AU1213701A - Tricyclic compounds useful as hiv reverse transcriptase inhibitors - Google Patents

Description

WO 01/29037 PCT/USOO/28824 TITLE TRICYCLIC COMPOUNDS USEFUL AS HIV REVERSE TRANSCRIPTASE INHIBITORS 5 FIELD OF THE INVENTION This invention relates generally to tricyclic compounds and also tricyclic compounds which are useful as inhibitors of HIV reverse transcriptase, 10 pharmaceutical compositions and diagnostic kits comprising the same, methods of using the same for treating viral infection or as assay standards or reagents, and intermediates and processes for making such tricyclic compounds. 15 BACKGROUND OF THE INVENTION Two distinct retroviruses, human immunodeficiency virus (HIV) type-1 (HIV-1) or type-2 (HIV-2), have been etiologically linked to the immunosuppressive disease, 20 acquired immunodeficiency syndrome (AIDS). HIV seropositive individuals are initially asymptomatic but typically develop AIDS related complex (ARC) followed by AIDS. Affected individuals exhibit severe immunosuppression which predisposes them to debilitating 25 and ultimately fatal opportunistic infections. The disease AIDS is the consequence of HIV-1 or HIV-2 virus following its complex viral life cycle. The virion life cycle involves the virion attaching itself to the host human T-4 lymphocyte immune cell through the 30 binding of a glycoprotein on the surface of the virion's protective coat with the CD4 glycoprotein on the lymphocyte cell. Once attached, the virion sheds its glycoprotein coat, penetrates into the membrane of the host cell, and uncoats its RNA. The virion enzyme, 35 reverse transcriptase, directs the process of 1 WO 01/29037 PCT/USOO/28824 transcribing the RNA into single-stranded DNA. The viral RNA is degraded and a second DNA strand is created. The now double-stranded DNA is integrated into the human cell's genes and those genes are used for 5 virus reproduction. RNA polymerase transcribes the integrated viral DNA into viral mRNA. The viral RNA is translated into the precursor gag-pol fusion polyprotein. The polyprotein is then cleaved by the HIV protease enzyme to yield the 10 mature viral proteins. Thus, HIV protease is responsible for regulating a cascade of cleavage events that lead to the virus particle's maturing into a virus that is capable of full infectivity. The typical human immune system response, killing 15 the invading virion, is taxed because the virus infects and kills the immune system's T cells. In addition, viral reverse transcriptase, the enzyme used in making a new virion particle, is not very specific, and causes transcription mistakes that result in continually 20 changed glycoproteins on the surface of the viral protective coat. This lack of specificity decreases the immune system's effectiveness because antibodies specifically produced against one glycoprotein may be useless against another, hence reducing the number of 25 antibodies available to fight the virus. The virus continues to reproduce while the immune response system continues to weaken. In most cases, without therapeutic intervention, HIV causes the host's immune system to be debilitated, allowing opportunistic infections to set 30 in. Without the administration of antiviral agents, immunomodulators, or both, death may result. There are at least three critical points in the HIV life cycle which have been identified as possible targets for antiviral drugs: (1) the initial attachment 35 of the virion to the T-4 lymphocyte or macrophage site, 2 WO 01/29037 PCT/USOO/28824 (2) the transcription of viral RNA to viral DNA (reverse transcriptase, RT), and (3) the processing of gag-pol protein by HIV protease. Inhibition of the virus at the second critical 5 point, the viral RNA to viral DNA transcription process, has provided a number of the current therapies used in treating AIDS. This transcription must occur for the virion to reproduce because the virion's genes are encoded in RNA and the host cell transcribes only DNA. 10 By introducing drugs that block the reverse transcriptase from completing the formation of viral DNA, HIV-1 replication can be stopped. A number of compounds that interfere with viral replication have been developed to treat AIDS. For 15 example, nucleoside analogs, such as 3'-azido-3'-deoxythymidine (AZT), 2',3'-dideoxycytidine (ddC), 2',3'-dideoxythymidinene (d4T), 2',3'-dideoxyinosine (ddI), and 2',3'-dideoxy-3'-thia-cytidine (3TC) have been shown to 20 be relatively effective in certain cases in halting HIV replication at the reverse transcriptase (RT) stage. An active area of research is in the discovery of non-nucleoside HIV reverse transcriptase inhibitors (NNRTIs). As an example, it has been found that certain 25 benzoxazinones and quinazolinones are active in the inhibition of HIV reverse transcriptase, the prevention or treatment of infection by HIV and the treatment of AIDS. U.S. 5,874,430 describes benzoxazinone non 30 nucleoside reverse transcriptase inhibitors for the treatment of HIV. U.S. 5,519,021 describe non nucleoside reverse transcriptase inhibitors which are benzoxazinones of the formula: 3 WO 01/29037 PCT/USOO/28824 X1 R x N Z H wherein X is a halogen, Z may be 0. EP 0,530,994 and WO 93/04047 describe HIV reverse transcriptase inhibitors which are quinazolinones of the 5 formula (A): R1 R2 R R2 R3 (GnN Z 14 R (A) wherein G is a variety of groups, R 3 and R 4 may be H, Z may be 0, R 2 may be unsubstituted alkyl, unsubstituted 10 alkenyl, unsubstituted alkynyl, unsubstituted cycloalkyl, unsubstituted heterocycle, and optionally substituted aryl, and R 1 may be a variety of groups including substituted alkyl. WO 95/12583 also describes HIV reverse 15 transcriptase inhibitors of formula A. In this publication, G is a variety of groups, R 3 and R 4 may be H, Z may be 0, R 2 is substituted alkenyl or substituted alkynyl, and R 1 is cycloalkyl, alkynyl, alkenyl, or cyano. WO 95/13273 illustrates the asymmetric synthesis 20 of one of the compounds of WO 95/12583, (S) -(-)-6-chloro-4-cyclopropyl-3,4-dihydro-4( (2-pyridy)e thynyl)-2(lH)-quinazolinone. Synthetic procedures for making quinazolinones like those described above are detailed in the following 25 references: Houpis et al., Tetr. Lett. 1994, 35(37), 6811-6814; Tucker et al., J. Med. Chem. 1994, 37, 4 WO 01/29037 PCT/USOO/28824 2437-2444; and, Huffman et al., J. Org. Chem. 1995, 60, 1590-1594. DE 4,320,347 illustrates quinazolinones of the formula:

R

3 Y R2 NkX 5 H wherein R is a phenyl, carbocyclic ring, or a heterocyclic ring. Compounds of this sort are not considered to be part of the present invention. Even with the current success of reverse 10 transcriptase inhibitors, it has been found that HIV patients can become resistant to a given inhibitor. Thus, there is an important need to develop additional inhibitors to further combat HIV infection. 15 SUMMARY OF THE INVENTION Accordingly, one object of the present invention is to provide novel reverse transcriptase inhibitors. It is another object of the present invention to provide a novel method for treating HIV infection which 20 comprises administering to a host in need of such treatment a therapeutically effective amount of at least one of the compounds of the present invention, including a pharmaceutically acceptable salt form thereof. It is another object of the present invention to 25 provide a novel method for treating HIV infection which comprises administering to a host in need thereof a therapeutically effective combination of (a) one of the compounds of the present invention and (b) one or more compounds selected from the group consisting of HIV 30 reverse transcriptase inhibitors and HIV protease inhibitors. 5 WO 01/29037 PCT/USOO/28824 It is another object of the present invention to provide pharmaceutical compositions with reverse transcriptase inhibiting activity comprising a pharmaceutically acceptable carrier and a 5 therapeutically effective amount of at least one of the compounds of the present invention or a pharmaceutically acceptable salt form thereof. It is another object of the present invention to provide novel tricyclic compounds for use in therapy. 10 It is another object of the present invention to provide the use of novel tricyclic compounds for the manufacture of a medicament for the treatment of HIV infection. These and other objects, which will become apparent 15 during the following detailed description, have been achieved by the inventors' discovery that compounds of formula (I): Ri R2 X- A B Z N (I) 20 wherein R 1 , R 2 , R 8 , n, A, B, W, X, Y, and Z are defined below, including any stereoisomeric form, mixtures of stereoisomeric forms, complexes, prodrug forms or pharmaceutically acceptable salt forms thereof, are effective reverse transcriptase inhibitors. 25 DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS [1] Thus, in a first embodiment, the present invention provides a novel compound of formula (I): 6 WO 01/29037 PCT/USOO/28824 Ri R2 ,W I IXA B), Z N (I) or a stereoisomeric form, mixtures of stereoisomeric forms, complexes, prodrug forms or pharmaceutically 5 acceptable salt form thereof, wherein: n is selected from 0, 1, 2 and 3; A is a ring selected from the group: CN , and 10 N wherein a ring nitrogen in ring A may optionally be in an N-oxide form; 15 said ring A being substituted with 0-3 B, said substituent B being independently selected from the group C 1

-

4 alkyl, -OH, C 1

-

4 alkoxy, -S-CI_ 4 alkyl,

OCF

3 , CF 3 , F, Cl, Br, I, -NO 2 , -CN, and -NR 5

R

5 a; 20 W is N or CR 3 ; X is N or CR 3 a; Y is N or CR 3 b; 25 7 WO 01/29037 PCT/USOO/28824 Z is N or CR 3 c; provided that if two of W, X, Y, and Z are N, then the remaining are other than N; 5

R

1 is selected from the group C 1

-

3 alkyl substituted with 0-7 halogen, and cyclopropyl substituted with 0-5 halogen; 10 R 2 is selected from the group -R 2 c, -OH, -CN, -OR 2 c,

-OCHR

2 aR 2 b, -OCH 2

CHR

2 aR 2 b, -O(CH 2

)

2

CHR

2 aR 2 b,

-OCHR

2 aC(R 2 a)=C(R 2 b) 2 , -OCHR 2 aC(R 2 a)=C(R 2 b) 2 ,

-OCHR

2 aC=C-R 2 b, -SR 2 c, -SCHR 2 aR 2 b, -SCH 2

CHR

2 aR 2 b,

-S(CH

2

)

2

CHR

2 aR 2 b, -SCHR 2 aC(R 2 a)=C(R 2 b) 2 , 15 -SCHR 2 aC(R 2 a)=(R 2 b) 2 , -SCHR 2 aC=C-R 2 b, -NR 2 aR 2 c,

-NHCHR

2 aR 2 b, -NHCH 2

CHR

2 aR 2 b, -NH (CH 2 ) 2

CHR

2 aR 2 b,

-NHCHR

2 aC(R 2 a)=C(R 2 b) 2 , -NHCHR 2 aC(R 2 a)=(R 2 b) 2 , and

-NHCHR

2 aC=C-R 2 b; 20 R 2 a is selected from the group H, CH 3 , CH 2

CH

3 , CH(CH 3

)

2 , and CH 2

CH

2

CH

3 ;

R

2 b is H or R 2 c; 25 R 2 c is selected from the group methyl substituted with 0-3 R 3 f, C1-6 alkyl substituted with 0-3 R 4 , C2-5 alkenyl substituted with 0-2 R 4 , C 2

-

5 alkynyl substituted with 0-1 R 4 , C 3

-

6 cycloalkyl substituted with 0-2 R3d, phenyl substituted with 30 0-2 R 3 d, and 3-6 membered heterocyclic system containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-2 R3d; 8 WO 01/29037 PCT/USOO/28824 alternatively, the group -NR 2 aR 2 c represents a 4-7 membered cyclic amine, wherein 0-1 carbon atoms are replaced by 0 or NR 5 ; 5

R

3 is selected from the group H, C 1

_

4 alkyl, -OH, Ci_ 4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5

R

5 a, -NO 2 , -CN,

-C(O)R

6 , -NHC(0)R 7 , -NHC(0)NR 5

R

5 a, -NHSO 2 R1 0 ,

-SO

2

NR

5

R

5 a, and a 5-6 membered heteroaromatic ring 10 containing 1-4 heteroatoms selected from the group 0, N, and S;

R

3 a is selected from the group H, C 1 4 alkyl, -OH, C 1

_

4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5

R

5 a, -NO 2 , -CN, 15 -C(O)R 6 , -NHC(O)R 7 , -NHC(0)NR 5

R

5 a, -NHSO 2

R

1 0 ,

-SO

2

NR

5 R5a, and a 5-6 membered heteroaromatic ring containing 1-4 heteroatoms selected from the group 0, N, and S; 20 alternatively, R 3 and R 3 a together form -OCH 2 0-;

R

3 b is selected from the group H, C 1

-

4 alkyl, -OH, C 1 4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5

R

5 a, -NO 2 , -CN,

-C(O)R

6 , -NHC(O)R 7 , -NHC(O)NR 5

R

5 a, -NHSO 2

R

1 o, and 25 -SO 2

NR

5

R

5 a; alternatively, R 3 a and R 3 b together form -OCH 2 0-;

R

3 c is selected from the group H, C 1

-

4 alkyl, -OH, C 1 4 30 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5

R

5 a, -NO 2 , -CN,

-C(O)R

6 , -NHC(O)R 7 , -NHC(O)NR5R 5 a, -NHSO 2

R

1 0 , and

-SO

2

NR

5

R

5 a; 9 WO 01/29037 PCT/USOO/28824 alternatively, R3b and R 3 c together form -OCH 2 0-; R3d, at each occurrence, is independently selected from 5 the group H, C 1

-

4 alkyl, -OH, C 1 4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5

R

5 a, -NO 2 , -CN, -C(O)R 6 , -NHC(0)R 7 ,

-NHC(O)NR

5

R

5 a, -NHSO 2

R

1 0 , and -SO 2

NR

5

R

5 a;

R

3 e, at each occurrence, is independently selected from 10 the group H, C 1

_

4 alkyl, -OH, C 1

-

4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5

R

5 a, -NO 2 , -CN, -C(O)R 6 , -NHC(O)R 7 ,

-NHC(O)NR

5

R

5 a, -NHSO 2

R

1 0 , and -SO 2

NR

5

R

5 a;

R

3 f, is selected from the group group H, F, Cl, Br, I, 15 -OH, -O-R 1 1 , -O-C 3

-

1 0 carbocycle substituted with 0 2 R3e, -O(CO) -R 1 3 , -OS(O) 2

CI_

4 alkyl, -NR1 2 R1 2 a, -C (0) R 1 3 , -NHC (0) R1 3 , -NHSO 2

R

1 0 , and -SO 2 NR1 2 R1 2 a;

R

4 is selected from the group H, F, Cl, Br, I, -OH, 20 -O-R 11 , -O-C 3

-

1 0 carbocycle substituted with 0-2

R

3 e, -OS(O) 2

C

1

_

4 alkyl, -NR1 2 R1 2 a, C 1 -6 alkyl substituted with 0-2 R 3 e, C 3

-

1 0 carbocycle substituted with 0-2 R 3 e, phenyl substituted with 0-5 R 3 e, and a 5-10 membered heterocyclic system 25 containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-2 R 3 e;

R

5 and R 5 a are independently selected from the group H and C 1 4 alkyl; 30 10 WO 01/29037 PCT/USOO/28824 alternatively, R 5 and R 5 a, together with the nitrogen to which they are attached, combine to form a 5-6 membered ring containing 0-1 0 or N atoms; 5 R 6 is selected from the group H, OH, C 1

-

4 alkyl, C 1 4 alkoxy, and NR5R 5 a;

R

7 is selected from the group H, C 1

-

3 alkyl and C1-3 alkoxy; 10

R

8 is selected from the group H, (C1-6 alkyl)carbonyl,

C

1

-

6 alkoxyalkyl, (C 1

-

4 alkoxy)carbonyl, C6-10 aryloxyalkyl, (C 6 -10 aryl)oxycarbonyl, (C6-10 aryl)methylcarbonyl, (Ci-4 alkyl)carbonyloxy(C 1 -4 15 alkoxy)carbonyl, C6-10 arylcarbonyloxy(Ci-4 alkoxy)carbonyl, C1-6 alkylaminocarbonyl, phenylaminocarbonyl, phenyl(C1-4 alkoxy)carbonyl, and (C 1

-

6 alkyl substitued with NR 5

R

5 a)carbonyl; and 20 R 1 0 is selected from the group C1_4 alkyl and phenyl

R

11 is selected from C1-6 alkyl, C1-6 haloalkyl, C1-6 alkyl substituted with C 3

-

6 cycloalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-6 cycloalkyl; 25 R1 2 and R12a are independently selected from H, C1-6 alkyl, and C3-6 cycloalkyl; alternatively, R 1 2 and R 1 2 a can join to form 4-7 membered 30 ring; and 11 WO 01/29037 PCT/USOO/28824

R

13 is selected from the group H, C 1

-

6 alkyl, C1-6 haloalkyl, C 1 -6 alkoxy, C2-6 alkenyl, C2-6 alkynyl, -0-C2- 6 alkenyl, -O-C2-6 alkynyl, NR1 2 R1 2 a, C3- 6 carbocycle, and -O-C3- 6 carbocycle. 5 [2] In another embodiment, the present invention provides compounds of formula (I) as set forth above, wherein: 10 R 1 is selected from the group C1-3 alkyl substituted with 1-7 halogen, and cyclopropyl;

R

2 is selected from the group -R 2 c, -OH, -CN, -OR 2 c,

-OCHR

2 aR 2 b, -OCH 2

CHR

2 aR 2 b, -O (CH 2 ) 2

CHR

2 aR 2 b, 15 -OCHR 2 aCH=CHR 2 b, -OCHR 2 aCH=CHR 2 c, -OCHR 2 aC=CR 2 b,

-NR

2 aR 2 c, -SR 2 c, -SCHR 2 aR 2 b, -SCH 2

CHR

2 aR 2 b,

-SCHR

2 aCH=CHR 2 b, -SCHR 2 aCH=CHR 2 c, and -SCHR 2 aC=CR 2 b;

R

2 a is selected from the group H, CH 3 , CH 2

CH

3 , CH(CH 3

)

2 , 20 and CH 2

CH

2

CH

3 ;

R

2 b is H or R 2 c;

R

2 c is selected from the group methyl substituted with 25 0-3 R 3 f, C1-5 alkyl substituted with 0-3 R 4 , C2-5 alkenyl substituted with 0-2 R 4 , C2-5 alkynyl substituted with 0-1 R 4 , C3-6 cycloalkyl substituted with 0-2 R 3 d, and phenyl substituted with 0-2 R3d; 30

R

3 and R 3 a, at each occurrence, are independently selected from the group H, C1-4 alkyl, OH, C1-4 12 WO 01/29037 PCT/USOO/28824 alkoxy, F, Cl, Br, I, NR 5

R

5 a, NO 2 , -CN, C(O)R 6 ,

NHC(O)R

7 , NHC(O)NR 5

R

5 a, and a 5-6 membered heteroaromatic ring containing 1-4 heteroatoms selected from the group 0, N, and S; 5 alternatively, R 3 and R 3 a together form -OCH 2 0-; R3b and R 3 c, at each occurrence, are independently selected from the group H, Ci_ 4 alkyl, OH, C 1

_

4 10 alkoxy, F, Cl, Br, I, NR 5

R

5 a, NO 2 , -CN, C(O)R 6 ,

NHC(O)R

7 , and NHC(O)NR 5

R

5 a; alternatively, R 3 a and R3b together form -OCH 2 0-; 15 R 4 is selected from the group H, Cl, F, -OH, -0-C 1 -6alkyl, -O-C 3

-

5 carbocycle substituted with 0 2 R 3 e, -OS(O) 2

C

1

_

4 alkyl, -NR1 2 R1 2 a, C 1

_

4 alkyl substituted with 0-2 R 3 e, C 3

-

5 carbocycle substituted with 0-2 R 3 e, phenyl substituted with 20 0-5 R 3 e, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-2 R 3 e;

R

5 and R 5 a are independently selected from the group H, 25 CH 3 and C 2

H

5 ;

R

6 is selected from the group H, OH, CH 3 , C 2

H

5 , OCH 3 ,

OC

2

H

5 , and NR 5

R

5 a; and 30 R 7 is selected from the group CH 3 , C 2

H

5 , CH(CH 3

)

2 , OCH 3 ,

OC

2

H

5 , and OCH(CH 3

)

2 . 13 WO 01/29037 PCT/USOO/28824 [3] In an alternative embodiment the present invention also provides compounds of formula (I) as described above, wherein: 5 ring A is selected from N N N SN ,/ N and jf

R

1 is selected from the group CF 3 , C 2

F

5 , CHF 2 , CF 2

CH

3 and cyclopropyl; 10

R

2 is selected from the group -R 2 c, -OH, -CN, -OR 2 c,

-OCHR

2 aR2b, -OCH 2

CHR

2 aR2b, -OCHR 2 aCH=CHR 2 b,

-OCHR

2 aCH=CHR 2 c, -OCHR 2 aC=CR 2 b, and -NR 2 aR 2 c; 15 R 2 a is selected from the group H, CH 3 , CH 2

CH

3 , CH(CH 3

)

2 , and CH 2

CH

2

CH

3 ;

R

2 b is H or R 2 c; 20 R 2 c is selected from the group methyl substituted with 0-3 R 3 f, C 1

-

3 alkyl substituted with 0-3 R 4 , C 2 -3 alkenyl substituted with 0-2 R 4 , C 2

-

3 alkynyl substituted with 0-1 R 4 , and C 3 -6 cycloalkyl substituted with 0-2 R3d. 25

R

3 , R 3 a, R 3 b, and R 3 c, at each occurrence, are independently selected from the group H, C 1 -3 14 WO 01/29037 PCT/USOO/28824 alkyl, OH, C 1

-

3 alkoxy, F, Cl, Br, I, NR 5

R

5 a, NO 2 , CN, C(O)R 6 , NHC(O)R 7 , and NHC(O)NR 5

R

5 a; alternatively, R 3 and R 3 a together form -OCH 2 0-; 5

R

3 e, at each occurrence, is independently selected from the group H, C 1

_

4 alkyl, -OH, C 1

-

4 alkoxy, OCF 3 , F, Cl, -NR 5

R

5 a, -C(O)R 6 , and -SO 2

NR

5

R

5 a; 10 R 3 f is selected from the group group H, F, Cl, Br, -OH,

-O-R

11 , -0-cyclopropyl substituted with 0-2 R 3 e, 0-cyclobutyl substituted with 0-2 R 3 e, -0-phenyl substituted with 0-2 R 3 e, -O(CO)-R1 3 , -OS(0) 2 Cl_ 4 alkyl, -NR1 2 R1 2 a, -C(O)R1 3 , -NHC(O)R1 3 , -NHSO 2 R1 0 , 15 and -SO 2 NR1 2 Rl 2 a;

R

4 is selected from the group H, Cl, F, -OH,

-O-C

1

-

6 alkyl, -O-C3- 1 0 carbocycle substituted with 0-2 R 3 e, -OS(O) 2

C

1

_

4 alkyl, -NR1 2 R1 2 a C 1

_

4 alkyl 20 substituted with 0-1 R 3 e, C 3

-

5 carbocycle substituted with 0-2 R 3 e, phenyl substituted with 0-2 R 3 e, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-1 R 3 e; 25

R

5 and R 5 a are independently selected from the group H,

CH

3 and C 2

H

5 ;

R

6 is selected from the group H, OH, CH 3 , C 2

H

5 , OCH 3 , 30 OC 2

H

5 , and NR 5

R

5 a; and

R

7 is selected from the group CH 3 , C 2

H

5 , OCH 3 , and OC 2

H

5 ; 15 WO 01/29037 PCT/USOO/28824

R

11 is selected from methyl, ethyl, propyl, i-propyl, butyl, pentyl, hexyl, CF 3 , CH 2

CF

3 , CH 2

CH

2

CF

3 ,

-CH

2 -cyclopropyl, and cyclopropyl; 5 R1 2 and R 1 2 a are independently selected from H, methyl, ethyl, propyl, i-propyl, butyl, pentyl, and cyclopropyl; 10 R1 3 is selected from the group H, methyl, ethyl, propyl, i-propyl, butyl, pentyl, hexyl, C 1 -6 haloalkyl, methoxy, ethoxy, propoxy, i-propoxy, butoxy, NR1 2 R1 2 a, cyclopropyl, cyclobutyl, cyclopropoxy, and cyclobutoxy. 15 [4] Another embodiment of the present invention include compounds of formula (I) as described above, wherein: R1 is CF 3 , CF 2

CH

3 , or CHF 2 ; 20

R

2 is selected from the group -R 2 c, -OH, -CN, -OCH 2

R

2 b,

-OCH

2

CH

2

R

2 b, -OCH 2

CH=CHR

2 b, -OCH 2

C=CR

2 b, and NR 2 aR 2 c; 25 R 2 b is H or R 2 c;

R

2 c is selected from the group methyl substituted with 0-3 R 3 f, C 1

-

3 alkyl substituted with 0-3 R 4 , C2-3 alkenyl substituted with 1 R 4 , and C 2

-

3 alkynyl 30 substituted with 1 R 4 ;

R

3 , R 3 a, R3b, and R 3 c, at each occurrence, are independently selected from the group H, C1-3 16 WO 01/29037 PCT/USOO/28824 alkyl, OH, C 1

-

3 alkoxy, F, Cl, NR 5

R

5 a, NO 2 , -CN,

C(O)R

6 , NHC(O)R 7 , and NHC(O)NR 5 R5a; alternatively, R 3 and R 3 a together form -OCH 2 0-; 5

R

3 e, at each occurrence, is independently selected from the group CH 3 , -OH, OCH 3 , OCF 3 , F, Cl, and -NR 5

R

5 a;

R

3 f, is selected from the group group H, F, Cl, -OH, 10 -O-R 11 , -O(CO)-R 1 3 , -OS(0) 2

C

1

_

4 alkyl, -NR1 2 R1 2 a, and -NHC (0) NR1 2 R1 2 a;

R

4 is selected from the group H, Cl, F, CH 3 , CH 2

CH

3 , cyclopropyl substituted with 0-1 R 3 e, 1-methyl 15 cyclopropyl substituted with 0-1 R 3 e, cyclobutyl substituted with 0-1 R 3 e, phenyl substituted with 0-2 R 3 e, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-1 R 3 e, wherein the 20 heterocyclic system is selected from the group 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, 2-imidazolyl, morpholinyl, piperidinyl, pyrrolidinyl, and 25 piperazinyl;

R

5 and R 5 a are independently selected from the group H,

CH

3 and C 2

H

5 ; 30 R 6 is selected from the group H, OH, CH 3 , C 2

H

5 , OCH 3 ,

OC

2

H

5 , and NR 5

R

5 a; and

R

7 is selected from the group CH 3 , C 2

H

5 , OCH 3 , and OC 2

H

5 . 17 WO 01/29037 PCT/USOO/28824 [5] Another embodiment of the present invention include compounds of formula (I) as described above, wherein: 5 n is 0 or 1; ring A is optionally in an N-oxide form;

R

1 is CF 3 , CHF 2 , or CF 2

CH

3 ; 10

R

2 is selected from the group -R 2 c, -OR 2 c, -OH, -CN,

-OCH

2

R

2 b, -OCH 2

CH

2

R

2 b, -OCH 2

C=C-R

2 b, -OCH 2

C=C-R

2 b,

-NR

2 aR 2 c, -SR 2 c, -SCH 2

R

2 b, -SCH 2

CH

2

R

2 b,

-SCH

2

CH=CHR

2 b, and -SCH 2

C=CR

2 b; 15

R

2 b is H or R 2 c;

R

2 c is selected from the group methyl substituted with 0-2 R 3 f, ethyl substituted with 0-3 R 4 , propyl 20 substituted with 0-2 R 4 , ethenyl substituted with 0-2 R 4 , 1-propenyl substituted with 0-2 R 4 , 2-propenyl substituted with 0-2 R 4 , ethynyl substituted with 0-2 R 4 , 1-propynyl substituted with 0-2 R 4 , 2-propynyl substituted with 0-2 R 4 , 25 and cyclopropyl substituted with 0-1 R 3 d;

R

3 e, at each occurrence, is independently selected from the group CH 3 , -OH, OCH 3 , OCF 3 , F, Cl, and -NR 5

R

5 a; 30 R 3 f, is selected from the group group H, F, Cl, -OH,

-O-R

1 l, -O (CO) -R 13 , -OS(0) 2

C

1 4 alkyl, -NR1 2 R1 2 a, and -NHC (0) NR1 2 R1 2 a; 18 WO 01/29037 PCT/USOO/28824

R

4 is selected from the group H, Cl, F, CH 3 , CH 2

CH

3 , cyclopropyl substituted with 0-1 R 3 e, 1-methyl cyclopropyl substituted with 0-1 R 3 e, cyclobutyl substituted with 0-1 R 3 e, phenyl substituted with 5 0-2 R 3 e, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-1 R 3 e, wherein the heterocyclic system is selected from the group 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 10 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, 2-imidazolyl, morpholinyl, piperidinyl, pyrrolidinyl, and piperazinyl; 15 R 5 and R 5 a are independently selected from the group H,

CH

3 and C 2

H

5 ;

R

6 is selected from the group H, OH, CH 3 , C 2

H

5 , OCH 3 ,

OC

2

H

5 , and NR 5

R

5 a; 20

R

7 is selected from the group CH 3 , C 2

H

5 , OCH 3 , and OC 2

H

5 ; R8 is H. 25 [6] Another embodiment of the present invention include compounds of formula (I) as described above, wherein: n is selected from 0 or 1; 30 A is selected from 19 WO 01/29037 PCT/USOO/28824 N, and o0. B is selected from methyl, ethyl, propyl, -OH, Cl, Br,

-S-CH

3 , 5 W is CR 3 ; X is CR 3 a. 10 Y is CR 3 a; Z is N or CR 3 a;

R

1 is selected from CF 3 , CHF 2 , and CF 2

CH

3 ; 15

R

2 is selected from -R 2 c, -OH, -CN, -OR 2 c, -OCH 2

C=C-R

2 b,

-OCH

2

C=C-R

2 b, and -NR 2 aR 2 c;

R

2 a is H; 20

R

2 b is H;

R

2 c is selected from the group methyl substituted with 0-3 R 3 f, ethyl substituted with 0-3 R 4 , propyl 25 substituted with 0-3 R 4 , i-propyl substituted with 0-3 R 4 , butyl substituted with 0-3 R 4 , 1-propenyl substituted with 0-2 R 4 , 2-propenyl substituted with 0-2 R 4 , 1-propynyl substituted with 0-2 R 4 , 2-propynyl substituted with 0-2 R 4 ; 30 20 WO 01/29037 PCT/USOO/28824

R

3 is H;

R

3 a is H, F, Cl, or Br; 5 R3b is H;

R

3 c is H;

R

3 e, at each occurrence, is independently selected from 10 the group H, methyl, and ethyl, -OH, C 1 4 alkoxy,

