NZ529714A - EPF receptor assays, compounds and therapeutic compositions - Google Patents

Abstract

Disclosed is an assay to identify compounds that mimic or alter the biological effects of early pregnancy factor (EPF) or chaperonin 10, which assay comprises the steps of: a) contacting EPF or a peptide having at least 70% sequence identity with EPF with a human dorsal root receptor 4 (hDRR4) and/or human dorsal root receptor 7 (hDRR7) polypeptide; b) contacting a test compound with said hDRR4 and/or hDRR7 polypeptide; and c) determining the effect of said test compound on said hDRR4 and/or hDRR7 polypeptide in a competitive, non-competitive or comparative assay with said EPF or peptide having at least 70% sequence identity with EPF. Further disclosed are isolated and purified hDRR4 and/or hDRR7 binding fragments of EPF or of a peptide having at least 70% sequence identity with EPF.

Description

b 3T7/Y- WO 03/005036 PCT/EP02/07263 EPF RECEPTOR ASSAYS, COMPOUNDS AND THERAPEUTIC COMPOSITIONS This invention relates to the field of assays for compounds that interact with the 5 receptor for Early Pregnancy Factor (EPF), also known as Chaperonin 10 and EPF-related peptides as well as the therapeutic use thereof.

BACKGROUND OF THE INVENTION EPF and the mitochondrial chaperonin 10 have identical amino acid sequences 10 (SEQ ID NO:4) although they may be encoded by different genes (Summers et al., 1998) and have very different physiological functions. Moreover, EPF is a secreted peptide, whereas chaperonin 10 is found in the intracellular vesicles along the secretory pathway.

Chaperonin 10 belongs to the family of heat shock proteins. In the mitochondria it 15 forms a chaperonin complex with heat shock protein 60 which is important for mitochondrial protein folding and function. Upon ischemia, upregulation of these two proteins is able to protect brain tissue as well as cardiac myocytes (Lau et al., 1997) against ischemia / reperfiision injury (Hickey et al., 2000).

Up until now, EPF is mainly known as an important factor in embryonic development, 20 in the pre-implementation stage as well as in the peri-implantation stage (Athanasas-Platsis et al., 2000). Its importance in these two phases is based on its growth regulatory and immunomodulatory properties. These actions of EPF are also apparent as it is produced by proliferating primary and neoplastic cells, where it functions as an autocrine growth factor both in vitro and in vivo (Morton, 1998). 25 The presence of EPF has been repeatedly confirmed as indispensable to successful pregnancy. Recently, Cheng SJ et al. (Am.J.Reprod. Immunol. 2000 Oct; 44(4):211-3) demonstrated that the EPF level declined rapidly after surgical abortion and as such suggests that monitoring the EPF activity is a useful index for embryonic care and development of normal pregnancy. Accordingly suppression of EPF activity 30 could have a contraceptive purpose, whilst enhancing EPF activity may prevent foetal loss. confirmation copy 2 EPF is already secreted into maternal serum within 6-12 hours after fertilisation, and EPF or EPF-derived or -related peptides could therefore be a useful early marker for diagnosing pregnancy. Such diagnostic would be useful in human medicine but also for veterinary applications. Currently used EPF assays (e.g. rosette test) are 5 cumbersome and unreliable. Moreover, they do not distinguish between various forms of EPF. Tests based on antibodies specific for (polypeptides with EPF activity or assays that distinguish the various forms of bioactive EPF (e.g. based on chromatography and/or mass spectroscopy) may therefore offer significant advantages. EPF activity has been repeatedly confirmed as indispensable to successful pregnancy. 10 Recently, Cheng SJ et al, (Am.J.Reprod. Immunol. 2000 Oct; 44(4):211-3) demonstrated that the EPF level declined rapidly after surgical abortion and as such suggests that monitoring the EPF activity is a useful index for embryonic well-being and development of normal pregnancy. Accordingly, suppression of EPF activity could have a contraceptive purpose, whilst enhancing physiological or correcting abnormal 15 EPF activity may prevent foetal loss.

It has been observed that pregnancy has a positive influence on the development of multiple sclerosis by decreasing the rate of relapses during pregnancy (Confavreux et al., 1998). As pointed out by Morton (1998), EPF is 'considered to be one of the major factors involved in the modification of multiple 20 sclerosis observed during pregnancy'. The positive effect of the immunosuppressive action of EPF during pregnancy could also be observed for another auto-immune disease, rheumatoid arthritis (Davis and Maslow, 1992).

The potential activities of EPF and chaperonin 10 in human systems make the peptides a target for studies aimed at identifying compounds that enhance or 25 diminish the biological effects of the peptides. However, while binding sites for EPF and chaperonin 10 were shown to exist, no receptor for these peptides was identified. The lack of a known receptor has hampered the design of assays and impeded efforts to discover and study compounds that mimic or alter the biological effects of EPF or chaperonin 10.

The present invention solves this problem in the art as reverse pharmacology has led to the identification of the human Dorsal Root Receptors (hDRRs) as receptor proteins for EPF or chaperonin 10. With this finding the present inventors further WO 03/005036 PCT/EP02/07263 3 substantiate the immunomodulatory properties of EPF as hDRR receptors are shown to be expressed in lymph nodes and chromosomal mapping of the hDRRs to chromosome llpl5 linked them to a number of lymphoblastic leukemias. It further provides assays to identify compounds that mimic or alter the biological effects of EPF or chaperonin 5 10, as well as the pharmacological use thereof. hDRRs belongs to the family of G protein coupled receptors (GPCRs) which share a common structural organization characterized by an extracellular N-terminal end, seven hydrophobic alpha helices putatively constituting transmembrane domains and an intracellular C-terminal domain. GPCRs bind a variety of ligands 10 that trigger intracellular signals through the activation of transducing G proteins (Caron et al., Rec. Prog. Horm. Res. 48:277-290 (1993); Freedman et al., Rec. Prog. Horm. Res. 51:319-353 (1996)).

Recent reviews (Stadel et al., 1997; Wilson et al., 1998) count the number of GPCRs being used as a target for commercially useful drugs to 25, this constitutes 18% 15 of the 140 characterized cloned human GPCRs. Extrapolation from fully sequenced genomes (yeast, C. elegans) to the expected 30.000 human genes leads to the expectation that 5000 human GPCRs will be found in the course of the next 3 years. In analogy to the current numbers, 150 of these novel orphan GPCRs should develop into a target of a commercially interesting drug during the next decade. This calculation 20 does not take into account that additional characterized GPCRs are currently the basis of compounds in development.

In general, it is fair to say that reverse pharmacology on orphan GPCRs will deliver novel approaches for the treatment of various diseases, which will outcompete current strategies or enable treatment of conditions that cannot be treated by current 25 means. This has been recognized by the pharmaceutical industry as is documented by recent publications on orphan GPCR ligand identification (orphanin FQ (Reinscheid et d, 1995.), oiexin (Sakurai et al, 1998), prolactin-releasing peptide (Hinuma et al.), apelin (Tatemoto et al., 1998).

The nucleic acid and polypeptide sequences of the human Dorsal Root 30 Receptors 1-6 were described in PCT application WO 99/32519 Al published July 1, 1999. Based on their homology to the rat Dorsal Root Receptor, this document describes the hDRR receptors as being involved in transmission, modulation and 4 sensation of pain, including the use thereof in assays for the identification of new agents for anesthesia and analgesia. In this PCT application the Dorsal Root Ganglia localization has been confirmed for hDRR5 in fetal dorsal root ganglia. However, for none of the human adult tissues examined thus far, including dorsal root ganglia, a 5 hDRR specific hybridization signal could be detected. In addition for none of the disclosed hDRR receptors in this application (WO 99/32519 Al) a natural ligand could be identified. The characterization of hDRR4 as an angiotensin receptor in aforesaid application (WO 99/32519-A1), based upon the stimulation of this receptor with angiotensin II and HI, could not be confirmed by the present inventors. 10 For another human Dorsal Root Receptor, hDRR7, the nucleic acid and polypeptide sequences were described in PCT applications WO 01/16159-A1 published March 08,2001 and in WO 01/19983-A1 published March 22, 2001. In neither of these documents a ligand for the hDRR7 receptor has been identified. In PCT application WO 01/16159-A1 the hDRR7 receptor is referred to as TheAnt disclosing a 15 large number of conditions associated with said polypeptide. However, no substantive evidence is provided to link this receptor to any of the enlisted disease states. In PCT application WO 01/19983 the hDRR7 receptor is generally described as a GPCR with low sequence similarity to the somatostatin 3 receptor.

Therefore, no assay employing competition with a natural ligand for hDRRs, or 20 employing a comparison to the interaction of the hDRRs with a natural ligand has been described. The latter is essential to use the hDRRs as pharmacological tools to explore receptor function and relationship to disease states. The present invention solves this problem in the art and provides assays that employ the interaction of hDRRs and EPF or EPF-related peptides, to determine whether a candidate compound is a ligand, 25 agonist or antagonist of hDRRs.

Only recently, Lembo et al (Nature Neuroscience 5,201-209 (2002)) demonstrated that the hDRR 4 receptor, also known as Sensory Neuron - Specific G protein coupled - Receptor 4 (SNSR4) or Mas Related Gene Receptor 1 (hMrgXl), are potently activated by gene products of the opioid peptide precursor proenkephalin A. In 30 particular BAM22 and BAM22 fragments, known to be involved in the control of nociception, were shown to activate the hDRR in a FLIPR based calcium assay.

In the present invention EPF and EPF-related peptides were shown to activate both the hDRR4 and hDRR7 receptors. Further, hDRR4 was shown to be predominantly expressed in dorsal root and trigeminal ganglia (Lembo et al., Nature Neuroscience 5, 201-209 (2002)), whilst for hDRR7 it has now been demonstrated that this receptor is predominantly expressed in lymph nodes. This receptor specific expression pattern suggests a different functionality in response to ligand activation.

It would accordingly be beneficial if one could design receptor-specific compounds useful in treating receptor related disorders. The identification of EPF and EPF-related peptides as ligands for hDRR4 and hDRR7, now provides a basis for the development of in vitro screening methods to identify compounds capable of modulating a hDRR involvement in the transmission, modulation and sensation of pain. Furthermore, they are useful as anticonceptives, in anesthesia and analgesia and in identifying compounds capable of modulating hDRR mediated disorders such as rheumatoid arthritis, multiple sclerosis or other conditions where immunosuppressive actions are desired like Inflammatory Bowel Disease (IBD) or to prevent transplant rejection.

These and other aspects of the invention are described herein in more detail.

SUMMARY OF THE INVENTION The present invention provides an assay to identify compounds that mimic or alter the biological effects of early pregnancy factor (EPF) or chaperonin 10, which assay comprises the steps of: a) contacting EPF or a peptide having at least 70% sequence identity with EPF with a human dorsal root receptor 4 (hDRR4) and/or human dorsal root receptor 7 (hDRR7) polypeptide; b) contacting a test compound with said hDRR4 and/or hDRR7 polypeptide; and c) determining the effect of said test compound on said hDRR4 and/or hDRR7 polypeptide in a competitive, non-competitive or comparative assay with said EPF or peptide having at least 70% sequence identity with EPF.

The assays are useful to identify whether a test compound can bind to the hDRRs under conditions in which EPF or EPF-related peptides, can bind to the receptor. The assays are also useful to determine whether the test compound is an agonist or antagonist of hDRRs. intellectual property office of N.Z. 1 J OCT 2007 received 6 In another aspect the present invention relates to an isolated and purified hDRR4 and/or hDRR7 binding fragment of EPF-related peptide or of a peptide having at least 70% sequence identity with EPF, said fragment being selected from the group consisting of: the hDRR4 and /or hDRR7 binding fragment consisting of amino acid sequence SEQ ID NO:8, or - SEQ ID NO: 18, SEQ ID NO:19, SEQ ID N0:20 or SEQ ID NO:21; or a sequence of between 16 and 21 amino acids having at least 70% sequence identity with SEQ ID NO:8,18, 19, 20 and/or 21.

In a further embodiment the present invention relates to the use of the an hDRR4 and/or hDRR7 binding fragment described above in the manufacture of a composition for use in the treatment of cancers like lymphoblastic leukemia; or for the treatment of autoimmune diseases like rheumatoid arthritis, and multiple sclerosis.

In a further aspect the present invention provides a method of identifying and obtaining a test compound capable of binding a hDRR4 and/or hDRR7 polypeptide comprising: a) incubating a source containing an hDRR4 and/or hDRR7 polypeptide or a functional fragment thereof, with i) EPF or a peptide having at least 70% sequence identity with EPF ii) said test compound; b) measuring the effect of the test compound on the amount of EPF or a peptide having at least 70% sequence identity with EPF bound to the receptor; and c) identifying that said test compound in step b) competes with EPF or a peptide having at least 70% sequence identity with EPF for binding to the receptor.

