPCRs using Transformer Site-Directed™ Mutagenesis Kit (Clontech) according to the

manufacturer instructions. Two mutagenesis primers are utilized, most preferably a lysine

mutagenesis oligonucleotide that creates the lysine mutation, and a selection marker

oligonucleotide. For convenience, the codon mutation to be incoφorated into the human

GPCR is also noted, in standard form (Table E): TABLE E

Receptor Identifier Codon Mutation hARE-3 F313K hARE-4 V233K hARE-5 A240K hGPCR14 L257K hGPCR27 C283K hARE-1 E232K hARE-2 G285K hPPRl L239K hG2A K232A hRUP3 L224K hRUP5 A236K hRUPό N267K hRUP7 A302K hCHN4 V236K hMC4 A244K hCHN3 S284K hCHN6 L352K hCHN8 N235K hCHN9 G223K hCHNlO L231K hH9 F236K

The following GPCRs were mutated according with the above method using the

designated sequence primers (Table F).

TABLE F

Receptor Codon Lysine Mutagenesis Selection Marker

Identifier Mutation (SEQ.ID.NO.) (SEQ.ID.NO.)

5'-3' orientation, mutation 5'-3' orientation sequence underlined hRUP4 V272K CAGGAAGAAGAAACGAGC CACTGTCACCATCATAATG

TGTCATTATGATGGTGACA ACAGCTCGTTTCTTCTTCC

GTG (83) TG (84) hATl see below alternative approach; see below alternative approach; see below hGPR38 V297K GGCCACCGGCAGACCAAAC CTCCTTCGGTCCTCCTATC

GCGTCCTGCTG (85) GTTGTCAGAAGT (86) hCCKB V332K alternative approach; see below alternative approach; see below hTDAG8 I225K GGAAAAGAAGAGAATCAA CTCCTTCGGTCCTCCTATC

AAAACTACTTGTCAGCATC GTTGTCAGAAGT (88)

(87) hH9 F236K GCTGAGGTTCGCAATAAAC CTCCTTCGGTCCTCCTATC

TAACCATGTTTGTG (143) GTTGTCAGAAGT (144) hMC4 A244K GCCAATATGAAGGGAAAA CTCCTTCGGTCCTCCTATC

ATTACCTTGACCATC (137) GTTGTCAGAAGT (138)

The non-endogenous human GPCRs were then sequenced and the derived and

verified nucleic acid and amino acid sequences are listed in the accompanying "Sequence

Listing" appendix to this patent document, as summarized in Table G below:

TABLE G

Non Endogenous Human Nucleic Acid Sequence Listing Amino Acid Sequence GPCR Listing hRUP4 SEQ.ID.NO.: 127 SEQ.ID.NO.: 128

(V272K) hATl (see alternative approaches (see alternative approaches,

(see alternative approaches below) below) below) hGPR38 SEQ.ID.NO.: 129 SEQ.ID.NO.: 130

(V297K) hCCKB SEQ.ID.NO.: 131 SEQ.ID.NO.: 132

(V332K)

HTDAG8 SEQ.ID.NO.: 133 SEQ.ID.NO.: 134

(I225K) hH9 SEQ.ID.NO.: 141 SEQ.ID.NO.: 142

(F236K) hMC4 SEQ.ID.NO.: 135 SEQ.ID.NO.: 136

(A244K) 2. Alternative Approaches For Creation of Non-Endogenous Human GPCRs

a. ATI

1. F239K Mutation

Preparation of a non-endogenous, constitutively activated human ATI receptor was

accomplished by creating an F239K mutation (see, SEQ.ID.NO. : 89 for nucleic acid sequence,

and SEQ.ID.NO.: 90 for amino acid sequence). Mutagenesis was performed using

Transformer Site-Directed Mutagenesis™ Kit (Clontech) according to the to manufacturer's

instructions. The two mutagenesis primers were used, a lysine mutagenesis oligonucleotide

(SEQ.ID.NO.: 91) and a selection marker oligonucleotide (SEQ.ID.NO.: 92), which had the

following sequences:

5'-CCAAGAAATGATGATATTAAAAAGATAATTATGGC-3' (SEQ.ID.NO.: 91) 5'-CTCCTTCGGTCCTCCTATCGTTGTCAGAAGT-3' (SEQ.ID.NO.: 92),

respectively.

2. N111A Mutation

Preparation of a non-endogenous human ATI receptor was also accomplished by

creating an Nl 11 A mutation (see, SEQ.ID.NO. :93 for nucleic acid sequence, and

SEQ.ID.NO.: 94 for amino acid sequence). Two PCR reactions were performed using pfu

polymerase (Stratagene) with the buffer system provided by the manufacturer,

supplemented with 10% DMSO, 0.25 μM of each primer, and 0.5 mM of each 4

nucleotides. The 5' PCR sense primer used had the following sequence: 5'-CCCAAGCTTCCCCAGGTGTATTTGAT-3' (SEQ.ID.NO.: 95) and the antisense primer had the following sequence: 5'-CCTGCAGGCGAAACTGACTCTGGCTGAAG-3' (SEQ.ID.NO.: 96). The resulting 400 bp PCR fragment was digested with Hindlll site and subcloned into

Hindlll-Smal site of pCMV vector (5' construct). The 3' PCR sense primer used had the

following sequence: 5'-CTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGAT-3' (SEQ.ID.NO: 97) and the antisense primer had the following sequence:. 5'-GTTGGATCCACATAATGCATTTTCTC-3' (SEQ.ID.NO: 98) The resulting 880 bp PCR fragment was digested with BamHl and inserted into Pst

(blunted by T4 polymerase) and BamHl site of 5^" construct to generated the full length

Nl 11 A construct. The cycle condition was 25 cycles of 94°C for 1 min, 60°C for lmin

and 72 °C for 1 min (5' PCR) or 1.5 min (3' PCR).

3. AT2K255IC3 Mutation

Preparation of a non-endogenous, constitutively activated human ATI was

accomplished by creating an AT2K255IC3 "domain swap" mutation (see, SEQ.ID.NO.:99

for nucleic acid sequence, and SEQ.ID.NO.: 100 for amino acid sequence). Restriction

sites flanking IC3 of ATI were generated to facilitate replacement of the IC3 with

corresponding IC3 from angiotensin II type 2 receptor (AT2). This was accomplished by

performing two PCR reactions. A 5' PCR fragment (Fragment A) encoded from the 5'

untranslated region to the beginning of IC3 was generated by utilizing SEQ.ID.NO.: 63 as

sense primer and the following sequence:

5'-TCCGAATTCCAAAATAACTTGTAAGAATGATCAGAAA-3' (SEQ.ID.NO.: 101) as antisense primer. A 3' PCR fragment (Fragment B) encoding from the end of IC3 to the

3' untranslated region was generated by using the following sequence: 5'-AGATCTTAAGAAGATAATTATGGCAATTGTGCT-3' (SEQ.ID.NO.: 102) as sense primer and SEQ.ID.NO.: 64 as antisense primer. The PCR condition was 30

cycles of 94°C for 1 min, 55°C for lmin and 72 °C for 1.5 min using endogenous ATI

cDNA clone as template and pfu polymerase (Stratagene), with the buffer systems

provided by the manufacturer, supplemented with 10% DMSO, 0.25 μM of each primer,

and 0.5 mM of each 4 nucleotides. Fragment A (720 bp) was digested with Hindlll and

EcoRI and subcloned. Fragment B was digested with BamHl and subcloned into pCMV

vector with an EcoRI site 5' to the cloned PCR fragment.