OCF

3 , F, Cl, Br, I, -NR 5

R

5 a, -NO 2 , -CN, -C(O)R 6 ,

-NHC(O)R

7 , -NHC(O)NR 5

R

5 a, -NHSO 2

R

10 , and -SO 2

NR

5

R

5 a;

R

3 f is selected from H, F, Cl, OH, -OR 1 1 , -OSO 2 methyl, 15 NR1 2 R1 2 a, and -NHC(O)NR 5

R

5 a;

R

4 is selected from H, F, -OH, -O-i-propyl, -OS(O) 2

CH

3 , cyclopropyl substituted with 0-1 R3e, cyclobutyl substituted with 0-1 R 3 e, phenyl, N-morpholinyl, 2 20 pyridyl, 3-pyridyl, 4-pyridiyl, N2-methyl-N1 piperidinyl, N-piperidinyl, N-pyrrolidinyl, and N piperazinyl;

R

8 is H; 25

R

11 is selected from H, methyl, ethyl, propyl, i-propyl,

CH

2 cyclopropyl, and cyclopropyl; and

R

12 and R12a are independently selected from H, methyl, 30 ethyl, propyl, i-propyl, and cyclopropyl. 21 WO 01/29037 PCT/USOO/28824 [7] Another embodiment of the present invention includes those compounds wherein the compound is of formula (Ic): 1B n R.W R\R AB YZ N R'8 5 (Ic) [8] Another embodiment of the present invention includes those compounds wherein the compound is of 10 formula (Id): xW~\ A B) IB n Y1Z Nn 8 (Id) 15 Another embodiment of the present invention include compounds of formula (I) wherein: ring A is selected from: NZ/ B1B I BN,, 20 N ; and ring A is optionally in an N-oxide form. 22 WO 01/29037 PCT/USOO/28824 Another embodiment of the present invention include compounds of formula (I) wherein: ring A is selected from: 5 1B-B B' , B , and ring A is optionally in an N-oxide form. 10 In another embodiment, the present invention provides ring A is B In another embodiment, the present invention 15 provides ring A is In another embodiment, the present invention provides ring A is NN O ~jN N ,and N 20 0 23 WO 01/29037 PCT/USOO/28824 In another embodiment, the present invention provides the N on ring A is in the N-oxide form. 5 In another embodiment, the present invention provides the N on ring A is not in the N-oxide form. Another embodiment of the present invention include compounds of formula (I) wherein: 10 W is CR 3 ; X is CR 3 a; 15 Y is CR3b; and Z is CR 3 c. Another embodiment of the present invention include 20 compounds of formula (I) wherein: W is CR 3 ; X is CR 3 a; 25 Y is CR3b; and Z is selected from N and CR 3 c. 30 Another embodiment of the present invention include compounds of formula (I) wherein: 24 WO 01/29037 PCT/USOO/28824

R

2 is selected from the group -R 2 c, -OH, -CN, -OR 2 c,

-OCHR

2 aR 2 b, -OCH 2

CHR

2 aR 2 b, -O (CH 2 ) 2

CHR

2 aR 2 b,

-OCHR

2 aCH=CHR 2 b, -OCHR 2 aCH=CHR 2 c, -OCHR 2 aC=CR 2 b,

-NR

2 aR 2 c, -SR 2 c, -SCHR 2 aR 2 b, -SCH 2

CHR

2 aR 2 b, 5 -SCHR 2 aCH=CHR 2 b, -SCHR 2 aCH=CHR 2 c, and -SCHR 2 aC=CR 2 b. Another embodiment of the present invention include compounds of formula (I) wherein: 10 R 2 is selected from the group -R 2 c, -OH, -CN, -OR 2 c,

-OCHR

2 aR2b, -OCH 2

CHR

2 aR2b, -OCHR 2 aCH=CHR 2 b,

-OCHR

2 aCH=CHR 2 c, -OCHR 2 aC=CR 2 b, and -NR 2 aR2c. Another embodiment of the present invention include 15 compounds of formula (I) wherein:

R

2 is selected from the group -R 2 c, -OR 2 c, -OCHR 2 aR 2 b,

-OCH

2

CHR

2 aR 2 b, -OCHR 2 aCH=CHR 2 b, -OCHR 2 aCH=CHR 2 c,

-OCHR

2 aC=CR 2 b, and -NR 2 aR 2 c. 20 Another embodiment of the present invention include compounds of formula (I) wherein:

R

2 c is selected from the group methyl substituted with 25 0-3 R 3 f, C 1

-

5 alkyl substituted with 0-3 R 4 , C 2 -5 alkenyl substituted with 0-2 R 4 , C 2

-

5 alkynyl substituted with 0-1 R 4 , C 3

-

6 cycloalkyl substituted with 0-2 R 3 d, and phenyl substituted with 0-2 R 3 d. 30 Another embodiment of the present invention include compounds of formula (I) wherein: 25 WO 01/29037 PCT/USOO/28824

R

2 c is selected from the group methyl substituted with 0-3 R 3 f, C1- 3 alkyl substituted with 0-3 R 4 , C 2 -3 alkenyl substituted with 1 R 4 , and C 2

-

3 alkynyl 5 substituted with 1 R 4 . Another embodiment of the present invention include compounds of formula (I) wherein: 10 R 2 c is selected from the group methyl substituted with 0-2 R 3 f, ethyl substituted with 0-3 R 4 , propyl substituted with 0-2 R 4 , ethenyl substituted with 0-2 R 4 , 1-propenyl substituted with 0-2 R 4 , 2-propenyl substituted with 0-2 R 4 , ethynyl 15 substituted with 0-2 R 4 , 1-propynyl substituted with 0-2 R 4 , 2-propynyl substituted with 0-2 R 4 , and cyclopropyl substituted with 0-1 R3d. Another embodiment of the present invention include 20 compounds of formula (I) wherein:

R

4 is selected from the group H, Cl, F, CH 3 , CH 2

CH

3 , cyclopropyl substituted with 0-1 R 3 e, 1-methyl cyclopropyl substituted with 0-1 R 3 e, cyclobutyl 25 substituted with 0-1 R 3 e, phenyl substituted with 0-2 R 3 e, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-1 R 3 e, wherein the heterocyclic system is selected from the group 30 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 2-thiazolyl, 4-isoxazolyl, 2-imidazolyl, 26 WO 01/29037 PCT/USOO/28824 morpholinyl, piperidinyl, pyrrolidinyl, and piperazinyl. Another embodiment of the present invention include 5 compounds of formula (I) wherein:

R

8 is H. Another embodiment of the present invention include 10 compounds of fomula (I) wherein:

R

4 is selected from H, F, -OH, -O-i-propyl, -OS(0) 2

CH

3 , cyclopropyl substituted with 0-1 R 3 e, cyclobutyl substituted with 0-1 R 3 e, phenyl, N-morpholinyl, 2 15 pyridyl, 3-pyridyl, 4-pyridiyl, N2-methyl-Nl piperidinyl, N-piperidinyl, N-pyrrolidinyl, and N piperazinyl; and 20 [7] Compounds of the present invention include compounds of formula (I), or a stereoisomeric form, mixtures of stereoisomeric forms, complexes, prodrug forms or pharmaceutically acceptable salt form thereof, or N-oxide forms thereof, wherein the compound of 25 formula (I) is selected from: the compounds of the Examples, Table 1, Table 2, Table 3, Table 4, and 30 7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(benzyloxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 27 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(cyclobutylmethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 5 7-Chloro-5-(ethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(hydroxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 10 7-Chloro-5-(n-propoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(i-propoxy)-5,10-dihydro-5 15 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(butyl)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 20 7-Chloro-5-(methoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5(S)-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 25 7-Chloro-5(R)-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(2-cyclopropylethyl)-5,10-dihydro-5 30 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(2,2,2-trifluoroethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 28 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(propargoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(ethyl)-5,10-dihydro-5 5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(cyclopropylmethoxy)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 10 7-Chloro-5-(n-butyl)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(2-cyclopropylethyl)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 15 7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-2 (methylthio)-5-(trifluoromethyl)pyrimido[4,5 b] quinoline, 20 7-Chloro-5-(i-butoxy)-5,10-dihydro-2-(methylthio)-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(benzyloxy)-5,10-dihydro-2-(methylthio)-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 25 7-Chloro-5-(2-pyridylmethoxy)-5,10-dihydro-2 (methylthio)-5-(trifluoromethyl)pyrimido[4,5 b]quinoline, 30 7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(cyclopropylamino)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 35 29 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(i-propylamino)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(N,N-dimethylaminoethoxy)-5,10-dihydro-5 5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(N-morpholinylethylamino)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 10 7-Chloro-5-((1-methylcyclopropyl)methoxy)-5,10-dihydro 5-(trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(3,3,3-trifluoroprop-1-oxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 15 7-Chloro-5-(cyclopropylmethylamino)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(methylamino)-5,10-dihydro-5 20 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(ethylamino)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 25 (S)-7-Chloro-5-(cyclopropylethyl)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, (R)-7-Chloro-5-(cyclopropylethyl)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 30 7-Fluoro-5-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Fluoro-5-(cyclopropylethoxy)-5,10-dihydro-5 35 (trifluoromethyl)benzo[b][1,8]naphthyridine, 30 WO 01/29037 PCT/USOO/28824 7-Fluoro-5-(allyloxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 5 7-Chloro-5-(phenylamino)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(cyclopropylmethoxy)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 10 7-Chloro-5-(n-butyl)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(cyclopropylethyl)-2-methyl-5,10-dihydro-5 15 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(cyclobutylmethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 20 7-Chloro-5-(methoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, (S)-7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 25 (R)-7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(N-piperidinylethoxy)-5,10-dihydro-5 30 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(N-pyrrolidinylethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 31 WO 01/29037 PCT/USOO/28824 7-Chloro-5-((4-methylpiperazin-1-yl)prop-1-oxy)-5,10 dihydro-5-(trifluoromethyl)pyrimido[4,5 b]quinoline, 5 7-Chloro-5-(prop-1-oxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(N,N-dimethylaminoprop-1-yl)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-blquinoline, 10 7-Chloro-5-(benzyloxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(3-pyridinylmethyl)-5,10-dihydro-5 15 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(allyloxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 20 7-Chloro-5-(propargoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, and 7-Chloro-5-(N,N-dimethylaminoethyl)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-blquinoline; 25 7-Chloro-5-cyclopropylmethoxy-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 5-Allyloxy-7-fluoro-5-trifluoromethyl-5,10-dihydro 30 benzo[b][1,8]naphthyridine; 7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine-5-carbonitrile; 32 WO 01/29037 PCT/USOO/28824 7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-ol; 5-Cyclopropylmethoxy-7-fluoro-5-trifluoromethyl-5,10 5 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 7-Chloro-5-prop-2-ynyloxy-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 10 7-Chloro-5-(1-methyl-cyclopropylmethoxy)-5 trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 7-Chloro-5-(2-cyclopropyl-ethoxy)-5-trifluoromethyl 15 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; (7-Chloro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-isopropyl-amine; 20 (7-Chloro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-cyclobutylmethyl amine; 7-Chloro-5-(2-cyclopropyl-ethyl)-5-trifluoromethyl-5,10 25 dihydro-benzojb][1,8]naphthyridine 1-oxide; 5-Cyclobutylmethoxy-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 30 (7-Fluoro-1-oxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-isopropyl-amine; 33 WO 01/29037 PCT/USOO/28824 5-Cyclobutylmethoxy-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridin-2-ol; 7-Chloro-5-(pyridin-2-ylmethoxy)-5-trifluoromethyl-5,10 5 dihydro-benzo[b][1,8]naphthyridine; 5-Butyl-7-fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine; 10 7-Chloro-1-oxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-ol; 7-Chloro-5-cyclopropylmethoxy-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 15 7-Chloro-5-pyridin-2-ylmethyl-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 7-Fluoro-5-pyridin-2-ylmethyl-5-trifluoromethyl-5,10 20 dihydro-benzo[b][1,8]naphthyridine; 5-Cyclopropylmethoxy-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 25 7-Chloro-5-pyridin-2-ylmethyl-5-trifluoromethyl-5,10 dihydro-benzoEb][1,8]naphthyridine; 3,7-Dichloro-5-cyclopropylmethoxy-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine; 30 3,7-Dichloro-5-cyclopropylmethoxy-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 34 WO 01/29037 PCT/USOO/28824 3,7-Dichloro-5-pentyl-5-trifluoromethyl-5,10-dihydro benzo b][1,8]naphthyridine 1-oxide; 5-(2-Cyclopropyl-ethyl)-7-fluoro-5-trifluoromethyl-5,10 5 dihydro-benzo[b][1,8]naphthyridine; 5-(2-Cyclopropyl-ethyl)-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 10 3,7-Dichloro-5-cyclopropylmethoxy-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 5-(2-Cyclopropyl-ethyl)-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 15 3-Chloro-5-cyclopropylmethoxy-7-fluoro-5 trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine; 20 3-Chloro-5-cyclopropylmethoxy-7-fluoro-5 trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 7-Chloro-5-isobutoxy-5-trifluoromethyl-5,10-dihydro 25 benzo[b][1,8]naphthyridine 1-oxide; 5-Butyl-7-chloro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 30 (S) 3-Chloro-5-cyclopropylmethoxy-7-fluoro-5 trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 35 WO 01/29037 PCT/USOO/28824 (7-Chloro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-methanol; 7-Fluoro-5-isobutoxy-5-trifluoromethyl-5,10-dihydro 5 benzo[b][1,8]naphthyridine 1-oxide; 7-Fluoro-5-isopropoxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 10 Methanesulfonic acid 7-chloro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridin-5-ylmethyl ester; 7-Chloro-5-isopropoxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 15 (7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetonitrile; 7-Fluoro-5-trifluoromethyl-5,10-dihydro 20 benzo[b][1,8]naphthyridine-5-carbaldehyde; 3-Bromo-5-cyclopropylmethoxy-7-fluoro-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 25 5-Butyl-7-fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 5-Diisopropoxymethyl-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine; 30 7-Fluoro-5-isopropoxymethyl-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 36 WO 01/29037 PCT/USOO/28824 7-Chloro-5-isobutyl-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 7-Chloro-5-propoxy-5-trifluoromethyl-5,10-dihydro 5 benzo[b][1,8]naphthyridine 1-oxide; (S) 7-Fluoro-5-isobutoxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 10 (R) 7-Fluoro-5-isobutoxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; (7-Chloro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetaldehyde; 15 7-Chloro-5-(2,2-diisopropoxy-ethyl)-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine; 7-Chloro-5-(2-isopropoxy-ethyl)-5-trifluoromethyl-5,10 20 dihydro-benzo[b][1,8]naphthyridine; 2-(7-Chloro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-ethanol; 25 7-Chloro-5-(2-isopropoxy-ethyl)-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; (R) 7-Fluoro-5-(2-isopropoxy-ethyl)-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 30 (7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetic acid tert butyl ester; 37 WO 01/29037 PCT/USOO/28824 (7-Fluoro-1-oxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetic acid tert butyl ester; 5 (7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetic acid; 7-Chloro-5-cyclopropylmethoxy-2-methylsulfanyl-5 10 trifluoromethyl-5,10-dihydro-pyrimido[4,5 b]quinoline; 7-Chloro-5-isobutoxy-2-methylsulfanyl-5-trifluoromethyl 5,10-dihydro-pyrimido[4,5-b]quinoline; 15 5-Benzyloxy-7-chloro-2-methylsulfanyl-5-trifluoromethyl 5,10-dihydro-pyrimido[4,5-b]quinoline; 7-Chloro-2-methylsulfanyl-5-(pyridin-2-ylmethoxy)-5 20 trifluoromethyl-5,10-dihydro-pyrimido[4,5 b]quinoline; 7-Chloro-5-cyclopropylmethoxy-5-trifluoromethyl-5,10 dihydro-pyrimido[4,5-b]quinoline 1-oxide; 25 7-Chloro-5-cyclopropylmethoxy-5-(1,1-difluoro-ethyl) 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 5-Cyclopropylmethoxy-5-(1,1-difluoro-ethyl)-7-fluoro 30 5,10-dihydro-benzo[b][1,8]naphthyridine; 5-Cyclopropylmethoxy-5-(1,1-difluoro-ethyl)-7-fluoro 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 38 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(1,1-difluoro-ethyl)-5-isobutoxy-5,10 dihydro-benzo[b][1,8]naphthyridine; 7-Chloro-5-(1,1-difluoro-ethyl)-5-isobutoxy-5,10 5 dihydro-benzo[b][1,8]naphthyridine 1-oxide; (R) 7-Chloro-5-cyclopropylmethoxy-5-(1,1-difluoro ethyl)-5,10-dihydro-benzo[b][1,8]naphthyridine 1 oxide; 10 (S) 7-Chloro-5-cyclopropylmethoxy-5-(1,1-difluoro ethyl)-5,10-dihydro-benzo[b][1,8]naphthyridine 1 oxide; 15 3-Chloro-10-cyclopropylmethoxy-10-trifluoromethyl-9,10 dihydro-1,8,9-triaza-anthracene; 3-Chloro-10-cyclopropylmethoxy-10-trifluoromethyl-9,10 dihydro-1,8,9-triaza-anthracene 8-oxide; 20 3,6-Dichloro-10-cyclopropylmethoxy-10-trifluoromethyl 9,10-dihydro-1,8,9-triaza-anthracene; 3-Chloro-10-isobutoxy-10-trifluoromethyl-9,10-dihydro 25 1,8,9-triaza-anthracene; 3-Chloro-10-isobutoxy-10-trifluoromethyl-9,10-dihydro 1,8,9-triaza-anthracene 8-oxide; 30 7-Chloro-5-difluoromethyl-5-isopropoxymethyl-5,10 dihydro-benzo[b][1,8]naphthyridine; 7-Chloro-5-difluoromethyl-5-isopropoxymethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 35 39 WO 01/29037 PCT/USOO/28824 7-chloro-1,5-dihydro-5-(N-ethylaminomethyl)-5 (trifluoromethyl)benzo[b][1,8]napthyridine; 7-chloro-5,10-dihydro-5-(N-isopropylaminomethyl)-5 5 (trifluoromethyl)benzo[b][1,8]napthyridine; 7-chloro-5,10-dihydro-5-(N-isopropyl-N ethylaminomethyl)-5 (trifluoromethyl)benzo[b][1,8]napthyridine; 10 7-chloro-5-(N,N-diethylaminomethyl)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]napthyridine; 5-(acetamidomethyl)-7-chloro-5,10-dihydro-5 15 (trifluoromethyl) [b][1,8]napthyridine; 5,10-dihydro-7-fluoro-5-(N-methylsulfonylmethyl)-5 (trifluoromethyl) [b][1,8]napthyridine; 20 5,10-dihydro-7-fluoro-5-(isopropylamidomethyl)-5 (trifluoromethyl) [b][1,8]napthyridine; 5,10-dihydro-7-fluoro-5-(isopropylguanadinomethyl)-5 (trifluormethyl)[b][1,8]napthyridine; 25 1,5-dihydro-7-fluoro-5-(N-isopropylmethyl)-5 (trifluoromethyl) [b][1,8]napthyridine-1-(N-oxide); 5-(N,N-diethylaminomethyl)-5,10-dihydro-7-fluoro-5 30 (trifluoromethyl) [b][1,8]napthyridine-1-(N-oxide); 5,10-dihydro-5-(N,N-dimethylaminomethyl)-7-fluoro-5 (trifluoromethyl) [b][1,8]napthyridine-1-(N-oxide); 40 WO 01/29037 PCT/USOO/28824 7-chloro-5,10-dihydro-5-(N-isopropylaminomethyl)-5 (trifluoromethyl) [b][1,8]napthyridine-l-(N-oxide); 5 7-chloro-5-(N,N-diethylaminomethyl)-5,10-dihydro-5 (trifluoromethyl) [b][1,8]napthyridine-1-(N-oxide); and 7-chloro-5,10-dihydro-5-(N,N-dimethylaminomethyl)-5 10 (trifluoromethyl) [b][1,8]napthyridine-1-(N-oxide. Another embodiment of the present invention are those compounds wherein the heterocyclic ring A is in an N-oxide form. 15 The present invention also provides a novel pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of formula (I) or a 20 pharmaceutically acceptable salt form thereof The compositions and methods of use comprising the compounds of the present invention include compositions and methods of use comprising the compounds of the 25 present invention and stereoisomeric forms thereof, mixtures of stereoisomeric forms thereof, complexes thereof, crystalline forms thereof, prodrug forms thereof and pharmaceutically acceptable salt forms thereof 30 In another embodiment, the present invention provides a novel method for treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of a 41 WO 01/29037 PCT/USOO/28824 compound of formula (I) or a pharmaceutically acceptable salt form thereof In another embodiment, the present invention 5 provides a novel method of treating HIV infection which comprises administering, in combination, to a host in need thereof a therapeutically effective amount of: (a) a compound of formula (I); and (b) at least one compound selected from the group 10 consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors. Preferred reverse transcriptase inhibitors useful in the above method of treating HIV infection are 15 selected from the group AZT, ddC, ddI, d4T, 3TC, delavirdine, efavirenz, nevirapine, Ro 18,893, trovirdine, MKC-442, HBY 097, HBY1293, GW867, ACT, UC-781, UC-782, RD4-2025, MEN 10979, and AG1549 (S1153). Preferred protease inhibitors useful in the above method 20 of treating HIV infection are selected from the group saquinavir, ritonavir, indinavir, amprenavir, nelfinavir, palinavir, BMS-232623, GS3333, KNI-413, KNI-272, LG-71350, CGP-61755, PD 173606, PD 177298, PD 178390, PD 178392, U-140690, and ABT-378. 25 In another embodiment, the reverse transcriptase inhibitor is selected from the group AZT, efavirenz, and 3TC and the protease inhibitor is selected from the group saquinavir, ritonavir, nelfinavir, and indinavir. 30 In another embodiment, the reverse transcriptase inhibitor is AZT. 35 42 WO 01/29037 PCT/USOO/28824 In another embodiment, the protease inhibitor is indinavir. 5 In another embodiment, the present invention provides a pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of: (a) a compound of formula (I); and, 10 (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers. 15 In another embodiment, the present invention provides novel tricyclic compounds for use in therapy. 20 In another embodiment, the present invention provides the use of novel tricyclic compounds for the manufacture of a medicament for the treatment of HIV infection. 25 The invention may be embodied in other specific forms without departing from the spirit or essential attributes thereof. This invention also encompasses all combinations of preferred aspects of the invention noted herein. It is understood that any and all embodiments 30 of the present invention may be taken in conjunction with any other embodiment to describe additional embodiments of the present invention. Furthermore, any elements of an embodiment are meant to be combined with any and all other elements from any of the embodiments 35 to describe additional embodiments. 43 WO 01/29037 PCT/USOO/28824 DEFINITIONS It will be appreciated that the compounds of the 5 present invention contain an asymmetrically substituted carbon atom, and may be isolated in optically active or racemic forms. It is well known in the art how to prepare optically active forms, such as by resolution of racemic forms or by synthesis, from optically active 10 starting materials. All chiral, diastereomeric, racemic forms and all geometric isomeric forms of a structure are intended, unless the specific stereochemistry or isomer form is specifically indicated. The present invention is intended to include all 15 isotopes of atoms occurring on the present compounds. Isotopes include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium. Isotopes of carbon 20 include C-13 and C-14. As used herein, the following terms and expressions have the indicated meanings. As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic 25 hydrocarbon groups having the specified number of carbon atoms. By way of illustration, the term "C 1

-

10 alkyl" or "Ci-C 10 alkyl" is intended to include C 1 , C 2 , C 3 , C 4 ,

C

5 , C 6 , C 7 , C 8 , C 9 , and C 1 0 alkyl groups. "Ci_ 4 alkyl" is intended to include C 1 , C 2 , C 3 , and C 4 alkyl groups. 30 Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, and s-pentyl. "Haloalkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having the 35 specified number of carbon atoms, substituted with 1 or 44 WO 01/29037 PCT/USOO/28824 more halogen (for example -CyFW where v = 1 to 3 and w = 1 to (2v+1)). Examples of haloalkyl include, but are not limited to, trifluoromethyl, trichloromethyl, 2,2,2 trifluoroethyl, 3,3,3-trifluoropropyl,pentafluoroethyl, 5 and pentachloroethyl. "Alkoxy" represents an alkyl group as defined above with the indicated number of carbon atoms attached through an oxygen bridge. C 1

-

10 alkoxy, is intended to include C 1 , C 2 , C 3 , C 4 , C 5 , C 6 ,

C

7 , C 8 , C 9 , and C 10 alkoxy groups. Examples of alkoxy 10 include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, n-pentoxy, and s-pentoxy. "Cycloalkyl" is intended to include saturated ring groups, such as cyclopropyl, cyclobutyl, or cyclopentyl. C3- 7 cycloalkyl, is 15 intended to include C 3 , C 4 , C 5 , C 6 , and C 7 cycloalkyl groups. "Alkenyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more unsaturated carbon-carbon bonds which may occur in any stable point along the chain, such as 20 ethenyl, propenyl and the like. C2- 1 0 alkenyl, is intended to include C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 , and

C

10 alkenyl groups. "Alkynyl" is intended to include hydrocarbon chains of either a straight or branched configuration and one or more triple carbon-carbon bonds 25 which may occur in any stable point along the chain, such as ethynyl, propynyl and the like. C2- 10 alkynyl, is intended to include C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 , and C 10 alkynyl groups. "Halo" or "halogen" as used herein refers to 30 fluoro, chloro, bromo and iodo. "Counterion" is used to represent a small, negatively charged species such as chloride, bromide, hydroxide, acetate, sulfate and the like. 45 WO 01/29037 PCT/USOO/28824 As used herein, "aryl" or "aromatic residue" is intended to mean an aromatic moiety containing the specified number of carbon atoms, such as phenyl or naphthyl. As used herein, "carbocycle" or "carbocyclic 5 residue" is intended to mean any stable 3, 4, 5, 6, or 7-membered monocyclic or bicyclic or 7, 8, 9, 10, 11, 12 or 13-membered bicyclic or tricyclic, any of which may be saturated, partially unsaturated, or aromatic. Examples of such carbocycles include, but are not 10 limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, adamantyl, cyclooctyl, [3.3.0]bicyclooctane, [4.3.0]bicyclononane, [4.4.0]bicyclodecane, [2.2.2]bicyclooctane, fluorenyl, phenyl, naphthyl, indanyl, adamantyl, or 15 tetrahydronaphthyl. As used herein, the term "heterocycle" or "heterocyclic system" is intended to mean a stable 5, 6, or 7-membered monocyclic or bicyclic or 7, 8, 9, or 10 membered bicyclic heterocyclic ring which is saturated 20 partially unsaturated or unsaturated (aromatic), and which consists of carbon atoms and 1, 2, 3, or 4 heteroatoms independently selected from the group consisting of N, 0 and S and including any bicyclic group in which any of the above-defined heterocyclic 25 rings is fused to a benzene ring. The nitrogen and sulfur heteroatoms may optionally be oxidized. An oxo group may be a substituent on a nitrogen heteroatom to form an N-oxide. The heterocyclic ring may be attached to its pendant group at any heteroatom or carbon atom 30 which results in a stable structure. The heterocyclic rings described herein may be substituted on carbon or on a nitrogen atom if the resulting compound is stable. If specifically noted, a nitrogen in the heterocycle may optionally be quaternized. It is preferred that when 35 the total number of S and 0 atoms in the heterocycle 46 WO 01/29037 PCT/USOO/28824 exceeds 1, then these heteroatoms are not adjacent to one another. It is preferred that the total number of S and 0 atoms in the heterocycle is not more than 1. As used herein, the term "aromatic heterocyclic system" is 5 intended to mean a stable 5, 6, or 7-membered monocyclic or bicyclic or 7, 8, 9, or 10-membered bicyclic heterocyclic aromatic ring which consists of carbon atoms and 1, 2, 3, or 4 heteroatoms independently selected from the group consisting of N, 0 and S. It is 10 preferred that the total number of S and 0 atoms in the aromatic heterocycle is not more than 1. Examples of heterocycles include, but are not limited to, acridinyl, azocinyl, benzimidazolyl, benzofuranyl, benzothiofuranyl, benzothiophenyl, 15 benzoxazolyl, benzthiazolyl, benztriazolyl, benztetrazolyl, benzisoxazolyl, benzisothiazolyl, benzimidazolinyl, carbazolyl, 4aH-carbazolyl, carbolinyl, chromanyl, chromenyl, cinnolinyl, decahydroquinolinyl, 2H,6H-1,5,2-dithiazinyl, 20 dihydrofuro[2,3-b]tetrahydrofuran, 5,10-dihydro benzo[b][1,8]naphthyridinyl, furanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, 1H-indazolyl, indolenyl, indolinyl, indolizinyl, indolyl, 3H-indolyl, isobenzofuranyl, isochromanyl, isoindazolyl, 25 isoindolinyl, isoindolyl, isoquinolinyl, isothiazolyl, isoxazolyl, morpholinyl, naphthyridinyl, octahydroisoquinolinyl, oxadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, oxazolidinyl, oxazolyl, oxazolidinyl, pyrimidinyl, 30 phenanthridinyl, phenanthrolinyl, phenazinyl, phenothiazinyl, phenoxathiinyl, phenoxazinyl, phthalazinyl, piperazinyl, piperidinyl, piperidonyl, 4-piperidonyl, piperonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, 35 pyridazinyl, pyridooxazole, pyridoimidazole, 47 WO 01/29037 PCT/USOO/28824 pyridothiazole, pyridinyl, pyridyl, pyrimidinyl, pyrimido[4,5-b]quinolinyl, pyrrolidinyl, pyrrolinyl, 2H-pyrrolyl, pyrrolyl, quinazolinyl, quinolinyl, 4H-quinolizinyl, quinoxalinyl, quinuclidinyl, 5 tetrahydrofuranyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, 6H-1,2,5-thiadiazinyl, 1,2,3 thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl, thianthrenyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, 10 thiophenyl, triazinyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,2,5-triazolyl, 1,3,4-triazolyl, and xanthenyl. Also included are fused ring and spiro compounds containing, for example, the above heterocycles. As used herein, "HIV reverse transcriptase 15 inhibitor" is intended to refer to both nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT). Examples of nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddI, d4T, and 3TC. Examples of non-nucleoside RT inhibitors include, but 20 are no limited to, delavirdine (Pharmacia and Upjohn U90152S), efavirenz (DuPont), nevirapine (Boehringer Ingelheim), Ro 18,893 (Roche), trovirdine (Lilly), MKC-442 (Triangle), HBY 097 (Hoechst), HBY1293 (Hoechst), GW867 (Glaxo Wellcome), ACT (Korean Research 25 Institute), UC-781 (Rega Institute), UC-782 (Rega Institute), RD4-2025 (Tosoh Co. Ltd.), MEN 10979 (Menarini Farmaceutici) and AG1549 (S1153; Agouron). As used herein, "HIV protease inhibitor" is intended to refer to compounds which inhibit HIV 30 protease. Examples include, but are not limited, saquinavir (Roche, Ro3l-8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), amprenavir (Vertex/Glaxo Wellcome), nelfinavir (Agouron, AG-1343), palinavir (Boehringer Ingelheim), BMS-232623 35 (Bristol-Myers Squibb), GS3333 (Gilead Sciences), 48 WO 01/29037 PCT/USOO/28824 KNI-413 (Japan Energy), KNI-272 (Japan Energy), LG-71350 (LG Chemical), CGP-61755 (Ciba-Geigy), PD 173606 (Parke Davis), PD 177298 (Parke Davis), PD 178390 (Parke Davis), PD 178392 (Parke Davis), U-140690 (Pharmacia and 5 Upjohn), and ABT-378. Additional examples include the cyclic protease inhibitors disclosed in W093/07128, WO 94/19329, WO 94/22840, and PCT Application Number US96/03426. As used herein, "pharmaceutically acceptable salts" 10 refer to derivatives of the disclosed compounds wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; 15 alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic 20 or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, 25 succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, 30 and the like. The pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts 35 can be prepared by reacting the free acid or base forms 49 WO 01/29037 PCT/USOO/28824 of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, 5 isopropanol, or acetonitrile are preferred. Lists of suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, 1985, p. 1418, the disclosure of which is hereby incorporated by reference. 10 The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals 15 without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio. Since prodrugs are known to enhance numerous desirable qualities of pharmaceuticals (e.g., 20 solubility, bioavailability, manufacturing, etc.) the compounds of the present invention may be delivered in prodrug form. Thus, the present invention is intended to cover prodrugs of the presently claimed compounds, methods of delivering the same and compositions 25 containing the same. "Prodrugs" are intended to include any covalently bonded carriers which release an active parent drug of the present invention in vivo when such prodrug is administered to a mammalian subject. Prodrugs the present invention are prepared by modifying 30 functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Prodrugs include compounds of the present invention wherein a hydroxy, amino, or sulfhydryl group is bonded 35 to any group that, when the prodrug of the present 50 WO 01/29037 PCT/USOO/28824 invention is administered to a mammalian subject, it cleaves to form a free hydroxyl, free amino, or free sulfhydryl group, respectively. Examples of prodrugs include, but are not limited to, acetate, formate and 5 benzoate derivatives of alcohol and amine functional groups in the compounds of the present invention. Examples of prodrugs at R 8 are C 1