The present invention also provides a method of identifying and obtaining a test compound capable of modulating the activity of the hDRR4 and/or hDRR7 comprising: a) incubating a source containing hDRR4 and/or hDRR7 or a functional fragment thereof, with said test compound; b) measuring the effect of the test compound on the activity of the hDRR4 and/or hDRR7 receptor; and c) comparing this effect with the activity of the hDRR4 and/or hDRR7 upon binding intellectual property office of n.z. 6a of the EPF ligand or a peptide having at least 70% sequence identity with EPF whereby, a test compound is considered capable of modulating the activity of the hDRR4 and/or hDRR7 when said test compound interacts with and activates hDRR4 and/or hDRR7 when compared to the binding of EPF or a peptide having at least 70% sequence identity with EPF with the hDRR4 and/or hDRR7 used as a positive or negative control.

In an additional aspect the present invention provides a method for isolating hDRR4 and/or hDRR7 from a cellular fraction containing the same comprising contacting the cellular fraction with EPF or a hDRR4 and/or hDRR7 binding fragment thereof immobilized to a solid substrate and eluting hDRR4 and/or hDRR7 therefrom.

In a further aspect the present invention provides a kit for diagnosing pregnancy comprising; i) a polypeptide selected from the group consisting of SEQ ED NO: 18, SEQ ID NO:19, SEQ ID N0:20 and SEQ ID NO:21, or the hDRR4 and/or hDRR7 binding fragment of SEQ ID NO:8, or a sequence of between 16 and 21 amino acids having at least 70% sequence identity with SEQ ID NO: 8, 18, 19, 20 and/or 21; or ii) an antibody to a polypeptide selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID N0:20 and SEQ ID NO:21, or the hDRR4 and/or hDRR7 binding fragment of SEQ ID NO:8.

BRIEF DESCRIPTION OF THE DRAWING Figure 1 A - The nucleotide coding sequence of hDRR4 (SEQ ID NO: 1) is shown, (start and stop codons in bold) Figure 1 B - The amino acid sequence of hDRR4 (SEQ ID NO: 2) is shown.

Figure 2 - Activation of orphan GPCR hDRR4 by porcine hypothalamus extract CI8 fractions after transient co-transfection with Gal6-pcDNA intoHek293. Relative fluorescence units (RFU) were determined by assaying the cells for Ca2+ transients in the FLIPR instrument (Molecular Devices, Sunnyvale, CA, U.S.A.). Figure 3 - Activation of orphan GPCR hDRR4 (SEQ ID NO: 2) by the hDRR binding fragment of EPF (SEQ ID NO: 8) at a test concentration of 150 nM after transient co-transfection with Gal6-pcDNA into Hek293.

Relative fluorescence units (RFU) were determined by loading the cells with Fluo-4 (Molecular Probes, Eugene, OR, U.S.A.). intellectual property office of n.z.

(F allowed fy 9® received 7 Figure 4 - Activation of orphan GPCR hDRR7 (SEQ NO: 12) by the hDRR binding fragment of EPF (SEQ ID NO: 8) at a test concentration of 150 nM after transient co-transfection with Gal6-pcDNA into Hek293. Relative fluorescence units (RFU) were determined by loading the cells 5 with Fluo-4 (Molecular Probes, Eugene, OR, U.S.A.) Figure 5 - Relative expression of hDRR7 in a number of tissues compared to the lymph node expression that is taken as 100%. Expression levels were determined using real time quantitative PCR.

Figure 6 - Relative expression of hDRR4 in a number of tissues compared 10 to the relative expression of human cyclophilin A in the evaluated tissues.

Expression levels were determined using real time quantitative PCR.

Figure 7 - Dose response curve of the hDRR binding fragment of EPF (SEQ ED NO: 8) on the hDRR4 receptor as determined using the FLEPR calcium assay.

Figure 8 - Dose response curve of the hDRR binding fragment of EPF (SEQ ID NO: 8) on the hDRR7 receptor as determined using the FLEPR calcium assay.

Figure 9 - Dose response curve of the EPF-related peptides EPF1-16 (SEQ ID NO: 19) and EPF1-18 (SEQ ID NO: 21) on the hDRR4 receptor as 20 determined using the FLIPR calcium assay.

Figure 10 - Dose response curve of the EPF-related peptides EPF1-16 (SEQ ID NO: 19) and EPF1-18 (SEQ ID NO: 21) on the hDRR7 receptor as determined using the FLIPR calcium assay.

DETAILED DESCRIPTION The present invention provides assays that make use of the interaction of EPF or an EPF-related peptide, with a hDRR receptor. EPF, also known as Chaperonin 10 and EPF-related peptides are high affinity ligands of hDRRs that activate the receptor when bound thereto and lead to an activation of phospholipase 30 C which hydrolyzes inositol lipids in membranes to release inositol trisphosphate that in turn mobilizes calcium within a cell. The assays provide methods to identify compounds that are ligands of hDRRs or are agonists or antagonists of hDRR receptors. intellectual property office of n.z. 1 3 APR 2006 RECEIVED 8 As used herein, "EPF or EPF-related peptides" refers to the early pregnancy factor, also known as chaperonin 10, having the amino acid sequence SEQ ID NO: 4 or EPF-related peptides wherein said related peptides are derived from the aforementioned sequence by way of substitution, deletion and/or addition of one or 5 several amino acids of the amino acid sequence encoding EPF and wherein said EPF-related peptides are capable of binding to the hDRR4 receptor protein according to the invention. In a preferred embodiment said EPF-related peptides comprise the hDRR binding region encoded by SEQ ID NO:8. In a more preferred embodiment said EPF-related peptide consists of the hDRR binding region encoded 10 by SEQ ID NO:8. In a further embodiment the EPF-related peptides comprise an amino acid sequence selected from the group consisting of ((LGKAFRKFLPLFDRVLVE (SEQ ID NO: 18)), ((LGQAFRKFLPLFDRVLVE (SEQ ID NO: 19)), ((LGKAFRKFLPLFDRVL (SEQ ID N0:20)) and ((LGQAFRKFLPLFDRVL (SEQ ID NO:21)). In another aspect of the invention the 15 EPF-related peptides consist of peptides having an amino acid sequence being selected from the group consisting of (SEQ ID NO:18), (SEQ ID NO: 19), (SEQ ID N0:20) and (SEQ ID NO:21).

In a specific embodiment, the hDRR receptor polypeptide in an assay according to the invention is either the hDRR4 receptor protein, comprising the 20 amino acid sequence SEQ ID NO:2 or fragments thereof, or the hDRR7 receptor protein, comprising the amino acid sequence SEQ ID NO: 12 or fragments thereof.

The term "fragments thereof' describes a piece, or sub-region of protein molecule whose sequence is disclosed herein, such that said fragment comprises 5 or more amino acids that are contiguous in the parent protein. The term "fragments 25 thereof' is intended to include "functional fragments" wherein the isolated fragment, piece or sub-region comprises a functionally distinct region such as an active site, a binding site or a phosphorylation site of the receptor protein. Functional fragments may be produced by cloning technology, or as the natural products of alternative splicing techniques.

The term "derived from" describes a piece or sub-region of a protein molecule whose sequence is disclosed herein, such that said piece or sub-region has 9 a high degree of sequence relatedness to the parent sequence. Said relatedness may be quantified by determining the degree of sequence identity to the parent sequence wherein a high degree of sequence relatedness refers to an isolated peptide or polypeptide having at least 70, 80,90,95 or 99% identity to the parent sequence as 5 determined using local alignment.

Methods for comparing the identity and similarity of two or more sequences are well known in the art. Thus for instance, programs available in the Winconsin Sequence Analysis Package, version 9.1 (Devreux J. et al, Nucleic Acid Res., 12, 387-395, 1984), for example the programs BESTFTT and GAP, may be used to 10 determine the % identity between two polynucleotides and the % identity and the % similarity between two peptide or polypeptide sequences. BESTFET uses the "local homology" algorithm of Smith and Waterman (J. Mol. Biol., 147, 195-197, 1981) and finds the best single region of similarity between two sequences. BESTFTT is more suited to compare two polynucleotide or two peptide or polypeptide sequences 15 that are dissimilar in length, the program assuming that the shorter sequence represents a portion of the longer. In comparison, GAP aligns two sequences, finding a "maximum similarity", according to the algorithm of Needleman and Wunsch (J.Mol.Biol., 48, 443-453, 1970). GAP is more suited to compare sequences that are approximately the same length and an alignment is expected over 20 the entire length. Preferably, the parameters "Gap Weight" and "Length Weight" used in each program are 50 and 3, for polynucleotide sequences and 12 and 4 for polypeptide sequences, respectively. Preferably, % identities and similarities are determined when the two sequences being compared are optimally aligned. Other programs for determining identity and/or similarity between sequences are also 25 known in the art, for instance the BLAST family of programs (Altschul S F et al, Nucleic Acids Res., 25:3389-3402,1997).

As used herein, a "compound" is an organic or inorganic assembly of atoms of any size, and includes small molecules (less than about 2500 Daltons) or larger molecules, e.g. peptides, polypeptides, whole proteins and polynucleotides.

As used herein, a "test" compound is a compound used in a test to assess whether said test compound might be a ligand of a hDRR receptor polypeptide. A test compound may also be an agonist or antagonist of the hDRR receptor. Whether or not the test compound is an actual ligand, agonist or antagonist of a hDRR polypeptide is determined in an assay according to the invention.

As used herein, a "ligand" is a compound capable of binding to an hDRR 5 receptor, where upon binding to the receptor a possible change in conformation of the ligand-receptor complex results in the transduction of the biological response through a second messenger. Said ligand can either be an agonist or an antagonist of the receptor.

As used herein, an "agonist" is a compound that interacts with and activates 10 a polypeptide of the hDRR receptor. An activated hDRR receptor polypeptide induces a change in a biochemical pathway linked to the receptor, e.g. can stimulate the cleavage of GTP by a G protein, activate the adenylate cyclase pathway or activate the phospholipase C pathway.

As used herein, an "antagonist" is a compound that interacts with and 15 inhibits or prevents the activation of a polypeptide of the hDRR receptor.

Polynucleotides Accordingly, in a first embodiment the present invention relates to the use of an isolated and purified nucleic acid molecule which encodes hDRR or a fragment 20 thereof, wherein said nucleic acid molecule is either RNA, DNA, cDNA or genomic DNA, in an assay that makes use of the interaction of EPF and the related peptides with the hDRR receptor.

In a second embodiment the present invention relates to the use of an isolated and purified nucleic acid molecule encoding EPF or related peptides, 25 wherein said nucleic acid molecule is either RNA, DNA, cDNA or genomic DNA, in an assay that makes use of the interaction of EPF and the related peptides with the hDRR receptor.

As used herein, "isolated" refers to the fact that the polynucleotides, proteins and polypeptides, or respective fragments thereof in question, have been removed 30 from their in vivo environment so that they can be manipulated by the skilled WO 03/005036 PCT/EP02/07263 11 artisan, such as but not limited to sequencing, restriction digestion, site-directed mutagenesis, and subcloning into expression vectors for a nucleic acid fragment as well as obtaining the protein or protein fragments in quantities that afford the opportunity to generate polyclonal antibodies, monoclonal antibodies, amino acid 5 sequencing, and peptide digestion. Therefore, the nucleic acids claimed herein can be present in whole cells or in cell lysates or in a partially, substantially or wholy purified form.

A polynucleotide is considered "purified" when it is purified away from environmental contaminants. Thus a polynucleotide isolated from cells is 10 considered to be substantially purified when purified from cellular components by standard methods while a chemically synthesized nucleic acid sequence is considered to be substantially purified when purified from its chemical precursors. A "substantially pure" protein or nucleic acid will typically comprise at least 85% of a sample with greater percentages being preferred. One method for determining 15 the purity of a protein or nucleic acid molecule, is by electrophoresing a preparation in a matrix such as polyacrylamide or agarose. Purity is evidenced by the appearance of a single band after staining. Other methods for assessing purity include chromatography, mass spectrometry and analytical centrifugation.

The term "fragments thereof' describes a piece, or sub-region of a nucleic 20 acid molecule whose sequence is disclosed herein, such that said fragment comprises 15 or more nucleotides that are contiguous in the parent nucleic acid molecule. The term "fragments thereof' is intended to include "functional fragments" wherein the isolated fragment, piece or sub-region comprises a functionally distinct region such as an active site, a binding site or a 25 phosphorylation site of a receptor. Functional fragments may be produced by cloning technology, or as the natural products of alternative splicing techniques.

In particular, the present invention encompasses the use in an assay according to the invention, of an isolated and purified nucleic acid molecule encoding hDRR4 or a fragment thereof, comprising a member selected from a 30 group consisting of: WO 03/005036 PCT/EP02/07263 12 (a) a nucleic acid molecule encoding hDRR4 comprising the amino acid sequence of SEQ ID NO:2; (b) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:l, encoding hDRR4; (c) a nucleic acid molecule which is complementary to the polynucleotide of (a) or (b); (d) a nucleic acid molecule comprising at least 15 sequential bases of the polynucleotide of (a), (b) or (c); (e) a nucleic acid molecule that hybridizes under stringent conditions to the 10 polynucleotide molecule of (a), (b) or (c); or (f) a nucleic acid molecule encoding a hDRR4 protein comprising a nucleotide sequence which is degenerated as a result of the genetic code to a nucleotide sequence of a polynucleotide of any of (a) to (e).

In a more preferred embodiment of the present invention the hDRR4 encoding 15 nucleic acid molecule consists of SEQ ID NO: 1.