The DNA fragment (Fragment C) encoding IC3 of AT2 with a L255K mutation

and containing an EcoRI cohesive end at 5' and a AfHI cohesive end at 3^". was generated

by annealing 2 synthetic oligonucleotides having the following sequences:

5'AATTCGAAAACACTTACTGAAGACGAATAGCTATGGGAAGAACAGGATAACCCGTGACCAA G-3' (sense; SEQ.ID.NO: 103)

5'TTAACTTGGTCACGGGTTATCCTGTTCTTCCCATAGCTATTCGTCTTCAGT AAGTGTTTTCG-3' (antisense; SEQ.ID.NO.: 104).

Fragment C was inserted in front of Fragment B through EcoRI and Aflll site. The

resulting clone was then ligated with the Fragment A through the EcoRI site to generate ATI

with AT2K255IC3.

4. A243+ Mutation

Preparation of a non-endogenous human ATI receptor was also accomplished by

creating an A243+ mutation (see, SEQ.ID.NO.: 105 for nucleic acid sequence, and

SEQ.ID.NO.: 106 for amino acid sequence). An A243+ mutation was constructed using the

following PCR based strategy: Two PCR reactions was performed using pfu polymerase

(Stratagene) with the buffer system provided by the manufacturer supplemented with 10%

DMSO, 0.25 μM of each primer, and 0.5 mM of each 4 nucleotides. The 5^" PCR sense primer utilized had the following sequence:

5'-CCCAAGCTTCCCCAGGTGTATTTGAT-3' (SEQ.ID.NO.: 107) and the antisense primer had the following sequence:

5'-AAGCACAATTGCTGCATAATTATCTTAAAAATATCATC-3' (SEQ.ID.NO.: 108).

The 3 ' PCR sense primer utilized had the following sequence:

5'-AAGATAATTATGGCAGCAATTGTGCTTTTCTTTTTCTTT-3' (SEQ.ID.NO: 109)

containing the Ala insertion and antisense primer: 5'-GTTGGATCCACATAATGCATTTTCTC-3'(SEQ.ID.NO.: 110). The cycle condition was 25 cycles of 94°C for 1 min, 54°C for lmin and 72 °C for 1.5 min.

An aliquot of the 5' and 3' PCR were then used as co-template to perform secondary PCR

using the 5' PCR sense primer and 3' PCR antisense primer. The PCR condition was the

same as primary PCR except the extention time was 2.5 min. The resulting PCR fragment

was digested with Hindlll and BamHl and subcloned into pCMV vector. (See,

SEQ.ID.NO.: 105)

4. CCKB

Preparation of the non-endogenous, constitutively activated human CCKB receptor

was accomplished by creating a V322K mutation (see, SEQ.ID.NO.: I l l for nucleic acid

sequence and SEQ.ID.NO.: 112 for amino acid sequence). Mutagenesis was performed by

PCR via amplification using the wildtype CCKB from Example 1.

The first PCR fragment (lkb) was amplified by using SEQ.ID.NO.: 75 and an

antisense primer comprising a V322K mutation:

5'-CAGCAGCATGCGCTTCACGCGCTTCTTAGCCCAG-3' (SEQ.ID.NO.: 113). The second PCR fragment (0.44kb) was amplified by using a sense primer comprising the

V322K mutation: 5'-AGAAGCGCGTGAAGCGCATGCTGCTGGTGATCGTT-3' (SEQ.ID.NO: 114) and SEQ.ID.NO.:

76.

The two resulting PCR fragments were then used as template for amplifying CCKB

comprising V332K, using SEQ.ID.NO.: 75 and SEQ.ID.NO.: 76 and the above-noted

system and conditions. The resulting 1.44kb PCR fragment containing the V332K

mutation was digested with Hindlll and EcoRI and cloned into Hindlll-EcoRI site of

pCMV expression vector. (See, SEQ.ID.NO.: 111).

3. QuikChange™ Site-Directed™ Mutagenesis

Preparation of non-endogenous human GPCRs can also be accomplished by using

QuikChange™ Site-Directed™ Mutagenesis Kit (Stratagene, according to manufacturer^'s

instructions). Endogenous GPCR is preferably used as a template and two mutagenesis

primers utilized, as well as, most preferably, a lysine mutagenesis oligonucleotide and a

selection marker oligonucleotide (included in kit). For convenience, the codon mutation

incoφorated into the human GPCR and the respective oligonucleotides are noted, in standard

form (Table H):

TABLE H

Receptor Codon Lysine Mutagenesis Selection Marker

Identifier Mutation (SEQ.ID.NO.) (SEQ.ID.NO.) 5'-3' orientation, mutation 5'-3' orientation underlined hCHN3 S284K ATGGAGAAAAGAATCAAAAGAA TATATAGAACATTCTTTT TGTTCTATATA (115) GATTCTTTTCTCCAT

(1 16) hCHN6 L352K CGCTCTCTGGCCTTGAAGCGCAC GCTGAGCGTGCGCTTCA GCTCAGC (117) AGGCCAGAGAGCG (118) hCHN8 N235K CCCAGGAAAAAGGTGAAAGTCA GAAAACTTTGACTTTCAC AAGTTTTC (119) CTTTTTCCTGGG (120) hCHN9 G223K GGGGCGCGGGTGAAACGGCTGG GCTCACCAGCCGTTTCA TGAGC (121) CCCGCGCCCC (122) hCHNlO L231K CCCCTTGAAAAGCCTAAGAACTT GATGACCAAGTTCTTAG GGTCATC (123) GCTTTTCAAGGGG (124)

Example 3

RECEPTOR EXPRESSION

Although a variety of cells are available to the art for the expression of proteins, it is

most preferred that mammalian cells be utilized. The primary reason for this is predicated

upon practicalities, i.e., utilization of, e.g., yeast cells for the expression of a GPCR, while

possible, introduces into the protocol a non-mammalian cell which may not (indeed, in the

case of yeast, does not) include the receptor-coupling, genetic-mechanism and secretary

pathways that have evolved for mammalian systems - thus, results obtained in non-

mammalian cells, while of potential use, are not as preferred as that obtained from mammalian

cells. Of the mammalian cells, COS-7, 293 and 293T cells are particularly preferred, although

the specific mammalian cell utilized can be predicated upon the particular needs of the artisan.