-

6 alkylcarbonyl, C 1 -6 alkoxy, C 1

-

4 alkoxycarbonyl, C 6

-

1 0 aryloxy, C 6

-

10 aryloxycarbonyl, C 6

-

1 0 arylmethylcarbonyl, C 1 -4 10 alkylcarbonyloxy C 1 4 alkoxycarbonyl, C 6

-

10 arylcarbonyloxy C 1

-

4 alkoxycarbonyl, C 1 -6 alkylaminocarbonyl, phenylaminocarbonyl, and phenyl C 1 -4 alkoxycarbonyl. "Stable compound" and "stable structure" are meant 15 to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contemplated by the present invention. 20 "Substituted" is intended to indicate that one or more hydrogens on the atom indicated in the expression using "substituted" is replaced with a selection from the indicated group(s), provided that the indicated atom's normal valency is not exceeded, and that the 25 substitution results in a stable compound. When a substituent is keto (i.e., =0) group, then 2 hydrogens on the atom are replaced. "Therapeutically effective amount" is intended to include an amount of a compound of the present invention 30 alone or in combination with other active ingredients or an amount of the combination of compounds claimed effective to inhibit HIV infection or treat the symptoms of HIV infection in a host. The combination of compounds is preferably a synergistic combination. 51 WO 01/29037 PCT/USOO/28824 Synergy, as described for example by Chou and Talalay, Adv. Enzyme Regul. 22:27-55 (1984), occurs when the effect (in this case, inhibition of HIV replication) of the compounds when administered in combination is 5 greater than the additive effect of the compounds when administered alone as a single agent. In general, a synergistic effect is most clearly demonstrated at suboptimal concentrations of the compounds. Synergy can be in terms of lower cytotoxicity, increased antiviral 10 effect, or some other beneficial effect of the combination compared with the individual components. Synthesis The compounds of the present invention can be 15 prepared in a number of ways well known to one skilled in the art of organic synthesis. The compounds of the present invention can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations 20 thereon as appreciated by those skilled in the art. Preferred methods include but are not limited to those methods described below. Each of the references cited below are hereby incorporated herein by reference. In the Schemes which follow, R1 is shown as a CF 3 group, 25 but could be any one of the presently described R 1 groups. 52 WO 01/29037 PCT/USOO/28824 Scheme 1

NHO

2 C x w H0 2 Y+

NH

2 CI NZ N Z N N H A 0 0 x x Z N N H H EM C B

F

3 C OH

F

3 C 0, Z NN ZN N DEMSEM E

F

3 5 y-IZ NN H F Scheme 1 illustrates the reaction between an 5 aryl/heterocyclic amine with 2-chioronicotinic acid to obtain the di-substituted amine A which can be cyclized 53 WO 01/29037 PCT/USOO/28824 using PPA to give B. Protection of the amine, followed by reaction with TMSCF 3 in the presence of TBAF gives D, which can be alkylated using a base and an alkylhalide and then deprotected to give F. 5 Scheme 2

CF

3 W X' D,F - 1 Z N N G

F

3 C R 2 G > W Z N N H H 10 Scheme 2 illustrates the aromatization of either D or F to give the compound G. The compound G can then be alkylated either through reaction with a Grignard reagent, or alternatively, by reaction with an organometalic reagent to give H. 15 54 WO 01/29037 PCT/USOO/28824 When required, separation of the diasteriomeric material can be achieved by HPLC using a chiral column or by a resolution using a resolving agent such as camphonic chloride as in Thomas J. Tucker, et al, J. Med. Chem. 5 1994, 37, 2437-2444. A chiral compound of formula (I) may also be directly synthesized using a chiral catalyst or a chiral ligand, e.g. Mark A. Huffman, et al, J. Org. Chem. 1995, 60, 1590-1594. Other features of the invention will become 10 apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof. 15 Examples Abbreviations used in the Examples are defined as follows: "OCC" for degrees Celsius, "d" for doublet, "dd" for doublet of doublets, "eq" or "equiv" for equivalent or equivalents, "g" for gram or grams, "mg" 20 for milligram or milligrams, "mL" for milliliter or milliliters, "H" for hydrogen or hydrogens, "hr" for hour or hours, "m" for multiplet, "M" for molar, "min" for minute or minutes, "MHz" for megahertz, "mp" for melting point, "MS" for mass spectroscopy, "nmr" or 25 "NMR" for nuclear magnetic resonance spectroscopy, "t" for triplet, "TLC" for thin layer chromatography, "CDI" for carbonyl diimidazole, "DIEA" for diisopropylethylamine, "DIPEA" for diisopropylethylamine, "DMAP" for dimethylaminopyridine, 30 "DME" for dimethoxyethane, "EDAC" for 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, "LAH" for lithium aluminium hydride, "MCPBA" is meta-chloroperbenzoic acid, "TBAF" for tetrabutylammonium fluoride, "TBS-Cl" for 35 t-butyldimethylsilyl chloride, "TEA" for triethylamine, 55 WO 01/29037 PCT/USOO/28824 "PPA" for polyphosphoric acid, "SEM-Cl" for 2 (trimethylsilyl)ethoxymethyl chloride, "TMS-CF 3 " for trifluoromethyltrimethylsilane, "THF" for tetrahydrofuran, "DMF" for dimethylformamide, "TFA" for 5 trifluoroactic acid, "NCS" for N-chlorosuccinimide, "EtOAc" for ethyl acetate, and "LDA" for lithium diisopropylamide. All reactions were run under a nitrogen atmosphere at room temperature and most were not optimized. The 10 reactions were followed by TLC. Reactions run overnight were done so for adequate time. Reagents were used as received. Dimethylformamide, tetrahydrofuran and acetonitrile were dried over molecular sieves. All other solvents were reagent grade. Ethanol and methanol 15 were absolute and water was deionized. Melting points were determined in open capillary tubes on a Mel-Temp apparatus and are uncorrected. Column chromatographies were done on flash silica gel. Exceptions to any of the conditions above are noted in the text. Chiral HPLC 20 separations were done using chiral columns which gave the enantiomers in >99% EE. The following methods are illustrated in the synthetic schemes which follow the methods. While the 25 examples are described for specific compounds, the same methods were employed to synthesize the other compounds which are listed in the table of examples. Example 1 30 Synthesis of 7-Chloro-5-(cycloproppvlmethoxy)-5,10 dihydro-5-(trifluoromethyl)benzoFbl[l,81naphthyridine. Method A. A mixture of the 4-chloroaniline (18.3 g, 144 mmol) and 2-chloronicotinic acid (24.6 g, 144 mmol) 35 in toluene (250 mL) was refluxed for 3 hours. The 56 WO 01/29037 PCT/USOO/28824 reaction was poured into a mixture of hexane and saturated NaHCO 3 (200 mL and 500 mL) and it was stirred vigorously for 30 minutes. Filtration gave 1 as a light creamy white powder that was used without further 5 purification, 32 g (85%). Method B. A mixture of 1 (30 g, 114 mmol) in PPA (35 mL) was stirred at 170 degrees C for 1.5 hours. The reaction was diluted with 1 N NaOH (400 mL) and the pH was adjusted to 2 with 50% NaOH then filtered. The 10 solid cake was re-suspended in water (400 mL) and the pH adjusted to 8 with 1N NaOH. Filtration gave 2 as a light tan powder that was used without further purification, 22.8 g (82%). Method C. To a mixture of 2 (8.31 g, 36.1 mmol) and 15 SEM-Cl (9.55 mL, 54.2 mmol) in DMF (100 mL) was added NaH (60%, 2.89 g, 72.3 mmol). After stirring overnight, the reaction was diluted with ethyl acetate (200 mL), washed with saturated NaHCO 3 (3x200 mL) and saturated NaCl (50 mL), dried (MgSO 4 ) and evaporated at reduced 20 pressure. Chromatography of the residue (hexane/ethyl acetate, 5-10%) gave a creamy foam on evaporation. It was crystallized from hexane giving 3 as creamy white needles, 9.02 g (69%). Method D. To a solution of 3 (7.84 g, 21.8 mmol) 25 and TMS-CF 3 (4.82 mL, 32.7 mmol) in chilled THF (0 degrees C, 150 mL) was added TBAF (1N in THF, 16.3 mL). After stirring for 10 minutes, the reaction was diluted with ethyl acetate (100 mL), washed with saturated NaHCO 3 (3x150 mL) and saturated NaCl (50 mL), dried 30 (MgSO 4 ) and evaporated at reduced pressure giving a reddish brown powder. It was crystallized from hexane giving 4 as a light tan powder, 8.09 g (86%). Method E. To a solution of 4 (4.00 g, 9.30 mmol) and cyclopropylmethylbromide (1.08 mL, 11.2 mmol) in DMF 57 WO 01/29037 PCT/USOO/28824 (50 mL) was added NaH (0.63 g, 15.7 mmol). After stirring overnight, the reaction was diluted with ethyl acetate (100 mL), washed with saturated NaHCO 3 (3x70 mL) and saturated NaCl (20 mL), dried (MgSO 4 ) and evaporated 5 at reduced pressure which gave 5 as a thick light brown oil that was used without further purification. Method F. A solution of 5 (-9.30 mmol) and TFA (5 mL) in dichloromethane (40 mL) was stirred under a glass stopper for one hour. The reaction was diluted with 10 ethyl acetate (100 mL), washed with saturated NaHCO 3 (3x70 mL) and saturated NaCl (20 mL) , dried (MgSO 4 ) and evaporated at reduced pressure giving a brown foam. Chromatography (hexane/ethyl acetate, 20%) gave a light yellow foam on evaporation. It was crystallized from 15 hexane giving 6 as creamy white micro-needles, 2.06 g (63% for steps E and F). CI N CI

HO

2 C H 1 B CI C1C N NN N IDSEM 3 0 3 O HB 0 C) N N N 4 SEM ~F SEM s F3C OH F 3 C 0_) Ci C19 N N H 6 58 WO 01/29037 PCT/USOO/28824 Example 2 Synthesis of 7-Chloro-5-trifluoromethyl benzorblfl,81naphthyridine

CF

3 CI 5 N N Method G. A solution of 6 (1.41 g, 3.98 mmol) in TFA (14 mL) was stirred overnight. The reaction was evaporated at reduced pressure and the residue was dissolved in dichloromethane (35 mL), washed with 10 saturated NaHCO 3 (3x20 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving a tan crystalline powder. It was triturated in hexane giving 7 as a light tan powder, 1.01 g (90%). 15 Example 3 Synthesis of 7-Chloro-5-(ethoxy)-5,10-dihydro-5 (trifluoromethvl)benzofbl[1,81naphthyridine. Method H. A solution of 6 (31 mg, 0.088 mmol) and 20 THF (0.2 mL) in ethanol (3 mL) was refluxed for 4 hours. The reaction was diluted with ethyl acetate (30 mL), washed with saturated NaHCO 3 (3x25 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving a white powder. Chromatography 25 (ether/hexane, 20%) gave a white powder, which was crystallized from dichloromethane and hexane giving 8 as a white crystalline powder, 18 mg (63%). Example 4 30 Synthesis of 7-Chloro-5-(n-butyl)-5,10-dihydro-5 (trifluoromethyl)benzoFbl[1,81nachthyridine. 59 WO 01/29037 PCT/USOO/28824 Method I. To a chilled (0 degree C) solution of 7 (86 mg, 0.304 mmol) in THF (3 mL) was added butylmagnesium chloride (0.460 mL, 0.915 mmol). After 5 stirring for 10 minutes, the reaction was diluted with ethyl acetate (30 mL), washed with saturated NaHCO 3 (3x25 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving clear brown film. Chromatography (hexane/ethyl acetate, 20%) gave a white 10 powder, which was crystallized from hexane giving 9 as a white crystalline powder, 24 mg (23%). Example 5 Synthesis of 7-Chloro-5-(ethyl)-5,10-dihydro-5 15 (trifluoromethvl)benzof[bl1,81naphthyridine. Method J. To a chilled (15 degree C) solution of 7 (30.0 g, 0.106 mmol) in benzene (3 mL) was added diethyl zinc (1N in hexane, 0.530 mL). After stirring 20 overnight, the reaction was diluted with ethyl acetate (20 mL), washed with saturated NaHC0 3 (3x15 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving a light brown film. Chromatography (hexane/ethyl acetate, 20%) gave a white 25 powder, which was crystallized from hexane giving 10 as a white microcrystalline powder, 12 mg (34%). Method K. A mixture of 3' (1.96 g, 4.80 mmol, synthesized by route A, B & C starting with ethyl 4 chloro-2-methylthio-5-pyrimidine carboxylate instead of 30 2-chloronicotinic acid) and Raney Nickel (excess) was refluxed in ethanol (15 mL) for 30 minutes. The reaction was filtered through celite and evaporated at reduced pressure giving a yellow solid. Chromatography 60 WO 01/29037 PCT/USOO/28824 (hexane/ethyl acetate, 20%) gave 3" as a yellow powder on evaporation, 580 mg (33%).

CF

3 C1 4,6 7 N N H

F

3 C Me CI 467 H9 N N H C1F 3 C Me 7 CI 10 N N H 0 0 C1 N SMe I SEM SEM 3' 3"' 5 Example 6 Synthesis of Cyclopropylethyl magnesium bromide. Method L. To a chilled (0 degree C) solution of 10 cyclopropylacetic acid (5.0 g, 50 mmol) in THF (50 mL) was added BH 3 .THF (lN in THF, 70 mL). After stirring overnight at room temperature, the reaction was quenched with water. It was then diluted with ethyl acetate (50 mL), washed with 1N HCl (3x30 mL) and saturated NaCl (10 15 mL), dried (MgSO 4 ) and evaporated at reduced pressure 61 WO 01/29037 PCT/USOO/28824 giving 11 as a colorless oil that was used without further purification, 4.3 g. Method M. A mixture of 11 (4.3 g, 50 mmol), 12 (12.7 g, 50 mmol), Ph 3 P (13.1 g, 50 mmol) and imidazole 5 (3.41 g, 50 mmol) in dichloromethane (140 mL) was stirred for two hours. The reaction was evaporated at reduced pressure and chromatography (hexane) gave 12 as a brown oil on evaporation, 6.3 g (64%). Method N. To a chilled (-78 degree C) solution of 10 12 (0.245 mL, 1.06 mmol) in THF (5 mL) was added t-butyl lithium (1.25 mL, 2.13 mmol). After warming to room temperature and stirring for one hour, the solution was re-chilled (to -78 degree C) and MgBr 2 was added (lN in ether/benzene, 1.06 mL). The reaction was then allowed 15 to warm to room temperature and then it was stirred for one hour affording a solution of 13. () L M N CO2H HO | BrMg 11 12 13 20 Example 7 Synthesis of 7-Chloro-5-(cyclopropylmethylamino)-5,10 dihvdro-5-(trifluoromethyl)benzoFbll,81naphthyridine. 25 Method 0. A solution of 7 (50 mg, 0.177 mmol) cyclopropylmethylamine (0.031 mL, 0.355 mmol) in DMF (2 mL) was stirred for 1 hour. The reaction was diluted with ethyl acetate (20 mL), washed with saturated NaHCO 3 30 (3x15 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving a yellow film. 62 WO 01/29037 PCT/USOO/28824 Chromatography (hexane/ethyl acetate, 30%) gave a white powder, which was crystallized from hexane giving 14 as a white crystalline powder, 26 mg (42%). 5 Example 8 Synthesis of 7-Chloro-5-(phenylamino)-5,10-dihydro-5 (trifluoromethvl)benzoFbl[l,81naphthyridine. Method P. To a solution of 7 (50 mg, 0.177 mmol) 10 and aniline (0.024 mL, 0.266 mmol) in DMF (3 mL) was added NaH (excess). After stirring 15 minutes, the reaction was diluted with ethyl acetate (20 mL), washed with saturated NaHCO3 (3x15 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure 15 which gave a brown film. Chromatography (hexane/ethyl acetate, 30%) gave a yellow film, which was crystallized from hexane and dichloromethane giving 15 as a creamy white crystalline powder, 27 mg (41%). 20 Example 9 Synthesis of 7-Chloro-5-(3,3,3-trifluoroprop-l-oxv) 5,10-dihydro-5 (trifluoromethvl)benzoFbl[l,81naphthyridine 25 Method Q. To a solution of 7 (50 mg, 0.177 mmol) and 3,3,3-trifluoropropanol (0.040 mL, 0.355 mmol) in DMF (3 mL) was added NaH (excess). After stirring 15 minutes, the reaction was quenched with saturated NH 4 Cl, diluted with ethyl acetate (20 mL), washed with 30 saturated NaHCO 3 (3x15 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure which gave a yellow film. It was crystallized from hexane giving 16 as a tan crystalline powder, 54 mg (77%). 63 WO 01/29037 PCT/USOO/28824

CF

3

F

3 C NH CI O CI N N N N H 7 14

F

3 C NH P CI 7 NII H 15

F

3 C CF3 Q CI 7 H 16 Example 9a Synthesis of 7-Chloro-5-pyridin-2-vlmethyl-5 5 trifluoromethyl-5,10-dihydro-benzorbI f,81naphthyridine. Method R; A solution of 2-picoline (5.0 mL, 51 mmol) and LDA (50 mmol) in THF (50 mL) was stirred for 3 hours under nitrogen at -78 0 C. The azaacridine 7 was 10 added and the reaction was stirred at -78 0 C for 30 minutes then it was allowed to warm to room temperature over 30 minutes. The reaction was quenched with saturated NH 4 Cl then diluted with ethyl acetate (50 mL), washed with saturated NaHCO 3 (3x30 mL) and saturated 15 NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving a brown syrup. Chromatography (ethyl acetate/hexane, 40%) gave a creamy film, which was 64 WO 01/29037 PCT/USOO/28824 crystallized from dichloromethane and hexane giving 19 as a creamy white crystalline powder, 645 mg (20%). Example 9b 5 Synthesis of 3,7-Dichloro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridin-5-ol. Method S; A solution of the azaacridine hydrate 20 (100 mg, 0.33 mmol) and NCS (49 mg, 0.37 mmol) in 10 isopropanol (5 mL) was refluxed for 15 minutes under nitrogen. The reaction was diluted with ethyl acetate (20 mL), washed with 1N HCl (3x10 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving a yellow powder. Trituration from 15 dichloromethane and gave the 3-chloroazaacridine 21 as a creamy white crystalline powder, 102 mg (92%). \ ,N

F

3 C C 7 R N N 19 H

F

3 C OH

F

3 C OH C CIC Cl Clj N N CI N N 21 H 20 H21 20 Example 10 Synthesis of 7-chloro-5-(cyclopropvlmethoxy)-5,10 dihvdro-lN-oxo-5 (trifluoromethvl)benzoFbl[l,81naphthyridine. 65 WO 01/29037 PCT/USOO/28824 Method U. A solution of 17 (150 mg, 0.424 mmol) mCPBA (3-chloroperbenzoic acid) (91 mg, 0.424 mmol) in dichloromethane (3 mL) was stirred for 2 hours. The 5 reaction was diluted with ethyl acetate (10 mL), washed with 1N NaOH (3x10 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving a brown film. Chromatography (ethyl acetate) gave a colorless film, which was crystallized from 10 dichloromethane and hexane giving 18 as a creamy white crystalline powder, 56 mg (36%).

F

3

COF

3 C O CI 'U C N N N N H H 17 18 Method Z. Chiral HPLC separation was performed using chiral columns which gave the (R) and (S) 15 enantiomers in >99% EE. Example 11 Synthesis of 7-Chloro-5-cyclopropylmethoxy-5 difluoromethyl-5,10-dihydro-benzo[b][1,8]naphthyridine 20 (X = Cl in Scheme 5, below). Method AA. Preparation of 2-Chloro-3 difluoroacetylpyridine. To a 1000 mL 3-necked round bottom flask equipped with a magnetic stirrer, cooling 25 bath, thermometer, addition funnel, septum and a nitrogen inlet was added diisopropylamine (20.2 g, 30 mL, d=0.722, 0.21 moles) and THF (200.0 mL). The 66 WO 01/29037 PCT/USOO/28824 solution was cooled to -20 0 C. n-Butyl lithium in hexane (2.5 M, 86 mL, 0.20 mole) was added over 30 min. The reaction mixture was stirred at -20 OC for 30 min and then cooled to -78 'C. 2-Chloropyridine (11.3 g, 5 9.4 mL, 0.1 moles) was aded dropwise over 5 min and the reaction mixture was stirred at -78 0 C for 4 h. Ethyl difluoroacetate (24.8 g, 0.01 moles) was added dropwise over 15 min and the reaction mixture was stirred at -78 *C. After 2 h, the reaction mixture was quenched with 10 sat. ammonium chloride solution (100 mL) and extracted with EtOAc (2 x 200 mL). The combined organics were washed with brine, dried (MgSO 4 ) and concentrated to afford a brown yellow oil. Column chromatography (SiO 2 , 15-30 % EtOAc-hexane, gradient elution) afforded the 15 desired material 23 (11.6 g, 61 % ) as brown yellow oil. Method BB Preparation of 2-amino-N-(4 chlorophenyl)-3-difluoroacetylpyridine: In a 100.0 mL round bottom flask equipped with a magnetic stirrer, oil 20 bath, thermometer, reflux condenser and a nitrogen inlet, 2-chloro-3-difluoroacetylpyridine 23 (2.75 g, 14.4 mmol) and 4-chloroaniline were dissolved in 3% H 2 0 AcOH and were heated to reflux for 14 h. The reaction mixture was cooled and concentrated by rotary 25 evaporation. The resulting brown residue was diluted with water, neutralized with NaHCO 3 , and extracted with EtOAc (3 x 150 mL). The combined organic layers were washed with brine and dried. Column chromatography (SiO 2 , 10 % EtOAc-hexane) provided the desired material 30 24 (2.15 g, mp 73-74 'C, 53 % yield) as yellow solid. 67 WO 01/29037 PCT/USOO/28824 Method CC: Preparation of 4-aza-7-chloro-9 difluoromethylacridine. To a 50.0 mL round bottom flask equipped with a magnetic stirrer and nitrogen inlet was added conc. H 2

SO

4 followed by 2-amino-N-(4 5 chlorophenyl)-3-difluoroacetylpyridine (2.5 g, 8.8 mmol) in portions over 15 min. The reaction mixture became an orange yellow homogeneous solution and was stirred at 23 OC for 48 h. The reaction was quenched with ice (250 g) and neutralized carefully with NaHCO 3 (30-32 g). The 10 cream precipitate was filtered, washed with water and dried in vacuum to afford 2.3 g (98 %) of the desired product 25 which was used without further purification (mp 232-233 *C). 15 Method DD: Preparation of 7-Chloro-9 Cyclopropylmethoxy-9-difluoromethyl-4-azaacridine. To a 250.0 mL round bottom equipped with a magnetic stirrer, a cooling bath, and nitrogen inlet was added 4-aza-7 chloro-9-difluoromethylacridine (2.0 g, 7.56 mmol), 20 cyclopropyl carbinol (0.82 g, 11.4 mmol, 1.5 equiv) and anhydrous DMF (50 mL). The cream colored suspension was cooled to -10 'C under N 2 and then NaH (60% oil dispersion) was added in portions over 10 min. The reaction mixture was stirred for 3 h at 0-5 0 C before 25 quenching with ice. The resulting mixture was extracted with EtOAc (3 x 200 mL), washed with brine, dried and concentrated. Column chromatography (SiO 2 , 25 % EtOAc hexane-1 % Et 3 N) afforded 1.4 g of the desired product 26 as a cream colored solid (mp 83-84 'C, 55 %) 30 68 WO 01/29037 PCT/USOO/28824 Scheme 5 1.) LDA (2 equiv) C X-& N CHF 2 0 ___ __ CHF 2 * __ __ N CI N THF -780C Ci N AcOH-H 2 0 2.) F 2

CHCO

2 Et reflux X N 61% 23 24

CHF

2 ONa

CHF

2 O conc. H 2

SO

4 X (1.5 equiv) X 23*C N N DMF-0*C N N 25 26 MCPBA X

CHF

2 O

CH

2 CI2 - rt N X<:N IN 0 27 Examples 12-14 were prepared according to the 5 procedure described in Example 11: Example 12 7-Fluoro-5-cyclopropylmethoxy-5-difluoromethyl 5, 10-dihydro-benzo [b] [1,8]naphthyridine, 900 mg, mp 137 10 138 OC. Example 13 7-Chloro-5-(2-cyclopropyl-ethoxy)-5-difluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine, 274 mg, mp 148 149 OC. 15 69 WO 01/29037 PCT/USOO/28824 Example 14 7-Chloro-5-pyridin-2-ylmethyl-5-difluoromethyl 5,10-dihydro-benzo[b] [1,8]naphthyridine, 17 mg, mp 204 205 OC. 5 Example 15 Synthesis of 3-chloro-7-fluoro-5-cyclopropylmethoxy-5 difluoromethyl-5,10-dihydro-benzo[b][1,8]naphthyridine. 10 Method EE: A solution of 28 (800 mg, 2.38 mmol) in isopropanol (16 mL) was treated with N-chlorosuccinimide (316 mg, 2.38 mmol). The resulting suspension was heated to 90 OC resulting in a homogeneous solution. A new precipitate formed after heating for 10 minutes. 15 The reaction was cooled to 23 OC and concentrated. The residue was partitioned between EtOAc and H 2 0 and the aqueous phase was extracted with EtOAc (4 x 25 mL). The combined organics were dried (Na 2

SO

4 ) and concentrated to provide a yellowish solid. Column chromatography 20 (SiO 2 , 65% EtOAc-hexane to 100 % EtOAc, gradient elution) afforded the desired material 29 (372 mg, 55%). Treatment with cyclopropylcarbinol as shown in example 11, method DD, afforded 7-Fluoro-2-chloro-9 cyclopropylmethoxy-9-difluoromethyl-4-azaacridine (141 25 mg, mp 169-170 OC).