Accordingly, the present invention encompasses the use in an assay according to the invention, of an isolated and purified nucleic acid molecule encoding hDRR7 or a fragment thereof, comprising a member selected from a group consisting of: (a) a nucleic acid molecule encoding hDRR7 comprising the amino acid sequence of SEQ ID NO: 12; (b) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 11, encoding hDRR7; (c) a nucleic acid molecule which is complementary to the polynucleotide of (a) or 25 (b); (d) a nucleic acid molecule comprising at least 15 sequential bases of the polynucleotide of (a), (b) or (c); (e) a nucleic acid molecule that hybridizes under stringent conditions to the polynucleotide molecule of (a), (b) or (c); or (f) a nucleic acid molecule encoding a hDRR7 protein comprising a nucleotide sequence which is degenerated as a result of the genetic code to a nucleotide sequence of a polynucleotide of any of (a) to (e). 13 In a more preferred embodiment of the present invention the hDRR7 encoding nucleic acid molecule consists of SEQ ID NO: 11.

In a further embodiment the present invention relates to the use in an assay according to the invention, of an isolated and purified nucleic acid molecule 5 encoding EPF or EPF-related peptides, comprising a member selected from a group consisting of: (a) a nucleic acid molecule encoding EPF comprising the amino acid sequence of SEQ ID NO:4; (b) a nucleic acid molecule which is complementary to the polynucleotide of (a); (c) a nucleic acid molecule comprising at least 15 sequential bases of the polynucleotide of (a) or (b); (d) a nucleic acid molecule that hybridizes under stringent conditions to the polynucleotide molecule of (a) or (b); (e) a nucleic acid molecule encoding a EPF-related peptide that has 70, 80,90,95 or 15 99% sequence identity to the amino acid sequence encoded by the polynucleotide molecule of (a) or (b); (f) a nucleic acid molecule encoding a EPF polypeptide comprising a nucleotide sequence which is degenerated as a result of the genetic code to a nucleotide sequence of a polynucleotide of any of (a) to (d).

In a more preferred embodiment of the present invention the EPF encoding nucleic acid molecule consists of SEQ ID NO: 3 and the EPF-related peptide consists of a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID N0:20 and SEQ ID NO:21, or of the hDRR4 binding fragment encoded by SEQ ID NO:8.

Those skilled in the art will recognize that owing to the degeneracy of the genetic code, numerous "silent" substitutions of nucleotide base pairs could be introduced into the sequence identified as SEQ ID NO:l, SEQ ID NO: 11 or SEQ ID NO:3 without altering the identity of the encoded amino acid(s) or protein products. All such substitutions are intended to be within the scope of the invention. 30 The terms "complementary" or "complementarity" as used herein refer to the capacity of purine and pyrimidine nucleotides to associate through hydrogen bonding to form double-stranded nucleic acid molecules. The following base pairs 14 are related by complementarity: guanine and cytosine; adenine and thymine; and adenine and uracil. As used herein "complementary" means that the aforementioned relationship applies to substantially all base pairs comprising two single-stranded nucleic acid molecules over the entire length of said molecules.

"Partially complementary" refers to the aforementioned relationship in which one of the two single-stranded nucleic acid molecules is shorter in length than the other such that a portion of one of the molecules remains single-stranded.

The term "hybridization" as used herein refers to a process in which a single-stranded nucleic acid molecule joints with a complementary strand through 10 nucleotide base pairing.

The term "stringency" refers to hybridization conditions. High stringency conditions disfavor non-homologous base pairing. Low stringency conditions have the opposite effect. Stringency may be altered, for example, by temperature and salt concentration. "Stringent conditions" refers to an overnight incubation at 42°C in a 15 solution comprising 50% formamide, 5x SSC (750 mM NaCl, 75 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 fig/ml denatured, sheared salmon sperm DNA, followed by washing the-filters in 0.1 x SSC at about 65°C. Further suitable hybridization conditions are described in the examples.

The nucleic acid sequences encoding hDRRs are preferentially expressed in dorsal root ganglia (PCT publication WO 99/32519-A1) and these ganglia may serve as a source for the isolation of nucleic acids coding for the receptor. Other cells and cell lines may also be suitable for use to isolate hDRR nucleic acids. Selection of suitable cells may be done by screening for hDRR activity in cell 25 extracts or in whole cell assays, described herein. Cells that possess Dorsal Root Receptor activity in any one of these assays may be suitable for the isolation of hDRR nucleic acids.

Any of a variety of procedures known in the art may be used to molecularly clone hDRR nucleic acids. In one method, mRNA is isolated, and first strand 30 cDNA synthesis is earned out. A second round of DNA synthesis can be carried out for the production of the second strand. Subsequently by the specific PCR amplification of hDRR DNA fragments through the design of degenerate oligonucleotide primers from the amino acid sequence of the purified hDRR protein or through DNA synthesis using sequence specific primers derived from the genomic DNA sequence, an isolated cDNA can be obtained.

A preferred set of primers consists of the hDRR4 forward primer 5 (CAGAATTCGCCACCATGGATCCAACGGTCTCAAC) (Seq ID NO:5) or a fragment thereof consisting of nucleotides 15 to 34 of SEQ ID NO:5, the hDRR4 reverse primer (GTCTCGAGTCACTGCTCCAATCTGCTTCCC) (Seq ID NO:6) or a fragment thereof consisting of nucleotides 9 to 30 of SEQ ID NO:6, the hDRR7 forward primer (CGAATTCCGCCACCATGGATCCAACCACCCCGG) (SEQ ID 10 NO: 13) and the hDRR7 reverse primer (GCTCTAGAGGCTGTCCATCTCTACACCAGACTGC) (SEQ ID NO:14). If desired the double-stranded cDNA can be cloned into any suitable vector, for example, a plasmid, thereby forming a cDNA libary. Another method is to screen a cDNA library constructed in a bacteriophage or plasmid shuttle vector with a 15 labeled oligonucleotide probe targeted to any suitable region of SEQ ID NO: 1 or SEQ ID NO: 11. See e.g. PCR Protocols: A Guide to Method and Application. Ed. M. Innis et al., Academic Press (1990)..

Methods for constructing cDNA libraries in a suitable vector such as a plasmid or phage for propagation in prokaryotic or eukaryotic cells are well known 20 to those skilled in the art. [See e.g. Maniatis et al. Supra]. Suitable cloning vectors are well known and are widely available.

It is readily apparent to those skilled in the art that other types of libraries, as well as libraries constructed from other cells or cell types, may be useful for isolating the nucleic acid sequences according to the invention. Other types of 25 libraries include, but are not limited to, cDNA libraries derived from other cells, from organisms other than human and mouse, and genomic DNA libraries that include YAC (yeast artificial chromosome) and cosmid libraries. Construction of genomic DNA libraries can be performed by standard techniques well known in the art. Well known genomic DNA library construction techniques can be found in T. 30 Maniatis et al. Molecular Cloning: A Laboratory Manual. 2d Ed. Chap. 14 (1989).

The skilled artisan will appreciate that, in many cases, an isolated cDNA sequence will be incomplete, in that the region coding for the polypeptide is short at 16 the 5' end of the cDNA. This is a consequence of reverse transcriptase, an enzyme with inherently low 'processivity' (a measure of the ability of the enzyme to remain attached to the template during the polymerisation reaction), failing to complete a DNA copy of the mRNA template during the 1st strand cDNA synthesis. 5 There are several methods available and well known to those skilled in the art to obtain full-length cDNAs, or extend short cDNAs, for example those based on the method of Rapid Amplification of cDNA ends (RACE) (Frohman et al., 1988, PNAS USA 85, 8998-9002), or recent modifications of this technique.

Polypeptides The present invention also relates to the use of hDRR receptor proteins or fragments thereof in an assay that makes use of the interaction of EPF and the related peptides with the hDRR receptor, wherein said polypeptide is encoded by an isolated and purified nucleic acid molecule according to the invention.

In a further aspect of the invention, the hDRR receptor protein is the hDRR4 receptor selected from the group consisting of; i) an isolated and purified protein which encodes hDRR4 having the amino acid sequence of SEQ ID NO:2 or a fragment thereof; ii) cells expressing on the surface thereof the receptor protein having the amino acid 20 sequence of SEQ ID NO:2 or a fragment thereof; or iii) membrane preparations of cells expressing on the surface thereof the polypeptide receptor having the amino acid sequence of SEQ ID NO:2 or a fragment thereof.

In a preferred embodiment the hDRR4 receptor protein comprises the amino acid sequence of SEQ ID NO:2 or fragments thereof. In a more preferred embodiment 25 the hDRR4 receptor protein consists of the amino acid sequence of SEQ ID NO:2 or fragments thereof.

In a further aspect of the invention, the hDRR receptor protein is the hDRR7 receptor selected from the group consisting of; i) an isolated and purified protein which encodes hDRR7 having the amino acid 30 sequence of SEQ ID NO: 12 or a fragment thereof; ii) cells expressing on the surface thereof the receptor protein having the amino acid sequence of SEQ ID NO: 12 or a fragment thereof; or 17 iii) membrane preparations of cells expressing on the surface thereof the polypeptide receptor having the amino acid sequence of SEQ ID NO: 12 or a fragment thereof.

In a preferred embodiment the hDRR7 receptor protein comprises the amino acid sequence of SEQ ID NO: 12 or fragments thereof. In a more preferred embodiment 5 the hDRR7 receptor protein consists of the amino acid sequence of SEQ ID NO: 12 or fragments thereof.

The term "fragments thereof' describes a piece, or sub-region of protein molecule whose sequence is disclosed herein, such that said fragment comprises 5 or more amino acids that are contiguous in the parent protein. The term "fragments 10 thereof' is intended to include "functional fragments" wherein the isolated fragment, piece or sub-region comprises a functionally distinct region such as an active site, a binding site or a phosphorylation site of the receptor protein. Functional fragments may be produced by cloning technology, or as the natural products of alternative splicing techniques.

In a further aspect, the present invention relates to the use of EPF and the related peptides in an assay according to the invention. In a preferred embodiment the EPF or EPF-related peptides are selected from the group consisting of; i) an isolated polypeptide encoding EPF, comprising the amino acid sequence SEQ ID NO:4; ii) an isolated polypeptide derived from EPF and capable of binding to hDRR4; iii) an isolated polypeptide encoding an EPF-related peptide comprising an amino acid selected from the group consisting of SEQ ID NO:18, SEQ ID NO:19, SEQ ID N0:20 and SEQ ID NO:21;or iv) an isolated polypeptide comprising the hDRR4 binding fragment encoded by amino 25 acid sequence SEQ ID NO: 8.

In a more preferred embodiment of the present invention, EPF consists of the amino acid sequence encoded by SEQ ID NO: 4 and an EPF-related peptide consists of an amino acide sequence selected from the group consisting of SEQ ID NO:18, SEQ ID NO: 19, SEQ ID N0:20 and SEQ ID NO:21, or of the hDRR4 binding fragment 30 encoded by SEQ ID NO:8.

The receptor protein and the peptides according to the invention includes all possible conservative amino acid changes, wherein "conservative amino acid 18 changes" refers to a replacement of one or more amino acid residue(s) in a parent receptor protein or peptide without affecting the biological activity of the parent molecule based on the art recognized substitutability of certain amino acids (See e.g. M. Dayhoff, In Atlas of Protein Sequence and Structure. Vol. 5, Supp. 3, pgs 5 345-352,1978).

Those skilled in the art will recognize that the polypeptides according to the invention, i.e. the hDRR4 receptor protein, the hDRR7 receptor protein and EPF or EPF-related peptides, could be obtained by a plurality of recombinant DNA techniques including, for example, hybridization, polymerase chain reaction (PCR) 10 amplification, or de novo DNA synthesis (See e.g., T. Maniatis et al. Molecular Cloning: A Laboratory Manual. 2d Ed. Chap. 14 (1989)).

The peptides and derivatives of the present invention can be readily prepared according to well-established, standard liquid or, preferably, solid-phase peptide synthesis methods, general descriptions of which are broadly available, or they may 15 be prepared in solution, by the liquid phase method or by any combination of solid-phase, liquid phase and solution chemistry.

As an example, the polypeptides of the present invention can be synthesized by employing the N-a-9-fluorenylmethyloxycarbonyl or Fmoc solid phase peptide synthesis chemistry using a RaininSymphony Multiplex Peptide Synthesizer. 20 The standard cycle used for coupling of an amino acid to the peptide-resin growing chain generally includes: (1) washing the peptide-resin three times for 30 seconds with N,N-dimethylformamide (DMF); (2) removing the Fmoc protective group on the amino terminus by deprotection with 20% piperdine in DMF by two washes for 15 minutes each, during which process mixing is effected by bubbling nitrogen through 25 the reaction vessel for one second every 10 seconds to prevent peptide-resin settling; (3) washing the peptide-resin three times for 30 seconds with DMF; (4) coupling the amino acid to the peptide resin by addition of equal volumes of a 250 mM solution of the Fmoc derivative of the appropriate amino acid and an activator mix consisting or 400 mM N-methylmorpholine and 250 mM (2-(lH-benzotriazol-l-4))-l,1,3,3-30 tetramethyluronium hexafluorophosphate (HHTU) in DMF; (5) allowing the solution to mix for 45 minutes; and (6) washing the peptide-resin three times for 30 seconds of DMF. 19 This cycle can be repeated as necessary with the appropriate amino acids in sequence to produce the desired peptide. Exceptions to this cycle are amino acid couplings predicted to be difficult by nature of their hydrophobicity or predicted inclusion within a helical fonnation during synthesis. For these situations, the above 5 cycle can be modified by repeating step 4 a second time immediately upon completion of the first 45 minute coupling step to "double couple" the amino acid of interest. In the first coupling step in peptide synthesis, the resin can be allowed to swell to effect more efficient coupling by increasing the time of mixing in the initial DMF washes to three 15-minute washes rather than three 30 second washes.