On day one, 1X10⁷ 293T cells per 150mm plate were plated out. On day two, two

reaction tubes were prepared (the proportions to follow for each tube are per plate): tube A

was prepared by mixing 20μg DNA (e.g., pCMV vector; pCMV vector with receptor

cDNA, etc.) in 1.2ml serum free DMEM (Irvine Scientific. Irvine, CA); tube B was prepared by mixing 120μl lipofectamine (Gibco BRL) in 1.2ml serum free DMEM. Tubes

A and B were admixed by inversions (several times), followed by incubation at room

temperature for 30-45min. The admixture is referred to as the "transfection mixture".

Plated 293T cells were washed with 1XPBS, followed by addition of 10ml serum free

5 DMEM. 2.4ml of the transfection mixture were added to the cells, followed by incubation

for 4hrs at 37°C/5% CO,. The transfection mixture was removed by aspiration, followed

by the addition of 25ml of DMEM/10% Fetal Bovine Serum. Cells were incubated at

37°C/5% CO₂. After 72hr incubation, cells were harvested and utilized for analysis.

Example 4 l o ASSAYS FOR DETERMINATION OF CONSTITUTIVE ACTIVITY OF NON-ENDOGENOUS GPCRs

A variety of approaches are available for assessment of constitutive activity of the

non-endogenous human GPCRs. The following are illustrative; those of ordinary skill in

the art are credited with the ability to determine those techniques that are preferentially

15 beneficial for the needs of the artisan.

1. Membrane Binding Assays. [³⁵S] GTPγS Assay

When a G protein-coupled receptor is in its active state, either as a result of ligand

binding or constitutive activation, the receptor couples to a G protein and stimulates the

release of GDP and subsequent binding of GTP to the G protein. The alpha subunit of the G

20 protein-receptor complex acts as a GTPase and slowly hydrolyzes the GTP to GDP, at which

point the receptor normally is deactivated. Constitutively activated receptors continue to

exchange GDP for GTP. The non-hydrolyzable GTP analog, [³⁵S]GTPγS. can be utilized to

demonstrate enhanced binding of [³⁵S] GTPγS to membranes expressing constitutively

activated receptors. The advantage of using [³⁵S] GTPγS binding to measure constitutive activation is that: (a) it is generically applicable to all G protein-coupled receptors; (b) it is

proximal at the membrane surface making it less likely to pick-up molecules which affect the

intracellular cascade.

The assay utilizes the ability of G protein coupled receptors to stimulate [³⁵S]GTPγS

binding to membranes expressing the relevant receptors. The assay can, therefore, be used in

the direct identification method to screen candidate compounds to known, oφhan and

constitutively activated G protein-coupled receptors. The assay is generic and has application

to drug discovery at all G protein-coupled receptors.

The [³⁵S]GTPγS assay can be incubated in 20 mM HEPES and between 1 and about

20mM MgCl₂ (this amount can be adjusted for optimization of results, although 20mM is

preferred) pH 7.4, binding buffer with between about 0.3 and about 1.2 nM [³⁵S]GTPγS (this

amount can be adjusted for optimization of results, although 1.2 is preferred ) and 12.5 to 75

μg membrane protein (e.g, COS-7 cells expressing the receptor; this amount can be adjusted

for optimization, although 75 μg is preferred) and 1 μM GDP (this amount can be changed for

optimization) for 1 hour. Wheatgerm agglutinin beads (25 μl; Amersham) should then be

added and the mixture incubated for another 30 minutes at room temperature. The tubes are

then centrifuged at 1500 x g for 5 minutes at room temperature and then counted in a

scintillation counter.

A less costly but equally applicable alternative has been identified which also meets

the needs of large scale screening. Flash plates™ and Wallac™ scintistrips may be utilized

to format a high throughput [³⁵S]GTPγS binding assay. Furthermore, using this technique,

the assay can be utilized for known GPCRs to simultaneously monitor tritiated ligand binding

to the receptor at the same time as monitoring the efficacy via [³⁵S]GTPγS binding. This is possible because the Wallac beta counter can switch energy windows to look at both tritium

and ³⁵S-labeled probes. This assay may also be used to detect other types of membrane

activation events resulting in receptor activation. For example, the assay may be used to

monitor ³²P phosphorylation of a variety of receptors (both G protein coupled and tyrosine

kinase receptors). When the membranes are centrifuged to the bottom of the well, the bound

[³⁵S]GTPγS or the ³²P-phosphorylated receptor will activate the scintillant which is coated of

the wells. Scinti^® strips (Wallac) have been used to demonstrate this principle. In addition, the

assay also has utility for measuring ligand binding to receptors using radioactively labeled

ligands. In a similar manner, when the radiolabeled bound ligand is centrifuged to the bottom

of the well, the scintistrip label comes into proximity with the radiolabeled ligand resulting

in activation and detection.

2. Adenylyl Cyclase

A Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A)

designed for cell-based assays can be modified for use with crude plasma membranes. The

Flash Plate wells contain a scintillant coating which also contains a specific antibody-

recognizing cAMP. The cAMP generated in the wells was quantitated by a direct

competition for binding of radioactive cAMP tracer to the cAMP antibody. The following

serves as a brief protocol for the measurement of changes in cAMP levels in membranes that

express the receptors.

Transfected cells are harvested approximately three days after transfection.

Membranes were prepared by homogenization of suspended cells in buffer containing 20mM

HEPES, pH 7.4 and lOmM MgCl₂. Homogenization is performed on ice using a Brinkman

Polytron™ for approximately 10 seconds. The resulting homogenate is centrifuged at 49.000 X g for 15 minutes at 4°C. The resulting pellet is then resuspended in buffer containing

20mM HEPES, pH 7.4 and 0.1 mM EDTA, homogenized for 10 seconds, followed by

centrifugation at 49,000 X g for 15 minutes at 4°C. The resulting pellet can be stored at -

80 °C until utilized. On the day of measurement, the membrane pellet is slowly thawed at

room temperature, resuspended in buffer containing 20mM HEPES, pH 7.4 and lOmM

MgCL₂ (these amounts can be optimized, although the values listed herein are preferred), to

yield a final protein concentration of 0.60mg/ml (the resuspended membranes were placed

on ice until use).

cAMP standards and Detection Buffer (comprising 2 μCi of tracer [¹²⁵I cAMP (100

l] to 11 ml Detection Buffer) are prepared and maintained in accordance with the

manufacturer's instructions. Assay Buffer is prepared fresh for screening and contained

20mM HEPES, pH 7.4, lOmM MgCl₂, 20mM (Sigma), 0.1 units/ml creatine phosphokinase

(Sigma), 50 μM GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer can be stored on ice

until utilized. The assay is initiated by addition of 50ul of assay buffer followed by addition

of 50ul of membrane suspension to the NEN Flash Plate. The resultant assay mixture is

incubated for 60 minutes at room temperature followed by addition of 1 OOul of detection

buffer. Plates are then incubated an additional 2-4 hours followed by counting in a Wallac

MicroBeta™ scintillation counter. Values of cAMP/well are extrapolated from a standard

cAMP curve that is contained within each assay plate.