CHF

2 O

CHF

2 F NCS IN F CI N N IPA, reflux N N N~ N 28 29 70 WO 01/29037 PCT/USOO/28824 Example 16 Synthesis of 7-Chloro-5-cyclopropylmethoxy-5 difluoromethyl-5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide 5 Method FF: To a 10.0 mL round bottom equipped with a magnetic stirrer, and nitrogen inlet was added 7 fluoro-9-cyclopropylmethoxy-9-difluoromethyl-4 azaacridine (1.4 g, 4.15 mmol) and anhydrous CH 2 Cl 2 (50 10 mL). MCPBA (1.23 g, 4.64 mmol) was added in portions and stirred at 23 OC for 4 h. The reaction mixture was diluted with CH 2 Cl 2 , washed with sat. NaHCO 3 solution (3 x 100 mL), brine and dried (MgSO 4 ). Concentration afforded a yellow residue which was purified by column 15 chromatography (SiO 2 , 1% Et 3 N-EtOAc) to afford 1.03 g of 7-Chloro-5-cyclopropylmethoxy-5-difluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide as a light green solid (mp 185-186 *C, 70 % yield). 20 Examples 17-20 were prepared according to the procedure described in Example 16: Example 17 7-Fluoro-5-cyclopropylmethoxy-5-difluoromethyl 25 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide, 102 mg, mp 166-167 OC. Example 18 7-Chloro-5-(2-cyclopropyl-ethoxy)-5-difluoromethyl 30 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide, 164 mg, mp 175-176 OC. 71 WO 01/29037 PCT/USOO/28824 Example 19 7-Chloro-5-pyridin-2-ylmethyl-5-difluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide, 9.2 5 mg, mp 210-211 OC. Example 20 3,7-Dichloro-5-cyclopropylmethoxy-5-difluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide, 84 mg, 10 mp 163-164 OC. Example 21 Synthesis of 5-Butyl-7-chloro-5-difluoromethyl 15 5,10-dihydro-benzo[b][1,8]naphthyridine Method GG: A solution of 7-chloro-9 difluoromethyl-4-azaacridine (396 mg 1.5 mmol) in THF (10 mL) was cooled under N 2 to -78 OC. n-Butyl lithium 20 was added dropwise over 15 min and the reaction mixture was stirred at -78 OC for 5 h. The reaction was quenched with sat. NH 4 Cl solution and extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine, dried and concentrated. Column 25 chromatography (SiO 2 , 10% EtOAc-hexane-1% Et 3 N) afforded the desired material 5-Butyl-7-chloro-5-difluoromethyl 5,10-dihydro-benzob][1,8]naphthyridine as a viscous yellow oil (10 mg, 2.1%). 30 Example 22 was prepared according to the procedure described in Example 21: 72 WO 01/29037 PCT/USOO/28824 Example 22 5-(2-cyclopropylethyl)-7-chloro-5-difluoromethyl 5,10-dihydro-benzo[b] [1,8]naphthyridine, 29 mg, viscous oil, MS m/z 335.1122 (M*+H) C 1 8

H

1 8 ClF 2

N

2 5 Scheme 6

CF

2

CH

3

CF

2

CH

3 1) LDA/THF/-78 "C CF2CH3 C1 NH 2 X O C H X N 2) CH 3

CF

2 C0 2 Et X N AcOH/H 2 0, reflux N N H X = Cl, 31 X = Cl, 33 X CI,35 X=F,32 X=F,34 X=F,36 H3CF2C OH H3CF2V conc. H 2

SO

4 x H30CH212OH C X CH 3

CO

3 H, AcOH N TFA, 90 *C N CICH 2

CH

2 CI, rt NN N NN- CC2H H H X = CI, 37 X = CI, 39 X = F, 38 X = F, 40

H,

3

CF

2 C PF X Chiral separation + N N- N N H _ H 1 H 1 X = Cl, 41 X = CI, 43 x = Cl, 45 X = F, 42 X= F, 44 X= F, 46 10 Example 23 and 24 Synthesis of 7-chloro-5-hydroxy-5-(1,1-difluoroethyl) 5,10-dihydrobenzo[b] [1,8]naphthyridine (37) and 7 15 Fluoro-5-hydroxy-5-(1,1-difluoroethyl)-5,10-dihydrobenzo [b] [1,8]naphthyridine (38): Method HH Preparation of 2-chloro-3-(2,2 difluoropropionyl)pyridine (33): To a stirred solution 73 WO 01/29037 PCT/USOO/28824 of diisopropylamine (11.8 mL, 84.00 mmol) in anhydrous THF (80 mL) at -20 OC was added n-BuLi (2.5 M in Hexanes, 32.0 mL, 80.00 mmol) dropwise. The reaction mixture was stirred at -20 OC for 30 min and then cooled 5 to -78 0 C. 2-Chloropyridine (3.82 mL, 40.00 mmol) was then added dropwise. The resulting yellow solution was stirred at -78 0 C for 3 h 20 min. Ethyl 2,2 difluoropropanoate was then added dropwise. After 3 h 40 min at -78 0, the reaction was quenched with saturated 10 aqueous ammonium chloride (40 mL) and extracted with EtOAc (2 X). The combined organic layers were washed with brine, dried over MgSO 4 , filtered and concentrated in vacuo. Flash chromatography (15% EtOAc-hexane) gave 33 (3.544 g, 86% yield) as a yellow oil. 15 2-Fluoro-3-(2,2-difluoropropionyl)pyridine (34) was prepared according to the procedure described in Method HH. 20 Preparation of 2-amino-N-(4-chlorophenyl)-3-(2,2 difluoropropionyl)pyridine (35): Method II: To a cloudy solution of 2-chloro-3 (2,2-difluoropropionyl)pyridine (33) (3.190 g, 15.52 mmol) in 10:1 AcOH-H 2 0 (38.5 mL) at room temperature was 25 added 4-chloroaniline (3.000 g, 23.28 mmol). The reaction mixture was heated to gently reflux for 21 h. The reaction mixture was then concentrated in vacuo. The resulting brown residue was diluted with EtOAc, neutralized with saturated aqueous NaHCO 3 (40 mL), and 30 extracted with EtOAc (2 X). The combined organic layers were washed with brine, dried over MgSO 4 , filtered and concentrated in vacuo. Flash chromatography (10% EtOAc 74 WO 01/29037 PCT/USOO/28824 hexane) afforded 35 (3.740 g, 81% yield) as a yellow solid (m.p. 85 - 86 OC). 2-Amino-N-(4-fluorophenyl)-3-(2,2 5 difluoropropionyl)pyridine (36) was prepared according to the procedure described in the Method II. Preparation of 7-chloro-5-hydroxy-5-(1,1-difluoroethyl) 5,10-dihydrobenzo[b] [1,8]naphthyridine (37): 10 Method JJ: 2-Amino-N-(4-chlorophenyl)-3-(2,2 difluoropropionyl)pyridine (35) (190 mg, 0.640 mmol) was treated with conc. sulfuric acid (1 mL). The resulting red homogeneous solution was stirred at room temperature for 47.5 h. The reaction was quenched with saturated 15 aqueous Na 2

CO

3 (15 mL), and extracted with EtOAc (3 X). The combined organic layers were washed with brine, dried over MgSO 4 , filtered and concentrated in vacuo. Flash chromatography (50% EtOAc-hexane) provided 37 (173 mg, 91% yield) as an off-white solid (m.p. 188 - 190 20 OC). 7-Fluoro-5-hydroxy-5-(1,1-difluoroethyl)-5,10 dihydrobenzo [b] [1,8]naphthyridine (38) was prepared according to the procedure described in Method JJ. 25 Example 25 Preparation of 7-chloro-5-(cyclopropylmethoxy)-5-(1,1 difluoroethyl)-5,10-dihydrobenzo[b] [1,8]naphthyridine (39): 30 Method KK: To a stirred suspension of 7-chloro-5 hydroxy-5-(1,1-difluoroethyl)-5,10-dihydrobenzo[b] [1,8]naphthyridine (37) (173 mg, 0.583 mmol) in 75 WO 01/29037 PCT/USOO/28824 cyclopropyl methanol (1.2 mL, 14.58 mmol) was added trifluoroacetic acid (446 pL, 5.83 mmol). The resulting solution was heated at reflux for 3 h 15 min. The reaction mixture was concentrated in vacuo, the residue 5 was purified by flash chromatography (40% EtOAc-hexane) afforded 39 (176 mg, 86% yield) as an off-white solid. Example 26 7-Fluoro-5-(cyclopropylmethoxy)-5-(1,1-difluoroethyl) 10 5,10-dihydrobenzo[b] [1,8]naphthyridine (40) was prepared according to the procedure described in Method KK. Example 27 15 Preparation of 7-chloro-5-(cyclopropylmethoxy)-5-(1,1 difluoroethyl)-5,10-dihydrobenzo[b] [1,8]naphthyridine 1-N-oxide (41): Method LL: To a stirred solution of 7-chloro-5 (cyclopropylmethoxy)-5-(1,1-difluoroethyl)-5,10 20 dihydrobenzo[b] [1,8]naphthyridine (39) (156 mg, 0.445 mmol) in anhydrous 1,2-dichloroethane (2 mL) at rt was added peracetic acid (32 wt.% in AcOH, 122 gL, 0.579 mmol). After 15 h at room tempertaure, the reaction was quenched with 1:1 aqueous 10% Na 2

S

2 03/saturated aqueous 25 NaHCO 3 (10 mL), and extracted with EtOAc (2 X). The combined organic layers were washed with brine, dried over MgSO 4 , filtered and concentrated in vacuo. Flash chromatography (10% MeOH-CH 2 Cl 2 ) furnished 41 (160 mg, 98% yield) as a pale yellow solid (m.p. 65 - 66 oC). 76 WO 01/29037 PCT/USOO/28824 Example 28 7-Fluoro-5- (cyclopropylmethoxy) -5- (1, 1-difluoroethyl) 5, 10-dihydrobenzo [b] [1, 8]naphthyridine-1-N-oxide (42) was prepared according to the procedure described in 5 Method LL. Scheme 7

CF

2

CH

3 H3FCOH ci CF-H NNNCDFC1 H 3

CF

2 C CN CI C NaCN,DMF - ref lux Nt N 10 H H X = CI, 37 X = CI, 47 X = CI, 49 X = F, 38 X = F, 48 X = F, 50 DIBAL, CH 2 CI C (i-PrO) 3 CH, p-TsO C H3CF2C CH(-i-Pr)2 -50 *C i-PrOH, CH 2

CI

2 , rt / N N H H X = CI, 51 X = CI, 53 X=F,52 X=F,54 H3CF2C 0 H3CF2 Et 3 SiH, TFA MCPBA CH2Cl2, rt N1 CH2C2 C 2 1, N N H 2

CI

2 , rtN N H H l. X = C1, 55 X = CI, 57 X=F, 56 X= F, 58 10 Example 29 Preparation of 7-chloro-5-cyano-5-(1,1-difluoroethyl) 5,10-dihydrobenzo[b] [1,8]naphthyridine (49): Method MM: A stirred solution of 7-chloro-5 15 hydroxy-5- (1, 1-difluoroethyl)-5,10-dihydrobenzo[b] [1,8]naphthyridine (37) (1.620 g, 5.393 mmol) in trifluoroacetic acid (11 mL) was heated at reflux for 16 h. The reaction mixture was concentrated in vacuo, the residue was purified by flash chromatography (90% - 95% 77 WO 01/29037 PCT/USOO/28824 EtOAc-hexane, gradient elution) afforded 47 (1.460 g, 97% yield) as a yellow solid (m.p. 151 -153 OC). 7-Fluoro-5-(1,1-difluoroethyl)benzo[b][1,8]naphthyridine 5 (48) was prepared according to the procedure described in Method MM. Preparation of 7-chloro-5-cyano-5-(1,1-difluoroethyl) 5,10-dihydrobenzo[b] [1,8]naphthyridine (49): 10 Method NN: To a stirred solution of 7-chloro-9 (1,1-difluoroethyl)-4-azaacridine (47) (1.440 g, 5.167 mmol) in anhydrous DMF (25 mL) at room temperature was added NaCN (533 mg, 10.334 mmol). After 15 h at room temperature, the reaction was quenched with 1:1 15 saturated aqueous NaHCO 3

/H

2 0 (50 mL), and extracted with EtOAc (3 X). The combined organic layers were washed with brine, dried over MgSO 4 , filtered and concentrated in vacuo. Flash chromatography (20% - 40% EtOAc-hexane, gradient elution) furnished 49 (1.106 g, 70% yield) as a 20 yellow solid. Example 30 7-Fluoro-5-cyano-5-(1,1-difluoroethyl)-5,10 dihydrobenzo[b] [1,8]naphthyridine (50) was prepared 25 according to the procedure described in Method NN. Preparation of 7-chloro-5-formyl-5-(1,1-difluoroethyl) 5,10-dihydrobenzo[b] [1,8]naphthyridine (51): Method 00: To a stirred solution of 7-chloro-5 30 cyano-5-(1,1-difluoroethyl)-5,10-dihydrobenzo[b] [1,8]naphthyridine (49) (862 mg, 2.820 mmol) in anhydrous methylene chloride (35 mL) at -78 0 C was added 78 WO 01/29037 PCT/USOO/28824 DIBAL (1.0 M in CH 2 C1 2 , 8.46 mL) dropwise. After 3 h 40 min at -50 OC, the reaction was quenched with 1 N HC1 (35 mL), and extracted with EtOAc (3 X). The combined organic layers were washed with brine, dried over MgSO 4 , 5 filtered and concentrated in vacuo. Flash chromatography (30% - 50% EtOAc-hexane, gradient elution) furnished 51 (706 mg, 81% yield) as a yellow solid. Example 32 10 7-Fluoro-5-formyl-5-(1,1-difluoroethyl)-5,10 dihydrobenzo[b] [1,8]naphthyridine (52) was prepared according to the procedure described in Method 00. Example 33 15 Preparation of 7-chloro-5-diisopropoxymethyl-5-(1,1 difluoroethyl)-5,10-dihydrobenzo[b] [1,8]naphthyridine (53): Method PP: To a stirred solution of 7-chloro-5 formyl-5-(1,1-difluoroethyl)-5,10-dihydrobenzo[b] 20 [1,8]naphthyridine (51) (619 mg, 2.005 mmol) in anhydrous triisopropyl orthoformate (30.0 mL, 134 mmol), anhydrous isopropanol (10 mL) and anhydrous methylene chloride (10 mL) at room temperature was added p TsOH-H 2 0 (763 mg, 4.010 mmol). After 18 h at room 25 temperature, the reaction was quenched with saturated aqueous NaHCO 3 (25 mL), and extracted with EtOAc (2 X). The combined organic layers were washed with brine, dried over MgSO 4 , filtered and concentrated in vacuo. Flash chromatography (30% - 40% EtOAc-hexane, gradient 30 elution) afforded 53 (400 mg, 49% yield) as a yellow solid as well as 45% recovery of starting material 51 (280 mg). 79 WO 01/29037 PCT/USOO/28824 Example 34 7-Fluoro-5-diisopropoxymethyl-5-(1,1-difluoroethyl) 5,10-dihydrobenzo[b] [1,8]naphthyridine (54) was 5 prepared according to the procedure described in Method PP. Example 35 Preparation of 7-chloro-5-isopropoxymethyl-5-(1,1 10 difluoroethyl)-5,10-dihydrobenzo[b] [1,8]naphthyridine (55): Method QQ: To a stirred solution of 7-chloro-5 diisopropoxymethyl-5-(1,1-difluoroethyl)-5,10 dihydrobenzo[b] [1,8]naphthyridine (53) (360 mg, 0.876 15 mmol) in anhydrous methylene chloride (4 mL) at room temperature was added trifluoroacetic acid (8 mL) and triethylsilane (6.0 mL, 36.44 mmol). After 14 h at room temperature, the reaction mixture was concentrated in vacuo, the residue was purified by flash chromatography 20 (30% - 40% EtOAc-hexane, gradient elution) afforded 55 (248 mg, 80% yield) as a yellow solid (m.p. 148 -149 0 C). Example 36 25 7-Fluoro-5-isopropoxymethyl-5-(1,1-difluoroethyl)-5,10 dihydrobenzo[b] [1,8]naphthyridine (56) was prepared according to the procedure described in Method QQ. Example 37 30 Preparation of 7-chloro-5-isopropoxymethyl-5-(1,1 difluoroethyl)-5,10-dihydrobenzo[b] [1,8]naphthyridine 1-N-oxide (57): 80 WO 01/29037 PCT/USOO/28824 Method RR: To a stirred solution of 7-chloro-5 isopropoxymethyl-5-(1,1-difluoroethyl)-5,10 dihydrobenzo[b] [1,8]naphthyridine (55) (108 mg, 0.306 mmol) in methylene chloride (3 mL) at room temperature 5 was added MCPBA (77% max, 103 mg, 0.459 mmol). After 2 h 15 min at room temperature, the reaction was quenched with 1:1 aqueous 10% Na 2

S

2

O

3 /saturated aqueous NaHCO 3 (10 mL), and extracted with EtOAc (2 X). The combined organic layers were washed with brine, dried over MgSO 4 , 10 filtered and concentrated in vacuo. Flash chromatography (5% MeOH-CH 2 Cl 2 ) furnished 57 (102 mg, 90% yield) as a pale yellow solid (m.p. 56 - 57 OC). Example 38 15 7-Fluoro-5-isopropoxymethyl-5-(1,1-difluoroethyl)-5,10 dihydrobenzo[b] [1,8]naphthyridine-l-N-oxide (58) was prepared according to the procedure described in Method RR. 81 WO 01/29037 PCT/USOO/28824 Scheme 8 C 3F 3 C CN FF 7 H 59 H N

IV

T 61 H60 62 ! ) F F8 WO 01/29037 PCT/USOO/28824 Scheme 9 O C1 F3C1 0 WW N N N N 63 H 64 H FC OH F3C O/S \O C1 C1 XX N N N N 65 H H N F3C YY N N 67 H Example 38 Preparation of 7-Fluoro-5-trifluoromethyl-5,10-dihydro 5 benzofbl[1,81naphthvridine-5-carbonitrile Method SS; To a solution of 7 (5.01g, 18.8 mmol) in DMF (80 mL) was added KCN (1.47 g, 22.6 mmol) and the reaction was stirred for 30 minutes. It was diluted with ethyl acetate (100 mL), washed with saturated 10 NaHCO, (3x60 mL) and saturated NaCl (10 mL), dried (MgSO 4 ) and evaporated at reduced pressure. The residue 83 WO 01/29037 PCT/USOO/28824 was triturated in hexane and ethyl acetate giving 59 as a tan powder, 5.06 g (92%). Example 39 Preparation of 7-Fluoro-5-trifluoromethyl-5,10-dihydro 5 benzoFbI[1,81naphthyridine-5-carbaldehyde Method TT; To a chilled solution (-50 0 C) of 59 (4.81 g, 16.4 mmol) in dichloromethane (100 mL) was added DIBAL-H (1N in dichloromethane, 49.2 mL, 49.2 mmol) and the rxn was stirred for 1 hour. It was 10 carefully quenched and then hydrolyzed at -50'C with 1N HCl. The reaction was diluted with ethyl acetate (80 mL), washed with saturated NaHCO, (3x60 mL) and saturated NaCl (10 mL), dried (MgSO 4 ) and evaporated at reduced pressure. The residue was triturated in hexane 15 and ethyl acetate giving 60 as a tan powder, 3.15 g (65%). Example 40 Preparation of 5-Diisopropoxymethyl-7-fluoro-5 trifluoromethyl-5,10-dihvdro-benzorblf,81naphthyridine 20 Method UU; Concentrated H 2 So, (54 mL, 1.02 mmol) was added to a solution of 60 (302 mg, 1.02 mmol) and triethoxy orthoformate (0.85 mL, 5.1 mmol) in ethanol (3 ml) and the reaction was stirred overnight. It was diluted with ethyl acetate (30 mL), washed with 25 saturated NaHCO, (3x20 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving 61 as a yellow film. The residue was used without further purification. Example 41 30 Preparation of 7-Fluoro-5-isopropoxymethyl-5 trifluoromethyl-5,10-dihydro-benzorbll,81naphthyridine Method VV; To a solution of 61 (310 mg, 0.779 mmol) in TFA (3 mL) was added BH 3 .Me 2 S (0.219 ml, 2.34 mmol) 84 WO 01/29037 PCT/USOO/28824 drop wise and the reaction was stirred overnight. It was diluted with ethyl acetate (30 mL), washed with IN NaOH (3x20 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure giving a honey colored 5 syrup. The residue was stirred in methanol (5 mL) with HCl (4N in dioxane, 1 mL) for one hour. The reaction was diluted with ethyl acetate (30 mL), washed with saturated NaHCO, (3x20 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated giving 62 as a yellow foam. 10 The residue was used without further purification. Example 42 Method WW; To a solution of the ketal 63 (85 mg, 0.198 mmol) and triethylsilane (0.320 mL, 1.98 mmol) in dichloromethane (0.3 mL) was added TFA (0.6 mL) and the 15 reaction was stirred overnight. It was diluted with ethyl acetate (30 mL), washed with saturated NaHCO 3 (3x20 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure. Chromatography of the residue (hexane/ethyl acetate, 20%) gave 64 (after 20 triturating in hexane) as a creamy white powder, 58 mg (79%) and 65 (after triturating in hexane) as a white powder, 15 mg (23%). Example 43 Preparation of 7-Chloro-5-pyrazol-l-vlmethyl-5 25 trifluoromethyl-5,10-dihvdro-benzorb[fl,81naphthyridine Method XX; To a solution of 65 (682 mg, 2.17 mmol) and diisopropylethylamine (1.13 mL, 6.52 mmol) in DMF (10 mL) was added methanesulfonyl chloride (0.336 mL, 4.34 mmol) and the reaction was stirred for 2 hours. It 30 was diluted with ethyl acetate (30 mL), washed with 1N HCl (3x20 mL) and saturated NaCl (5 mL), dried (MgSO 4 ), clarified with activated charcoal and evaporated at reduced pressure. Chromatography of the residue (hexane/ethyl acetate, 20%) gave a colorless film. It 85 WO 01/29037 PCT/USOO/28824 was triturated in dicholromethane and hexane giving 66 as a white powder, 688 mg (81%). Method YY; A mixture of 66 (26 mg, 0.066 mmol), pyrizole (22 mg, 0.33 mmol) and excess K 2

CO

3 in DMF (3 5 mL) was stirred at 100 0 C for 6 hours. It was diluted with ethyl acetate (30 mL), washed with saturated NaHCO 3 (3x20 mL) and saturated NaCl (5 mL), dried (MgSO 4 ) and evaporated at reduced pressure. Chromatography of the residue (hexane/ethyl acetate, 30%) gave a colorless 10 film. It was triturated in hexane giving 67 as a white powder, 12 mg (50%). 86 WO 01/29037 PCT/USOO/28824 Scheme 10 Cv T C 2 CI 1

N

1 t-BuLi, CF 3

CO

2 Et, THF HO OH 0 "C to rt (quant) -78 0 C (78%) C CF 3 N NH 2 N NHPiv 71 N NHPiv 0 72 6N HC, DPh 3 COH, p-TsOHH 2 0, MeCN CF3 reflux (90%) N NH2 24 h, (57%) 73 74 FFF F LDA (2 eq), 2-Chloropyridine, C AcOH:H2(4:1) C F H THF, -78 *C (61%) N I reflux, 24 h (65%) N HT r N N N H 776 F F FEF C11 F conc. H2"41 ~ CPA, TFA, RT N. MCPBA, CH 2

CI

2 CfC 30 mI C I rtI 30_ - 90min (88%) I rt,4hIt(60%) N N NN N N (83 %) H H HH 878 FE 5F NN N. N N N NH HH Example 44 Synthesis of 3-Chloro-10-trifluoromethyl-9,10-dihydro 1,8,9-triaza-anthracen-100-ol 10 Method ZZ; To a suspension of 2-amino-5 chloropyridine (5 g, 38.89 mmol) in dichloromethane (75 87 WO 01/29037 PCT/USOO/28824 mL) cooled to 0 OC was added triethylamine (9.7 mL, 70 mmol) in a stream followed by the dropwise addition of pivaloyl chloride (7.2 mL, 58.33 mmol) over 10 minutes. The reaction was stirred and allowed to warm to room 5 temperature over 1 hour. The reaction was quenched with saturated ammonium chloride (100 mL) and extracted with 50% diethyl ether-hexane mixture (2 X 200 mL). The combined organic layers were washed with brine (2 X 100 mL) and dried over MgSO 4 . Filtration and concentration 10 yielded a pale yellow oil which was dissolved in a 50% mixture of diethyl ether in hexane (100 mL) and filtered through a plug of silica gel. Evaporation afforded 8.6 g (quant.) of 71 as an off-white solid which was used without further purification. 15 Synthesis of N-[5-Chloro-3-(2,2,2-trifluoro-1,1 dihydroxyethyl)-2-pyridyl]-2,2-dimethylpropanamide. Method AAA; To a solution of N-(5-Chloro-2 20 pyridyl)-2,2-dimethylpropanamide (2.5 g, 11.75 mmol) in THF (50 mL) at -78 OC was added t-Butyllithium (1.7 M in pentane, 15.2 mL, 25.85 mmol) dropwise over 10 minutes. The reaction was stirred at -78 OC for 3 hours and ethyl trifluoroactetate (4.2 mL, 35.25 mmol) was added 25 dropwise. The mixture was stirred for 15 minutes at -78 oC and allowed to warm to room temperature over 45 minutes. After stirring at room temperature for an additional 30 minutes, the reaction was quenched with a dropwise addition of saturated ammonium chloride (100 30 mL) and partitioned between diethyl ether (150 mL) and water (150 mL). The organic layer was washed with brine (100 mL) and diluted with hexane (150 ml). After standing overnight, the off-white crystals 72 were 88 WO 01/29037 PCT/USOO/28824 collected and dried in vacuo, 2.85 g (78.5 %) and used without further purification. Synthesis of 1-(2-Amino-5-chloro-3-pyridinyl)-2,2,2 5 trifluoroethanone Method BBB; N-[5-Chloro-3-(2,2,2-trifluoro-1,1 dihydroxyethyl)-2-pyridyl]-2,2-dimethylpropanamide 72 (1 g, 3.23 mmol) was dissolved in a mixture of 6 N HCl (12 10 mL) and dimethoxyethane (3 mL) and heated to 110 OC for 2 h. After cooling to room temperature, the reaction mixture was poured onto ice and made basic by portionwise addition of NaHCO 3 . The mixture was extracted with a 50% mixture of diethyl ether in ethyl 15 acetate (2 X 50 mL) and the combined organic layers were washed with brine (50 mL) and dried (MgSO 4 ). Concentration yielded 73 as a bright yellow solid, 0.66 g (90%) which was used without further purification. 20 Synthesis of 1-[5-Chloro-2-(tritylamino)-3-pyridinyl] 2,2, 2-trifluoroethanone. Method CCC; 1-(2-Amino-5-chloro-3-pyridinyl)-2,2,2 trifluoroethanone (4.86 g, 21.69 mmol), 25 triphenylmethylcarbinol (6.78 g, 26.02 mmol) and p toluenesulfonic acid monohydrate (0.41 g, 2.16 mmol) were dissolved in acetonitrile (75 mL) in a 200 mL round bottom flask fitted with a Dean-Stark trap and a reflux condenser. After heating to reflux for 16 hours, the 30 reaction mixture was cooled and diluted with ethyl acetate (100 mL). The organic layer was washed with saturated NaHCO 3 (2 X 100 mL), brine (1 X 100 mL) and 89 WO 01/29037 PCT/USOO/28824 concentrated. Chromatography (SiO 2 , 20% diethyl ether hexane) afforded the product 74 as a yellow solid, 5.76 g (57%). 5 Synthesis of 1-(2-Chloro-3-pyridinyl)-1-[5-chloro-2 (tritylamino)-3-pyridinyl]-2,2,2-trifluoroethanol Method DDD; A solution of diisopropylamine (1.08 mL, 7.71 mmol) in THF at -78 OC was treated with n-BuLi 10 (2.5 M in hexane, 3.2 mL, 7.9 mmol) dropwise such that the temperature remained below -65 OC. After stirring at -78 OC for 1 hour, 2-chloropyridine (0.435 mL, 4.62 mmol) was added to the reaction at a rate to keep the temperature below -70 0 C. After stirring at -78 OC for 15 3 hours, a solution of 1-[5-Chloro-2-(tritylamino)-3 pyridinyl]-2,2,2-trifluoroethanone (1.8 g, 3.82 mmol in 20 mL THF) was added to the reaction dropwise such that the temperature did not rise above -70 OC. The reaction was stirred at -78 OC for 1 hour then warmed to room 20 temperature over 90 minutes. After stirring for an additional 30 minutes, the reaction was quenched by dropwise addition of saturated ammonium chloride (50 mL) and partitioned between ethyl acetate (150 mL) and water (100 mL). The organic layer was washed with brine (100 25 mL), dried with MgSO 4 and concentrated. Trituration of the resulting solid with diethyl ether (100 mL) yielded the desired product 75 as a brown solid, 1.37 g (61%) which was used without further purification. 90 WO 01/29037 PCT/USOO/28824 Synthesis of 3-Chloro-5-hydroxy-5-trifluoromethvl-5,10 dihydropyrido[2,3-b]l1,81naphthyridine Method EEE; 1-(2-Chloro-3-pyridinyl)-1-[5-chloro-2 5 (tritylamino)-3-pyridinyl]-2,2,2-trifluoroethanol (3.6 g, 6.2 mmol) was dissolved in a mixture of acetic acid (36 mL) and water (9 mL) and heated to reflux. After 24 hours, the reaction was cooled to room temperature and poured onto ice. The mixture was made basic by 10 portionwise addition of NaHCO 3 and extracted with ethyl acetate (2 X 75 mL). The combined organic layers were washed with brine (100 mL), dried with MgSO 4 , and concentrated. Chromatography (SiO 2 , 40% ethyl acetate hexane) provided the desired material 76 as an off white 15 solid, 1.22 g (65.2%). Example 45 Synthesis of 3-Chloro-10-cyclopropylmethoxy-10 trifluoromethyl-9,10-dihydro-1,8,9-triaza-anthracene 20 Method FFF; A solution of 3-chloro-5-(hydroxy)-5 (trifluoromethyl)-5,10-dihydropyrido[2,3 b][1,8]naphthyridine (50 mg, 0.166 mmol) in concentrated

H

2

SO

4 (1.5 mL ) was stirred at room temperature. After 25 30 minutes, the reaction mixture was added dropwise to a vigorously stirring solution of saturated NaHCO 3 and extracted with ethyl acetate (25 mL). The organic phase was washed with brine (25 mL), dried with MgSO 4 , and concentrated to yield 77 as a light brown solid, 38.7 mg 30 (82.5%) which was used without further purification. 91 WO 01/29037 PCT/USOO/28824 Synthesis of 3-Chloro-5-(cyclopropylmethoxy)-5 (trifluoromethyl)-5,10-dihydropyrido[2,3 b][1,8]naphthyridine. 5 Method GGG; A solution of 5-trifluoromethyl-3 chloropyrido[2,3-b][1,8]naphthyridine (20 mg 0.056 mmol) in cyclopropyl methyl alcohol (1.5 mL) was treated with trifluoroacetic acid (14 iL, 0.18 mmol) and stirred for 90 minutes. After concentration, the residue was 10 dissolved in ethyl acetate (25 mL), washed with saturated NaHCO 3 (25 mL), brine (25 mL), and dried over MgSO 4 . Concentration followed by chromatography (SiO 2 , 20% ethyl acetate-hexane) yielded 78 as a white solid, 22 mg (87.7%, mp 188 OC). 15 Example 46 Synthesis of 3-Chloro-5-(cyclopropylmethoxy)-5 (trifluoromethyl)-5,10-dihydropyrido[2,3 b][1,8]naphthyridine-9-N-oxide. 20 Method HHH; A solution of 3-chloro-5 (cyclopropylmethoxy)-5-(trifluoromethyl)-5,10 dihydropyrido[2,3-b][1,8]naphthyridine (0.02 g, 0.056 mmol) in dichloromethane (4 mL) was treated with m 25 chloroperbenzoic acid in one portion and stirred at room temperature for 4 hours. The reaction was quenched with saturated NaHCO 3 and was partitioned between dichloromethane (20 mL) and water (20 mL). The organic layer was washed with brine and dried over MgSO 4 . 30 Concentration and chromatography (SiO 2 , 60% ethyl acetate-hexane to 100% ethyl acetate to 5% methanol dichloromethane, gradient elution) afforded 12.5 mg of a white solid 79 (60%). 92 WO 01/29037 PCT/USOO/28824 Example 47 Synthesis of 3-Chloro-5- (isopropylmethoxy) -5 (trifluoromethyl) -5, 10-dihydropyrido [2,3 5 b][1,8]naphthyridine (10) was according to the procedure described in method GGG (55 mg, 15%). Example 48 Synthesis of 3-Chloro-5-(isopropylmethoxy)-5 10 (trifluoromethyl)-5,10-dihydropyrido[2,3 b][1,8]naphthyridine-9-N-oxide (11) was according to the procedure described in method HHH (35 mg, 82%). Scheme 11 FF F E F I OH F OH F FH NCS(1.1eq), n-BuOH CI C conc. H 2 SO4, 70 0 C u N Ih, (21%) H 76 82 F F F FEF C1 Cyclopropylmethanol C1 F CI TFA, rt , N N N 2 h, (57%) N N N H 15 83 84 Example 49 20 Synthesis of 3,7-Dichloro-5-hydroxy-5-trifluoromethyl 5,10-dihydropyrido[2,3-b][1,8]naphthyridine Method III; To a solution of 3-chloro-5-hydroxy-5 trifluoromethyl-5,10-dihydropyrido[2,3 25 b][1,8]naphthyridine (0.23 g, 0.76 mmol) in n-BuOH (5 93 WO 01/29037 PCT/USOO/28824 mL) was added N-chlorosuccinamide (0.11 g, 0.84 mmol) and the reaction was stirred at 120 OC for 1 hour. The reaction was cooled to room temperature and poured into saturated NaHCO 3 . The resulting mixture was extracted 5 with ethyl acetate (20 mL) and the organic layer was washed with brine (20 mL) and dried over MgSO 4 . Concentration and trituration with diethyl ether yielded 82 as a white colored solid, 0.175 g (68.1%). 10 Example 50 Synthesis of 5-Trifluoromethyl-3,7-dichloropyrido[2,3 b][1,8]naphthyridine Method JJJ; A solution of 3,7-dichloro-5-hydroxy-5 15 trifluoromethyl-5,10-dihydropyrido[2,3 b][1,8]naphthyridine (75 mg, 0.223 mmol) in concentrated