After synthesis, the peptide can be cleaved from the resin as follows: (1) washing the peptide-resin three times for 30 seconds with DMF; (2) removing the Fmoc protective group on the amino terminus by washing two times for 15 minutes in 20% piperdine in DMF; (3) washing the peptide-resin three times for 30 seconds with DMF; and (4) mixing a cleavage cocktail consisting of 95% trifluoroacetic acid (TFA), 2.4% 15 water, 2.4% phenol, and 0.2% trisopropysilane with the peptide-resin for two hours, then filtering the peptide in the cleavage cocktail away from the resin, and precipitating the peptide out of solution by addition of two volumes of ethyl ether.

To isolate the peptide, the ether-peptide solution can be allowed to sit at -20°C for 20 minutes, then centrifuged at 6,OOOxG for 5 minutes to pellet the peptide. The 20 peptide can be washed with ethyl ether to remove residual cleavage cocktail ingredients. The final peptide product can be purified by reversed phase high pressure liquid chromatography (RP-HPLC) with the primary solvent consisting of 0.1% TFA and the eluting buffer consisting of 80% acetonitrile and 0.1% TFA. The purified peptide can then be lyophilized to a powder.

Purified biologically active hDRR proteins may have several different physical forms. The polypeptides according to the invention may exist as a full-length nascent or unprocessed polypeptides, or as partially processed polypeptides or combinations of processed polypeptides. The full-length nascent polypeptide may be 30 post-translationally modified, amongst other, by specific proteolytic cleavage events that result in the formation of fragments of the full-length nascent polypeptide. A fragment, or physical association of fragments may have the full biological activity associated with hDRR4 or hDRR7; however, the degree of receptor activity may vary between individual receptor fragments and physically associated receptor polypeptide fragments.

Therefore, in another aspect this invention provides modified hDRR 5 polypeptides which have amino acid deletions, additions or substitutions but that still retain substantially the same biological activity, i.e., binding EPF or EPF-related peptides, as the native hDRR polypeptide. A hDRR polypeptide has "substantially the same biological activity" as the wild type if that polypeptide has an ECso-value for the EPF-related peptide encoded by amino acid sequence SEQ ID No:8, that is no 10 more than 10-fold, preferably no more than 5-fold greater than the ECso-value of the wild type hDRR receptor polypeptide for the same ligand. For the hDRR4 receptor an ECso-value ranging of 10,6 - 12 nM has been determined for the EPF-related peptide consisting of SEQ ID NO:8. For the hDRR7 receptor an ECso-value ranging of 345 - 82,9 nM has been determined for the EPF-related peptide consisting of SEQ 15 ID NO:8 The present invention also provides antibodies against and epitopes of EPF and the EPF-related peptides according to the invention, including antisera and both polyclonal and monoclonal embodiments of such antibodies and hybridoma cell lines producing such monoclonal antibodies. Antibodies generated against 20 polypeptides of the present invention may be obtained by administering the polypeptides or epitope-bearing fragments, or cells to an animal, preferably non-human animal using routine protocols The above-described antibodies may be employed to purify the polypeptides according to the invention by affinity chromatography or to treat diseases of the 25 invention. It is also an object of the present invention to provide the use of the aforementioned antibodies in a method of diagnosing a pathological condition in a subject related to a disorder related to hDRR activity comprising; contacting the antibodies with a test sample wherein said test preferably consists of bodily fluids such as blood, saliva, semen, cerebrospinal fluid, plasma or lymph; and measuring 30 the reactivity of said antibodies on the test sample.

The reactivities of antibodies on a sample may be determined by any appropriate means. Tagging with individual reporter molecules is one possibility.

WO 03/005036 PCT/EP02/07263 21 Said reporter molecules may directly or indirectly generate detectable, and preferably measurable, signals.

Thus in another aspect, the present invention relates to a diagnostic kit comprising; i) a polypeptide of the present invention, preferably the polypeptides selected from the group consisting of SEQ ID NO:18, SEQ ID NO:19, SEQ ID N0:20 and SEQ ID NO:21, or of the hDRR4 binding fragment encoded by SEQ ID NO:8; or ii) an antibody to a polypeptide of the present invention preferably a polypeptide selected from the group consisting of SEQ ID NO:18, SEQ ID NO: 19, 10 SEQ ID NO:20 and SEQ ID NO:21, or of the hDRR4 binding fragment encoded by SEQ ID NO:8.

It will be appreciated that in any such kit, i) or ii) may comprise a substantial component. Such a kit will be of use in diagnosing a disease or susceptibility to a disease, particularly diseases of the invention.

Recombinant expression of hDRR receptor polypeptides An important aspect of many assays is the step of providing a host cell expressing a recombinant hDRR receptor on the surface thereof. Therefore, in a further aspect the present invention relates to hDRR expression vectors that can be 20 used in an assay according to the invention.

Expression vectors are defined herein as DNA sequences that are required for the transcription of cloned copies of genes and the translation of their mRNAs in an appropriate host. Such vectors can be used to express eukaiyotic genes in a variety of hosts such as bacteria including E. coli, cyanobacteria, plant cells, insect 25 cells, fungal cells including yeast cells, and animal cells including human cells.

Specifically designed vectors allow the shuttling of DNA between hosts such as bacteria-yeast or bacteria-animal cells or bacteria-fungal cells or bacteria-invertebrate cells. An appropriately constructed expression vector may contain: an origin of replication for autonomous replication in host cells, selectable markers, a 30 limited number of useful restriction enzyme sites, a potential for high copy number, and active promoters. A promoter is defined as a DNA sequence that directs RNA 22 polymerase to bind to DNA and initiate RNA synthesis. A strong promoter is one that causes mRNAs to be initiated at high frequency. Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses.

The isolated and purified nucleic acid molecules, according to the invention, encoding KDRR4 or hDRR7 may be cloned into an expression vector for expression in a recombinant host cell. Recombinant host cells may be prokaryotic or eukaryotic, including but not limited to bacteria such as E. coli, fungal cells such as yeast, mammalian cells including but not limited to cell lines of human, bovine, 10 porcine, monkey and rodent origin, and insect cells including but not limited to Drosophila- and silkworm-derived cell lines. Cell lines derived from mammalian species which may be suitable and which are commercially available, include but are not limited to, CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92), NIH/3T3 15 (ATCC CRL 1658), HeLa (ATCC CCL 2), C127I (ATCC CRL 1616), BS-C-1 (ATCC CCL 26), MRC-5 (ATCC CCL 171), L-cells, neuroblastoma, glial cells and HEK-293 (ATCC CRL1573).

Therefore, in a further embodiment this invention relates to the use of a recombinant host cell containing a recombinantly cloned nucleic acid molecule 20 encoding a hDRR protein or fragments thereof in an assay according to the invention. In a further aspect the recombinant host cell contains a nucleic acid molecule which is either genomic DNA or has a nucleotide sequence consisting of: (SEQ ID NO:l) and fragments thereof.

In a more preferred embodiment of this invention the recombinant host cell 25 consists of the HEK293 cells comprising the nucleotide sequence consisting of Seq ID NO:l or fragments thereof, in the mammalian expression vector pcDNA3.

The expression vector may be introduced into host cells via any one of a number of techniques including but not limited to transformation, transfection, protoplast fusion, lipofection, and electroporation. The expression vector-30 containing cells are clonally propagated and analyzed to determine whether they produce a hDRR4 protein. Identification of receptor expressing host cell clones may be done by several' means, including but not limited to immunological 23 reactivity with antibodies directed against the polypeptides according to the invention, and the presence of host cell-associated hDRR4 activity.

The proteins of this invention may be synthesized either by direct expression or as a fusion protein comprising the protein of interest as a translational fusion 5 with another protein or peptide which may be removable by self, enzymatic or chemical cleavage. Therefore, in a particular embodiment this invention provides the proteins according to the invention wherein said polypeptides are part of a fusion protein.

Furthermore, one could use, e.g., a mammalian cell that already comprises 10 in its genome a nucleic acid molecule encoding a DRR polypeptide as described above, but does not express the same or not in an appropriate manner due to, e.g., a weak promoter, and introduce into the mammalian cell a regulatory sequence such as a strong promoter in close proximity to the endogenous nucleic acid molecule encoding said receptor polypeptide so as to induce expression of the same. 15 As such a recombinant host cell containing a polynucleotide encoding a DRR polypeptide under the control of a heterologous transcription and/or regulatory sequence or protein, would be another embodiment of this invention.

In this context the term "regulatory sequence" denotes a nucleic acid molecule that can be used to increase the expression of the DRR receptor 20 polypeptide, due to its integration into the genome of a cell in close proximity to the DRR receptor encoding gene. Such regulatory sequences comprise promoters, enhancers, inactivated silencer intron sequences, 3UTR and/or 5TJTR coding regions, protein and/or RNA stabilizing elements, nucleic acid molecules encoding a regulatory protein, e.g., a transcription factor, capable of inducing or triggering the 25 expression of the DRR receptor gene or other gene expression control elements which are known to activate gene expression and/or increase the amount of the gene product. The introduction of said regulatory sequence leads to increase and/or induction of expression of DRR receptor polypeptides, resulting in the end in an increased amount of DRR receptor polypeptides in the cell. Thus, the present 30 invention is aiming at providing de novo and/or increased expression of DRR receptor polypeptides. 24 Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other methods. Such methods are described in many standard laboratory manuals, such as Davis, 5 Basic Methods In Molecular Biology (1986). hi addition, expression of polynucleotides according to the invention may also be performed using in vitro produced synthetic mRNA. Synthetic mRNA or mRNA isolated from hDRR producing cells can be efficiently translated in various cell-free systems, including but not limited to wheat germ extracts and reticulocyte 10 extracts, as well as efficiently translated in cell-based systems, including but not limited to microinjection into frog or toad oocytes (Xenopus laevis), with microinjection into toad oocytes being generally preferred.

Assays Assays of the present invention can be designed in many formats generally known in the art of screening compounds for biological activity or for binding receptors.

Polypeptides of the present invention are responsible for one or more biological functions, including one or more disease states, in particular the diseases 20 hereinbefore mentioned. It is therefore desirable to devise screening methods to identify compounds which stimulate or which inhibit the function of hDRR receptors.

The assays of the present invention advantageously exploit the fact that EPF or EPF-related peptides are high affinity ligands for hDRR receptor polypeptides and 25 activate the hDRR receptors upon binding thereto.

Therefore, the present invention includes methods of identifying compounds that specifically bind to hDRR receptor polypeptides, wherein said compounds may be ligands, agonists or antagonists of the hDRR receptor polypeptide. The assay 30 methods of the present invention differ from those described in the art because the present assays incorporate at least one step wherein the interaction of EPF or EPF-related peptides with the hDRR receptor is incorporated in the assay. The specificity of binding can be shown by measuring the affinity of the compounds for cells expressing a hDRR receptor polypeptide on the surface thereof or affinity for membranes of such cells.

Thus, the present invention provides for a method of identifying and obtaining a test 5 compound capable of binding a hDRR receptor comprising: a) incubating a source containing a hDRR or a fragments thereof, with i) EPF or EPF-related peptides ii) said test compound; and b) measuring the effect of the test compound on the amount of EPF or EPF-10 related peptides bound to the receptor.

In a preferred embodiment, the present invention provides for a method of identifying and obtaining a test compound capable of binding the hDRR4 receptor comprising: a) incubating a source containing hDRR4 or a fragments thereof, with 15 i) EPF or EPF-related peptides ii) said test compound; and b) measuring the effect of the test compound on the amount of EPF or EPF- related peptides bound to the receptor.

In a further embodiment of the present invention, the hDRR4 containing source is 20 selected from the group consisting of; i) an isolated and purified protein having the amino acid sequence of SEQ ID NO:2 or a fragment thereof; ii) cells expressing on the surface thereof the polypeptide receptor having the amino acid sequence of SEQ ID NO:2 or a fragment thereof; or iii) membrane preparations of cells expressing on the surface thereof the polypeptide receptor having the amino acid sequence of SEQ ID NO:2 or fragments thereof. 26 In a another embodiment, the present invention provides for a method of identifying and obtaining a test compound capable of binding the hDRR7 receptor comprising: a) incubating a source containing hDRR7 or a fragments thereof, with 5 i) EPF or EPF-related peptides ii) said test compound; and b) measuring the effect of the test compound on the amount of EPF or EPF- related peptides bound to the receptor.