C. Reporter-Based Assays

1. CREB Reporter Assay (Gs-associated receptors)

A method to detect Gs stimulation depends on the known property of the transcription

factor CREB, which is activated in a cAMP-dependent manner. A PathDetect™ CREB trans- Reporting System (Stratagene, Catalogue # 219010) can utilized to assay for Gs coupled

activity in 293 or 293T cells. Cells are transfected with the plasmids components of this

above system and the indicated expression plasmid encoding endogenous or mutant receptor

using a Mammalian Transfection Kit (Stratagene, Catalogue #200285) according to the

manufacturer' s instructions. Briefly, 400 ng pFR-Luc (luciferase reporter plasmid containing

Gal4 recognition sequences), 40 ng pFA2-CREB (Gal4-CREB fusion protein containing the

Gal4 DNA-binding domain), 80 ng pCMV -receptor expression plasmid (comprising the

receptor) and 20 ng CMV-SEAP (secreted alkaline phosphatase expression plasmid; alkaline

phosphatase activity is measured in the media of transfected cells to control for variations in

transfection efficiency between samples) are combined in a calcium phosphate precipitate as

per the Kit's instructions. Half of the precipitate is equally distributed over 3 wells in a 96-

well plate, kept on the cells overnight, and replaced with fresh medium the following morning.

Forty-eight (48) hr after the start of the transfection, cells are treated and assayed for, e.g.,

luciferase activity

2. API reporter assay (Gq-associated receptors)

A method to detect Gq stimulation depends on the known property of Gq-dependent

phospholipase C to cause the activation of genes containing API elements in their promoter.

A Pathdetect™ AP-1 cis-Reporting System (Stratagene, Catalogue # 219073) can be utilized

following the protocol set forth above with respect to the CREB reporter assay, except that

the components of the calcium phosphate precipitate were 410 ng pAP 1 -Luc. 80 ng pCMV-

receptor expression plasmid, and 20 ng CMV-SEAP.

3. CRE-LUC Reporter Assay

293 and 293T cells are plated-out on 96 well plates at a density of 2 x 10⁴ cells per well and were transfected using Lipofectamine Reagent (BRL) the following day according

to manufacturer instructions. A DNA/lipid mixture is prepared for each 6-well transfection

as follows: 260ng of plasmid DNA in lOOμl of DMEM were gently mixed with 2μl of lipid

in lOOμl of DMEM (the 260ng of plasmid DNA consisted of 200ng of a 8xCRE-Luc reporter

plasmid (.see below and Figure 1 for a representation of a portion of the plasmid), 50ng of

pCMV comprising endogenous receptor or non-endogenous receptor or pCMV alone, and

lOng of a GPRS expression plasmid (GPRS in pcDNA3 (Invitrogen)). The 8XCRE-Luc

reporter plasmid was prepared as follows: vector SRIF-β-gal was obtained by cloning the rat

somatostatin promoter (-71/+51) at BglV-Hindlll site in the pβgal-Basic Vector (Clontech).

Eight (8) copies of cAMP response element were obtained by PCR from an adenovirus

template AdpCF126CCRE8 (see, 1 Human Gene Therapy 1883 (1996)) and cloned into the

SRIF-β-gal vector at the Kpn-BglV site, resulting in the 8xCRE-β-gal reporter vector. The

8xCRE-Luc reporter plasmid was generated by replacing the beta-galactosidase gene in the

8xCRE-β-gal reporter vector with the luciferase gene obtained from the pGL3 -basic vector

(Promega) at the Hindlll-BamHI site. Following 30 min. incubation at room temperature, the

DNA/lipid mixture was diluted with 400 μl of DMEM and lOOμl of the diluted mixture was

added to each well. 100 μl of DMEM with 10% FCS were added to each well after a 4hr

incubation in a cell culture incubator. The following day the transfected cells were changed

with 200 μl/well of DMEM with 10% FCS. Eight (8) hours later, the wells were changed to

100 μl /well of DMEM without phenol red, after one wash with PBS. Luciferase activity were

measured the next day using the LucLite™ reporter gene assay kit (Packard) following

manufacturer instructions and read on a 1450 MicroBeta™ scintillation and luminescence

counter (Wallac). 4. SRF-LUC Reporter Assay

One method to detect Gq stimulation depends on the known property of Gq-dependent

phospholipase C to cause the activation of genes containing serum response factors in their

promoter. A Pathdetect™ SRF-Luc-Reporting System (Stratagene) can be utilized to assay

for Gq coupled activity in, e.g., COS7 cells. Cells are transfected with the plasmid

components of the system and the indicated expression plasmid encoding endogenous or non-

endogenous GPCR using a Mammalian Transfection™ Kit (Stratagene, Catalogue #200285)

according to the manufacturer' s instructions. Briefly, 410 ng SRF-Luc.80 ng pCMV -receptor

expression plasmid and 20 ng CMV-SEAP (secreted alkaline phosphatase expression plasmid;

alkaline phosphatase activity is measured in the media of transfected cells to control for

variations in transfection efficiency between samples) are combined in a calcium phosphate

precipitate as per the manufacturer' s instructions. Half of the precipitate is equally distributed

over 3 wells in a 96-well plate, kept on the cells in a serum free media for 24 hours. The last

5 hours the cells are incubated with 1 μM Angiotensin, where indicated. Cells are then lysed

and assayed for luciferase activity using a Luclite™ Kit (Packard, Cat. # 601691 1) and "Trilux

1450 Microbeta" liquid scintillation and luminescence counter (Wallac) as per the

manufacturer's instructions. The data can be analyzed using GraphPad Prism™ 2.0a

(GraphPad Software Inc.).