H

2

SO

4 (2.0 mL) was stirred at 70 OC for 1 h. After the reaction was complete, the mixture was added dropwise to a vigorously stirring solution of saturated NaHCO 3 and 20 was extracted with ethyl acetate (25 mL). The organic layer was washed with brine (25 mL), dried with MgSO 4 , and concentrated to yield 83 as a light brown solid, 85 mg (21%) which was used without further purification. 25 Example 50a Synthesis of 3,7-Dichloro-5-(cyclopropylmethoxy)-5 trifluoromethyl-5,10-dihydropyrido[2,3 b][1,8]naphthyridine (84)was prepared according to the 30 procedure described in method GGG (10.5 mg, 57%). 94 WO 01/29037 PCT/USOO/28824 Scheme 12

CF

2 H CI ~NaCN, DMF H 91 92 H2C CHO

HF

2 C CH(O-i-Pr) 2 DIBAL, CH2Cl2 (i-PrO) 3 CH, p-TsOH -50 *C N i-PrOH, CH 2 Cl 2 , rt N H H 93 94

HF

2 C O HF 2 C 1. BH 3 -Me 2 S, TFA MCPBA C 2. HCI, MeOH, rt N N CH 2

CI

2 , N N H H 0. 95 96 Example 51 5 Preparation of 7-chloro-5-cyano-5-(difluoromethyl)-5,10 dihydrobenzo [b] [1, 8]naphthyridine (92): Method KKK To a stirred solution of 7-chloro-9 (difluoromethyl)-4-azaacridine (91) (1.28 g, 4.84 mmol) in anhydrous DMF (30 mL) at room temperature was added 10 NaCN (711 mg, 14.51 mmol). After 15 h at room temperature, the reaction was quenched with H 2 0 (150 mL), and extracted with EtOAc (3 X). The combined organic layers were washed with brine, dried over Na 2

SO

4 , filtered and concentrated in vacuo. Flash 15 chromatography (SiO 2 , 30% EtOAc-hexane) furnished 92 (747 mg, 53% yield) as a brown solid. Example 52 Preparation of 7-chloro-5- (difluoromethyl) -5-formyl 20 5,10-dihydrobenzo[b] [1,8]naphthyridine (93): 95 WO 01/29037 PCT/USOO/28824 Method LLL To a stirred solution of 7-chloro-5 cyano-5-(difluoromethyl)-5,10-dihydrobenzo[b] [1,8]naphthyridine (92) (747mg, 2.55 mmol) in anhydrous methylene chloride (40 mL) at -78 0 C was added DIBAL 5 (1.0 M in CH 2 Cl 2 , 7.67 mL) dropwise. After 3 h at -50 oC, the reaction was quenched with 1.0 N HCl (40 mL), and extracted with EtOAc (3 X). The combined organic layers were washed with brine, dried over Na 2

SO

4 , filtered and concentrated in vacuo. Flash chromatography 10 (SiO 2 , 30% EtOAc-hexane) furnished 93 (299 mg, 39% yield) as a yellow solid. Example 53 Preparation of 7-chloro-5-(difluoromethyl)-5 15 diisopropoxymethyl-5,10-dihydrobenzo[b] [1,8]naphthyridine (94): Method MMM To a stirred solution of 7-chloro-5 (difluoromethyl)-5-formyl-5,10-dihydrobenzo[b] [1,8]naphthyridine (93) (294 mg, 1.0 mmol) in anhydrous 20 triisopropyl orthoformate (8.24 mL, 36.98 mmol) and anhydrous isopropanol (5 mL) at room temperature was added p-TsOH-H 2 0 (380 mg, 2.0 mmol). After 1.5 h at room temperature, the reaction was concentrated in vacuo. Flash chromatography (SiO 2 , 30% EtOAc-hexane) afforded 25 94 (132 mg, 34% yield) as a yellow solid. Example 54 Preparation of 7-chloro-5-(difluoromethyl)-5 isopropoxymethyl-5,10-dihydrobenzo[b] [1,8]naphthyridine 30 (95): Method NNN To a stirred solution 7-chloro-5 (difluoromethyl)-5-diisopropoxymethyl-5,10 96 WO 01/29037 PCT/USOO/28824 dihydrobenzo[b] [1,8]naphthyridine (94) (50 mg, 0.13 mmol) in trifluoroacetic acid (2 mL) at room temperature was added borane-methyl sulfide complex (36 pL, 0.38 mmol). After 14 h at room temperature, the reaction 5 mixture was quenched with 1.0 N NaOH and extracted with EtOAc (3 X). The combined layers were dried over MgSO 4 , filtered and concentrated in vacuo. The resulting yellow residue was taken up in MeOH (3 mL), acidified with 4 N HCl in dioxane (100 pL), and stirred at room 10 temperature for 3 hours. The solution was quenched with saturated aqueous NaHCO 3 (50 mL) and extracted with EtOAc (3 X). The combined organic layers were dried over MgSO 4 , filtered and concentrated in vacuo. The residue afforded 95 in quantitative yield. 15 Example 55 Preparation of 7-chloro-5-(difluoromethyl)-5 isopropoxymethyl-5,10-dihydrobenzo[b] [1,8]naphthyridine-1-N-oxide (96): 20 Method 000 To a stirred solution of 7-chloro-5 (difluoromethyl)-5-isopropoxymethyl-5,10-dihydrobenzo[b] [1,8]naphthyridine (95) (44 mg, 0.13 mmol) in methylene chloride (3 mL) at room temperature was added MCPBA (77% max, 44 mg, 0.19 mmol). After 16 h at room temperature, 25 the reaction was quenched with 1:1 aqueous 10% Na 2

S

2 03/saturated aqueous NaHCO 3 (10 mL), and extracted with EtOAc (2 X). The combined organic layers were washed with brine, dried over MgSO 4 , filtered and concentrated in vacuo. Flash chromatography (SiO 2 , 5% 30 MeOH-CH 2 Cl 2 ) furnished 96 (6 mg, 13% yield) as a red oil. 97 WO 01/29037 PCT/USOO/28824

CF

3 F 3 C N0 2

F

3 C NH 2 C F3I NH N N H 7 102 103

F

3 C NH CI N N H 104 Example 56 Preparation of 7-chloro-1,5-dihydro-5-(N 5 ethylaminomethyl)-5 (trifluoromethyl)benzo[b][1,8]napthyridine To a solution of 7 (1.77 g, 6.26 mmol) in dry acetonitrile (20 mL) was added nitromethane (6 mL) 10 followed by DBU (1.9 mL, 12.52 mmol). The solution was stirred at room temperature for 2 h and was then warmed to 70 0 C for 1 h. The reaction was cooled to room temperature, poured into saturated NH 4 Cl and extracted with EtOAc. The organic phase was dried over MgSO 4 , 15 filtered, and concentrated. The crude product was purified via column chromatography (20% EtOAc/hex) to provide 102 (1.74 g, 81%) in the form of a yellow foam. A mixture of 102 (1.74 g, 5.06 mmol) and stannous chloride dihydrate (5.70 g, 25.26 mmol) in EtOH (6 mL) 20 was warmed to 60 0 C. Concentrated HCl (6 mL) was then added and the resulting solution was stirred at 60'C for 30 min. The volatiles were removed in vacuo and the remaining residue was adjusted to pH 12 with 1N NaOH. This aqueous phase was extracted with EtOAc. The 98 WO 01/29037 PCT/USOO/28824 organic phase was dried over MgSO 4 , filtered and concentrated to provide 1.38 g (87%) of 103 which was isolated as a pale pink solid. A mixture of primary amine 103 (100 mg, 0.32 mmol), 5 iodoethane (0.118 mL, 0.48 mmol), and K 2

CO

3 (133 mg, 0.96 mmol) in acetonitrile (2.5 mL) was heated at 70 0 C for 2 h. The reaction mixture was poured into H 2 0 and was extracted with CH 2 C1 2 . The organic phase was dried over MgSO 4 , filtered, and concentrated. The crude 10 product was purified using column chromatography (50% EtOAc/hexane -> 5% MeOH/CH 2 Cl 2 ) to provide 46 mg (42%, mp 142.3-144.2 0 C) of 104, which crystallized upon slow evaporation from a solution in Et 2 0. 15 Example 57 Preparation of 7-chloro-5,10-dihydro-5-(N isopropylaminomethyl)-5 (trifluoromethyl)benzo[b][1,8]napthyridine

F

3 C NH CI | | N N H 105 20 A mixture of amine 103 (100 mg, 0.32 mmol) and acetone (0.026 mL, 0.35 mmol) in MeOH (1.6 mL) was cooled to OC. The reaction mixture was brought to pH 4 by adding several drops of glacial acetic acid, upon addition of which, solution occurred. The solution was 25 stirred for 15 min before adding NaCNBH 4 (22 mg, 0.34 mmol). The reaction was stirred for 3 h while allowing it to warm to room temperature and was then slowly 99 WO 01/29037 PCT/USOO/28824 poured into saturated NaHCO 3 . Extraction with EtOAc followed by drying over MgSO 4 , filtration and concentration provided 116 mg (100%, mp 182.2-184.8 0 C) of 105 in the form of a white foam which crystallized 5 upon slow evaporation from a solution in hexane. Example 58 Preparation of 7-chloro-5,10-dihydro-5-(N-isopropyl-N ethylaminomethyl)-5 10 (trifluoromethyl)benzo[b][1,8]napthyridine

F

3 C N C1 N N H A mixture of 104 (76 mg, 0.21 mmol) and formaldehyde (37% aqueous, 0.040 mL) in MeOH (2.5 mL) at 15 0 0 C was adjusted to pH 4 by adding several drops of glacial acetic acid. After 15 min, NaCNBH 4 (21 mg, 0.32 mmol) was added and the reaction mixture was stirred for 3 h while allowing it to gradually warm to room temperature. The solution was then poured into 20 saturated NaHCO 3 , the MeOH was removed in vacuo and the remaining aqueous phase was extracted with CH 2 Cl 2 . The organic phase was dried ove MgSO 4 , filtered and concentrated to provide 76 mg (99%, mp 139.6-141.2'C) of the title compound which crystallized upon slow 25 evaporation from a solution in hexane. 100 WO 01/29037 PCT/USOO/28824 Example 59 Preparation of 7-chloro-5- (N,N-diethylaminomethyl) -5,10 dihydro-5- (trifluoromethyl)benzo [b] [1, 8]napthyridine

F

3 C N CI I I N N 5 H A solution of 104 (110 mg, 0.32 mmol) and excess acetaldehyde in MeOH (3 mL) at 0 0 C was adjusted to pH 4 by adding several drops of glacial acetic acid. After 10 15 min, NaCNBH 4 (44 mg, 0.66 mmol) was added and the reaction mixture was allowed to warm to room temperature. After 2 h, the reaction mixture was poured into saturated NaHCO 3 and was extracted with CH 2 Cl 2 . The organic phase was dried over MgSO 4 , filtered, and 15 concentrated to provide 48 mg (40%, mp 115-117 0 C) of the title compound which crystallized upon slow evaporation from a solution in hexane. Example 60 20 Preparation of 5-(acetamidomethyl) -7-chloro-5, 10 dihydro-5- (trifluoromethyl) [b] [1, 8]napthyridine O

F

3 C NH CI N N H 101 WO 01/29037 PCT/USOO/28824 To a solution of 103 (60 mg, 0.19 mmol) in pyridine (1 mL) at room temperature was added acetic anhydride (0.180 mL, 1.9 mmol) . After stirring the resulting solution for 2 h, it was poured into water and was 5 extracted with EtOAc. The organic phase was dried over MgSO 4 , filtered and concentrated, then co-concentrated with heptane. The crude solid was washed with CH 2 Cl 2 to provide 45 mg (67%, mp 271.6-273.2 0 C) of the title compound in the form of colorless crystals. 10 Example 61 Preparation of 5,10-dihydro-7-fluoro-5-(N methylsulfonylmethyl) -5 (trifluoromethyl) [b] [1, 8]napthyridine 15 0

F

3 C NH 2

F

3 C NH F F I | - I | N N N N H H 106 Methanesulfonic anhydride (79 mg, 0.45 mmol) was added to a solution of amine 106 (prepared according to 20 the method of Example 1 using 7-fluoro-5 )trifluoromethyl)-1-azaacridine as the starting material) and triethylamine (0.146 mL, 1.05 mmol) in

CH

2 C1 2 (2 mL) at room temperature. After 1 h, the reaction mixture was poured into water and was extracted 25 with CH2Cl The organic phase was dried over MgSO 4 , filtered and concentrated to a residue that crystallized upon slow evaporation from a CH 2

CH

2 solution. The title 102 WO 01/29037 PCT/USOO/28824 compound (47mg, 33%, mp 234.9-237.4 0 C(d)) was obtained in the form of pale yellow crystals. Example 62 5 Preparation of 5,10-dihydro-7-fluoro-5 (isopropylamidomethyl) -5 (trifluoromethyl) [b] [1, 8]napthyridine O

F

3 C NH F I I N N 10 The title compound (mp 228.6-229.4 0 C) was prepared according to the method of Example 61 by substituting methanesulfonic anhydride with isobutyryl chloride. 15 Example 63 Preparation of 5,10-dihydro-7-fluoro-5 (isopropylguanadinomethyl)-5 (trifluormethyl) [b] [1, 8]napthyridine

F

3 C NH F l I N N 20 H To a solution of amine 106 (50 mg, 0.17 mmol) and triethylamine (0.24 mL, 0.17 mmol) in DMF (1 mL) at room temperature was added isopropyl isocyanate (0.017 mL, 0.17 mmol). After stirring for 1 h, the reaction 25 mixture was poured into H 2 0 and was extracted with 103 WO 01/29037 PCT/USOO/28824

CH

2 Cl 2 . Several drops of MeOH were added to the organic phase in order to achieve solution. This solution was then dried over MgSO 4 , filtered and concentrated. The remaining solid residue was washed with CH 2

CH

2 to afford 5 25 mg (38%, mp 273.2-275.0'C) of pure title compound in the form of a white solid. Example 64 Preparation of 1,5-dihydro-7-fluoro-5-(N 10 isopropylmethyl)-5 (trifluoromethyl) [b] [1, 8]napthyridine-l- (N-oxide)

F

3 C NH 2

F

3 C NHBoc F 3 C NHBoc F F F N N N N N N H H H 0 106 107 108

F

3 C NH 2

F

3 C NH F F - I _ _,_|_ N N N N H jH 00 109 15 To a suspension of amine 106 (1.0 g, 3.5 mmol) in acetonitrile (32 mL) at room temperature was added NEt 3 (0.975 mL, 7.0 mmol), then Boc 2 0 (0.885 mL, 3.9 mmol). The reaction mixture was stirred for 1.5 h and was 20 poured into saturated NH 4 Cl. The aqueous phase was extracted with EtOAc. The organic phase was then dried over MgSO 4 , filtered and concentrated. The crude product was purified via column chromatography (50% 104 WO 01/29037 PCT/USOO/28824 EtOAc/hexane) to provide 1.0 g (75%) of 107 in the form of a white solid. A solution of 107 (1.1 g, 2.3 mmol) and MCPBA (1.1 g, 3.4 mmol) in CH 2 Cl 2 (15 mL) was stirred at room 5 temperature for 2 h. The reaction mixture was then poured into saturated NaHCO 3 and was extracted with

CH

2 Cl 2 . The organic phase was dried over MgSO 4 , filtered and concentrated. The crude product was purified via column chromatography (5% MeOH/CH 2 Cl 2 ) to afford 906 mg 10 (79%) of 108 in the form of a brown foam. A solution of 108 (413 mg, 0.73 mmol) in TFA (3 mL) was stirred at room temperature for 1 h. The TFA was removed in vacuo and the remaining residue was adjusted to pH 11 with 1N NaOH. The aqueous phase was extracted 15 with EtOAc. The organic phase was dried over MgSO 4 , filtered and concentrated to provide 218 mg (95%) of 109 in the form of a pale brown solid. A solution of amine 109 (218 mg, 0.70 mmol) and acetone (0.56 mL, 0.76 mmol) in MeOH (3.5 mL) at 0 0 C was 20 adjusted to pH 4 by adding several drops of glacial acetic acid. After 15 minutes, NaCNBH 4 (48 mg, 0.73 mmol) was added. The reaction mixture was allowed to warm to room temperature and was stirred for 1.5 h after which time the mixture was poured into saturated NaHCO 3 . 25 The MeOH was removed in vacuo and the remaining aqueous phase was extracted with EtOAc. The organic layer was dried over MgSO 4 , filtered and concentrated to afford 213 mg (86%, mp 172.1-173.6 0 C) of the title compound in the form of a foam which crystallized upon slow 30 evaporation from a solution in Et 2 0. 105 WO 01/29037 PCT/USOO/28824 Example 65 Preparation of 5-(N,N-diethylaminomethyl)-5,10-dihydro 7-fluoro-5-(trifluoromethyl) [b][1,8]napthyridine-l-(N 5 oxide)

F

3 C N F N N H * A solution of amine 109 (60 mg, 0.19 mmol) and excess acetaldehyde in MeOH (1.0 mL) at 0 0 C was adjusted to pH 4 by adding several drops of glacial acetic acid. 10 After 15 minutes, NaCNBH 4 (26 mg, 0.42 mmol) was added. The reaction mixture was allowed to warm to room temperature and was stirred for 1.5 h after which time the mixture was poured into saturated NaHCO 3 . The MeOH was removed in vacuo and the remaining aqueous phase was 15 extracted with EtOAc. The organic layer was dried over MgSO 4 , filtered and concentrated. The crude product was purified via column chromatography (10 % MeOH/Et 2 O) to afford 60 mg (86%, mp 166.9-168.60C) of the title compound which crystallized upon slow evaporation from a 20 solution in Et 2 0. Example 66 Preparation of 5,10-dihydro-5-(N,N-dimethylaminomethyl) 7-fluoro-5-(trifluoromethyl) [b][1,8]napthyridine-l-(N 25 oxide) 106 WO 01/29037 PCT/USOO/28824

F

3 C N\ F | | N N H The title compound (mp 180.5-182.2 0 C) was prepared by the method of Example 65 substituting acetaldehyde 5 with a 37% solution of formaldehyde. Example 67 Preparation of 7-chloro-5,10-dihydro-5-(N isopropylaminomethyl)-5 10 (trifluoromethyl) [b] [1,8]napthyridine-l- (N-oxide)

F

3 C NH Cl I I N N H 0 The title compound (mp 169.9-172.1 0 C) was prepared according to the method of Example 64 by substituting 15 amine 106 with amine 103. Example 68 Preparation of 7-chloro-5-(N,N-diethylaminomethyl)-5,10 dihydro-5- (trifluoromethyl) [b] [1, 8]napthyridine-l- (N 20 oxide) 107 WO 01/29037 PCT/USOO/28824 C F 3 C NH 2 C1

F

3 C N CI CI N IN N IN) H I H 00 110 The title compound (mp 153.7-155.4 0 C) was prepared from amine 110 (prepared according to the method of Example 64 using amine 103 as the starting material) by 5 the method described in Example 65. Example 69 Preparation of 7-chloro-5,10-dihydro-5-(N,N dimethylaminomethyl) -5 10 (trifluoromethyl)[b][1,8]napthyridine-l-(N-oxide)

F

3 C N\ CI N N H The title compound (mp 151.3-153.5 0 C) was prepared from 110 using the method of Example 66. 15 The following compounds may be synthesized using 20 the methods described above. 108 WO 01/29037 PCT/USOO/28824 Table 1* R3a F3C

R

2 N N- H No. R 2 B R 3 a MP (C) MS Synthesis (M+H) Method 21 0-cyclopropylmethyl H Cl 166-167 355 A,B,C,D, E, F 22 O-benzyl H Cl 126-127 391 E,F 23 0-cyclobutylmethyl H Cl 183-184 369 E,F 24 0-ethyl H Cl 221-222 329 H 25 OH H Cl 206-207 301 D,F 26 O-n-propyl H Cl 155-156 343 H 27 O-i-propyl H Cl 147-148 343 H 28 n-butyl H Cl 133-134 341 G,I 29 0-methyl H Cl 207-208 315 H 30 0-cyclopropylmethyl H Cl 146-147 355 Z (S) 31 0-cyclopropylmethyl H Cl 146-147 355 Z (R) 32 cyclopropylethyl H Cl 150-151 353 L,M,N,I 33 0-2,2,2- H Cl 153-154 383 H trifluoroethyl 34 0-propargyl H Cl 174-175 339 E,F 35 ethyl H Cl 148-149 312 G,J 36 NH-cyclopropyl H Cl 132-133 340 G,O 37 NH-i-propyl H Cl 126-127 342 G,O 38 O-N,N- H Cl 223-224 372 G,Q dimethylaminoethyl 39 NH-(N- H Cl 174-175 413 G,O morpholinyl) ethyl 109 WO 01/29037 PCT/USOO/28824 40 0-(l- H Cl 172-173 369 G,Q methylcyclopropyl)met hyl 41 0-3,3,3- H Cl 166-167 397 G,Q trifluoropropyl 42 NH-cyclopropylmethyl H Cl 163-164 354 G,O 43 NH-methyl H Cl 186-187 314 G,O 44 NH-ethyl H Cl 149-150 328 G,O 45 cyclopropylethyl (S) H Cl 68-69 353 L,M,N,I 46 cylopropylethyl (R) H Cl 68-69 353 L,M,N,I 47 0-cylopropylmethyl H F 166-167 339 G,Q 48 0-cyclopropylethyl H F 154-155 353 G,Q 49 0-allyl H F 161-162 325 G,Q 50 NH-phenyl H Cl 236-237 376 G,P 51 0-cyclopropylmethyl 2- Cl 185-190 369 A,B,C,D, methyl E,F 52 n-butyl 2- Cl 115-118 469 H,I methyl 53 cyclopropylethyl 2- Cl 368 L,M,N,I methyl 54 allyl H F 173-174 309 L,M,N,I 55 nitrile H F 218-219 294 L,M,N,I 56 OH H F 186-187 285 D,F 57 NH-i-propyl H Cl 131-132 340 0 58 0-cyclobutylmethyl H Cl 157-158 353 H 59 0-cyclobutylmethyl 2-OH F 110-111 369 H 60 2-pyridylmethyl H Cl 193-195 376 R 61 butyl H F 93-94 325 I 62 2-pyridylmethyl H F 210-211 360 R 63 2-pyridylmethyl (R) H Cl 89-90 376 R 64 0-cyclopropylmethyl 3-Cl Cl 166-167 390 H 65 cyclopropylethyl H F 143-144 337 I 66 0-cyclopropylmethyl 3-Cl F 156-157 373 H,U 110 WO 01/29037 PCT/USOO/28824 67 hydroxymethyl H Cl 210-211 315 D,F 68 (methanesulfonic H Cl 187-188 393 T ether)methyl 69 0-cyclopropylmethyl 2- Cl 185-190 369 A,B,C,D, methyl E, F 70 n-butyl 2- Cl 115-118 469 H,I methyl 71 cyclopropylethyl 2- Cl 140-143 368 L,M,N,I methyl 72 0-cyclopropylmethyl 2-S- Cl NA 402 A,B,C,D, methyl E, F 73 0-i-butyl 2-S- Cl NA 404 E,F methyl 74 0-benzyl 2-S- Cl NA 438 E,F methyl 75 0-2-pyridylmethyl 2-S- Cl NA 439 E,F methyl 76 0-cyclopropylmethyl H Cl none 356 E,K,F 77 0-cyclobutylmethyl H Cl none 370 E,K,F 78 O-methyl H Cl none 316 E,K,F 79 0-cyclopropylmethyl H Cl none 356 E,K,F (S) 80 0-cyclopropylmethyl H Cl none 356 E,K,F (R) 81 0-N- H Cl none 413 E,K,F piperidinylethyl 82 O-N- H Cl none 415 E,K,F pyrrolidinylethyl 83 0-(N2-methyl)-N1- H Cl none 399 E,K,F piperazinepropyl 84 0-propyl H Cl none 442 E,K,F 85 O-N,N- H Cl none 344 E,K,F dimethylaminopropyl 86 0-benzyl H Cl none 387 E,K,F 111 WO 01/29037 PCT/USOO/28824 87 0-3-pyridinylmethyl H Cl none 392 E,K,F 88 O-allyl H Cl none 393 E,K,F 89 O-propargyl H Cl none 340 E,K,F 90 O-N,N- H Cl none 373 E,K,F dimethylaminoethyl 91 N-ethylaminomethyl H Cl 142.3 144.2 92 N-isopropyl H Cl 182.2 aminomethyl 184.8 93 N-isopropyl-N- H Cl 139.6 ethylaminomethyl 141.2 94 N,N- H Cl 115-117 diethylaminomethyl 95 acetamidomethyl H Cl 271.6 273.2 96 N-methylsulfonyl H F 234.9 methyl 237.4(d) 97 isopropyl H F 228.6 amidomethyl 229. 4 0 C 98 isopropyl H F 273.2 guanadinomethyl 275.0 112 WO 01/29037 PCT/USOO/28824 Table 2*

R

3 a F3C

R

2 R N N N B H No. R 2 B R 3 a MS Synthesis (M+H) Method 99 O-cyclopropylmethyl S-methyl Cl 402 A,B,C,D, E, F 100 O-i-butyl S-methyl Cl 404 E,F 101 0-benzyl S-methyl Cl 438 E,F 102 0-2-pyridylmethyl S-methyl Cl 439 E,F 103 0-cyclopropylmethyl H Cl 356 E,K,F 104 0-cyclobutylmethyl H Cl 370 E,K,F 105 0-methyl H Cl 316 E,K,F 106 O-cyclopropylmethyl (S) H Cl 356 E,K,F 107 0-cyclopropylmethyl (R) H Cl 356 E,K,F 108 0-(N-piperidinyl)ethyl H Cl 413 E,K,F 109 0-(N-pyrrolidinyl)ethyl H Cl 415 E,K,F 110 0-(N2-methyl)-Nl- H Cl 399 E,K,F piperazinepropyl 111 0-propyl H Cl 442 E,K,F 112 0-N,N-dimethylaminopropyl H Cl 344 E,K,F 113 O-benzyl H Cl 387 E,K,F 114 0-3-pyridinylmethyl H Cl 392 E,K,F 115 O-allyl H Cl 393 E,K,F 116 0-propargyl H Cl 340 E,K,F 117 O-N,N-dimethylaminoethyl H Cl 373 E,K,F 118 O-cyclopropylmethyl H Cl 119 butyl H Cl 347 A,B,C,D, E, F 113 WO 01/29037 PCT/USOO/28824 Table 3*

R

3 a F 3 C R 2 I B N N 2 H f 0 No. R 2 B R 3 a MP (C) MS Synthesis (M+H) Method 120 0-cyclopropylmethyl H Cl 165-166 371 H,U 121 0-benzyl H Cl 122 0-cyclobutylmethyl H Cl 123 O-ethyl H Cl 124 OH H Cl 274-275 317 U 125 0-n-propyl H Cl 126 0-i-propyl H Cl 127 n-butyl H Cl 128 0-methyl H Cl 129 O-cyclopropylmethyl H Cl 114-116 371 U (S) 130 0-cyclopropylmethyl H Cl (R) 131 cyclopropylethyl H Cl 132 0-2,2,2- H Cl trifluoroethyl 133 0-propargyl H Cl 172-173 355 U 134 ethyl H Cl 135 NH-cyclopropyl H Cl 136 NH-i-propyl H Cl 137 O-N,N- H Cl dimethylaminoethyl 138 NH-N-morpholinylethyl H Cl 139 0-(1-methyl H Cl 167-168 385 U cyclopropyl)methyl 114 WO 01/29037 PCT/USOO/28824 140 0-3,3,3- H Cl trifluoropropyl 141 NH-cyclopropylmethyl H Cl 142 NH-methyl H Cl 143 NH-ethyl H Cl 144 cyclopropylethyl (S) H Cl 120-121 369 U 145 cylopropylethyl (R) H Cl 146 0-cylopropylmethyl H F 193-194 355 U 147 0-cyclopropylethyl H Cl 97-98 369 U 148 O-allyl H F 149 NH-phenyl H Cl 150 0-cyclopropylmethyl 2- Cl 225-227 385 U methyl 151 n-butyl 2- Cl methyl 152 cyclopropylethyl 2- Cl 205-207 384 methyl 153 allyl H F 154 nitrile H F 155 OH H F 156 0-cyclobutylmethyl H F 171-172 369 H,U 157 NH-i-propyl H F 206-207 356 O,U 158 2-pyridylmethyl H Cl 251-252 392 R,U 159 2-pyridylmethyl H Cl 303-304 408 R,U 160 0-cyclopropylmethyl H F 115-116 354 H,U (S) 161 0-cyclopropylmethyl 3-Cl Cl 244-245 406 S,H,U 162 pentyl 3-Cl Cl 214-215 406 S,I,U 163 cyclopropylethyl H F 196-197 354 I,U 164 0-cyclopropylmethyl 3-Cl Cl 223-224 406 H,U (S) 165 cyclopropylethyl H F 153-154 354 I,U (R) 166 0-cyclopropylmethyl 3-Cl F 191-192 389 H,U 167 O-i-butyl H Cl 165-166 373 H,U 115 WO 01/29037 PCT/USOO/28824 168 butyl H Cl 161-162 357 I,U 169 0-cyclopropylmethyl 3-Cl F 173-174 389 H,U (S) 170 O-i-butyl H F 142-143 357 H,U 171 O-i-propyl H F 156-157 343 H,U 172 O-i-propyl H Cl 115-116 358 H,U 173 N-isopropylmethyl H F 172.1 173.6 174 N,N- H F 166.9 diethylaminomethyl 168.6 175 N,N- H F 180.5 dimethylaminomethyl 182.2 176 N-isopropyl H Cl 169.9 aminomethyl 172.1 177 N,N- H Cl 153.7 diethylaminomethyl 155.4 178 N,N- H Cl 151.3 dimethylaminomethyl 153.5 116 WO 01/29037 PCT/USOO/28824 Table 4*