In a further embodiment of the present invention, the hDRR7 containing source is 10 selected from the group consisting of; i) an isolated and purified protein having the amino acid sequence of SEQ ID NO: 12 or a fragment thereof; ii) cells expressing on the surface thereof the polypeptide receptor having the amino acid sequence of SEQ ID NO: 12 or a fragment thereof; or iii) membrane preparations of cells expressing on the surface thereof the polypeptide receptor having the amino acid sequence of SEQ ID NO: 12 or fragments thereof.

The screening method may simply measure the binding of a candidate compound to the polypeptide, or to cells or membranes bearing the polypeptide, or a 20 fusion protein thereof by means of a label directly or indirectly associated with the candidate compound. Alternatively, the screening method may involve competition with a labeled competitor. In a preferred embodiment, this labeled competitor is a ligand known to bind to hDRRs such as EPF, also known as chaperonin 10, or EPF-related peptides. In a further embodiment said EPF-related peptide consists of the 25 hDRR binding fragment encoded by SEQ ID NO:8 or of the EPF-related peptides encoded by SEQ ID NO:18, SEQ ID NO:19, SEQ ID N0:20 or SEQ ID NO:21.

Therefore, in a more preferred embodiment, the screening method comprises labeled EPF or labeled EPF-related peptides, wherein said label is used to measure the effect of the test compound on the amount of EPF or EPF-related peptide bound 30 to the receptor.

WO 03/005036 PCT/EP02/07263 27 Accordingly, the present invention provides a method of identifying and obtaining a test compound capable of binding the hDRR4 receptor comprising: i) membrane preparations of cells, preferably HEK293 cells, expressing on the surface thereof the receptor polypeptide having the amino acid sequence of SEQ ID NO:2; ii) incubating said membranes with a labeled EPF-related peptide comprising an amino acid sequence encoded by SEQ ID NO: 8, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID N0:20 or SEQ ID NO:21, preferably iodinated EPF-related peptide consisting of SEQ JD NO: 8; iii) adding the test compound to the incubation mixture; and iv) measuring the effect of the test compound on the amount of labeled EPF-related peptide bound to the hDRR4 receptor.

Concordantly, the present invention provides a method of identifying and obtaining a test compound capable of binding the hDRR7 receptor comprising: 15 i) membrane preparations of cells, preferably HEK293 cells, expressing on the surface thereof the receptor polypeptide having the amino acid sequence of SEQ ID NO: 12; ii) incubating said membranes with a labeled EPF-related peptide comprising the amino acid sequence encoded by an amino acid sequence encoded by SEQ ID NO:8, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID N0:20 or SEQ ID NO:2, preferably iodinated EPF-related peptide consisting of SEQ ID NO:8; iii) adding the test compound to the incubation mixture; and iv) measuring the effect of the test compound on the amount of labeled EPF-related peptide bound to the hDRR7 receptor.

Further, these screening methods may test whether the candidate compound results in a signal generated by activation or inhibition of the polypeptide, using detection systems appropriate to the cells bearing the polypeptide. Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on 30 activation by the agonist by the presence of the candidate compound is observed. Constitutively active receptor polypeptides may be employed in screening methods for inverse agonists or inhibitors, in the absence of an agonist or inhibitor, by testing 28 whether the candidate compound results in inhibition or activation of the polypeptide.

Therefore, the present invention provides a method of identifying and obtaining a test compound capable of modulating the activity of the hDRR receptor comprising: a) incubating a source containing hDRR or functional fragments thereof, with said test compound; b) measuring the effect of the test compound on the activity of the hDRR receptor; and c) compare this effect with the activity of the hDRR receptor upon binding of 10 EPF or EPF-related peptides.

In a further embodiment of the present invention, the hDRR-containing source in a method of identifying and obtaining a test compound capable of modulating the activity of a hDRR receptor, is a cell expressing on the surface thereof the polypeptide receptor having the amino acid sequence of SEQ ID NO:2 or SEQ ID NO: 12. In a 15 preferred embodiment said cell may be a recombinant host cell containing a recombinantly cloned nucleic acid molecule encoding a hDRR4 or a hDRR7 protein or fragments thereof as provided in above-described methods. The effect of the modulator on a hDRR receptor may be modulation of an intracellular second messenger formation that is mediated by hDRR receptors such as intracellular calcium, cAMP or a reporter 20 gene product. hDRR belongs to the class of proteins known as G-protein coupled receptors (GPCRs). GPCRs transmit signals across cell membranes upon the binding of the ligand. The ligand-bound GPCR activates intracellular signalling events mediated by heterotrimerie G proteins, such as activation of the adenylate cyclase pathway or activation of the phospholipase C-f5 pathway. Assay to assess the activation 25 of the aforementioned intracellular signalling events are generally known in the art and include amongst others cell based assays for signal transduction comprising chimeric ligand-inducible transcription factors, binding assays for G-protein-coupled receptors using fluorescence intensity distribution analysis, cell-signaling assays using cyclic nucleotides coupled to luminophores or measurement of responses from G protein 30 coupled receptors using a multiple response element or cAMP response element-directed reporter assay. 29 Accordingly, the present invention provides a method of identifying and obtaining a test compound capable of modulating the activity of the hDRR4 receptor comprising: a) incubating a source containing hDRR4 or functional fragments thereof, with 5 said test compound; b) measuring the effect of the test compound on the activity of the hDRR4 receptor; and c) compare this effect with the activity of the hDRR4 receptor upon binding of EPF or EPF-related peptides.

In a preferred embodiment, the present invention provides a method of identifying and obtaining a test compound capable of modulating the activity of the hDRR4 receptor consisting of; a) host cells, preferably HEK293 cells, co-transfected with a mammalian expression vector, preferably pcDNA3, encoding the hDRR4 receptor protein consisting of SEQ ID NO:2 and a mammalian expression vector, preferably pcDNA3, encoding Gal6 consisting of SEQ ID N0:10; b) loading the cells with a calcium sensitive fluorescent dye such as Fura-2, FLUO-3 or FLUO-4, preferably FLUO-3 or FLUO-4; c) incubating the cells with the test compound; d) measure the effect of the test compound on the hDRR4 receptor activity as a change in relative fluorescence units of the calcium sensitive fluorescent dye; and e) compare the effect with the activity of the hDRR4 receptor upon binding of EPF or EPF-related peptides.

In another preferred embodiment, the method to identify and obtain a compound capable of modulating the activity of the hDRR4 receptor consists of; a) host cells, preferably HEK293 cells, transfected with a mammalian expression vector, preferably pcDNA3, encoding the hDRR4 receptor protein consisting of SEQ ID NO:2; b) loading the cells with a calcium sensitive fluorescent dye such as Fura-2, ELUO-3 or FLUO-4, preferably FLUO-3 or FLUO-4, preferably FLUO-4; c) incubating the cells with the test compound; d) measure the effect of the test compound on the hDRR4 receptor activity as a 5 change in relative fluorescence units of the calcium sensitive fluorescent dye; and e) compare the effect with the activity of the hDRR4 receptor upon binding of EPF or EPF-related peptides.

Accordingly, the present invention provides a method of identifying and obtaining a test 10 compound capable of modulating the activity of the hDRR7 receptor comprising: a) incubating a source containing hDRR7 or functional fragments thereof, with said test compound; b) measuring the effect of the test compound on the activity of the hDRR7 15 receptor; and c) compare this effect with the activity of the hDRR7 receptor upon binding of EPF or EPF-related peptides.

In a preferred embodiment, the present invention provides a method of identifying and obtaining a test compound capable of modulating the activity of the 20 hDRR7 receptor consisting of; a) host cells, preferably HEK293 cells, co-transfected with a mammalian expression vector, preferably pcDNA3, encoding the hDRR7 receptor protein consisting of SEQ ID NO:12 and a mammalian expression vector, preferably pcDNA3, encoding Gal6 consisting of SEQ ID NO: 10; b) loading the cells with a calcium sensitive fluorescent dye, preferably FLUO- 4; c) incubating the cells with the test compound; 31 d) measure the effect of the test compound on the hDRR7 receptor activity as a change in relative fluorescence units of the calcium sensitive fluorescent dye; and e) compare the effect with the activity of the hDRR7 receptor upon binding of 5 EPF or EPF-related peptides.

In another preferred embodiment, the method to identify and obtain a compound capable of modulating the activity of the hDRR7 receptor consists of; a) host cells, preferably HEK293 cells, transfected with a mammalian expression vector, preferably pcDNA3, encoding the hDRR7 receptor protein consisting of SEQ ID NO: 12; b) loading the cells with a calcium sensitive fluorescent dye, preferably FLUO-4; c) incubating the cells with the test compound; d) measure the effect of the test compound on the hDRR7 receptor activity as a 15 change in relative fluorescence units of the calcium sensitive fluorescent dye; and e) compare the effect with the activity of the hDRR7 receptor upon binding of EPF or EPF-related peptides.

It will be readily appreciated by the skilled artisan that the discovery of the 20 interaction of EPF or EPF-related peptides with hDRR may also be used in a method for the structure-based or rational design of an agonist or antagonist of the polypeptide, by: a) probing the structure of the ligand binding site on hDRR with EPF or EPF derivatives; b) identifying contacting atoms in the ligand binding site of the hDRR receptor that interact with the EPF ligand during binding; c) design test compounds that interact with the atoms identified in (b) to modulate the activity of the hDRR receptor; and 32 d) contact said designed test compound with a source containing hDRR or a functional fragment thereof, to measure the capability of said compound to modulate the hDRR activity.

It will be further appreciated that this will normally be an iterative process.

Therapeutic use In general, agonists or antagonists may be employed for therapeutic and prophylactic purposes for such diseases as hereinbefore mentioned. Compounds may be identified from a variety of sources, for example, cells, cell-free preparations, 10 chemical libraries, and natural product mixtures. Such agonists or antagonists so-identified may be natural or modified peptides, ligands, enzymes, etc., as the case may be, of the receptor polypeptide; or may be structural or functional mimetics thereof (see Coligan et al., Current Protocols in Immunology 1 (2): Chapter 5 (1991)).

Therefore, the present invention relates to the use of EPF, EPF fragments or the EPF-related peptides as a medicine and where said EPF, EPF fragments or EPF-related peptide is an agonists of the hDRR receptor, for use in the treatment of pain or in the treatment of autoimmune diseases like rheumatoid arthritis, multiple sclerosis or other conditions where immunosuppresive actions are desired like in 20 IBD or to prevent transplant rejection. In a preferred embodiment said EPF, EPF fragments or EPF- related peptide consists of the hDRR binding fragment encoded by SEQ ID NO: 8 or a EPF-related peptide according to the invention, i.e consisting of a polypeptide selected from the group consisting of SEQ ID NO: 18, SEQ ED NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21.

The composition will be adapted to the route of administration, for instance by a systemic or an oral route. Preferred forms of systemic administration include injection, typically by intravenous injection. Other injection routes, such as subcutaneous, intramuscular, or intraperitoneal, can be used. Alternative means for systemic administration include transmucosal and transdermal administration using 30 penetrants such as bile salts or fusidic acids or other detergents. In addition, if a polypeptide or other compounds of the present invention can be formulated in an enteric or an encapsulated formulation, oral administration may also be possible. 1 intellectual property i office of n.z. 1 3 APR 2006 RECEIVED 33 Administration of these compounds may also be topical localized, in the form of patches, salves, pastes, gels, and the like.

The dosage range required depends on the choice of peptide or other compounds of the present invention, the route of administration, the nature of the formulation, the nature of the subject's condition, and the judgment of the attending practitioner. Suitable dosages, however, are in the range of 0.1-100ng/kg of subject. Wide variations in the needed dosage, however, are to be expected in view of the variety of compounds available and the differing efficiencies of various routes of administration. For example, oral administration would be expected to require higher intellectual property office of n.z. \ 3 APR 2006 RECEIVED 34 intellectual property office of n.z. 1 3 APR 2006 RECEIVED dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using, standard empirical routines for optimization, as is well understood in the art.

This invention will be better understood by reference to the Experimental 5 Details that follow, but those skilled in the art will readily appreciate that these are only illustrative of the invention as described more fully in the claims that follow thereafter. Additionally, throughout this application, various publications are cited. The disclosure of these publications is hereby incorporated by reference into this application to describe more fully the state of the art to which this invention pertains.

WO 03/005036 PCT/EP02/07263 36 EXAMPLE 1: CLONING AND FUNCTIONAL CHARACTERIZATION OF THE GPCR BDRR4 Material and Methods Materials Expand high fidelity polymerase, PCR buffer, T4 DNA ligase, and restriction endonucleases were obtained from Boehringer (Mannheim, Germany). 10 Oligonucleotides were purchased from Eurogentec (Seraing, Belgium). Plasmid preparation kits and the Qiaquick PCR amplification kit were from Qiagen (Hilden, Germany). The PRISM Ready Reaction Dye Terminator Cycle Sequencing kits and the ABI 377 or 373A sequencing machines were from Applied Biosystems (Foster City, CA, U.S.A.). The Geneamp PCR System 9600 was from Perkin-Elmer (Norwalk, CT, 15 U.S.A.). The mammalian expression vector pcDNA3 was obtained from Invitrogen (Carlsbad, CA, U.S.A.). Dulbecco's modified Eagle medium (DMEM), foetal calf serum, and dialysed foetal calf serum were from Life Technologies (Gaithersburg, MD, U.S.A.).