5. Intracellular IP₃ Accumulation Assay

On day 1 , cells comprising the receptors (endogenous and/or non-endogenous) can

be plated onto 24 well plates, usually IxlO⁵ cells/well (although his umber can be

optimized. On day 2 cells can be transfected by firstly mixing 0.25ug DNA in 50 ul serum

free DMEM/well and 2 ul lipofectamine in 50 μl serumfree DMEM/well. The solutions are gently mixed and incubated for 15-30 min at room temperature. Cells are washed with

0.5 ml PBS and 400 μl of serum free media is mixed with the transfection media and

added to the cells. The cells are then incubated for 3-4 hrs at 37°C/5%CO₂ and then the

transfection media is removed and replaced with 1 ml/well of regular growth media. On

day 3 the cells are labeled with ³H-myo-inositol. Briefly, the media is removed and the

cells are washed with 0.5 ml PBS. Then 0.5 ml inositol-free/serum free media (GIBCO

BRL) is added/well with 0.25 μCi of ³H-myo-inositol / well and the cells are incubated for

16-18 hrs o/n at 37°C/5%CO₂. On Day 4 the cells are washed with 0.5 ml PBS and 0.45

ml of assay medium is added containing inositol-free/serum free media 10 μM pargyline

10 mM lithium chloride or 0.4 ml of assay medium and 50 ul of lOx ketanserin (ket) to

final concentration of lOμM. The cells are then incubated for 30 min at 37 °C. The cells

are then washed with 0.5 ml PBSand 200 ul of fresh/icecold stop solution (1M KOH; 18

mM Na-borate; 3.8 mM EDTA) is added/well. The solution is kept on ice for 5-10 min or

until cells were lysed and then neutralized by 200 μl of fresh/ice cold neutralization sol.

(7.5 % HCL). The lysate is then transferred into 1.5 ml eppendorf tubes and 1 ml of

chloroform/methanol (1 :2) is added/tube. The solution is vortexed for 15 sec and the

upper phase is applied to a Biorad AG1-X8™ anion exchange resin (100-200 mesh).

Firstly, the resin is washed with water at 1 : 1.25 W/V and 0.9 ml of upper phase is loaded

onto the column. The column is washed with 10 mis of 5 mM myo-inositol and 10 ml of 5

mM Na-borate/60mM Na-formate. The inositol tris phosphates are eluted into scintillation

vials containing 10 ml of scintillation cocktail with 2 ml of 0.1 M formic acid/ 1 M

ammonium formate. The columns are regenerated by washing with 10 ml of 0.1 M formic

acid/3M ammonium formate and rinsed twice with dd H,O and stored at 4°C in water. Exemplary results are presented below in Table I:

TABLE I

Receptor Mutation Assay Signal Signal Percent

Utilized Generated: Generated: Difference

Endogenous Non-

Version Endogenous

(Relative Version

Light Units) (Relative Light Units) hATl F239K SRF-LUC 34 137 75% t

AT2K255IC3 SRF-LUC 34 127 73% 1

hTDAG8 I225K CRE-LUC 2,715 14,440 81%1 (293 cells)

I225K CRE-LUC 65,681 185,636 65% t (293 T cells) hH9 F236K CRE-LUC 1,887 6,096 69% 1 hCCKB V332K CRE-LUC 785 3,223 76% t

C. CELL-BASED DETECTION ASSAY (EXAMPLE -TDAG8)

293 cells were plated-out on 150mm plates at a density of 1.3 x 10⁷ cells per plate, and

were transfected using 12ug of the respective DNA and 60ul of Lipofectamine Reagent

(BRL) per plate. The transfected cells were grown in media containing serum for an assay

performed 24 hours post-transfection. For detection assay performed 48 hours post-

transfection (assay comparing serum and serum-free media; see Figure 3). the initial media

was changed to either serum or serum-free media. The serum-free media was comprised solely

of Dulbecco's Modified Eagle's (DME) High Glucose Medium (Irvine Scientific #9024). In

addition to the above DME Medium, the media with serum contained the following: 10%

Fetal Bovine Serum (Hyclone #SH30071.03), 1% of lOOmM Sodium Pyruvate (Irvine

Scientific #9334). 1 % of 20mM L-Glutamine (Irvine Scientific #9317), and 1 % of Penicillin- Streptomycin solution (Irvine Scientific #9366).

A 96-well Adenylyl Cyclase Activation Flashplate™ was used (NEN: #SMP004A).

First, 50ul of the standards for the assay were added to the plate, in duplicate, ranging from

concentrations of 50pmol to zero pmol cAMP per well. The standard cAMP (NEN:

#SMP004A) was reconstituted in water, and serial dilutions were made using lxPBS (Irvine

Scientific: #9240). Next, 50ul of the stimulation buffer (NEN: #SMP004A) was added to all

wells. In the case of using compounds to measure activation or inactivation of cAMP, lOul

of each compound, diluted in water, was added to its respective well, in triplicate. Various

final concentrations used range from luM up to ImM. Adenosine 5'-triphosphate, ATP,

(Research Biochemicals International: #A- 141) and Adenosine 5'-diphosphate, ADP, (Sigma:

#A2754) were used in the assay. Next, the 293 cells transfected with the respective cDNA

(CMV or TDAG8) were harvested 24 (assay detection in serum media) or 48 hours post-

transfection (assay detection comparing serum and serum-free media). The media was

aspirated and the cells washed once with lxPBS. Then 5ml of lxPBS was added to the cells

along with 3ml of cell dissociation buffer (Sigma: #C-1544). The detached cells were

transferred to a centrifuge tube and centrifuged at room temperature for five minutes. The

supernatant was removed and the cell pellet was resuspended in an appropriate amount of

lxPBS to obtain a final concentration of 2x10⁶ cells per milliliter. To the wells containing the

compound, 50ul of the cells in lxPBS (lxl 0⁵ cells/well) were added. The plate was incubated

on a shaker for 15 minutes at room temperature. The detection buffer containing the tracer

cAMP was prepared. In 11ml of detection buffer (NEN: #SMP004A). 50ul (equal to luCi)

of [¹²⁵I]cAMP (NEN: #SMP004A) was added. Following incubation, 50ul of this detection

buffer containing tracer cAMP was added to each well. The plate was placed on a shaker and incubated at room temperature for two hours. Finally, the solution from the wells of the plate

were aspirated and the flashplate was counted using the Wallac MicroBeta™ scintillation

counter.

In Figure 2A, ATP and ADP bind to endogenous TDAG8 resulting in an increase

of c AMP of about 59% and about 55% respectively. Figure 2B evidences ATP and ADP

binding to endogenous TDAG8 where endogenous TDAG8 was transfected and grown in

serum and serum-free medium. ATP binding to endogenous TDAG8 grown in serum

media evidences an increase in cAMP of about 65%, compared to the endogenous TDAG8

with no compounds; in serum-free media there was an increase of about 68%. ADP

binding to endogenous TDAG8 in serum evidences about a 61% increase, while in serum-

free ADP binding evidences an increase of about 62% increase. ATP and ADP bind to

endogenous TDAG8 with an EC50 value of 139.8uM and 120.5uM, respectively (data not

shown).

Although the results presented in Figure 2B indicate substantially the same results

when serum and serum-free media were compared, our choice is to use a serum based

media, although a serum-free media can also be utilized.

Example 6

GPCR FUSION PROTEIN PREPARATION

The design of the constitutively activated GPCR-G protein fusion construct was

accomplished as follows: both the 5' and 3' ends of the rat G protein Gsα (long form; Itoh.