R

3 a

R

1

R

2 1 3 N N 2 H I (O)t No. R 2 R1 B R 3 a t Mp C 179 0-cyclopropylmethyl CHF 2 H Cl 0 83-84 180 0-cyclopropylmethyl CHF 2 H F 0 137-138 181 0-cycloproylethyl CHF 2 H Cl 0 148-149 182 2-pyridylmethyl CHF 2 H Cl 0 204-205 183 O-cycloproylmethyl CHF 2 3-Cl F 0 169-170 184 O-cyclopropylmethyl CHF 2 H Cl 1 185-186 185 0-cyclopropylmethyl CHF 2 H F 1 166-167 186 0-cyclopropylethyl CHF 2 H Cl 1 175-176 187 2-pyridylmethyl CHF 2 H Cl 1 210-211 188 O-cyclopropylmethyl CHF 2 3-Cl F 1 163-164 189 n-butyl CHF 2 H Cl 0 oil 190 (2-cyclopropyl)ethyl CHF 2 H Cl 0 oil 191 0-cyclopropylmethyl CF 2

CH

3 H Cl 0 65-66 192 0-cyclopropylmethyl CF 2

CH

3 H F 0 132-135 193 0-cyclopropylmethyl CF 2

CH

3 H F 1 199-202 194 O-i-propyl CF 2

CH

3 H Cl 0 148-149 195 O-i-propyl CF 2

CH

3 H Cl 1 56-57 196 (S) 0- CF 2

CH

3 H Cl 1 cyclopropylmethyl 197 (R) 0- CF 2

CH

3 H Cl 1 cyclopropylmethyl 198 i-propoxymethyl CHF 2 H Cl 0 199 i-propoxymethyl CHF 2 H Cl 1 117 WO 01/29037 PCT/USOO/28824 Table 5* 3a R R 2 N N N2 H I (O)t No. R 2 R1 B R 3 a t Mp C 200 0-cyclopropylmethyl CF 3 H Cl 0 201 0-cyclopropylmethyl CF 3 H Cl 1 202 0-cyclopropylmethyl CF 3 3-Cl Cl 0 203 O-i-butyl CF 3 H Cl 0 204 O-i-butyl CF 3 H Cl 1 5 *Unless otherwise noted, stereochemistry is racemic The following compounds shown in Table 6 can be made using the procedure described above or by those known to one skilled in the art. Each of the cores at 10 the beginning of the table (a-ff) are meant to be paired with each entry in the table. For example, core e can be combined with entry 10 to provide one example. The number for R 3 * is indicated in core a and is the same throughout the different core structures. 118 WO 01/29037 PCT/USOO/28824 Table 6 8

F

3 C R 2

F

3 C R 2 3F 3 0 R 2 -3* B R3 B 3* B N BK 2 R 6-N N2 H f N N B H 0 H 5 a b c CH3 _ C R 2 F 2 HC R 2

F

2 HC R2 R * B R3 B 3*-----3 RI1 * 1 R 3 * N N ::kB RN I N ~' N 2 H O H g Hi d e f C CH R2CH 3 2 R 3 * R B2 RR S3* R R3*____ N R N N 2B R3*_ N N B N N B N N 2 H H6 H h 1 9H 3

CH

3

CH

3 2 F20 RR 2* F 2 C R2 R N* 1j- N_ N -- KI N B R H N 10 0 H H jk 1 I B KIB ~N" NN 3N HB NNB 15 H 0 H m n 119 WO 01/29037 PCT/USOO/28824

RF

3 C R 2

F

3 C R 2 3* N N B3*, N N N 'B R 3 '. 2~B Kt . HN NN NN N B O H H p q r

CH

3

F

2 HC R B F 2 HC R F 2 C R I-B R- - _ 3 I B N N N 2 N N N B N N N 5 H H H s t u CH3

F

2 C R 2 H V Entry B R3a R2 205 H 7-Cl -OH 206 H 7-Cl -0-methyl 207 H 7-Cl -0-ethyl 208 H 7-Cl -O-n-propyl 209 H 7-Cl -0-i-propyl 210 H 7-Cl -0-butyl 211 H 7-Cl -O-CH 2 -cyclopropyl 212 H 7-Cl -O-CH 2 -(l-methylcyclopropyl) 213 H 7-Cl -0-CH 2

CH

2 -cyclopropyl 214 H 7-Cl -0-CH 2 -cyclobutyl 120 WO 01/29037 PCT/USOO/28824 215 H 7-Cl -O-CH 2

CH

2 -cyclobutyl 216 H 7-Cl -O-benzyl 217 H 7-Cl -0-2,2,2-trifluoroethyl 218 H 7-Cl -0-trifluoromethyl 219 H 7-Cl -0-3,3,3-trifluoropropyl 220 H 7-Cl -0-allyl 221 H 7-Cl -0-propargyl 222 H 7-Cl -O-CH 2

CH

2

-N(CH

3

)

2 223 H 7-Cl -O-CH 2

CH

2 -(N-morpholinyl) 224 H 7-Cl -O-CH 2 -3-Pyridyl 225 H 7-Cl -O-CH 2 -4-Pyridyl 226 H 7-Cl

-O-CH

2 -2-furanyl 227 H 7-Cl -O-CH 2 -3-furanyl 228 H 7-Cl -O-CH 2 -2-thienyl 229 H 7-Cl -O-CH 2 -3-thienyl 230 H 7-Cl -O-CH 2 -2-oxazolyl 231 H 7-Cl -O-CH 2 -2-thiazolyl 232 H 7-Cl -O-CH 2 -4-isoxazolyl 233 H 7-Cl -O-CH 2 -2-imidazolyl 234 H 7-Cl -NH-methyl 235 H 7-Cl -NH -ethyl 236 H 7-Cl -NH-n-propyl 237 H 7-Cl -NH-i-propyl 238 H 7-Cl -NH-butyl 239 H 7-Cl -NH-CH 2 -cyclopropyl 240 H 7-Cl -NH-CH 2 -( l-methylcyclopropyl) 241 H 7-Cl -NH-CH 2

CH

2 -cyclopropyl 242 H 7-Cl -NH-CH 2 -cyclobutyl 121 WO 01/29037 PCT/USOO/28824 243 H 7-Cl -NH-CH 2

CH

2 -cyclobutyl 244 H 7-Cl -NH-benzyl 245 H 7-Cl -NH-2,2,2-trifluoroethyl 246 H 7-Cl -NH-trifluoromethyl 247 H 7-Cl -NH-3,3,3-trifluoropropyl 248 H 7-Cl -NH-allyl 249 H 7-Cl -NH-propargyl 250 H 7-Cl -NH-CH 2

CH

2

-N(CH

3

)

2 251 H 7-Cl -NH-CH 2

CH

2 -(N-morpholinyl) 252 H 7-Cl

-NH-CH

2 -3-Pyridyl 253 H 7-Cl -NH-CH 2 -4-Pyridyl 254 H 7-Cl -NH-CH 2 -2-furanyl 255 H 7-Cl -NH-CH 2 -3-furanyl 256 H 7-Cl -NH-CH 2 -2-thienyl 257 H 7-Cl -NH-CH 2 -3-thienyl 258 H 7-Cl -NH-CH 2 -2-oxazolyl 259 H 7-Cl -NH-CH 2 -2-thiazolyl 260 H 7-Cl -NH-CH 2 -4-isoxazolyl 261 H 7-Cl -NH-CH 2 -2-imidazolyl 262 H 7-Cl -benzyl 263 H 7-Cl -2,2,2-trifluoroethyl 264 H 7-Cl -trifluoromethyl 265 H 7-Cl -methyl 266 H 7-Cl -ethyl 267 H 7-Cl -propyl 268 H 7-Cl -i-propyl 269 H 7-Cl -butyl 270 H 7-Cl -i-butyl 122 WO 01/29037 PCT/USOO/28824 271 H 7-Cl -t-butyl 272 H 7-Cl -pentyl 273 H 7-Cl -CH 2

-CH

2 -cyclopropyl 274 H 7-Cl -CH 2

-CH

2 -(l-methylcyclopropyl) 275 H 7-Cl -CH2-CH 2

CH

2 -cyclopropyl 276 H 7-Cl -CH2-CH 2 -cyclobutyl 277 H 7-Cl -CH2-CH 2

CH

2 -cyclobutyl 278 H 7-Cl -CH2-benzyl 279 H 7-Cl -CH2-2,2,2-trifluoroethyl 280 H 7-Cl -CH2-trifluoromethyl 281 H 7-Cl -CH2-3,3,3-trifluoropropyl 282 H 7-Cl -CH2-allyl 283 H 7-Cl -CH2-propargyl 284 H 7-Cl -CH2-CH 2

CH

2

-N(CH

3

)

2 285 H 7-Cl -CH2-CH 2

CH

2 -(N-morpholinyl) 286 H 7-Cl -CH2-CH 2 -3-Pyridyl 287 H 7-Cl -CH2-CH 2 -4-Pyridyl 288 H 7-Cl -CH2-CH 2 -2-furanyl 289 H 7-Cl -CH2-CH 2 -3-furanyl 290 H 7-Cl -CH2-CH 2 -2-thienyl 291 H 7-Cl -CH2-CH 2 -3-thienyl 292 H 7-Cl -CH2-CH 2 -2-oxazolyl 293 H 7-Cl -CH2-CH 2 -2-thiazolyl 294 H 7-Cl -CH2-CH 2 -4-isoxazolyl 295 H 7-Cl -CH2-CH 2 -2-imidazolyl 296 H 7-Cl -C=C-(2-OH)Ph 297 H 7-Cl -C=C-(3-OH)Ph 298 H 7-Cl -C=C-(4-OH)Ph 123 WO 01/29037 PCT/USOO/28824 299 H 7-Cl -C=C-(2-OMe)Ph 300 H 7-Cl -C=C-(3-OMe)Ph 301 H 7-Cl -C=C-(4-OMe)Ph 302 H 7-Cl -C=C-(2-CN)Ph 303 H 7-Cl -C=C-(3-CN)Ph 304 H 7-Cl -C=C-(4-CN)Ph 305 H 7-Cl -C=C-(2-NO 2 )Ph 306 H 7-Cl -C=C-(3-NO 2 )Ph 307 H 7-Cl -C=C-(4-NO 2 )Ph 308 H 7-Cl -C=C-(2-NH 2 )Ph 309 H 7-Cl -C=C-(3-NH 2 )Ph 310 H 7-Cl -C=C-(4-NH 2 )Ph 311 H 7-Cl -C=C-(2-NMe 2 )Ph 312 H 7-Cl -C=C-(3-NMe 2 )Ph 313 H 7-Cl -C=C-(4-NMe 2 )Ph 314 H 7-Cl -C=C-3-Pyridyl 315 H 7-Cl -C=C-4-Pyridyl 316 H 7-Cl -C=C-2-furanyl 317 H 7-Cl -C=C-3-furanyl 318 H 7-Cl -C=C-2-thienyl 319 H 7-Cl -C=C-3-thienyl 320 H 7-Cl -C=C-2-oxazolyl 321 H 7-Cl -C=C-2-thiazolyl 322 H 7-Cl -C=C-4-isoxazolyl 323 H 7-Cl -C=C-2-imidazolyl 324 H 7-Cl -CH 2

CH

2 -cycPr 325 H 7-Cl

-CH

2

CH

2

CH

2

CH

2 OH 326 H 7-Cl -CH 2

CH

2 -CH(OH)Me 124 WO 01/29037 PCT/USOO/28824 327 H 7-Cl

-CH

2

CH

2 -Ph 328 H 7-Cl -CH 2

CH

2 -(2-Cl)Ph 329 H 7-Cl -CH 2

CH

2 -(3-Cl)Ph 330 H 7-Cl -CH 2

CH

2 -(4-Cl)Ph 331 H 7-Cl -CH 2

CH

2 -(2-F)Ph 332 H 7-Cl -CH 2

CH

2 -(3-F)Ph 333 H 7-Cl -CH 2

CH

2 -(4-F)Ph 334 H 7-Cl -CH 2

CH

2 -(2-OH)Ph 335 H 7-Cl -CH 2

CH

2 -(3-OH)Ph 336 H 7-Cl -CH 2

CH

2 -(4-OH)Ph 337 H 7-Cl -CH 2

CH

2 -(2-OMe)Ph 338 H 7-Cl

-CH

2

CH

2 -(3-OMe)Ph 339 H 7-Cl -CH 2

CH

2 -(4-OMe)Ph 340 H 7-Cl -CH 2

CH

2 -(2-CN)Ph 341 H 7-Cl -CH 2

CH

2 -(3-CN)Ph 342 H 7-Cl -CH 2

CH

2 -(4-CN)Ph 343 H 7-Cl -CH 2

CH

2 -(2-NO 2 )Ph 344 H 7-Cl -CH 2

CH

2 -(3-NO 2 )Ph 345 H 7-Cl -CH 2

CH

2 -(4-NO 2 )Ph 346 H 7-Cl -CH 2

CH

2 -(2-NH 2 )Ph 347 H 7-Cl -CH 2

CH

2 -(3-NH 2 )Ph 348 H 7-Cl -CH 2

CH

2 -(4-NH 2 )Ph 349 H 7-Cl -CH 2

CH

2 -(2-NMe 2 )Ph 350 H 7-Cl -CH 2

CH

2 -(3-NMe 2 )Ph 351 H 7-Cl -CH 2

CH

2 -(4-NMe 2 )Ph 352 H 7-Cl -CH 2

CH

2 -2-Pyridyl 353 H 7-Cl

-CH

2

CH

2 -3-Pyridyl 125 WO 01/29037 PCT/USOO/28824 354 H 7-Cl -CH 2

CH

2 -4-Pyridyl 355 H 7-Cl -CH 2

CH

2 -2-furanyl 356 H 7-Cl -CH 2

CH

2 -3-furanyl 357 H 7-Cl -CH 2

CH

2 -4-furanyl 358 H 7-Cl -CH 2

CH

2 -3-thienyl 359 H 7-Cl -CH 2

CH

2 -2-oxazolyl 360 H 7-Cl -CH 2

CH

2 -2-thiazolyl 361 H 7-Cl -CH 2

CH

2 -4-isoxazolyl 362 H 7-Cl -CH 2

CH

2 -2-imidazolyl 363 H 7-Cl -C=C-cycPr 364 H 7-Cl -C=C-Ph 365 H 7-Cl -C=C-2-Pyridyl 366 H 7-Cl -C=C-3-Pyridyl 367 H 7-Cl -C=C-4-Pyridyl 368 H 7-Cl -C=C-2-furanyl 369 H 7-Cl -C=C-3-furanyl 370 H 7-Cl -C=C-2-thienyl 371 H 7-Cl -C=C-3-thienyl 372 H 7-Cl -C=C-cycPr 373 H 7-Cl -C=C-Ph 374 H 7-Cl -C=C-2-Pyridyl 375 H 7-Cl -C=C-3-Pyridyl 376 H 7.-Cl -C=C-4-Pyridyl 377 H 7-Cl -C=C-2-furanyl 378 H 7-Cl -C=C-3-furanyl 379 H 7-Cl -C=C-2-thienyl 380 H 7-Cl -C=C-3-thienyl 126 WO 01/29037 PCT/USOO/28824 381 H 7-Cl -CH 2

CH

2 -cycPr 382 H 7-Cl

-CH

2

CH

2 -Ph 383 H 7-Cl -CH 2

CH

2 -2-Pyridyl 384 H 7-Cl

-CH

2

CH

2 -3-Pyridyl 385 H 7-Cl -CH 2

CH

2 -4-Pyridyl 386 H 7-Cl -CH 2

CH

2 -2-furanyl 387 H 7-Cl -CH 2

CH

2 -3-furanyl 388 H 7-Cl -CH 2

CH

2 -2-thienyl 389 H 7-Cl -CH 2

CH

2 -3-thienyl 390 H 7-Cl -CaC-cycPr 391 H 7-Cl -CaC-Ph 392 H 7-Cl -CaC-2-Pyridyl 393 H 7-Cl -CaC-3-Pyridyl 394 H 7-Cl -CeC-4-Pyridyl 395 H 7-Cl -CaC-2-furanyl 396 H 7-Cl -CaC-3-furanyl 397 H 7-Cl -CaC-2-thienyl 398 H 7-Cl -CaC-3-thienyl 399 H 7-Cl -C=C-cycPr 400 H 7-Cl -C=C-Ph 401 H 7-Cl -C=C-2-Pyridyl 402 H 7-Cl -C=C-3-Pyridyl 403 H 7-Cl -C=C-4-Pyridyl 404 H 7-Cl -C=C-2-furanyl 405 H 7-Cl -C=C-3-furanyl 406 H 7-Cl -C=C-2-thienyl 407 H 7-Cl -C=C-3-thienyl 127 WO 01/29037 PCT/USOO/28824 408 H 7-Cl

-CH

2

CH

2 -cycPr 409 H 7-Cl

-CH

2

CH

2 -Ph 410 H 7-Cl -CH 2

CH

2 -2-Pyridyl 411 H 7-Cl -CH 2

CH

2 -3-Pyridyl 412 H 7-Cl -CH 2

CH

2 -4-Pyridyl 413 H 7-Cl -CH 2

CH

2 -2-furanyl 414 H 7-Cl -CH 2

CH

2 -3-furanyl 415 H 7-Cl

-CH

2

CH

2 -2-thienyl 416 H 7-Cl -CH 2

CH

2 -3-thienyl 417 3-Cl 7-Cl -OH 418 3-Cl 7-Cl -0-methyl 419 3-Cl 7-Cl -0-ethyl 420 3-Cl 7-Cl -0-n-propyl 421 3-Cl 7-Cl -0-i-propyl 422 3-Cl 7-Cl ~O-butyl 423 3-Cl 7-Cl -0-CH 2 -cyclopropyl 424 3-Cl 7-Cl -0-CH 2 -(1-methylcyclopropyl) 425 3-Cl 7-Cl -0-CH 2

CH

2 -cyclopropyl 426 3-Cl 7-Cl -0-CH 2 -cyclobutyl 427 3-Cl 7-Cl -0-CH 2

CH

2 -cyclobutyl 428 3-Cl 7-Cl -0-benzyl 429 3-Cl 7-Cl -0-2,2,2-trifluoroethyl 430 3-Cl 7-Cl -0-trifluoromethyl 431 3-Cl 7-Cl -0-3,3,3-trifluoropropyl 432 3-Cl 7-Cl -0-allyl 433 3-Cl 7-Cl -0-propargyl 434 3-Cl 7-Cl -0-CH 2

CH

2

-N(CH

3

)

2 435 3-Cl 7-Cl -0-CH 2

CH

2 -(N-morpholinyl) 128 WO 01/29037 PCT/USOO/28824 436 3-Cl 7-Cl -O-CH 2 -3-Pyridyl 437 3-Cl 7-Cl -O-CH 2 -4-Pyridyl 438 3-Cl 7-Cl -O-CH 2 -2-furanyl 439 3-Cl 7-Cl -O-CH 2 -3-furanyl 440 3-Cl 7-Cl -O-CH 2 -2-thienyl 441 3-Cl 7-Cl -O-CH 2 -3-thienyl 442 3-Cl 7-Cl -O-CH 2 -2-oxazolyl 443 3-Cl 7-Cl -O-CH 2 -2-thiazolyl 444 3-Cl 7-Cl -O-CH 2 -4-isoxazolyl 445 3-Cl 7-Cl -O-CH 2 -2-imidazolyl 446 3-Cl 7-Cl -NH-methyl 447 3-Cl 7-Cl -NH -ethyl 448 3-Cl 7-Cl -NH-n-propyl 449 3-Cl 7-Cl -NH-i-propyl 450 3-Cl 7-Cl -NH-butyl 451 3-Cl 7-Cl -NH-CH 2 -cyclopropyl 452 3-Cl 7-Cl -NH-CH 2 -(1-methylcyclopropyl) 453 3-Cl 7-Cl -NH-CH 2

CH

2 -cyclopropyl 454 3-Cl 7-Cl -NH-CH 2 -cyclobutyl 455 3-Cl 7-Cl -NH-CH 2

CH

2 -cyclobutyl 456 3-Cl 7-Cl -NH-benzyl 457 3-Cl 7-Cl -NH-2,2,2-trifluoroethyl 458 3-Cl 7-Cl -NH-trifluoromethyl 459 3-Cl 7-Cl -NH-3,3,3-trifluoropropyl 460 3-Cl 7-Cl -NH-allyl 461 3-Cl 7-Cl -NH-propargyl 462 3-Cl 7-Cl

-NH-CH

2

CH

2

-N(CH

3

)

2 463 3-Cl 7-Cl -NH-CH 2

CH

2 -(N-morpholinyl) 129 WO 01/29037 PCT/USOO/28824 464 3-Cl 7-Cl -NH-CH 2 -3-Pyridyl 465 3-Cl 7-Cl -NH-CH 2 -4-Pyridyl 466 3-Cl 7-Cl -NH-CH 2 -2-furanyl 467 3-Cl 7-Cl -NH-CH 2 -3-furanyl 468 3-Cl 7-Cl -NH-CH 2 -2-thienyl 469 3-Cl 7-Cl -NH-CH 2 -3-thienyl 470 3-Cl 7-Cl -NH-CH 2 -2-oxazolyl 471 3-Cl 7-Cl -NH-CH 2 -2-thiazolyl 472 3-Cl 7-Cl -NH-CH 2 -4-isoxazolyl 473 3-Cl 7-Cl -NH-CH 2 -2-imidazolyl 474 3-Cl 7-Cl -benzyl 475 3-Cl 7-Cl -2,2,2-trifluoroethyl 476 3-Cl 7-Cl -trifluoromethyl 477 3-Cl 7-Cl -methyl 478 3-Cl 7-Cl -ethyl 479 3-Cl 7-Cl -propyl 480 3-Cl 7-Cl -i-propyl 481 3-Cl 7-Cl -butyl 482 3-Cl 7-Cl -i-butyl 483 3-Cl 7-Cl -t-butyl 484 3-Cl 7-Cl -pentyl 485 3-Cl 7-Cl -CH 2

-CH

2 -cyclopropyl 486 3-Cl 7-Cl -CH 2

-CH

2 -(1-methylcyclopropyl) 487 3-Cl 7-Cl -CH2-CH 2

CH

2 -cyclopropyl 488 3-Cl 7-Cl -CH2-CH 2 -cyclobutyl 489 3-Cl 7-Cl -CH2-CH 2

CH

2 -cyclobutyl 490 3-Cl 7-Cl -CH2-benzyl 491 3-Cl 7-Cl -CH2-2,2,2-trifluoroethyl 130 WO 01/29037 PCT/USOO/28824 492 3-Cl 7-Cl -CH2-trifluoromethyl 493 3-Cl 7-Cl -CH2-3,3,3-trifluoropropyl 494 3-Cl 7-Cl -CH2-allyl 495 3-Cl 7-Cl -CH2-propargyl 496 3-Cl 7-Cl -CH2-CH 2

CH

2

-N(CH

3

)

2 497 3-Cl 7-Cl -CH2-CH 2

CH

2 -(N-morpholinyl) 498 3-Cl 7-Cl -CH2-CH 2 -3-Pyridyl 499 3-Cl 7-Cl -CH2-CH 2 -4-Pyridyl 500 3-Cl 7-Cl -CH2-CH 2 -2-furanyl 501 3-Cl 7-Cl -CH2-CH 2 -3-furanyl 502 3-Cl 7-Cl -CH2-CH 2 -2-thienyl 503 3-Cl 7-Cl -CH2-CH 2 -3-thienyl 504 3-Cl 7-Cl -CH2-CH 2 -2-oxazolyl 505 3-Cl 7-Cl -CH2-CH 2 -2-thiazolyl 506 3-Cl 7-Cl -CH2-CH 2 -4-isoxazolyl 507 3-Cl 7-Cl -CH2-CH 2 -2-imidazolyl 508 3-Cl 7-Cl -C=C-(2-OH)Ph 509 3-Cl 7-Cl -C=C-(3-OH)Ph 510 3-Cl 7-Cl -C=C-(4-OH)Ph 511 3-Cl 7-Cl -C=C-(2-OMe)Ph 512 3-Cl 7-Cl -C=C-(3-OMe)Ph 513 3-Cl 7-Cl -C=C-(4-OMe)Ph 514 3-Cl 7-Cl -C=C-(2-CN)Ph 515 3-Cl 7-Cl -C=C-(3-CN)Ph 516 3-Cl 7-Cl -C=C-(4-CN)Ph 517 3-Cl 7-Cl -C=C-(2-NO 2 )Ph 518 3-Cl 7-Cl -C=C-(3-NO 2 )Ph 131 WO 01/29037 PCT/USOO/28824 519 3-Cl 7-Cl -C=C-(4-NO 2 )Ph 520 3-Cl 7-Cl -C=C-(2-NH 2 )Ph 521 3-Cl 7-Cl -C=C-(3-NH 2 )Ph 522 3-Cl 7-Cl -C=C-(4-NH 2 )Ph 523 3-Cl 7-Cl -C=C-(2-NMe 2 )Ph 524 3-Cl 7-Cl -C=C-(3-NMe 2 )Ph 525 3-Cl 7-Cl -C=C-(4-NMe 2 )Ph 526 3-Cl 7-Cl -C=C-3-Pyridyl 527 3-Cl 7-Cl -C=C-4-Pyridyl 528 3-Cl 7-Cl -C=C-2-furanyl 529 3-Cl 7-Cl -C=C-3-furanyl 530 3-Cl 7-Cl -C=C-2-thienyl 531 3-Cl 7-Cl -C=C-3-thienyl 532 3-Cl 7-Cl -C=C-2-oxazolyl 533 3-Cl 7-Cl -C=C-2-thiazolyl 534 3-Cl 7-Cl -C=C-4-isoxazolyl 535 3-Cl 7-Cl -C=C-2-imidazolyl 536 3-Cl 7-Cl -CH 2

CH

2 -cycPr 537 3-Cl 7-Cl -CH 2

CH

2

CH

2

CH

2 OH 538 3-Cl 7-Cl -CH 2

CH

2 -CH(OH)Me 539 3-Cl 7-Cl -CH 2

CH

2 -Ph 540 3-Cl 7-Cl -CH 2

CH

2 -(2-Cl)Ph 541 3-Cl 7-Cl -CH 2

CH

2 -(3-Cl)Ph 542 3-Cl 7-Cl -CH 2

CH

2 -(4-Cl)Ph 543 3-Cl 7-Cl -CH 2

CH

2 -(2-F)Ph 544 3-Cl 7-Cl -CH 2

CH

2 -(3-F)Ph 545 3-Cl 7-Cl -CH 2

CH

2 -(4-F)Ph 132 WO 01/29037 PCT/USOO/28824 546 3-Cl 7-Cl -CH 2

CH

2 -(2-OH)Ph 547 3-Cl 7-Cl -CH 2

CH

2 -(3-OH)Ph 548 3-Cl 7-Cl

-CH

2

CH

2 -(4-OH)Ph 549 3-Cl 7-Cl -CH 2

CH

2 -(2-OMe)Ph 550 3-Cl 7-Cl

-CH

2

CH

2 -(3-OMe)Ph 551 3-Cl 7-Cl -CH 2

CH

2 -(4-OMe)Ph 552 3-Cl 7-Cl -CH 2

CH

2 -(2-CN)Ph 553 3-Cl 7-Cl

-CH

2

CH

2 -(3-CN)Ph 554 3-Cl 7-Cl -CH 2

CH

2 -(4-CN)Ph 555 3-Cl 7-Cl -CH 2

CH

2 -(2-NO 2 )Ph 556 3-Cl 7-Cl -CH 2

CH

2 -(3-NO 2 )Ph 557 3-Cl 7-Cl -CH 2

CH

2 -(4-NO 2 )Ph 558 3-Cl 7-Cl -CH 2

CH

2 -(2-NH 2 )Ph 559 3-Cl 7-Cl -CH 2

CH

2 -(3-NH 2 )Ph 560 3-Cl 7-Cl -CH 2

CH

2 -(4-NH 2 )Ph 561 3-Cl 7-Cl -CH 2

CH

2 -(2-NMe 2 )Ph 562 3-Cl 7-Cl -CH 2

CH

2 -(3-NMe 2 )Ph 563 3-Cl 7-Cl -CH 2

CH

2 -(4-NMe 2 )Ph 564 3-Cl 7-Cl -CH 2

CH

2 -2-Pyridyl 565 3-Cl 7-Cl -CH 2

CH

2 -3-Pyridyl 566 3-Cl 7-Cl -CH 2

CH

2 -4-Pyridyl 567 3-Cl 7-Cl -CH 2

CH

2 -2-furanyl 568 3-Cl 7-Cl

-CH

2

CH

2 -3-furanyl 569 3-Cl 7-Cl -CH 2

CH

2 -4-furanyl 570 3-Cl 7-Cl

-CH

2

CH

2 -3-thienyl 571 3-Cl 7-Cl

-CH

2

CH

2 -2-oxazolyl 572 3-Cl 7-Cl -CH 2

CH

2 -2-thiazolyl 133 WO 01/29037 PCT/USOO/28824 573 3-Cl 7-Cl -CH 2

CH

2 -4-isoxazolyl 574 3-Cl 7-Cl -CH 2

CH

2 -2-imidazolyl 575 3-Cl 7-Cl -CEC-cycPr 576 3-Cl 7-Cl -C=C-Ph 577 3-Cl 7-Cl -C=C-2-Pyridyl 578 3-Cl 7-Cl -C=C-3-Pyridyl 579 3-Cl 7-Cl -CEC-4-Pyridyl 580 3-Cl 7-Cl -C=C-2-furanyl 581 3-Cl 7-Cl -C=C-3-furanyl 582 3-Cl 7-Cl -C=C-2-thienyl 583 3-Cl 7-Cl -C=C-3-thienyl 584 3-Cl 7-Cl -C=C-cycPr 585 3-Cl 7-Cl -C=C-Ph 586 3-Cl 7-Cl -C=C-2-Pyridyl 587 3-Cl 7-Cl -C=C-3-Pyridyl 588 3-Cl 7-Cl -C=C-4-Pyridyl 589 3-Cl 7-Cl -C=C-2-furanyl 590 3-Cl 7-Cl -C=C-3-furanyl 591 3-Cl 7-Cl -C=C-2-thienyl 592 3-Cl 7-Cl -C=C-3-thienyl 593 3-Cl 7-Cl