DNA sequencing DNA sequencing was carried out with reagents from the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems) on PTC-200 PCR machines (MJ Research). Reaction products were purified on SEQueaky Kleen 96 well Terminator Removal Kit columns (BioRad) and were resolved on ABB77 DNA 25 sequencing machines. For sequence analysis we used the Sequeneher software from GeneCodes (Ann Harbor, MI).

Cloning ofhDRR4 PCR was performed on a human genomic cosmid library (Clontech, Palo Alto, CA, 30 USA) using a forward primer (GGAATTCGCCACCATGGATCCAACGGTCTCAACCTTGG) and a reverse primer (GTCTCGAGTCACTGCTCCAATCTGCTTCCC). The resulting PCR products were 37 cloned with the help of the TOPO™ TA Cloning kit (Invitrogen, Carlsbad, CA, U.S.A.). The full length reading frame was inserted into the mammalian expression vector pcDNA3 (Invitrogen, Carlsbad, CA, U.S.A.) and was used in subsequent screening experiments.

Cloning ofhDRR7 PCR was performed on a human genomic cosmid library (Clontech, Palo Alto, CA, USA) using the hDRR7 forward primer (CGAATTCCGCCACCATGGATCCAACCACCCCGG) (SEQ ID NO:13) and the 10 hDRR7 reverse primer (GCTCTAGAGGCTGTCCATCTCTACACCAGACTGC) (SEQ ID NO: 14). The resulting PCR product was inserted into the mammalian expression vector pcDNA3 (Invitrogen, Carlsbad, CA, U.S.A.) and was used in subsequent screening experiments.

Transient expression in mammalian cells and FLIPR assay The hDRR4 expression plasmid or the hDRR7 expression plasmid was transiently co-transfected with a Gal6-pcDNA3 contract using the FuGENE 6 reagent (Roche Molecular Biochemicals, Mannheim, Germany) into HEK293 cells. Hie cells were loaded with Fiuo-4 (Molecular Probes, Eugene, OR, U.S.A.) according to the 20 recommendations of the supplier. Subsequently the cells were assayed in the FLIPR instrument (Molecular Devices, Sunnyvale, CA, U.S.A.) for Ca2+ transients.

Preparation of tissue extracts and extract fractionation Five kg porcine hypothalamus were homogenized and extracted in methanol/water/acetic acid, 90/9/1, v/v/v. After centrifugation, the supernatant was delipidated by n-hexane extraction and the aqueous layer was fractionated by a Megabondelute fractionation. The material eluting at 50% acetonitrile/EtO was further fractionated on a HPLC C18 column. The fractions derived thereof were tested for 30 activation of the hDRR4 GPCR in the FLIPR assay. The Megabondelute fraction eluting from 0 to 60% acetonitrile in aqueous trifluoracetic acid (0.1%) was further WO 03/005036 PCT/EP02/07263 38 fractionated on a preparative DeltaPak C18 column (Waters Ass., 25x100mm, 15 fim, 300A). The fractions derived thereof were tested for activation of the hDRR4 GPCR in the FLIPR assay. Subsequent purification steps on a preparative Hypersil CI 8, an analytical Symmetry C18 column (4.6 x 250 mm), a narrow bore Xterra C8 column (2.1 5 x 250 mm), a narrow bore Xterra C18 column (2.1 x 250 mm) column and finally a narrow bore Symmetry C18 column (2.1x150 mm) were also followed by the FLIPR based activity assay for fractions activating hDRR4 transfected cells.

Mass spectrometry and Edman degradation based sequencing Electrospray ionisation (ESI) double quadrupole (Qq) orthogonal acceleration (oa) time-of-flight (Tof) mass spectrometry was performed on a Q-Tof system (Micromass UK). The active molecule was identified by analysis of fragment ions using collision induced dissociation (CID). One jil of acetonitrile/water/formic acid (50/49.9/0. l,v,v,v) containing the active fraction was loaded in a gold coated capillary (Protana L/Q 15 needle). The needle voltage was set at 900 V, the sampling cone at 25 V. The sample was sprayed at a flow rate of about 25 nl/min giving extended analysis time during which MS as well as MS/MS spectra could be acquired. During MS/MS or tandem mass spectrometry fragment ions are generated from a selected precursor ion by collision induced dissociation (CID), the collision energy is typically varied between 20 20 and 35 V, Argon was used as the collision gas. N-terminal amino acid sequencing of the purified peptide was performed on a Perkin Elmer/Applied Biosystems Procise 492 micro-sequencer running in the pulsed mode.

Membrane preparation The membranes were prepared as total particulate fractions. The cell lines were cultured to 90% confluency on 145 mm petri dishes and treated with 5 mM sodium butyrate, 24 hours before collection. The culturing medium was removed and the cells were washed twice with ice-cold phosphate-buffered saline (PBS w/o Ca2+ and Mg2+), scraped from the plates in 50 mM Tris-HCl buffer, pH 7.4, and collected by centrifugation (10 30 minutes at 16,000 RPM at 4°C). The cell pellet was re-suspended in hypotonic 5 mM Tris-HCI buffer, pH 7.4, and homogenized with an Ultra Tuirax homogenizer. The 39 homogenate was centrifuged at 18,000 RPM for 20 minutes at 4°C. The final pellet was re-suspended in 50 mM Tris-HCl buffer, pH 7.4 and stored in aliquots at -70°C. A protein determination was performed using the Bradford protein assay (Biorad) using bovine serum albumin (BSA) as standard.

J [ HJ Adenine binding [3H]Adenine binding experiments were performed to characterize transiently transfected cell lines. Membranes were thawed on ice and diluted in 50 mM HEPES buffer, pH 7.4 supplemented with 10 mM MgCk and 1 mM EGTA. Non-specific 10 binding was defined in the presence of 1 fiM adenine and a 1 hour incubation at 25°C with [^adenine (specific activity of 30.4 Ci/mmol), was found to be optimal for competition binding assays. Assays were carried out in a final volume of 500 fil, using 20 jxg of membrane protein for the transfected as well as the wildtype COS cells. The reaction was terminated by rapid filtration through Whatman GF/B filters using a 15 Brandel multi-channel cell harvester (96 wells). The filters were washed three times with 3 ml ice cold 50 mM HEPES buffer, pH 7.4, transferred to liquid scintillation vials and 3 ml of scintillation fluid (Ultima Gold MV) was added. Samples were counted in a P-scintillation counter after at least 6 hours to permit the glass fiber filters to become uniformly translucent.

Competitive inhibition of [3H]adenine by adenine was performed with 15 nM of [^adenine.

Specific binding was calculated as difference between counts in the presence and absence of 1 juM unlabeled adenine.

Verify expression levels of genes via real-time quantification PCR RNA from various tissues was obtained from Clontech except the Dorsal Root Ganglia RNA which was obtained from Analytical Biological Services. SDS primers and TaqMan probes for the hDRR4 gene have been designed using PrimerExpress 1.0 software (Perkin Elmer, MA, USA). The SDS forward and reverse primers for the 30 hDRR4 gene were 5*- GCGCAGGAACGCCTTCT -3' (SEQ ID NO:22) and 5'- CGGCCGCTGAGGAAGAG -3' (SEQ ID NO:23), respectively. The TaqMan probe for hDRR4 (5'-TCCTCAACTTGGCCGCAGCAGA-3' (SEQ ID NO:24) has been 40 designed using PrimerExpress 1.0 software (Perkin Elmer, MA, USA) and can be chosen either from the upper strand or the lower strand of the target sequence. The TagMan hDRR4 probe has been labeled with a reporter fluorescent dye, 6-carboxyfluorescein(FAM) at the 5'end. cDNA was made using Superscript II Reverse transcriptase. RT was carried out for 60 min at 42°C in a water bath. The reaction was terminated by heating at 70°C for 10 min. The PCR amplification was then performed in MicroAmp Optical 96-well reaction plates for 50 cycles with each cycle at 95°C for 15 s and 60°C for 1 min. All reactions were carried out in triplicate using the ABI Prism 7700 SDS. Relative expression of 10 hDRR4 in the tested tissues was compared to CyclophilinA expression.

Results Generation and cDNA sequence ofhDRR4 After performing PCR on a human genomic cosmid library a single PCR products was obtained. Sequencing of the PCR product showed strong similarity with the sequences of hDRR3 (97% aa identity) and hDRR4 (99% aa identity) (Patent W9932519). However, the sequence was identical to a stretch of sequence in an entry in the EMBL 20 database (AC023078). We arrived at the nucleotide and amino acid sequence depicted in Fig. 1.

The sequence described in Fig.l was analysed by BLAST (Altschul et al., 1997) search to examine whether related GPCRs with known ligands could be found. The closest homologues of this orphan GPCR that was retrieved, was the GPCR RC56.3.1 recently 25 identified in our laboratory as an adenine receptor. No ligands have been reported for other receptors related to hDRR4. These are a family of human GPCRs (Derwent sequence database accession numbers Z10067, Z10068, Z10069, Z10070 Z10071 and Z10072) cloned from dorsal root ganglion that have between 79% and 99% of residues in common with GPCR hDRR4. Another well known homologue is the mas proto-30 oncogene which shares 38% of residues with hDRR4. 41 Our first approach was to test adenine and other structurally related compounds, especially purines on hDRR4 in a FLIPR-based cellular assay. This was done by transient transfections in HEK293 cells with and without co-transfection of chimeric G proteins or the promiscuous Gal6 G protein. In these assays no specific response was observed. In a binding experiment using tritiated adenine no specific adenine binding to hDRR4 could be detected, while RC56.1.3 transfected cells showed clear specific adenine binding. Since this approach did not give us a hint for the natural ligand of this receptor we applied in order to identify the natural ligand the 'reverse pharmacology' strategy.

Purification of the natural agonist ofhDRR4 from porcine hypothalamus Essentially, an extract from the tissue known to be a rich source of secreted peptides, e.g. hypothalamus was prepared and the purification of the natural ligand was followed by a cellular assay based on the activation of the orphan GPCR as described in Material 15 and Methods.

The screening of the porcine hypothalamus extract after the first fractionation on a CI8 column delivered a range of fractions that resulted in transient intracellular Ca2+ release for cells transiently transfected with the hDRR4 expression construct. This was the case 20 for HEK293 cells transiently co-transfected with a Gal6 expression construct (Fig. 2), but not for wild-type HEK293 cells (data not shown). Two of these fractions, number 65 and 66, that yielded the strongest stimulation were chosen for further sub-fractionation and processed as described in Material and Methods. The purification was guided by the FLIPR based activity assay and the fraction that showed activity from the 25 last column run was subjected to mass spectrometry to determine purity as well as the structure of the compounds that it contained.

Identification ofhDRR4 activating substance by mass spectrometry Mass analysis of the active purified fraction from the Symmetry C18 (4.6 x 250 mm; 30 5jxm, Waters) reverse phase column gave one major mass-peak at 2163 Da (2164.7 M+H+). The elution profile of the active fraction on different HPLC columns indicated 42 that the receptor-activating compound was a peptide. Therefore, this mass was subsequently analyzed by Edman degradation based sequencing. The sequence was determined to be: AFRKFLPLFDRVLVERSA 5 (in single letter amino acid annotation).

Effect of the KDRR4 activating substance on the cell based FLIPR assay Activation of orphan GPCR hDRR4 (SEQ ID NO:2) by the hDRR binding fragment of EPF (SEQ ID NO:8) at a test concentration of 150 nM was measured in Hek293 cells 10 co-transfected with Gal6-pcDNA. Relative fluorescence units (RFU) were determined by loading the cells with Fluo-4 (Molecular Probes, Eugene, OR, U.S.A.). Hek 293 cells only transfected with the Gccl6-pcDNA expression vector did not response to the hDRR binding fragment as shown in Fig. 3. Using this FLIPR assay at different test concentrations of the hDRR activating peptide consisting of SEQ ID NO:8, an EC50-15 value of 12 nM has been determined (Fig. 7).

Expression of the hDRR4 gene Real-time quantification PCR, revealed hDRR4 expression in dorsal root ganglia (DRG) and trigeminal ganglia. This finding substantiates the potential role of this 20 receptor in perception or modulation of pain. Of al the tissues tested, hDRR4 was almost exclusively expressed in dorsal root ganglia and trigeminal ganglia as shown in Fig.6 herein the expression levels in the other tissues were compared to the expression level observed in dorsal root ganglia and trigeminal ganglia.

EXAMPLE 2: CLONING AND FUNCTIONAL CHARACTERIZATION OF THE GPCR HDRR7 Material and Methods 43 Materials Expand high fidelity polymerase, PCR buffer, T4 DNA ligase, and restriction endonucleases were obtained from Boehringer (Mannheim, Germany). Oligonucleotides were purchased from Eurogentec (Seraing, Belgium). Plasmid 5 preparation kits and the Qiaquick PCR amplification kit were from Qiagen (Hilden, Germany). The PRISM Ready Reaction Dye Tenninator Cycle Sequencing kits and the ABI 377 or 373A sequencing machines were from Applied Biosystems (Foster City, CA, U.S.A.). The Geneamp PCR System 9600 was from Perkin-Elmer (Norwalk, CT, U.S.A.). The mammalian expression vector pcDNA3 was obtained from Invitrogen 10 (Carlsbad, CA, U.S.A.). Dulbecco's modified Eagle medium (DMEM), foetal calf serum, and dialysed foetal calf serum was from Life Technologies (Gaithersburg, MD, U.S.A.).