H. et al., 83 PNAS 3776 (1986)) were engineered to include a Hindlll (5^"-AAGCTT-3')

sequence thereon. Following confirmation of the correct sequence (including the flanking

Hindlll sequences), the entire sequence was shuttled into pcDNA3.1(-) (Invitrogen, cat. no.

V795-20) by subcloning using the Hindlll restriction site of that vector. The correct orientation for the Gsα sequence was determined after subcloning into pcDNA3.1(-). The

modified pcDNA3.1 (-) containing the rat Gsα gene at Hindlll sequence was then verified; this

vector was now available as a "universal" Gsα protein vector. The pcDNA3.1(-) vector

contains a variety of well-known restriction sites upstream of the Hindlll site, thus

beneficially providing the ability to insert, upstream of the Gs protein, the coding sequence

of an endogenous, constitutively active GPCR. This same approach can be utilized to create

other "universal" G protein vectors, and, of course, other commercially available or

proprietary vectors known to the artisan can be utilized - the important criteria is that the

sequence for the GPCR be upstream and in-frame with that of the G protein.

TDAG8 couples via Gs, while H9 couples via Gz. For the following exemplary GPCR

Fusion Proteins, fusion to Gsα was accomplished.

A TDAG8(I225K)-Gsα Fusion Protein construct was made as follows: primers were

designed as follows:

5'-gatcTCTAGAATGAACAGCACATGTATTGAAG-3' (SEQ.ID.NO.: 125; sense) 5'-ctagGGTACCCGCTCAAGGACCTCTAATTCCATAG-3' (SEQ.ID.NO.: 126; antisense).

Nucleotides in lower caps are included as spacers in the restriction sites between the

G protein and TDAG8. The sense and anti-sense primers included the restriction sites for

Xbal and Kpnl, respectively.

PCR was then utilized to secure the respective receptor sequences for fusion within

the Gsα universal vector disclosed above, using the following protocol for each: 1 OOng cDNA

for TDAG8 was added to separate tubes containing 2ul of each primer (sense and anti-sense),

3uL of lOmM dNTPs, lOuL of 1 OXTaqPlus™ Precision buffer, luL of TaqPlus™ Precision

polymerase (Stratagene: #600211), and 80uL of water. Reaction temperatures and cycle times

for TDAG8 were as follows: the initial denaturing step was done it 94 °C for five minutes, and a cycle of 94°C for 30 seconds; 55 °C for 30 seconds; 72°C for two minutes. A final

extension time was done at 72 ° C for ten minutes. PCR product for was run on a 1 % agarose

gel and then purified (data not shown). The purified product was digested with Xbal and

Kpnl (New England Biolabs) and the desired inserts purified and ligated into the Gs universal

vector at the respective restriction site. The positive clones was isolated following

transformation and determined by restriction enzyme digest; expression using 293 cells was

accomplished following the protocol set forth infra. Each positive clone for TDAG8:Gs -

Fusion Protein was sequenced to verify correctness.

GPCR Fusion Proteins comprising non-endogenous, constitutively activated

TDAG8(I225K) were analyzed as above and verified for constitutive activation.

An H9(F236K)-Gsα Fusion Protein construct was made as follows: primers were

designed as follows:

5'-TTAgatatcGGGGCCCACCCTAGCGGT-3' (SEQ.ID.NO.: 145; sense) 5'-ggtaccCCCACAGCCATTTCATCAGGATC-3' (SEQ.ID.NO.: 146; antisense). Nucleotides in lower caps are included as spacers in the restriction sites between the

G protein and H9. The sense and anti-sense primers included the restriction sites for EcoRV

and Kpnl, respectively such that spacers (attributed to the restriction sites) exists between the

G protein and H9.

PCR was then utilized to secure the respective receptor sequences for fusion within

the Gsα universal vector disclosed above, using the following protocol for each: 80ng cDNA

for H9 was added to separate tubes containing lOOng of each primer (sense and anti-sense).

and 45uL of PCR Supermix™ (Gibco-Brl, LifeTech) (50ul total reaction volume). Reaction

temperatures and cycle times for H9 were as follows: the initial denaturing step was done it

94°C for one, and a cycle of 94°C for 30 seconds: 55 °C for 30 seconds: 72°C for two minutes. A final extension time was done at 72 °C for seven minutes. PCR product for was

run on a 1 % agarose gel and then purified (data not shown). The purified product was cloned

into pCRII-TOPO™ System followed by identification of positive clones. Positive clones

were isolated, digested with EcoRV and Kpnl (New England Biolabs) and the desired inserts

were isolated, purified and ligated into the Gs universal vector at the respective restriction site .

The positive clones was isolated following transformation and determined by restriction

enzyme digest; expression using 293 cells was accomplished following the protocol set forth

infra. Each positive clone for H9(F236K):Gs - Fusion Protein was sequenced to verify

correctness. Membranes were frozen (-80 °C) until utilized.

To ascertain the ability of measuring a cAMP response mediated by the Gs protein

(even though H9 couples with Gz), the following cAMP membrane assay was utilized, based

upon an NEN Adenyl Cyclase Activation Flahplate™ Assay kit (96 well format). "Binding

Buffer" consisted of 1 OmM HEPES, 1 OOmM NaCl and 1 OmM MgCl (ph 7.4). "Regeneration

Buffer" was prepared in Binding Buffer and consisted of 20mM phosphocreatine, 20U

creatine phosphokinase, 20uM GTP, 0.2mM ATP, and 0.6mM IBMX. "cAMP Standards"

were prepared in Binding Buffer as follows: cAMP Stock Added to Final Assay Concentration

(5,000 pmol ml in 2ml H₂0) indicted amount of Binding (50ul into lOOul) in ul Buffer to achieve indicated pmol/well

A 250 1ml 50

B 500 of A 500ul 25

C 500 of B 500ul 12.5

D 500 of C 750ul 5.0

E 500 of D 500ul 2.5

F 500 of E 500ul 1.25

G 500 of F 750ul 0.5

Frozen membranes (both pCMV as control and the non-endogenous H(-Gs Fusion

Protein) were thawed (on ice at room temperature until in solution). Membranes were homogenized with a polytron until in suspension (2 x 15 seconds). Membrane protein

concentration was determined using the Bradford Assay Protocol (see infra). Membrane

concentration was diluted to 0.5mg/ml in Regeneration Buffer (final assay concentration -

25ug/well). Thereafter, 50ul of Binding Buffer was added to each well. For control, 50ul/well

of cAMP standard was added to wells 11 and 12 A-G, with Binding Buffer alone to 12H (on

the 96-well format). Thereafter, 50ul/well of protein was added to the wells and incubated at

room temperature (on shaker) for 60min. 100ul[¹²⁵I]cAMP in Detection Buffer (see infra) was

added to each well (final - 50ul[¹²⁵I]cAMP into 11ml Detection Buffer). These were

incubated for 2hrs at room temperature. Plates were aspirated with an 8 channel manifold and

sealed with plate covers. Results (pmoles cAMP bound) were read in a Wallac™ 1450 on

"prot #15). Results are presented in Figure 3.