-CH

2

CH

2 -cycPr 594 3-Cl 7-Cl

-CH

2

CH

2 -Ph 595 3-Cl 7-Cl -CH 2

CH

2 -2-Pyridyl 596 3-Cl 7-Cl -CH 2

CH

2 -3-Pyridyl 597 3-Cl 7-Cl -CH 2

CH

2 -4-Pyridyl 598 3-Cl 7-Cl -CH 2

CH

2 -2-furanyl 599 3-Cl 7-Cl -CH 2

CH

2 -3-furanyl 134 WO 01/29037 PCT/USOO/28824 600 3-Cl 7-Cl -CH 2

CH

2 -2-thienyl 601 3-Cl 7-Cl -CH 2

CH

2 -3-thienyl 602 3-Cl 7-Cl -C=C-cycPr 603 3-Cl 7-Cl -C=C-Ph 604 3-Cl 7-Cl -C=C-2-Pyridyl 605 3-Cl 7-Cl -C=C-3-Pyridyl 606 3-Cl 7-Cl -C=C-4-Pyridyl 607 3-Cl 7-Cl -C=C-2-furanyl 608 3-Cl 7-Cl -C=C-3-furanyl 609 3-Cl 7-Cl -C=C-2-thienyl 610 3-Cl 7-Cl -C=C-3-thienyl 611 3-Cl 7-Cl -C=C-cycPr 612 3-Cl 7-Cl -C=C-Ph 613 3-Cl 7-Cl -C=C-2-Pyridyl 614 3-Cl 7-Cl -C=C-3-Pyridyl 615 3-Cl 7-Cl -C=C-4-Pyridyl 616 3-Cl 7-Cl -C=C-2-furanyl 617 3-Cl 7-Cl -C=C-3-furanyl 618 3-Cl 7-Cl -C=C-2-thienyl 619 3-Cl 7-Cl -C=C-3-thienyl 620 3-Cl 7-Cl -CH 2

CH

2 -cycPr 621 3-Cl 7-Cl -CH 2

CH

2 -Ph 622 3-Cl 7-Cl -CH 2

CH

2 -2-Pyridyl 623 3-Cl 7-Cl -CH 2

CH

2 -3-Pyridyl 624 3-Cl 7-Cl -CH 2

CH

2 -4-Pyridyl 625 3-Cl 7-Cl -CH 2

CH

2 -2-furanyl 626 3-Cl 7-Cl -CH 2

CH

2 -3-furanyl 135 WO 01/29037 PCT/USOO/28824 627 3-Cl 7-Cl -CH 2

CH

2 -2-thienyl 628 3-Cl 7-Cl -CH 2

CH

2 -3-thienyl 629 2-Me 7-Cl -OH 630 2-Me 7-Cl -0-methyl 631 2-Me 7-Cl -0-ethyl 632 2-Me 7-Cl -O-n-propyl 633 2-Me 7-Cl -O-i-propyl 634 2-Me 7-Cl -0-butyl 635 2-Me 7-Cl -O-CH 2 -cyclopropyl 636 2-Me 7-Cl -O-CH 2 -(1-methylcyclopropyl) 637 2-Me 7-Cl -0-CH 2

CH

2 -cyclopropyl 638 2-Me 7-Cl -0-CH 2 -cyclobutyl 639 2-Me 7-Cl -0-CH 2

CH

2 -cyclobutyl 640 2-Me 7-Cl -O-benzyl 641 2-Me 7-Cl -0-2,2,2-trifluoroethyl 642 2-Me 7-Cl -0-trifluoromethyl 643 2-Me 7-Cl -0-3,3,3-trifluoropropyl 644 2-Me 7-Cl -0-allyl 645 2-Me 7-Cl -0-propargyl 646 2-Me 7-Cl -0-CH 2

CH

2

-N(CH

3

)

2 647 2-Me 7-Cl -0-CH 2

CH

2 -(N-morpholinyl) 648 2-Me 7-Cl -O-CH 2 -3-Pyridyl 649 2-Me 7-Cl -0-CH 2 -4-Pyridyl 650 2-Me 7-Cl -0-CH 2 -2-furanyl 651 2-Me 7-Cl -0-CH 2 -3-furanyl 652 2-Me 7-Cl -0-CH 2 -2-thienyl 653 2-Me 7-Cl -0-CH 2 -3-thienyl 654 2-Me 7-Cl -0-CH 2 -2-oxazolyl 136 WO 01/29037 PCT/USOO/28824 655 2-Me 7-Cl -O-CH 2 -2-thiazolyl 656 2-Me 7-Cl -O-CH 2 -4-isoxazolyl 657 2-Me 7-Cl -O-CH 2 -2-imidazolyl 658 2-Me 7-Cl -NH-methyl 659 2-Me 7-Cl -NH -ethyl 660 2-Me 7-Cl -NH-n-propyl 661 2-Me 7-Cl -NH-i-propyl 662 2-Me 7-Cl -NH-butyl 663 2-Me 7-Cl -NH-CH 2 -cyclopropyl 664 2-Me 7-Cl -NH-CH 2 -(l-methylcyclopropyl) 665 2-Me 7-Cl -NH-CH 2

CH

2 -cyclopropyl 666 2-Me 7-Cl -NH-CH 2 -cyclobutyl 667 2-Me 7-Cl -NH-CH 2

CH

2 -cyclobutyl 668 2-Me 7-Cl -NH-benzyl 669 2-Me 7-Cl -NH-2,2,2-trifluoroethyl 670 2-Me 7-Cl -NH-trifluoromethyl 671 2-Me 7-Cl -NH-3,3,3-trifluoropropyl 672 2-Me 7-Cl -NH-allyl 673 2-Me 7-Cl -NH-propargyl 674 2-Me 7-Cl -NH-CH 2

CH

2

-N(CH

3

)

2 675 2-Me 7-Cl -NH-CH 2

CH

2 -(N-morpholinyl) 676 2-Me 7-Cl -NH-CH 2 -3-Pyridyl 677 2-Me 7-Cl -NH-CH 2 -4-Pyridyl 678 2-Me 7-Cl -NH-CH 2 -2-furanyl 679 2-Me 7-Cl -NH-CH 2 -3-furanyl 680 2-Me 7-Cl -NH-CH 2 -2-thienyl 681 2-Me 7-Cl -NH-CH 2 -3-thienyl 682 2-Me 7-Cl -NH-CH 2 -2-oxazolyl 137 WO 01/29037 PCT/USOO/28824 683 2-Me 7-Cl -NH-CH 2 -2-thiazolyl 684 2-Me 7-Cl -NH-CH 2 -4-isoxazolyl 685 2-Me 7-Cl -NH-CH 2 -2-imidazolyl 686 2-Me 7-Cl -benzyl 687 2-Me 7-Cl -2,2,2-trifluoroethyl 688 2-Me 7-Cl -trifluoromethyl 689 2-Me 7-Cl -methyl 690 2-Me 7-Cl -ethyl 691 2-Me 7-Cl -propyl 692 2-Me 7-Cl -i-propyl 693 2-Me 7-Cl -butyl 694 2-Me 7-Cl -i-butyl 695 2-Me 7-Cl -t-butyl 696 2-Me 7-Cl -pentyl 697 2-Me 7-Cl -CH 2

-CH

2 -cyclopropyl 698 2-Me 7-Cl -CH 2

-CH

2 -(1-methylcyclopropyl) 699 2-Me 7-Cl -CH2-CH 2

CH

2 -cyclopropyl 700 2-Me 7-Cl -CH2-CH 2 -cyclobutyl 701 2-Me 7-Cl -CH2-CH 2

CH

2 -cyclobutyl 702 2-Me 7-Cl -CH2-benzyl 703 2-Me 7-Cl -CH2-2,2,2-trifluoroethyl 704 2-Me 7-Cl -CH2-trifluoromethyl 705 2-Me 7-Cl -CH2-3,3,3-trifluoropropyl 706 2-Me 7-Cl -CH2-allyl 707 2-Me 7-Cl -CH2-propargyl 708 2-Me 7-Cl -CH2-CH 2

CH

2

-N(CH

3

)

2 709 2-Me 7-Cl -CH2-CH 2

CH

2 -(N-morpholinyl) 710 2-Me 7-Cl -CH2-CH 2 -3-Pyridyl 138 WO 01/29037 PCT/USOO/28824 711 2-Me 7-Cl -CH2-CH 2 -4-Pyridyl 712 2-Me 7-Cl -CH2-CH 2 -2-furanyl 713 2-Me 7-Cl -CH2-CH 2 -3-furanyl 714 2-Me 7-Cl -CH2-CH 2 -2-thienyl 715 2-Me 7-Cl -CH2-CH 2 -3-thienyl 716 2-Me 7-Cl -CH2-CH 2 -2-oxazolyl 717 2-Me 7-Cl -CH2-CH 2 -2-thiazolyl 718 2-Me 7-Cl -CH2-CH 2 -4-isoxazolyl 719 2-Me 7-Cl -CH2-CH 2 -2-imidazolyl 720 2-Me 7-Cl -C=C-(2-OH)Ph 721 2-Me 7-Cl -C=C-(3-OH)Ph 722 2-Me 7-Cl -C=C-(4-OH)Ph 723 2-Me 7-Cl -C=C-(2-OMe)Ph 724 2-Me 7-Cl -C=C-(3-OMe)Ph 725 2-Me 7-Cl -C=C-(4-OMe)Ph 726 2-Me 7-Cl -C=C-(2-CN)Ph 727 2-Me 7-Cl -C=C-(3-CN)Ph 728 2-Me 7-Cl -C=C-(4-CN)Ph 729 2-Me 7-Cl -C=C-(2-NO 2 )Ph 730 2-Me 7-Cl -C=C-(3-NO 2 )Ph 731 2-Me 7-Cl -C=C-(4-NO 2 )Ph 732 2-Me 7-Cl -C=C-(2-NH 2 )Ph 733 2-Me 7-Cl -C=C-(3-NH 2 )Ph 734 2-Me 7-Cl -C=C-(4-NH 2 )Ph 735 2-Me 7-Cl -C=C-(2-NMe 2 )Ph 736 2-Me 7-Cl -C=C-(3-NMe 2 )Ph 737 2-Me 7-Cl -C=C-(4-NMe 2 )Ph 139 WO 01/29037 PCT/USOO/28824 738 2-Me 7-Cl -C=C-3-Pyridyl 739 2-Me 7-Cl -C=C-4-Pyridyl 740 2-Me 7-Cl -C=C-2-furanyl 741 2-Me 7-Cl -C=C-3-furanyl 742 2-Me 7-Cl -C=C-2-thienyl 743 2-Me 7-Cl -C=C-3-thienyl 744 2-Me 7-Cl -C=C-2-oxazolyl 745 2-Me 7-Cl -C=C-2-thiazolyl 746 2-Me 7-Cl -C=C-4-isoxazolyl 747 2-Me 7-Cl -C=C-2-imidazolyl 748 2-Me 7-Cl

-CH

2

CH

2 -cycPr 749 2-Me 7-Cl -CH 2

CH

2

CH

2

CH

2 OH 750 2-Me 7-Cl

-CH

2

CH

2 -CH(OH)Me 751 2-Me 7-Cl

-CH

2

CH

2 -Ph 752 2-Me 7-Cl -CH 2

CH

2 -(2-Cl)Ph 753 2-Me 7-Cl -CH 2

CH

2 -(3-Cl)Ph 754 2-Me 7-Cl -CH 2

CH

2 -(4-Cl)Ph 755 2-Me 7-Cl -CH 2

CH

2 -(2-F)Ph 756 2-Me 7-Cl -CH 2

CH

2 -(3-F)Ph 757 2-Me 7-Cl -CH 2

CH

2 -(4-F)Ph 758 2-Me 7-Cl -CH 2

CH

2 -(2-OH)Ph 759 2-Me 7-Cl -CH 2

CH

2 -(3-OH)Ph 760 2-Me 7-Cl -CH 2

CH

2 -(4-OH)Ph 761 2-Me 7-Cl -CH 2

CH

2 -(2-OMe)Ph 762 2-Me 7-Cl -CH 2

CH

2 -(3-OMe)Ph 763 2-Me 7-Cl -CH 2

CH

2 -(4-OMe)Ph 764 2-Me 7-Cl

-CH

2

CH

2 -(2-CN)Ph 140 WO 01/29037 PCT/USOO/28824 765 2-Me 7-Cl -CH 2

CH

2 -(3-CN)Ph 766 2-Me 7-Cl -CH 2

CH

2 -(4-CN)Ph 767 2-Me 7-Cl -CH 2

CH

2 -(2-N0 2 )Ph 768 2-Me 7-Cl -CH 2

CH

2 -(3-N0 2 )Ph 769 2-Me 7-Cl

-CH

2

CH

2 -(4-NO 2 )Ph 770 2-Me 7-Cl

-CH

2

CH

2 -(2-NH 2 )Ph 771 2-Me 7-Cl -CH 2

CH

2 -(3-NH 2 )Ph 772 2-Me 7-Cl -CH 2

CH

2 -(4-NH 2 )Ph 773 2-Me 7-Cl -CH 2

CH

2 -(2-NMe 2 )Ph 774 2-Me 7-Cl -CH 2

CH

2 -(3-NMe 2 )Ph 775 2-Me 7-Cl -CH 2

CH

2 -(4-NMe 2 )Ph 776 2-Me 7-Cl -CH 2

CH

2 -2-Pyridyl 777 2-Me 7-Cl -CH 2

CH

2 -3-Pyridyl 778 2-Me 7-Cl -CH 2

CH

2 -4-Pyridyl 779 2-Me 7-Cl -CH 2

CH

2 -2-furanyl 780 2-Me 7-Cl -CH 2

CH

2 -3-furanyl 781 2-Me 7-Cl

-CH

2

CH

2 -4-furanyl 782 2-Me 7-Cl -CH 2

CH

2 -3-thienyl 783 2-Me 7-Cl -CH 2

CH

2 -2-oxazolyl 784 2-Me 7-Cl -CH 2

CH

2 -2-thiazolyl 785 2-Me 7-Cl -CH 2

CH

2 -4-isoxazolyl 786 2-Me 7-Cl -CH 2

CH

2 -2-imidazolyl 787 2-Me 7-Cl -C=C-cycPr 788 2-Me 7-Cl -C=C-Ph 789 2-Me 7-Cl -CEC-2-Pyridyl 790 2-Me 7-Cl -C=C-3-Pyridyl 141 WO 01/29037 PCT/USOO/28824 791 2-Me 7-Cl -C=C-4-Pyridyl 792 2-Me 7-Cl -CEC-2-furanyl 793 2-Me 7-Cl -C=C-3-furanyl 794 2-Me 7-Cl -CEC-2-thienyl 795 2-Me 7-Cl -C=C-3-thienyl 796 2-Me 7-Cl -C=C-cycPr 797 2-Me 7-Cl -C=C-Ph 798 2-Me 7-Cl -C=C-2-Pyridyl 799 2-Me 7-Cl -C=C-3-Pyridyl 800 2-Me 7-Cl -C=C-4-Pyridyl 801 2-Me 7-Cl -C=C-2-furanyl 802 2-Me 7-Cl -C=C-3-furanyl 803 2-Me 7-Cl -C=C-2-thienyl 804 2-Me 7-Cl -C=C-3-thienyl 805 2-Me 7-Cl

-CH

2

CH

2 -cycPr 806 2-Me 7-Cl -CH2CH2-Ph 807 2-Me 7-Cl

-CH

2

CH

2 -2-Pyridyl 808 2-Me 7-Cl -CH 2

CH

2 -3-Pyridyl 809 2-Me 7-Cl -CH 2

CH

2 -4-Pyridyl 810 2-Me 7-Cl -CH 2

CH

2 -2-furanyl 811 2-Me 7-Cl

-CH

2

CH

2 -3-furanyl 812 2-Me 7-Cl

-CH

2

CH

2 -2-thienyl 813 2-Me 7-Cl

-CH

2

CH

2 -3-thienyl 814 2-Me 7-Cl -C=C-cycPr 815 2-Me 7-Cl -C=C-Ph 816 2-Me 7-Cl -C=C-2-Pyridyl 817 2-Me 7-Cl -C=C-3-Pyridyl 142 WO 01/29037 PCT/USOO/28824 818 2-Me 7-Cl -C=C-4-Pyridyl 819 2-Me 7-Cl -C=C-2-furanyl 820 2-Me 7-Cl -CEC-3-furanyl 821 2-Me 7-Cl -C=C-2-thienyl 822 2-Me 7-Cl -C=C-3-thienyl 823 2-Me 7-Cl -C=C-cycPr 824 2-Me 7-Cl -C=C-Ph 825 2-Me 7-Cl -C=C-2-Pyridyl 826 2-Me 7-Cl -C=C-3-Pyridyl 827 2-Me 7-Cl -C=C-4-Pyridyl 828 2-Me 7-Cl -C=C-2-furanyl 829 2-Me 7-Cl -C=C-3-furanyl 830 2-Me 7-Cl -C=C-2-thienyl 831 2-Me 7-Cl -C=C-3-thienyl 832 2-Me 7-Cl -CH 2

CH

2 -cycPr 833 2-Me 7-Cl -CH 2

CH

2 -Ph 834 2-Me 7-Cl

-CH

2

CH

2 -2-Pyridyl 835 2-Me 7-Cl -CH 2

CH

2 -3-Pyridyl 836 2-Me 7-Cl

-CH

2

CH

2 -4-Pyridyl 837 2-Me 7-Cl -CH 2

CH

2 -2-furanyl 838 2-Me 7-Cl

-CH

2

CH

2 -3-furanyl 839 2-Me 7-Cl -CH 2

CH

2 -2-thienyl 840 2-Me 7-Cl -CH 2

CH

2 -3-thienyl 841 2-OH 7-Cl -OH 842 2-OH 7-Cl -0-methyl 843 2-OH 7-Cl -0-ethyl 844 2-OH 7-Cl -0-n-propyl 143 WO 01/29037 PCT/USOO/28824 845 2-OH 7-Cl -O-i-propyl 846 2-OH 7-Cl -0-butyl 847 2-OH 7-Cl -O-CH 2 -cyclopropyl 848 2-OH 7-Cl -O-CH 2 -(1-methylcyclopropyl) 849 2-OH 7-Cl -O-CH 2

CH

2 -cyclopropyl 850 2-OH 7-Cl -O-CH 2 -cyclobutyl 851 2-OH 7-Cl -O-CH 2

CH

2 -cyclobutyl 852 2-OH 7-Cl -O-benzyl 853 2-OH 7-Cl -0-2,2,2-trifluoroethyl 854 2-OH 7-Cl -0-trifluoromethyl 855 2-OH 7-Cl -0-3,3,3-trifluoropropyl 856 2-OH 7-Cl -0-allyl 857 2-OH 7-Cl -0-propargyl 858 2-OH 7-Cl -O-CH 2

CH

2

-N(CH

3

)

2 859 2-OH 7-Cl -O-CH 2

CH

2 -(N-morpholinyl) 860 2-OH 7-Cl -O-CH 2 -3-Pyridyl 861 2-OH 7-Cl -O-CH 2 -4-Pyridyl 862 2-OH 7-Cl -O-CH 2 -2-furanyl 863 2-OH 7-Cl -O-CH 2 -3-furanyl 864 2-OH 7-Cl -O-CH 2 -2-thienyl 865 2-OH 7-Cl

-O-CH

2 -3-thienyl 866 2-OH 7-Cl -O-CH 2 -2-oxazolyl 867 2-OH 7-Cl -O-CH 2 -2-thiazolyl 868 2-OH 7-Cl -O-CH 2 -4-isoxazolyl 869 2-OH 7-Cl -O-CH 2 -2-imidazolyl 870 2-OH 7-Cl ~NH-methyl 871 2-OH 7-Cl -NH -ethyl 872 2-OH 7-Cl -NH-n-propyl 144 WO 01/29037 PCT/USOO/28824 873 2-OH 7-Cl -NH-i-propyl 874 2-OH 7-Cl -NH-butyl 875 2-OH 7-Cl -NH-CH 2 -cyclopropyl 876 2-OH 7-Cl -NH-CH 2 -(l-methylcyclopropyl) 877 2-OH 7-Cl -NH-CH 2

CH

2 -cyclopropyl 878 2-OH 7-Cl -NH-CH 2 -cyclobutyl 879 2-OH 7-Cl -NH-CH 2

CH

2 -cyclobutyl 880 2-OH 7-Cl -NH-benzyl 881 2-OH 7-Cl -NH-2,2,2-trifluoroethyl 882 2-OH 7-Cl -NH-trifluoromethyl 883 2-OH 7-Cl -NH-3,3,3-trifluoropropyl 884 2-OH 7-Cl -NH-allyl 885 2-OH 7-Cl -NH-propargyl 886 2-OH 7-Cl -NH-CH 2

CH

2

-N(CH

3

)

2 887 2-OH 7-Cl -NH-CH 2

CH

2 -(N-morpholinyl) 888 2-OH 7-Cl -NH-CH 2 -3-Pyridyl 889 2-OH 7-Cl -NH-CH 2 -4-Pyridyl 890 2-OH 7-Cl -NH-CH 2 -2-furanyl 891 2-OH 7-Cl -NH-CH 2 -3-furanyl 892 2-OH 7-Cl -NH-CH 2 -2-thienyl 893 2-OH 7-Cl -NH-CH 2 -3-thienyl 894 2-OH 7-Cl

-NH-CH

2 -2-oxazolyl 895 2-OH 7-Cl -NH-CH 2 -2-thiazolyl 896 2-OH 7-Cl -NH-CH 2 -4-isoxazolyl 897 2-OH 7-Cl -NH-CH 2 -2-imidazolyl 898 2-OH 7-Cl -benzyl 899 2-OH 7-Cl -2,2,2-trifluoroethyl 900 2-OH 7-Cl -trifluoromethyl 145 WO 01/29037 PCT/USOO/28824 901 2-OH 7-Cl -methyl 902 2-OH 7-Cl -ethyl 903 2-OH 7-Cl -propyl 904 2-OH 7-Cl -i-propyl 905 2-OH 7-Cl -butyl 906 2-OH 7-Cl -i-butyl 907 2-OH 7-Cl -t-butyl 908 2-OH 7-Cl -pentyl 909 2-OH 7-Cl -CH 2

-CH

2 -cyclopropyl 910 2-OH 7-Cl -CH 2

-CH

2 -(1-methylcyclopropyl) 911 2-OH 7-Cl -CH2-CH 2

CH

2 -cyclopropyl 912 2-OH 7-Cl -CH2-CH 2 -cyclobutyl 913 2-OH 7-Cl -CH2-CH 2

CH

2 -cyclobutyl 914 2-OH 7-Cl -CH2-benzyl 915 2-OH 7-Cl -CH2-2,2,2-trifluoroethyl 916 2-OH 7-Cl -CH2-trifluoromethyl 917 2-OH 7-Cl -CH2-3,3,3-trifluoropropyl 918 2-OH 7-Cl -CH2-allyl 919 2-OH 7-Cl -CH2-propargyl 920 2-OH 7-Cl -CH2-CH 2

CH

2

-N(CH

3

)

2 921 2-OH 7-Cl -CH2-CH 2

CH

2 -(N-morpholinyl) 922 2-OH 7-Cl -CH2-CH 2 -3-Pyridyl 923 2-OH 7-Cl -CH2-CH 2 -4-Pyridyl 924 2-OH 7-Cl -CH2-CH 2 -2-furanyl 925 2-OH 7-Cl -CH2-CH 2 -3-furanyl 926 2-OH 7-Cl -CH2-CH 2 -2-thienyl 927 2-OH 7-Cl -CH2-CH 2 -3-thienyl 928 2-OH 7-Cl -CH2-CH 2 -2-oxazolyl 146 WO 01/29037 PCT/USOO/28824 929 2-OH 7-Cl -CH2-CH 2 -2-thiazolyl 930 2-OH 7-Cl -CH2-CH 2 -4-isoxazolyl 931 2-OH 7-Cl -CH2-CH 2 -2-imidazolyl 932 2-OH 7-Cl -C=C-(2-OH)Ph 933 2-OH 7-Cl -C=C-(3-OH)Ph 934 2-OH 7-Cl -C=C-(4-OH)Ph 935 2-OH 7-Cl -C=C-(2-OMe)Ph 936 2-OH 7-Cl -C=C-(3-OMe)Ph 937 2-OH 7-Cl -C=C-(4-OMe)Ph 938 2-OH 7-Cl -C=C-(2-CN)Ph 939 2-OH 7-Cl -C=C-(3-CN)Ph 940 2-OH 7-Cl -C=C-(4-CN)Ph 941 2-OH 7-Cl -C=C-(2-NO 2 )Ph 942 2-OH 7-Cl -C=C-(3-NO 2 )Ph 943 2-OH 7-Cl -C=C-(4-NO 2 )Ph 944 2-OH 7-Cl -C=C-(2-NH 2 )Ph 945 2-OH 7-Cl -C=C-(3-NH 2 )Ph 946 2-OH 7-Cl -C=C-(4-NH 2 )Ph 947 2-OH 7-Cl -C=C-(2-NMe 2 )Ph 948 2-OH 7-Cl -C=C-(3-NMe 2 )Ph 949 2-OH 7-Cl -C=C-(4-NMe 2 )Ph 950 2-OH 7-Cl -C=C-3-Pyridyl 951 2-OH 7-Cl -C=C-4-Pyridyl 952 2-OH 7-Cl -C=C-2-furanyl 953 2-OH 7-Cl -C=C-3-furanyl 954 2-OH 7-Cl -C=C-2-thienyl 955 2-OH 7-Cl -C=C-3-thienyl 956 2-OH 7-Cl -C=C-2-oxazolyl 147 WO 01/29037 PCT/USOO/28824 957 2-OH 7-Cl -C=C-2-thiazolyl 958 2-OH 7-Cl -C=C-4-isoxazolyl 959 2-OH 7-Cl -C=C-2-imidazolyl 960 2-OH 7-Cl -CH 2

CH

2 -cycPr 961 2-OH 7-Cl -CH 2

CH

2

CH

2

CH

2 OH 962 2-OH 7-Cl -CH 2

CH

2 -CH(OH)Me 963 2-OH 7-Cl

-CH

2

CH

2 -Ph 964 2-OH 7-Cl -CH 2

CH

2 -(2-Cl)Ph 965 2-OH 7-Cl -CH 2

CH

2 -(3-Cl)Ph 966 2-OH 7-Cl -CH 2

CH

2 -(4-Cl)Ph 967 2-OH 7-Cl -CH 2

CH

2 -(2-F)Ph 968 2-OH 7-Cl -CH 2

CH

2 -(3-F)Ph 969 2-OH 7-Cl -CH 2

CH

2 -(4-F)Ph 970 2-OH 7-Cl

-CH

2

CH

2 -(2-OH)Ph 971 2-OH 7-Cl

-CH

2

CH

2 -(3-OH)Ph 972 2-OH 7-Cl -CH 2

CH

2 -(4-OH)Ph 973 2-OH 7-Cl -CH 2

CH

2 -(2-OMe)Ph 974 2-OH 7-Cl

-CH

2

CH

2 -(3-OMe)Ph 975 2-OH 7-Cl -CH 2

CH

2 -(4-OMe)Ph 976 2-OH 7-Cl -CH 2

CH

2 -(2-CN)Ph 977 2-OH 7-Cl

-CH

2

CH

2 -(3-CN)Ph 978 2-OH 7-Cl -CH 2

CH

2 -(4-CN)Ph 979 2-OH 7-Cl -CH 2

CH

2 -(2-N0 2 )Ph 980 2-OH 7-Cl -CH 2

CH

2 -(3-NO 2 )Ph 981 2-OH 7-Cl -CH 2

CH

2 -(4-N0 2 )Ph 982 2-OH 7-Cl -CH 2

CH

2 -(2-NH 2 )Ph 983 2-OH 7-Cl -CH 2

CH

2 -(3-NH 2 )Ph 148 WO 01/29037 PCT/USOO/28824 984 2-OH 7-Cl -CH 2

CH

2 -(4-NH 2 )Ph 985 2-OH 7-Cl -CH 2

CH

2 -(2-NMe 2 )Ph 986 2-OH 7-Cl -CH 2

CH

2 -(3-NMe 2 )Ph 987 2-OH 7-Cl -CH 2

CH

2 -(4-NMe 2 )Ph 988 2-OH 7-Cl -CH 2

CH

2 -2-Pyridyl 989 2-OH 7-Cl -CH 2

CH

2 -3-Pyridyl 990 2-OH 7-Cl -CH 2

CH

2 -4-Pyridyl 991 2-OH 7-Cl -CH 2

CH

2 -2-furanyl 992 2-OH 7-Cl

-CH

2

CH

2 -3-furanyl 993 2-OH 7-Cl -CH 2

CH

2 -4-furanyl 994 2-OH 7-Cl

-CH

2

CH

2 -3-thienyl 995 2-OH 7-Cl -CH 2

CH

2 -2-oxazolyl 996 2-OH 7-Cl -CH 2

CH

2 -2-thiazolyl 997 2-OH 7-Cl -CH 2

CH

2 -4-isoxazolyl 998 2-OH 7-Cl -CH 2

CH

2 -2-imidazolyl 999 2-OH 7-Cl -CEC-cycPr 1000 2-OH 7-Cl -C=C-Ph 1001 2-OH 7-Cl -C=C-2-Pyridyl 1002 2-OH 7-Cl -C=C-3-Pyridyl 1003 2-OH 7-Cl -C=C-4-Pyridyl 1004 2-OH 7-Cl -C=C-2-furanyl 1005 2-OH 7-Cl -C=C-3-furanyl 1006 2-OH 7-Cl -C=C-2-thienyl 1007 2-OH 7-Cl -C=C-3-thienyl 1008 2-OH 7-Cl -C=C-cycPr 1009 2-OH 7-Cl -C=C-Ph 149 WO 01/29037 PCT/USOO/28824 1010 2-OH 7-Cl -C=C-2-Pyridyl 1011 2-OH 7-Cl -C=C-3-Pyridyl 1012 2-OH 7-Cl -C=C-4-Pyridyl 1013 2-OH 7-Cl -C=C-2-furanyl 1014 2-OH 7-Cl -C=C-3-furanyl 1015 2-OH 7-Cl -C=C-2-thienyl 1016 2-OH 7-Cl -C=C-3-thienyl 1017 2-OH 7-Cl -CH 2