DNA sequencing DNA sequencing was carried out with reagents from the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems) on PTC-200 PCR machines (MJ Research). Reaction products were purified on SEQueaky Kleen 96 well Terminator Removal Kit columns (BioRad) and were resolved on ABI377 DNA sequencing machines. For sequence analysis we used the Sequencher software from 20 GeneCodes (Ann Harbor, MI).

Cloning ofhDRR7 PCR was performed on a human genomic cosmid library (Clontech, Palo Alto, CA, USA) using the hDRR7 forward primer (CGAATTCCGCCACCATGGATCCAACCACCCCGG) (SEQ ID NO:13) and the hDRR7 reverse primer (GCTCTAGAGGCTGTCCATCTCTACACCAGACTGC) (SEQ ID NO: 14). The resulting PCR product was inserted into the mammalian expression vector pcDNA3 (Invitrogen, Carlsbad, CA, U.S.A.) and was used in subsequent screening experiments. 44 Transient expression in mammalian cells and FLIPR assay The hDRR7 expression plasmid was transiently co-transfected with a Gal6-pcDNA3 contract using the FuGENE 6 reagent (Roche Molecular Biochemicals, Mannheim, Germany) into HEK293 cells. The cells were loaded with Fluo-4 (Molecular Probes, 5 Eugene, OR, U.S.A.) according to the recommendations of the supplier. Subsequently the cells were assayed in the FLEPR instrument (Molecular Devices, Sunnyvale, CA, U.S. A.) for Ca2+ transients.

Membrane preparation 10 The membranes were prepared as total particulate fractions. The cell lines were cultured to 90% confluency on 145 nam petri dishes and treated with 5 mM sodium butyrate, 24 hours before collection. The culturing medium was removed and the cells were washed twice with ice cold phosphate buffered saline (PBS w/o Ca2+ and Mg2+), scraped from the plates in 50 mM Tris-HCl buffer, pH 7.4, and collected by centrifugation (10 15 minutes at 16,000 RPM at 4°C). The cell pellet was re-suspended in hypotonic 5 mM Tris-HCl buffer, pH 7.4, and homogenized with an Ultra Turrax homogenizer. The homogenate was centrifuged at 18,000 RPM for 20 minutes at 4°C. Hie final pellet was re-suspended in 50 mM Tris-HCl buffer, pH 7.4 and stored in aliquots at -70°C. A protein determination was performed using the Bradford protein assay (Biorad) using 20 bovine serum albumin (BSA) as standard.

Verify expression levels of genes via real-time quantification PCR RNA from various tissues was obtained from Clontech except the Dorsal Root Ganglia RNA which was obtained from Analytical Biological Services. SDS primers and 25 TaqMan probes for the hDRR7 gene have been designed using PrimerExpress 1.0 software (Perkin Elmer, MA, USA). The SDS forward and reverse primers for the hDRR7 gene were 5'- TGGAAATGACCAAGCCCTTCT -3' (SEQ ID NO: 15) and 5'-GAAAAGGATCAGGAAGACCGG-3" (SEQ ID NO: 16), respectively. The TaqMan probe for hDRR7 (5'-ATCAGGGTCTCCTTGCCACAAAGCAGT-3' (SEQ ID 30 NO: 17) has been designed using PrimerExpress 1.0 software (Perkin Elmer, MA, USA) and can be chosen either from the upper strand or the lower strand of the target 45 sequence. The TagMan hDRR7 probe has been labeled with a reporter fluorescent dye, 6-carboxyfluorescein (FAM) at the 5' end. cDNA was made using Superscript II Reverse transcriptase. RT was carried out for 60 min at 42°C in a water bath. The reaction was terminated by heating at 70°C for 10 min. 5 The PCR amplification was then performed in MicroAmp Optical 96-well reaction plates for 50 cycles with each cycle at 95°C for 15 s and 60°Cfor 1 min. All reactions were carried out in triplicate using the ABI Prism 7700 SDS. Relative expression of hDRR7 in the tested tissues was compared to P-actin expression.

Results Generation and cDNA sequence of hDRR7 After performing PCR on a human genomic cosmid library a single PCR products was 15 obtained. Sequencing of the PCR product showed that the sequence was identical to a stretch of sequence in an entry in the EMBL database (AX099247). We arrived at the nucleotide sequence depicted in SEQ ID NOtll.

Effect of the hDRR4 activating substance in the cell based FLIPR assay 20 Activation of orphan GPCR hDRR7 (SEQ ID NO: 12) by the hDRR binding fragment of EPF (SEQ ID NO:8) at a test concentration of 150 nM after transient co-transfection with Gal6-pcDNA into HEK293 cells. Relative fluorescence units (RFU) were determined by loading the cells with Fluo-4 (Molecular Probes, Eugene, OR, U.S.A.). Hek 293 cells only transfected with the Gal6-pcDNA expression vector did not 25 response to the hDRR binding fragment as shown in Fig. 4. Using this FLIPR assay at different test concentrations of the hDRR activating peptide consisting of SEQ ID NO:8, an ECso-value of 354 nM has been determined (Fig. 8).

Expression of the hDRR7 gene 30 Real-time quantification PCR, revealed hDRR7 expression in lymph nodes. This finding, in combination with the identification of early pregancy factor as natural agonist of the hDRR receptors, substantiates the potential role of this receptor in the 46 immunosuppressive action of EPF observed during pregnancy (Davis and Maslow, 1992). Of al the tissues tested, hDRR7 was predominantly expressed in lymph nodes as shown in Fig.5 wherein the expression levels in the other tissues were compared to the expression level observed in lymph nodes.

EXAMPLE 3: PURIFICATION AND IDENTIFICATION OF EPF-RELATED PEPTIDES Material and Methods Materials Expand high fidelity polymerase, PCR buffer, T4 DNA ligase, and restriction endonucleases were obtained from Boehringer (Mannheim, Germany). 15 Oligonucleotides were purchased from Eurogentec (Seraing, Belgium). Plasmid preparation kits and the Qiaquick PCR amplification kit were from Qiagen (Hilden, Germany). The PRISM Ready Reaction Dye Tenninator Cycle Sequencing kits and the ABI 377 or 373A sequencing machines were from Applied Biosystems (Foster City, CA, U.S.A.). The Geneamp PCR System 9600 was from Perkin-Elmer (Norwalk, CT, 20 U.S.A.). The mammalian expression vector pcDNA3 was obtained from Invitrogen (Carlsbad, CA, U.S.A.). Dulbecco's modified Eagle medium (DMEM), foetal calf serum, and dialysed foetal calf serum was from life Technologies (Gaithersburg, MD, U.S.A.).

DNA sequencing DNA sequencing was carried out with reagents from the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit OPE Biosystems) on PTC-200 PCR machines (MJ Research). Reaction products were purified on SEQueaky Kleen 96 well Terminator Removal Kit columns (BioRad) and were resolved on ABI377 DNA 30 sequencing machines. For sequence analysis we used the Sequencher software from GeneCodes (Ann Harbor, MI)- 47 Cloning ofhDRR4 PCR was performed on a human genomic cosmid library (Clontech, Palo Alto, CA, USA) using a forward primer (GGAATTCGCCACCATGGATCCAACGGTCTCAACCTTGG) and a reverse primer (GTCTCGAGTCACTGCTCCAATCTGCTTCCC). The resulting PCR products were cloned with the help of the TOPO™ TA Cloning kit (Invitrogen, Carlsbad, CA, U.SA.). The full-length reading frame was inserted into the mammalian expression vector pcDNA3 (Invitrogen, Carlsbad, CA, U.S.A.) and was used in subsequent screening experiments.

Cloning ofhDRR7 PCR was performed on a human genomic cosmid library (Clontech, Palo Alto, CA, USA) using the hDRR7 forward primer (CGAATTCCGCCACCATGGATCCAACCACCCCGG) (SEQ ID NO: 13) and the 15 hDRR7 reverse primer (GCTCTAGAGGCTGTCCATCTCTACACCAGACTGC) (SEQ ID NO: 14). The resulting PCR product was inserted into the mammalian expression vector pcDNA3 (Invitrogen, Carlsbad, CA, U.SA.) and was used in subsequent screening experiments.

Transient expression in mammalian cells and FLIPR assay The hDRR4 expression plasmid or the hDRR7 expression plasmid was transiently co-transfected with a Gal6-pcDNA3 construct using the FuGENE 6 reagent (Roche Molecular Biochemicals, Mannheim, Germany) into HEK293 cells. The cells were loaded with FIuo-4 (Molecular Probes, Eugene, OR, U.S.A.) according to the 25 recommendations of the supplier. Subsequently the cells were assayed in the ELDPR instrument (Molecular Devices, Sunnyvale, CA, U.S.A.) for Ca2+ transients.

Purification from a thyroid gland extract. 2.5 kg porcine thyroid glands were homogenized and extracted in methanol/water/acetic 30 acid (90/9/1, v/v/v). After centrifugation, the supernatant was delipidated by n-hexane extraction and the aqueous layer was fractionated by a MegabondElute solid phase 48 extraction. The material eluting from 0 to 50% acetonitrile in aqueous trifluoracetic acid (0.1%) was further fractionated by reverse phase HPLC on a preparative DeltaPak CI 8 column (40x100 mm). The fractions derived thereof were tested for activation of the hDRR4 GPCR in the FLIPR assay. Subsequent purification steps on a preparative 5 Deltapak C4 column (25x10 mm), an analytical C18 column (4.6x250 mm), a narrow bore X-terra C18 column (2.1x250 mm) and finally a capillary Symmetry C18 column (0.32x150 mm) were also followed by the FLIPR based activity assay for fractions activating hDRR4 transfected cells.

Results Purification of the natural agonist ofhDRR4 from porcine thyroid glands Essentially, an extract from the tissue known to be a rich source of secreted peptides, e.g. thyroid gland was prepared and the purification of the natural ligand was followed by a cellular assay based on the activation of the orphan GPCR as described in Material and Methods.

The screening of the porcine thyroid gland extract after the first fractionation on a C18 column delivered a range of fractions that resulted in transient intracellular Ca2+ release for cells transiently transfected with the hDRR4 expression construct.

Two adjacent fractions were purified to homogeneity and analysed by ESI-Qq-TOF MS. Both fractions yielded two prominent triple charged ion peaks at m/z 640.59 corresponding to a mass of 1918.77 Da and at mlz 716.63 corresponding to a mass of 2146.89 Da. These peaks were selected in a tandem MS experiment and fragmented by collision-induced dissociation on a Q-TOF system. Four possible sequences were obtained for the 2146.8 Da compound: LGX1AFRX2FLPLFDRVLVE, (Xi and X2 being K or Q), and four possible sequences for the 1918.77 Da peptide, which is a shorter isoform of the first peptide, LGXj AFRX2FLPLFDRVL (Xj and X2 being K or Q). (SEQ ID NOs 18 -21) The amino acids 2-19 and 2-17 of these sequences correspond to chaperoninlO (HsplO) 2-18 and chaperoninlO (HsplO) 2-16 respectively. The amino acid residue on position 7 is a lysine (K) in chaperonins of all vertebrates studied so far. The amino acid residue 49 on position 3 is a Q in Rattus norvegicus, Mus musculus and Homo sapiens, all mammalian species and a K in Gallus gallus (Aves).

FLIPR measurement The purified peptides or dried tissue fractions were dissolved in calcium buffer and loaded onto regular multi-well 96 plates. Subsequently the cells were assayed in the FLEPR instrument (Molecular Devices, Sunnyvale, CA, U.S.A.) for Ca2+ transients. For the EPF-related peptides the following pECso values were determined; Name Sequence MrgXl (pEC50) MrgX2(pEC50) EPF 1-16 LGQAFRKFLPLFDRVL (SBQ ID NO:21) 7.821 ± 0.1538 6.059 ± 0.916 Fig. 9 EPF i-ia LGQAFRKFLPLFDRVLVE (SEQ ID NO:19) 7.003 ± 0.0462 6.086 + 0.105 Fig 10 References Altschul,S.F., Madden,TX., Schaffer,A.A., Zhang, J., Zhang,Z., Miller,W., and LipmanJD J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402.

Athanasas-Platsis, S., Corcoran, C.M., Kaye, P.L., Cavanagh, A.C., and Morton, H. early pregnancy factor is required at two important stages of embiyonic development in the mouse. American J. of Reproductive Immunology 43 (4), 2000,223 -233.

Confavieux, C., Hutchinson, M., Hours, M.M., Cortinovis-Tourniaire, P., and Moreau, T. Rate of pregnancy-related relapse in multiple sclerosis, pregnancy in multiple sclerosis group. New England J. of Medicine 339 (5), 1998,285 - 291.

Davis, R.K., and Maslow, A.S. Multiple sclerosis in pregancy: a review. Obstetrical & Gynecological Survey 47 (5), 1992,290 - 296.