The results presented in Figure 3 indicate that the Gs coupled fusion was able to

"drive" the cyclase reaction such that measurement of the consitutive activation of H9(F236K)

was viable. Based upon these results, the direct identification of candidate compounds that

are inverse agonists, agonists and partial agonists is possible using a cyclase-based assay.

Example 6

Protocol: Direct Identification of Inverse Agonists and Agonists Using [³⁵S]GTPγS

Although we have utilized endogenous, constitutively active GPCRs for the direct

identification of candidate compounds as, e.g., inverse agonists, for reasons that are not

altogether understood, intra-assay variation can become exacerbated. Preferably, then, a

GPCR Fusion Protein, as disclosed above, is also utilized with a non-endogenous,

constitutively activated GPCR. We have determined that when such a protein is used, intra-

assay variation appears to be substantially stabilized, whereby an effective signal-to-noise

ratio is obtained. This has the beneficial result of allowing for a more robust identification of candidate compounds. Thus, it is preferred that for direct identification, a GPCR Fusion

Protein be used and that when utilized, the following assay protocols be utilized.

Membrane Preparation

Membranes comprising the non-endogenous, constitutively active oφhan GPCR

Fusion Protein of interest and for use in the direct identification of candidate compounds as

inverse agonists, agonists or partial agonists are preferably prepared as follows:

a. Materials

"Membrane Scrape Buffer" is comprised of 20mM HEPES and 1 OmM EDTA, pH 7.4;

"Membrane Wash Buffer" is comprised of 20 mM HEPES and 0.1 mM EDTA, pH 7.4;

"Binding Buffer" is comprised of 20mM HEPES, 100 mM NaCl, and 10 mM MgCl₂, pH 7.4

b. Procedure

All materials are kept on ice throughout the procedure. Firstly, the media is aspirated

from a confluent monolayer of cells, followed by rinse with 10ml cold PBS, followed by

aspiration. Thereafter, 5ml of Membrane Scrape Buffer is added to scrape cells; this is

followed by transfer of cellular extract into 50ml centrifuge tubes (centrifuged at 20,000 φm

for 17 minutes at 4°C). Thereafter, the supernatant is aspirated and the pellet is resuspended

in 30ml Membrane Wash Buffer followed by centrifuge at 20,000 φm for 17 minutes at 4 ° C .

The supernatant is then aspirated and the pellet resuspended in Binding Buffer. This is then

homogenized using a Brinkman polytron™ homogenizer (15-20 second bursts until the all

material is in suspension). This is referred to herein as "Membrane Protein".

Bradford Protein Assay

Following the homogenization, protein concentration of the membranes is determined

using the Bradford Protein Assay (protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-80°C) for later use; when frozen, protocol for use is as follows: on the day of the

assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then

homogenized with a polytron at about 12 x 1 ,000 φm for about 5-10 seconds; it is noted that

for multiple preparations, the homogenizor should be thoroughly cleaned between

homoginezation of different preparations).

a. Materials

Binding Buffer (as per above); Bradford Dye Reagent; Bradford Protein Standard are

utilized, following manufacturer instructions (Biorad. cat. no. 500-0006).

b. Procedure

Duplicate tubes are prepared, one including the membrane, and one as a control

"blank". Each contained 800ul Binding Buffer. Thereafter, lOul of Bradford Protein Standard

(lmg/ml) is added to each tube, and lOul of membrane Protein is then added to just one tube

(not the blank). Thereafter, 200ul of Bradford Dye Reagent is added to each tube, followed

by vortex of each. After five (5) minutes, the tubes were re-vortexed and the material therein

is transferred to cuvettes. The cuvettes are then read using a CECIL 3041 spectrophotometer,

at wavelength 595.

Direct Identification Assay

a. Materials

GDP Buffer consists of 37.5 ml Binding Buffer and 2mg GDP (Sigma, cat. no. G-

7127), followed by a series of dilutions in Binding Buffer to obtain 0.2 uM GDP (final

concentration of GDP in each well was 0.1 uM GDP); each well comprising a candidate

compound, has a final volume of 200ul consisting of lOOul GDP Buffer (final concentration,

O.luM GDP), 50ul Membrane Protein in Binding Buffer, and 50ul [³⁵S]GTPγS (0.6 nM) in Binding Buffer (2.5 ul [³⁵S]GTPγS per 10ml Binding Buffer).

b. Procedure

Candidate compounds are preferably screened using a 96-well plate format (these can

be frozen at -80 °C). Membrane Protein (or membranes with expression vector excluding the

GPCR Fusion Protein, as control), are homogenized briefly until in suspension. Protein

concentration is then determined using the Bradford Protein Assay set forth above. Membrane

Protein (and control) is then diluted to 0.25mg/ml in Binding Buffer (final assay

concentration, 12.5ug/well). Thereafter, 100 ul GDP Buffer is added to each well of a Wallac

Scintistrip™ (Wallac). A 5ul pin-tool is then used to transfer 5 ul of a candidate compound

into such well (i.e., 5ul in total assay volume of 200 ul is a 1 :40 ratio such that the final

screening concentration of the candidate compound is 1 OuM). Again, to avoid contamination,

after each transfer step the pin tool should be rinsed in three reservoirs comprising water (IX),

ethanol (IX) and water (2X) - excess liquid should be shaken from the tool after each rinse

and dried with paper and kimwipes. Thereafter, 50 ul of Membrane Protein is added to each

well (a control well comprising membranes without the GPCR Fusion Protein is also utilized),

and re-incubatedfor 5-10 minutes at room temperature. Thereafter, 50 ul of [³⁵S]GTPγS (0.6

nM) in Binding Buffer is added to each well, followed by incubation on a shaker for 60

minutes at room temperature (again, in this example, plates were covered with foil). The

assay is then stopped by spinning of the plates at 4000 RPM for 15 minutes at 22 °C. The

plates are then aspirated with an 8 channel manifold and sealed with plate covers. The plates

are then read on a Wallace 1450 using setting "Prof #37" (as per manufacturer instructions).

Example 7

Protocol: Confirmation Assay

Using an independent assay approach to provide confirmation of a directly identified candidate compound as set forth above, it is preferred that a confirmation assay then be

utilized. In this case, the preferred confirmation assay is a cyclase-based assay.

A modified Flash Plate™ Adenylyl Cyclase kit (New England Nuclear; Cat. No.

SMP004A) is preferably utilized for confirmation of candidate compounds directly identified

as inverse agonists and agonists to non-endogenous, constitutively activated oφhan GPCRs

in accordance with the following protocol.

Transfected cells are harvested approximately three days after transfection.

Membranes are prepared by homogenization of suspended cells in buffer containing 20mM

HEPES, pH 7.4 and lOmM MgCl₂. Homogenization is performed on ice using a Brinkman

Polytron™ for approximately 10 seconds. The resulting homogenate is centrifuged at 49,000

X g for 15 minutes at 4°C. The resulting pellet is then resuspended in buffer containing

20mM HEPES, pH 7.4 and 0.1 mM EDTA, homogenized for 10 seconds, followed by

centrifugation at 49,000 X g for 15 minutes at 4°C. The resulting pellet can be stored at -

80 °C until utilized. On the day of direct identification screening, the membrane pellet is

slowly thawed at room temperature, resuspended in buffer containing 20mM HEPES, pH 7.4

and lOmM MgCL2, to yield a final protein concentration of 0.60mg/ml (the resuspended

membranes are placed on ice until use).

cAMP standards and Detection Buffer (comprising 2 μCi of tracer [¹²⁵I cAMP (100

μl] to 11 ml Detection Buffer) are prepared and maintained in accordance with the

manufacturer's instructions. Assay Buffer is prepared fresh for screening and contained

20mM HEPES, pH 7.4, lOmM MgCl₂, 20mM phospocreatine (Sigma), 0.1 units/ml creatine

phosphokinase (Sigma), 50 μM GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer can

be stored on ice until utilized. Candidate compounds identified as per above (if frozen, thawed at room temperature)

are added, preferably, to 96-well plate wells (3μl/well; 12μM final assay concentration),

together with 40 μl Membrane Protein (30μg/well) and 50μl of Assay Buffer. This admixture

is then incubated for 30 minutes at room temperature, with gentle shaking.

Following the incubation, lOOμl of Detection Buffer is added to each well, followed

by incubation for 2-24 hours. Plates are then counted in a Wallac MicroBeta™ plate reader

using "Prot. #31 " (as per manufacturer instructions).

It is intended that each of the patents, applications, and printed publications mentioned

in this patent document be hereby incoφorated by reference in their entirety.

As those skilled in the art will appreciate, numerous changes and modifications may

be made to the preferred embodiments of the invention without departing from the spirit of

the invention. It is intended that all such variations fall within the scope of the invention.

Although a variety of expression vectors are available to those in the art, for

puφoses of utilization for both the endogenous and non-endogenous human GPCRs, it is

most preferred that the vector utilized be pCMV. This vector was deposited with the

American Type Culture Collection (ATCC) on October 13, 1998 (10801 University Blvd.,

Manassas, VA 20110-2209 USA) under the provisions of the Budapest Treaty for the

International Recognition of the Deposit of Microorganisms for the Puφose of Patent

Procedure. The DNA was tested by the ATCC and determined to be. The ATCC has

assigned the following deposit number to pCMV: ATCC #203351.

Claims

What is claimed is:

I . A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hARE-3(F313K).

2. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 1.

3. A Plasmid comprising a Vector and the cDNA of claim 1.

4. A Host Cell comprising the Plasmid of claim 3.

5. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hARE-4(V233K)

6. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 5.

7. A Plasmid comprising a Vector and the cDNA of claim 5.

8. A Host Cell comprising the Plasmid of claim 7.

9. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hARE-5(A240K).

10. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 9.

I I. A Plasmid comprising a Vector and the cDNA of claim 5.

12. A Host Cell comprising the Plasmid of claim 11.

13. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hGPCR14(L257K).

14. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 13.

15. A Plasmid comprising a Vector and the cDNA of claim 13.

16. A Host Cell comprising the Plasmid of claim 15.

17. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hGPCR27(C283K).

18. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 17.

19. A Plasmid comprising a Vector and the cDNA of claim 17.

20. A Host Cell comprising the Plasmid of claim 19.

21. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hARE-l(E232K).

22. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 21.

23. A Plasmid comprising a Vector and the cDNA of claim 21.

24. A Host Cell comprising the Plasmid of claim 23.

25. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hARE-2(G285K).

26. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 25.

27. A Plasmid comprising a Vector and the cDNA of claim 25.

28. A Host Cell comprising the Plasmid of claim 27.

29. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hPPRl(L239K).

30. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 29.

31. A Plasmid comprising a Vector and the cDNA of claim 29.

32. A Host Cell comprising the Plasmid of claim 31.

33. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hG2A(K232A).

34. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 33.

35. A Plasmid comprising a Vector and the cDNA of claim 33.

36. A Host Cell comprising the Plasmid of claim 35.

37. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hRUP3(L224K).

38. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 37.

39. A Plasmid comprising a Vector and the cDNA of claim 37.

40. A Host Cell comprising the Plasmid of claim 39.

41. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hRUP5(A236K).

42. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 41.

43. A Plasmid comprising a Vector and the cDNA of claim 41.

44. A Host Cell comprising the Plasmid of claim 42.

45. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hRUP6(N267K)

46. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 45.

47. A Plasmid comprising a Vector and the cDNA of claim 45.

48. A Host Cell comprising the Plasmid of claim 47.

49. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hRUP7(A302K).

50. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 49.

51. A Plasmid comprising a Vector and the cDNA of claim 49.

52. A Host Cell comprising the Plasmid of claim 51.

53. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hCHN4(V236K).

54. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 53.

55. A Plasmid comprising a Vector and the cDNA of claim 53.

56. A Host Cell comprising the Plasmid of claim 55.

57. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hMC4(A244K).

58. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 57.

59. A Plasmid comprising a Vector and the cDNA of claim 57.

60. A Host Cell comprising the Plasmid of claim 60.

61. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hCHN3(S284K).

62. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 61.

63. A Plasmid comprising a Vector and the cDNA of claim 61.

64. A Host Cell comprising the Plasmid of claim 63.

65. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hCHN6(L352K) .

66. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 65.

67. A Plasmid comprising a Vector and the cDNA of claim 65.

68. A Host Cell comprising the Plasmid of claim 67.

69. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hCHN8(N235K).

70. A non-endogenous version of a human G protein-coupled receptor encoded by the

cDNA of claim 69.

71. A Plasmid comprising a Vector and the cDNA of claim 69.

72. A Host Cell comprising the Plasmid of claim 71.

73. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled receptor comprising hH9(F236K).

74. A non-endogenous version of a human G protein-coupled receptor encoded by the cDNA of claim 73.

75. A Plasmid comprising a Vector and the cDNA of claim 73.

76. A Host Cell comprising the Plasmid of claim 74.

77. A cDNA encoding a non-endogenous, constitutively activated version of a human

G protein-coupled ATI receptor selected from the group consisting of:

hATl(F239K); hATl(Nl l lA); hATl(AT2K255IC3); and hATl (A243+).

78. A non-endogenous version of a human G protein-coupled receptor encoded by a

cDNA of claim 77.

79. A Plasmid comprising a Vector and the cDNA of claim 77.

80. A Host Cell comprising the Plasmid of claim 79.

- *A**********A**A*A*A**A*ιkA