Hickey, R.W., Zhu, R.L., Alexander, H.L., Jin, K.L., Stetler, R.A., Chen, J., Kochanek, P.M., and Graham, S.H. 10 kD mitochondrial matrix heat shock protein mRNA is induced following global brain ischemia in the rat. Brain Research. Molecular Brain Research 79 (1-2), 2000,169 -173.

Hinuma, S. et al (1998) A prolactin-releasing peptide in the brain. Nature 393,272-276.

Lau, S., Patnaik, N., Sayen, M.R., and Mestril, R. Simultaneous overexpression of two stress proteins in rat cardiomyocytes and myogenic cells confers protection against ischemia - induced injury. Circulation 96 (7), 1997, 2287 - 2294. 50 Morton, H. Early pregnancy factor: an extracellular chaperonin 10 homologue.

Immunology & Cell Biology 76 (6), 1998,483 - 496.

Reinscheid R.K. et al., (1995) Oiphanin FQ: A neuropeptide that activates an opioidlike G-protein-coupled receptor. Science 270,792-794.

Sakurai T. et al., (1998) Orexins and orexin receptors: a family of hypothalamic neuropeptide and G-protein-coupled receptors that regulate feeding behaviour. Cell 92, 573-585.

Stadel, J.M., Wilson, S., andBergsma, D.J. (1997) Orphan G protein-coupled receptors: a neglected opportunity for pioneer drug discovery. TiPS 18,430-437. 10 Summers, K.M., Fletcher, B.H., Macaranas, D.D., Somodevilla-Torres, M.J., Murphy, R.M., Osbonie, M.J., Spuir, NX, Cassady, A.I, and Cavanagh, A.C. Mapping and characterization of the eukaryotic early pregnancy factor/chaperonin 10 gene family. Somatic Cell & Molecular Genetics 24(6), 1998,315 -326.

Tatemoto K, Hosoya M, Habata Y, Fujii R, Kakegawa T, Zou MX, Kawamata Y, 15 Fukusumi S, Hinuma S, Kitada C, Kurokawa T, Onda H, Fujino M. (1998) Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor.

Biochem Biophys Res Commun. 251,471-476.

Wilson S., Bergsma D .J., Chambers J.K., Muir A.I., Fantom K.G., Ellis C., Murdock 20 P.R., Herrity N.C., Stadel J.M. (1998) Orphan G-protein-coupled receptors: the next generation of drug targets? Br. J. Pharmacol. 125,1387-1392.

Claims (27)

1. 51. WHAT IS CLAIMED IS: 1An assay to identify compounds that mimic or alter the biological effects of early pregnancy factor (EPF) or chaperonin 10, which assay comprises the steps of: a) contacting EPF or a peptide having at least 70% sequence identity with EPF with a human dorsal root receptor 4 (hDRR4) and/or human dorsal root receptor 7 (hDRR7) polypeptide; b) contacting a test compound with said hDRR4 and/or hDRR7 polypeptide; and c) determining the effect of said test compound on said hDRR4 and/or hDRR7 polypeptide in a competitive, non-competitive or comparative assay with said EPF or peptide having at least 70% sequence identity with EPF.

2. The assay according to claim 1 wherein EPF or the peptide having at least 70% sequence identity with EPF is selected from the group consisting of: i) an isolated polypeptide encoding EPF, comprising the amino acid sequence SEQ ID NO:4; ii) an isolated polypeptide derived from EPF having at least 70% sequence identity with EPF and capable of binding to hDRR4 and/or hDRR7; iii) an isolated polypeptide having at least 70% sequence identity with EPF comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID N0:20 and SEQ ID NO:21; and iv) an isolated polypeptide comprising the hDRR4 and/or hDRR7 binding fragment consisting of amino acid sequence SEQ ID NO:8.

3. The assay according to claim 1 wherein i) the hDRR4 polypeptide is a polypeptide comprising the amino acid sequence SEQ ID NO:2 or a functional fragment thereof; or fiMTBlECTi^LWPERTYj office of n.z. ' 17 OCT 2007 received. 52 ii) the hDRR7 polypeptide is a polypeptide comprising the amino acid sequence SEQ ID NO: 12 or a functional fragment thereof.

4. An isolated and purified hDRR4 and/or hDRR7 binding fragment of EPF or of a peptide having at least 70% sequence identity with EPF, said fragment being selected from the group consisting of: the hDRR4 and /or hDRR7 binding fragment consisting of amino acid sequence SEQ ID NO: 8, or - SEQ ID NO: 18, SEQ ID NO: 19, SEQ IDNO:20 or SEQ IDNO:21; or a sequence of between 16 and 21 amino acids having at least 70% sequence identity with SEQ ID NO:8, 18, 19, 20 and/or 21.

5. An isolated and purified nucleic acid molecule encoding an hDRR4 and/or hDRR7 binding fragment of EPF or of a peptide having at least 70% sequence identity with EPF according to claim 4.

6. Use of an isolated and purified nucleic acid molecule encoding EPF or a peptide having at least 70% sequence identity with EPF in an assay according to claim 1 wherein said nucleic acid molecule is selected from the group consisting of: (a) a nucleic acid molecule encoding EPF comprising the amino acid sequence of SEQ ID NO:4; (b) a nucleic acid molecule which is complementary to the polynucleotide of (a); (c) a nucleic acid molecule comprising at least 15 sequential bases of the polynucleotide of (a) or (b); (d) a nucleic acid molecule that hybridizes under stringent conditions to the polynucleotide molecule of (a) or (b); and ntellectual property office of n.z. 17 OCT 2007 received 53 (e) a nucleic acid molecule encoding a peptide having at least 70% sequence identity with EPF that has 70, 80, 90, 95 or 99% sequence identity to the amino acid sequence encoded by the polynucleotide molecule of (a) or (b).

7.Use of an isolated and purified nucleic acid molecule which encodes hDRR4, or a functional fragment thereof, in an assay according to claim 1, wherein said nucleic acid molecule is selected from the group consisting of: (a) a nucleic acid molecule encoding hDRR4 comprising the amino acid sequence of SEQ ID NO:2; (b) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:l, encoding hDRR4; (c) a nucleic acid molecule which is complementary to the polynucleotide of (a) or (b); (d) a nucleic acid molecule comprising at least 15 sequential bases of the polynucleotide of (a), (b) or (c); and (e) a nucleic acid molecule that hybridizes under stringent conditions to the polynucleotide molecule of (a), (b) or (c).

8.Use of an isolated and purified nucleic acid molecule which encodes hDRR7, or a functional fragment thereof, in an assay according to claim 1, wherein said nucleic acid molecule is selected from the group consisting of: (a) a nucleic acid molecule encoding hDRR7 comprising the amino acid sequence of SEQ ID NO: 12; (b) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:l 1, encoding hDRR7; (c) a nucleic acid molecule which is complementary to the polynucleotide of (a) or (b); (d) a nucleic acid molecule comprising at least 15 sequential bases of the polynucleotide of (a), (b) or (c); and intellectual property office of n.z. 1 7 OCT 2007 nroci\/Cn 54 (e) a nucleic acid molecule that hybridizes under stringent conditions to the polynucleotide molecule of (a), (b) or (c).

9.A method of identifying and obtaining a test compound capable of binding a hDRR4 and/or hDRR7 polypeptide comprising: a) incubating a source containing an hDRR4 and/or hDRR7 polypeptide or a functional fragment thereof, with i) EPF or a peptide having at least 70% sequence identity with EPF ii) said test compound; b) measuring the effect of the test compound on the amount of EPF or a peptide having at least 70% sequence identity with EPF bound to the receptor; and c) identifying that said test compound in step b) competes with EPF or a peptide having at least 70% sequence identity with EPF for binding to the receptor.

10.The method according to claim 9 wherein the source containing an hDRR4 and/or hDRR7 polypeptide or a functional fragment thereof is selected from the group consisting of: i) an isolated and purified protein having the amino acid sequence of SEQ ID NO:2 or a functional fragment thereof; ii) an isolated and purified protein having the amino acid sequence of SEQ ID NO: 12 or a functional fragment thereof; iii) cells expressing on the surface thereof the hDRR4 polypeptide having the amino acid sequence of SEQ ID NO:2 or a functional fragment thereof; iv) cells expressing on the surface thereof the hDRR7 polypeptide having the amino acid sequence of SEQ ID NO: 12 or a functional fragment thereof; intellectual property office of n.z. 17 OCT 2007 r-> rr/-> tr I\/ P n 55 v) membrane preparations of cells expressing on the surface thereof the hDRR4 polypeptide having the amino acid sequence of SEQ ID NO:2 or a functional fragment thereof; and vi) membrane preparations of cells expressing on the surface thereof the hDRR7 polypeptide having the amino acid sequence of SEQ ID NO: 12 or a functional fragment thereof.

11. The method according to claim 10 wherein the isolated and purified protein is bound to a solid support.

12. The method according to any one of claims 9 to 11 wherein EPF or the peptide having at least 70% sequence identity with EPFjs labeled and wherein said label is used to measure the effect of the test compound on the amount of EPF or peptide having at least 70% sequence identity with EPF_bound to the receptor.

13. The method according to claim 9 wherein the method is of rational drug design comprising the steps of: a) probing the structure of the ligand binding site on hDRR4 and/or hDRR7 with EPF or a peptide having at least 70% sequence identity with EPF; b) identifying contacting atoms in the ligand binding site of hDRR4 and/or hDRR7 that interact with the EPF ligand during binding; c) designing test compounds that interact with the atoms identified in (b) to modulate the activity of hDRR4 and/or hDRR7; and d) contacting said designed test compound with a source containing hDRR4 and/or hDRR7 or a functional fragment thereof, to measure the capability of said compound to modulate hDRR4 and/or hDRR7 activity.

14. A method of identifying and obtaining a test compound capable of modulating the activity of hDRR4 and/or hDRR7 comprising: intellectual property office of n.z. 17 OCT 2007 received 56 a) incubating a source containing hDRR4 and/or hDRR7 or a functional fragment thereof, with said test compound; b) measuring the effect of the test compound on the activity of hDRR4 and/or hDRR7; and c) comparing this effect with the activity of hDRR4 and/or hDRR7 upon binding of the EPF ligand or a peptide having at least 70% sequence identity with EPF whereby, a test compound is considered capable of modulating the activity of hDRR4 and/or hDRR7 when said test compound interacts with and activates hDRR4 and/or hDRR7 when compared to the binding of EPF or a peptide having at least 70% sequence identity with EPF with the hDRR4 and/or hDRR7 used as a positive or negative control.

15. The method according to claim 14, wherein the hDRR4 and/or hDRR7 containing source is a cell expressing on the surface thereof the polypeptide receptor having the amino acid sequence of SEQ ID NO:2 or SEQ ID NO: 12.

16. The method according to any one of claims 14-15, wherein the effect of the modulator on hDRR4 and/or hDRR7 is modulation of an intracellular second messenger formation.

17. The method according to claim 16, wherein the intracellular second messenger is cAMP, calcium or a reporter gene product.

18. An hDRR4 and/or hDRR7 binding fragment as claimed in claim 4 for use as a medicine.

19. Use of an hDRR4 and/or hDRR7 binding fragment as claimed in claim 4 in the manufacture of a composition for use in the treatment of cancers like ntellectual property office of n.z. I 7 OCT 2007 received 57 lymphoblastic leukemia; or for the treatment of autoimmune diseases like rheumatoid arthritis and multiple sclerosis.

20. A method for isolating hDRR4 and/or hDRR7 from a cellular fraction containing the same comprising contacting the cellular fraction with EPF or a hDRR4 and/or hDRR7 binding fragment thereof immobilized to a solid substrate and eluting hDRR4 and/or hDRR7 therefrom.

21. A kit for diagnosing pregnancy comprising; i) a polypeptide selected from the group consisting of SEQ ID NO:18, SEQ ID NO:19, SEQ ID N0:20 and SEQ ID NO:21, or the hDRR4 and/or hDRR7 binding fragment of SEQ ID NO:8, or a sequence of between 16 and 21 amino acids having at least 70% sequence identity with SEQ ID NO:8, 18, 19, 20 and/or 21; or ii) an antibody to a polypeptide selected from the group consisting of SEQ ID NO:18, SEQ ID NO:19, SEQ ID N0:20 and SEQ ID NO:21, or the hDRR4 and/or hDRR7 binding fragment of SEQ ID NO:8.

22. Use of the hDRR4 and/or hDRR7 binding fragment according to claim 4 in the manufacture of a composition for use in the prevention of foetal loss.

23. The assay according to claim 1, substantially as herein described with reference to any example thereof.

24. The isolated and purified hDRR4 and/or hDRR7 binding fragment of EPF or of a peptide having at least 70% sequence identity with EPF according to claim 4, substantially as herein described with reference to any example thereof. intellectual property office of n.z. 17 OCT 2007 rfceived 58

25. The use according to any one of claims 6 to 8, 19, and 22, substantially as herein described with reference to any example thereof.

26. The method according to any one of claims 9, 14, or 20, substantially as herein described with reference to any example thereof.

27. The diagnostic kit according to claim 21, substantially as herein described with reference to any example thereof. JANSSEN PHARMACEUTICA N.V. By Its Attorneys BALDWINS intellectual property office of n.z. 17 OCT 2007 received