CH

2 -cycPr 1018 2-OH 7-Cl -CH 2

CH

2 -Ph 1019 2-OH 7-Cl -CH 2

CH

2 -2-Pyridyl 1020 2-OH 7-Cl -CH 2

CH

2 -3-Pyridyl 1021 2-OH 7-Cl -CH 2

CH

2 -4-Pyridyl 1022 2-OH 7-Cl -CH 2

CH

2 -2-furanyl 1023 2-OH 7-Cl -CH 2

CH

2 -3-furanyl 1024 2-OH 7-Cl -CH 2

CH

2 -2-thienyl 1025 2-OH 7-Cl -CH 2

CH

2 -3-thienyl 1026 2-OH 7-Cl -C=C-cycPr 1027 2-OH 7-Cl -C=C-Ph 1028 2-OH 7-Cl -C=C-2-Pyridyl 1029 2-OH 7-Cl -C=C-3-Pyridyl 1030 2-OH 7-Cl -C=C-4-Pyridyl 1031 2-OH 7-Cl -C=C-2-furanyl 1032 2-OH 7-Cl -C=C-3-furanyl 1033 2-OH 7-Cl -C=C-2-thienyl 1034 2-OH 7-Cl -C=C-3-thienyl 1035 2-OH 7-Cl -C=C-cycPr 1036 2-OH 7-Cl -C=C-Ph 150 WO 01/29037 PCT/USOO/28824 1037 2-OH 7-Cl -C=C-2-Pyridyl 1038 2-OH 7-Cl -C=C-3-Pyridyl 1039 2-OH 7-Cl -C=C-4-Pyridyl 1040 2-OH 7-Cl -C=C-2-furanyl 1041 2-OH 7-Cl -C=C-3-furanyl 1042 2-OH 7-Cl -C=C-2-thienyl 1043 2-OH 7-Cl -C=C-3-thienyl 1044 2-OH 7-Cl -CH 2

CH

2 -cycPr 1045 2-OH 7-Cl

-CH

2

CH

2 -Ph 1046 2-OH 7-Cl -CH 2

CH

2 -2-Pyridyl 1047 2-OH 7-Cl -CH 2

CH

2 -3-Pyridyl 1048 2-OH 7-Cl -CH 2

CH

2 -4-Pyridyl 1049 2-OH 7-Cl -CH 2

CH

2 -2-furanyl 1050 2-OH 7-Cl -CH 2

CH

2 -3-furanyl 1051 2-OH 7-Cl -CH 2

CH

2 -2-thienyl 1052 2-OH 7-Cl -CH 2

CH

2 -3-thienyl 1053 H 7-F -OH 1054 H 7-F -0-methyl 1055 H 7-F -0-ethyl 1056 H 7-F -O-n-propyl 1057 H 7-F -0-i-propyl 1058 H 7-F -0-butyl 1059 H 7-F -O-CH 2 -cyclopropyl 1060 H 7-F -O-CH 2 -(1-methylcyclopropyl) 1061 H 7-F -O-CH 2

CH

2 -cyclopropyl 1062 H 7-F -O-CH 2 -cyclobutyl 1063 H 7-F -O-CH 2

CH

2 -cyclobutyl 1064 H 7-F -0-benzyl 151 WO 01/29037 PCT/USOO/28824 1065 H 7-F -0-2,2,2-trifluoroethyl 1066 H 7-F -0-trifluoromethyl 1067 H 7-F -0-3,3,3-trifluoropropyl 1068 H 7-F -0-allyl 1069 H 7-F -0-propargyl 1070 H 7-F -O-CH 2

CH

2

-N(CH

3

)

2 1071 H 7-F -O-CH 2

CH

2 -(N-morpholinyl) 1072 H 7-F -O-CH 2 -3-Pyridyl 1073 H 7-F -O-CH 2 -4-Pyridyl 1074 H 7-F -O-CH 2 -2-furanyl 1075 H 7-F -O-CH 2 -3-furanyl 1076 H 7-F -O-CH 2 -2-thienyl 1077 H 7-F -O-CH 2 -3-thienyl 1078 H 7-F -O-CH 2 -2-oxazolyl 1079 H 7-F -O-CH 2 -2-thiazolyl 1080 H 7-F -O-CH 2 -4-isoxazolyl 1081 H 7-F -O-CH 2 -2-imidazolyl 1082 H 7-F -NH-methyl 1083 H 7-F -NH -ethyl 1084 H 7-F -NH-n-propyl 1085 H 7-F -NH-i-propyl 1086 H 7-F -NH-butyl 1087 H 7-F -NH-CH 2 -cyclopropyl 1088 H 7-F -NH-CH 2 -(1-methylcyclopropyl) 1089 H 7-F -NH-CH 2

CH

2 -cyclopropyl 1090 H 7-F -NH-CH 2 -cyclobutyl 1091 H 7-F -NH-CH 2

CH

2 -cyclobutyl 1092 H 7-F -NH-benzyl 152 WO 01/29037 PCT/USOO/28824 1093 H 7-F -NH-2,2,2-trifluoroethyl 1094 H 7-F -NH-trifluoromethyl 1095 H 7-F -NH-3,3,3-trifluoropropyl 1096 H 7-F -NH-allyl 1097 H 7-F -NH-propargyl 1098 H 7-F

-NH-CH

2

CH

2

-N(CH

3

)

2 1099 H 7-F -NH-CH 2

CH

2 -(N-morpholinyl) 1100 H 7-F -NH-CH 2 -3-Pyridyl 1101 H 7-F -NH-CH 2 -4-Pyridyl 1102 H 7-F -NH-CH 2 -2-furanyl 1103 H 7-F -NH-CH 2 -3-furanyl 1104 H 7-F -NH-CH 2 -2-thienyl 1105 H 7-F -NH-CH 2 -3-thienyl 1106 H 7-F -NH-CH 2 -2-oxazolyl 1107 H 7-F -NH-CH 2 -2-thiazolyl 1108 H 7-F -NH-CH 2 -4-isoxazolyl 1109 H 7-F -NH-CH 2 -2-imidazolyl 1110 H 7-F -benzyl 1111 H 7-F -2,2,2-trifluoroethyl 1112 H 7-F -trifluoromethyl 1113 H 7-F -methyl 1114 H 7-F -ethyl 1115 H 7-F -propyl 1116 H 7-F -i-propyl 1117 H 7-F -butyl 1118 H 7-F -i-butyl 1119 H 7-F -t-butyl 1120 H 7-F -pentyl 153 WO 01/29037 PCT/USOO/28824 1121 H 7-F -CH 2

-CH

2 -cyclopropyl 1122 H 7-F -CH 2

-CH

2 -(1-methylcyclopropyl) 1123 H 7-F -CH2-CH 2

CH

2 -cyclopropyl 1124 H 7-F -CH2-CH 2 -cyclobutyl 1125 H 7-F -CH2-CH 2

CH

2 -cyclobutyl 1126 H 7-F -CH2-benzyl 1127 H 7-F -CH2-2,2,2-trifluoroethyl 1128 H 7-F -CH2-trifluoromethyl 1129 H 7-F -CH2-3,3,3-trifluoropropyl 1130 H 7-F -CH2-allyl 1131 H 7-F -CH2-propargyl 1132 H 7-F -CH2-CH 2

CH

2

-N(CH

3

)

2 1133 H 7-F -CH2-CH 2

CH

2 -(N-morpholinyl) 1134 H 7-F -CH2-CH 2 -3-Pyridyl 1135 H 7-F -CH2-CH 2 -4-Pyridyl 1136 H 7-F -CH2-CH 2 -2-furanyl 1137 H 7-F -CH2-CH 2 -3-furanyl 1138 H 7-F -CH2-CH 2 -2-thienyl 1139 H 7-F -CH2-CH 2 -3-thienyl 1140 H 7-F -CH2-CH 2 -2-oxazolyl 1141 H 7-F -CH2-CH 2 -2-thiazolyl 1142 H 7-F -CH2-CH 2 -4-isoxazolyl 1143 H 7-F -CH2-CH 2 -2-imidazolyl 1144 H 7-F -C=C-(2-OH)Ph 1145 H 7-F -C=C-(3-OH)Ph 1146 H 7-F -C=C-(4-OH)Ph 1147 H 7-F -C=C-(2-OMe)Ph 1148 H 7-F -C=C-(3-OMe)Ph 154 WO 01/29037 PCT/USOO/28824 1149 H 7-F -C=C-(4-OMe)Ph 1150 H 7-F -C=C-(2-CN)Ph 1151 H 7-F -C=C-(3-CN)Ph 1152 H 7-F -C=C-(4-CN)Ph 1153 H 7-F -C=C-(2-NO 2 )Ph 1154 H 7-F -C=C-(3-NO 2 )Ph 1155 H 7-F -C=C-(4-NO 2 )Ph 1156 H 7-F -C=C-(2-NH 2 )Ph 1157 H 7-F -C=C-(3-NH 2 )Ph 1158 H 7-F -C=C-(4-NH 2 )Ph 1159 H 7-F -C=C-(2-NMe 2 )Ph 1160 H 7-F -C=C-(3-NMe 2 )Ph 1161 H 7-F -C=C-(4-NMe 2 )Ph 1162 H 7-F -C=C-3-Pyridyl 1163 H 7-F -C=C-4-Pyridyl 1164 H 7-F -C=C-2-furanyl 1165 H 7-F -C=C-3-furanyl 1166 H 7-F -C=C-2-thienyl 1167 H 7-F -C=C-3-thienyl 1168 H 7-F -C=C-2-oxazolyl 1169 H 7-F -C=C-2-thiazolyl 1170 H 7-F -C=C-4-isoxazolyl 1171 H 7-F -C=C-2-imidazolyl 1172 H 7-F -CH 2

CH

2 -cycPr 1173 H 7-F -CH 2

CH

2

CH

2

CH

2 OH 1174 H 7-F -CH 2

CH

2 -CH(OH)Me 1175 H 7-F

-CH

2

CH

2 -Ph 1176 H 7-F -CH 2

CH

2 -(2-Cl)Ph 155 WO 01/29037 PCT/USOO/28824 1177 H 7-F -CH 2

CH

2 -(3-Cl)Ph 1178 H 7-F -CH 2

CH

2 -(4-Cl)Ph 1179 H 7-F -CH 2

CH

2 -(2-F)Ph 1180 H 7-F -CH 2

CH

2 -(3-F)Ph 1181 H 7-F -CH 2

CH

2 -(4-F)Ph 1182 H 7-F -CH 2

CH

2 -(2-OH)Ph 1183 H 7-F -CH 2

CH

2 -(3-OH)Ph 1184 H 7-F -CH 2

CH

2 -(4-OH)Ph 1185 H 7-F -CH 2

CH

2 -(2-OMe)Ph 1186 H 7-F -CH 2

CH

2 -(3-OMe)Ph 1187 H 7-F -CH 2

CH

2 -(4-OMe)Ph 1188 H 7-F -CH 2

CH

2 -(2-CN)Ph 1189 H 7-F -CH 2

CH

2 -(3-CN)Ph 1190 H 7-F -CH 2

CH

2 -(4-CN)Ph 1191 H 7-F

-CH

2

CH

2 -(2-NO 2 )Ph 1192 H 7-F

-CH

2

CH

2 -(3-NO 2 )Ph 1193 H 7-F -CH 2

CH

2 -(4-NO 2 )Ph 1194 H 7-F -CH 2

CH

2 -(2-NH 2 )Ph 1195 H 7-F -CH 2

CH

2 -(3-NH 2 )Ph 1196 H 7-F -CH 2

CH

2 -(4-NH 2 )Ph 1197 H 7-F -CH 2

CH

2 -(2-NMe 2 )Ph 1198 H 7-F -CH 2

CH

2 -(3-NMe 2 )Ph 1199 H 7-F -CH 2

CH

2 -(4-NMe 2 )Ph 1200 H 7-F -CH 2

CH

2 -2-Pyridyl 1201 H 7-F -CH 2

CH

2 -3-Pyridyl 1202 H 7-F -CH 2

CH

2 -4-Pyridyl 1203 H 7-F

-CH

2

CH

2 -2-furanyl 156 WO 01/29037 PCT/USOO/28824 1204 H 7-F -CH 2

CH

2 -3-furanyl 1205 H 7-F -CH 2

CH

2 -4-furanyl 1206 H 7-F -CH 2

CH

2 -3-thienyl 1207 H 7-F -CH 2

CH

2 -2-oxazolyl 1208 H 7-F -CH 2

CH

2 -2-thiazolyl 1209 H 7-F -CH 2

CH

2 -4-isoxazolyl 1210 H 7-F -CH 2

CH

2 -2-imidazolyl 1211 H 7-F -C=C-cycPr 1212 H 7-F -C=C-Ph 1213 H 7-F -CEC-2-Pyridyl 1214 H 7-F -C=C-3-Pyridyl 1215 H 7-F -C=C-4-Pyridyl 1216 H 7-F -C=C-2-furanyl 1217 H 7-F -C=C-3-furanyl 1218 H 7-F -C=C-2-thienyl 1219 H 7-F -C=C-3-thienyl 1220 H 7-F -C=C-cycPr 1221 H 7-F -C=C-Ph 1222 H 7-F -C=C-2-Pyridyl 1223 H 7-F -C=C-3-Pyridyl 1224 H 7-F -C=C-4-Pyridyl 1225 H 7-F -C=C-2-furanyl 1226 H 7-F -C=C-3-furanyl 1227 H 7-F -C=C-2-thienyl 1228 H 7-F -C=C-3-thienyl 1229 H 7-F

-CH

2

CH

2 -cycPr 1230 H 7-F

-CH

2

CH

2 -Ph 157 WO 01/29037 PCT/USOO/28824 1231 H 7-F -CH 2

CH

2 -2-Pyridyl 1232 H 7-F -CH 2

CH

2 -3-Pyridyl 1233 H 7-F -CH 2

CH

2 -4-Pyridyl 1234 H 7-F

-CH

2

CH

2 -2-furanyl 1235 H 7-F -CH 2

CH

2 -3-furanyl 1236 H 7-F -CH 2

CH

2 -2-thienyl 1237 H 7-F -CH 2

CH

2 -3-thienyl 1238 H 7-F -C=C-cycPr 1239 H 7-F -C=C-Ph 1240 H 7-F -C=C-2-Pyridyl 1241 H 7-F -C=C-3-Pyridyl 1242 H 7-F -C=C-4-Pyridyl 1243 H 7-F -C=C-2-furanyl 1244 H 7-F -C=C-3-furanyl 1245 H 7-F -C=C-2-thienyl 1246 H 7-F -C=C-3-thienyl 1247 H 7-F -C=C-cycPr 1248 H 7-F -C=C-Ph 1249 H 7-F -C=C-2-Pyridyl 1250 H 7-F -C=C-3-Pyridyl 1251 H 7-F -C=C-4-Pyridyl 1252 H 7-F -C=C-2-furanyl 1253 H 7-F -C=C-3-furanyl 1254 H 7-F -C=C-2-thienyl 1255 H 7-F -C=C-3-thienyl 1256 H 7-F -CH 2

CH

2 -cycPr 1257 H 7-F -CH 2

CH

2 -Ph 158 WO 01/29037 PCT/USOO/28824 1258 H 7-F -CH 2

CH

2 -2-Pyridyl 1259 H 7-F -CH 2

CH

2 -3-Pyridyl 1260 H 7-F -CH 2

CH

2 -4-Pyridyl 1261 H 7-F -CH 2

CH

2 -2-furanyl 1262 H 7-F -CH 2

CH

2 -3-furanyl 1263 H 7-F

-CH

2

CH

2 -2-thienyl 1264 H 7-F -CH 2

CH

2 -3-thienyl 1265 3-Cl 7-F -OH 1266 3-Cl 7-F -0-methyl 1267 3-Cl 7-F -0-ethyl 1268 3-Cl 7-F -0-n-propyl 1269 3-Cl 7-F -0-i-propyl 1270 3-Cl 7-F -0-butyl 1271 3-Cl 7-F -0-CH 2 -cyclopropyl 1272 3-Cl 7-F -0-CH 2 -(l-methylcyclopropyl) 1273 3-Cl 7-F -0-CH 2

CH

2 -cyclopropyl 1274 3-Cl 7-F -0-CH 2 -cyclobutyl 1275 3-Cl 7-F -0-CH 2

CH

2 -cyclobutyl 1276 3-Cl 7-F -0-benzyl 1277 3-Cl 7-F -0-2,2,2-trifluoroethyl 1278 3-Cl 7-F -0-trifluoromethyl 1279 3-Cl 7-F -0-3,3,3-trifluoropropyl 1280 3-Cl 7-F -0-allyl 1281 3-Cl 7-F -0-propargyl 1282 3-Cl 7-F -0-CH 2

CH

2

-N(CH

3

)

2 1283 3-Cl 7-F -0-CH 2

CH

2 -(N-morpholinyl) 1284 3-Cl 7-F -0-CH 2 -3-Pyridyl 1285 3-Cl 7-F -0-CH 2 -4-Pyridyl 159 WO 01/29037 PCT/USOO/28824 1286 3-Cl 7-F -O-CH 2 -2-furanyl 1287 3-Cl 7-F -O-CH 2 -3-furanyl 1288 3-Cl 7-F -O-CH 2 -2-thienyl 1289 3-Cl 7-F -O-CH 2 -3-thienyl 1290 3-Cl 7-F -O-CH 2 -2-oxazolyl 1291 3-Cl 7-F -O-CH 2 -2-thiazolyl 1292 3-Cl 7-F -O-CH 2 -4-isoxazolyl 1293 3-Cl 7-F -O-CH 2 -2-imidazolyl 1294 3-Cl 7-F -NH-methyl 1295 3-Cl 7-F -NH -ethyl 1296 3-Cl 7-F -NH-n-propyl 1297 3-Cl 7-F -NH-i-propyl 1298 3-Cl 7-F -NH-butyl 1299 3-Cl 7-F -NH-CH 2 -cyclopropyl 1300 3-Cl 7-F -NH-CH 2 -(1-methylcyclopropyl) 1301 3-Cl 7-F -NH-CH 2

CH

2 -cyclopropyl 1302 3-Cl 7-F -NH-CH 2 -cyclobutyl 1303 3-Cl 7-F -NH-CH 2

CH

2 -cyclobutyl 1304 3-Cl 7-F -NH-benzyl 1305 3-Cl 7-F -NH-2,2,2-trifluoroethyl 1306 3-Cl 7-F -NH-trifluoromethyl 1307 3-Cl 7-F -NH-3,3,3-trifluoropropyl 1308 3-Cl 7-F -NH-allyl 1309 3-Cl 7-F -NH-propargyl 1310 3-Cl 7-F -NH-CH 2

CH

2

-N(CH

3

)

2 1311 3-Cl 7-F -NH-CH 2

CH

2 -(N-morpholinyl) 1312 3-Cl 7-F -NH-CH 2 -3-Pyridyl 1313 3-Cl 7-F

-NH-CH

2 -4-Pyridyl 160 WO 01/29037 PCT/USOO/28824 1314 3-Cl 7-F -NH-CH 2 -2-furanyl 1315 3-Cl 7-F -NH-CH 2 -3-furanyl 1316 3-Cl 7-F -NH-CH 2 -2-thienyl 1317 3-Cl 7-F -NH-CH 2 -3-thienyl 1318 3-Cl 7-F -NH-CH 2 -2-oxazolyl 1319 3-Cl 7-F -NH-CH 2 -2-thiazolyl 1320 3-Cl 7-F -NH-CH 2 -4-isoxazolyl 1321 3-Cl 7-F -NH-CH 2 -2-imidazolyl 1322 3-Cl 7-F -benzyl 1323 3-Cl 7-F -2,2,2-trifluoroethyl 1324 3-Cl 7-F -trifluoromethyl 1325 3-Cl 7-F -methyl 1326 3-Cl 7-F -ethyl 1327 3-Cl 7-F -propyl 1328 3-Cl 7-F -i-propyl 1329 3-Cl 7-F -butyl 1330 3-Cl 7-F -i-butyl 1331 3-Cl 7-F -t-butyl 1332 3-Cl 7-F -pentyl 1333 3-Cl 7-F -CH 2

-CH

2 -cyclopropyl 1334 3-Cl 7-F -CH 2

-CH

2 -(1-methylcyclopropyl) 1335 3-Cl 7-F -CH2-CH 2

CH

2 -cyclopropyl 1336 3-Cl 7-F -CH2-CH 2 -cyclobutyl 1337 3-Cl 7-F -CH2-CH 2

CH

2 -cyclobutyl 1338 3-Cl 7-F -CH2-benzyl 1339 3-Cl 7-F -CH2-2,2,2-trifluoroethyl 1340 3-Cl 7-F -CH2-trifluoromethyl 1341 3-Cl 7-F -CH2-3,3,3-trifluoropropyl 161 WO 01/29037 PCT/USOO/28824 1342 3-Cl 7-F -CH2-allyl 1343 3-Cl 7-F -CH2-propargyl 1344 3-Cl 7-F -CH2-CH 2

CH

2

-N(CH

3

)

2 1345 3-Cl 7-F -CH2-CH 2

CH

2 -(N-morpholinyl) 1346 3-Cl 7-F -CH2-CH 2 -3-Pyridyl 1347 3-Cl 7-F -CH2-CH 2 -4-Pyridyl 1348 3-Cl 7-F -CH2-CH 2 -2-furanyl 1349 3-Cl 7-F -CH2-CH 2 -3-furanyl 1350 3-Cl 7-F -CH2-CH 2 -2-thienyl 1351 3-Cl 7-F -CH2-CH 2 -3-thienyl 1352 3-Cl 7-F -CH2-CH 2 -2-oxazolyl 1353 3-Cl 7-F -CH2-CH 2 -2-thiazolyl 1354 3-Cl 7-F -CH2-CH 2 -4-isoxazolyl 1355 3-Cl 7-F -CH2-CH 2 -2-imidazolyl 1356 3-Cl 7-F -C=C-(2-OH)Ph 1357 3-Cl 7-F -C=C-(3-OH)Ph 1358 3-Cl 7-F -C=C-(4-OH)Ph 1359 3-Cl 7-F -C=C-(2-OMe)Ph 1360 3-Cl 7-F -C=C-(3-OMe)Ph 1361 3-Cl 7-F -C=C-(4-OMe)Ph 1362 3-Cl 7-F -C=C-(2-CN)Ph 1363 3-Cl 7-F -C=C-(3-CN)Ph 1364 3-Cl 7-F -C=C-(4-CN)Ph 1365 3-Cl 7-F -C=C-(2-NO 2 )Ph 1366 3-Cl 7-F -C=C-(3-NO 2 )Ph 1367 3-Cl 7-F -C=C-(4-NO 2 )Ph 1368 3-Cl 7-F -C=C-(2-NH 2 )Ph 162 WO 01/29037 PCT/USOO/28824 1369 3-Cl 7-F -C=C-(3-NH 2 )Ph 1370 3-Cl 7-F -C=C-(4-NH 2 )Ph 1371 3-Cl 7-F -C=C-(2-NMe 2 )Ph 1372 3-Cl 7-F -C=C-(3-NMe 2 )Ph 1373 3-Cl 7-F -C=C-(4-NMe 2 )Ph 1374 3-Cl 7-F -C=C-3-Pyridyl 1375 3-Cl 7-F -C=C-4-Pyridyl 1376 3-Cl 7-F -C=C-2-furanyl 1377 3-Cl 7-F -C=C-3-furanyl 1378 3-Cl 7-F -C=C-2-thienyl 1379 3-Cl 7-F -C=C-3-thienyl 1380 3-Cl 7-F -C=C-2-oxazolyl 1381 3-Cl 7-F -C=C-2-thiazolyl 1382 3-Cl 7-F -C=C-4-isoxazolyl 1383 3-Cl 7-F -C=C-2-imidazolyl 1384 3-Cl 7-F -CH 2

CH

2 -cycPr 1385 3-Cl 7-F -CH 2

CH

2

CH

2

CH

2 OH 1386 3-Cl 7-F -CH 2

CH

2 -CH(OH)Me 1387 3-Cl 7-F -CH 2

CH

2 -Ph 1388 3-Cl 7-F -CH 2

CH

2 -(2-Cl)Ph 1389 3-Cl 7-F -CH 2

CH

2 -(3-Cl)Ph 1390 3-Cl 7-F -CH 2

CH

2 -(4-Cl)Ph 1391 3-Cl 7-F -CH 2

CH

2 -(2-F)Ph 1392 3-Cl 7-F -CH 2

CH

2 -(3-F)Ph 1393 3-Cl 7-F -CH 2

CH

2 -(4-F)Ph 1394 3-Cl 7-F -CH 2

CH

2 -(2-OH)Ph 1395 3-Cl 7-F -CH 2

CH

2 -(3-OH)Ph 163 WO 01/29037 PCT/USOO/28824 1396 3-Cl 7-F -CH 2

CH

2 -(4-OH)Ph 1397 3-Cl 7-F -CH 2

CH

2 -(2-OMe)Ph 1398 3-Cl 7-F -CH 2

CH

2 -(3-OMe)Ph 1399 3-Cl 7-F -CH 2

CH

2 -(4-OMe)Ph 1400 3-Cl 7-F -CH 2

CH

2 -(2-CN)Ph 1401 3-Cl 7-F -CH 2

CH

2 -(3-CN)Ph 1402 3-Cl 7-F -CH 2

CH

2 -(4-CN)Ph 1403 3-Cl 7-F -CH 2

CH

2 -(2-NO 2 )Ph 1404 3-Cl 7-F

-CH

2

CH

2 -(3-NO 2 )Ph 1405 3-Cl 7-F -CH 2

CH

2 -(4-NO 2 )Ph 1406 3-Cl 7-F -CH 2

CH

2 -(2-NH 2 )Ph 1407 3-Cl 7-F -CH 2

CH

2 -(3-NH 2 )Ph 1408 3-Cl 7-F -CH 2

CH

2 -(4-NH 2 )Ph 1409 3-Cl 7-F -CH 2

CH

2 -(2-NMe 2 )Ph 1410 3-Cl 7-F -CH 2

CH

2 -(3-NMe 2 )Ph 1411 3-Cl 7-F -CH 2

CH

2 -(4-NMe 2 )Ph 1412 3-Cl 7-F -CH 2

CH

2 -2-Pyridyl 1413 3-Cl 7-F -CH 2

CH

2 -3-Pyridyl 1414 3-Cl 7-F -CH 2

CH

2 -4-Pyridyl 1415 3-Cl 7-F -CH 2

CH

2 -2-furanyl 1416 3-Cl 7-F -CH 2

CH

2 -3-furanyl 1417 3-Cl 7-F -CH 2

CH

2 -4-furanyl 1418 3-Cl 7-F -CH 2

CH

2 -3-thienyl 1419 3-Cl 7-F -CH 2

CH

2 -2-oxazolyl 1420 3-Cl 7-F -CH 2

CH

2 -2-thiazolyl 1421 3-Cl 7-F -CH 2

CH

2 -4-isoxazolyl 1422 3-Cl 7-F -CH 2

CH

2 -2-imidazolyl 164 WO 01/29037 PCT/USOO/28824 1423 3-Cl 7-F -C=C-cycPr 1424 3-Cl 7-F -C=C-Ph 1425 3-Cl 7-F -CEC-2-Pyridyl 1426 3-Cl 7-F -C=C-3-Pyridyl 1427 3-Cl 7-F -C=C-4-Pyridyl 1428 3-Cl 7-F -C=C-2-furanyl 1429 3-Cl 7-F -CEC-3-furanyl 1430 3-Cl 7-F -C=C-2-thienyl 1431 3-Cl 7-F -C=C-3-thienyl 1432 3-Cl 7-F -C=C-cycPr 1433 3-Cl 7-F -C=C-Ph 1434 3-Cl 7-F -C=C-2-Pyridyl 1435 3-Cl 7-F -C=C-3-Pyridyl 1436 3-Cl 7-F -C=C-4-Pyridyl 1437 3-Cl 7-F -C=C-2-furanyl 1438 3-Cl 7-F -C=C-3-furanyl 1439 3-Cl 7-F -C=C-2-thienyl 1440 3-Cl 7-F -C=C-3-thienyl 1441 3-Cl 7-F

-CH

2

CH

2 -cycPr 1442 3-Cl 7-F -CH 2

CH

2 -Ph 1443 3-Cl 7-F -CH 2

CH

2 -2-Pyridyl 1444 3-Cl 7-F -CH 2

CH

2 -3-Pyridyl 1445 3-Cl 7-F -CH 2

CH

2 -4-Pyridyl 1446 3-Cl 7-F -CH 2

CH

2 -2-furanyl 1447 3-Cl 7-F -CH 2

CH

2 -3-furanyl 1448 3-Cl 7-F -CH 2

CH

2 -2-thienyl 1449 3-Cl 7-F

-CH

2

CH

2 -3-thienyl 165 WO 01/29037 PCT/USOO/28824 1450 3-Cl 7-F -C=C-cycPr 1451 3-Cl 7-F -C=C-Ph 1452 3-Cl 7-F -C=C-2-Pyridyl 1453 3-Cl 7-F -C=C-3-Pyridyl 1454 3-Cl 7-F -C=C-4-Pyridyl 1455 3-Cl 7-F -C-C-2-furanyl 1456 3-Cl 7-F -C=C-3-furanyl 1457 3-Cl 7-F -CEC-2-thienyl 1458 3-Cl 7-F -C=C-3-thienyl 1459 3-Cl 7-F -C=C-cycPr 1460 3-Cl 7-F -C=C-Ph 1461 3-Cl 7-F -C=C-2-Pyridyl 1462 3-Cl 7-F -C=C-3-Pyridyl 1463 3-Cl 7-F -C=C-4-Pyridyl 1464 3-Cl 7-F -C=C-2-furanyl 1465 3-Cl 7-F -C=C-3-furanyl 1466 3-Cl 7-F -C=C-2-thienyl 1467 3-Cl 7-F -C=C-3-thienyl 1468 3-Cl 7-F -CH 2

CH

2 -cycPr 1469 3-Cl 7-F

-CH

2

CH

2 -Ph 1470 3-Cl 7-F -CH 2

CH

2 -2-Pyridyl 1471 3-Cl 7-F -CH 2

CH

2 -3-Pyridyl 1472 3-Cl 7-F -CH 2

CH

2 -4-Pyridyl 1473 3-Cl 7-F -CH 2

CH

2 -2-furanyl 1474 3-Cl 7-F -CH 2

CH

2 -3-furanyl 1475 3-Cl 7-F -CH 2

CH

2 -2-thienyl 1476 3-Cl 7-F -CH 2

CH

2 -3-thienyl 166 WO 01/29037 PCT/USOO/28824 1477 2-Me 7-F -OH 1478 2-Me 7-F -0-methyl 1479 2-Me 7-F -0-ethyl 1480 2-Me 7-F -0-n-propyl 1481 2-Me 7-F -0-i-propyl 1482 2-Me 7-F -0-butyl 1483 2-Me 7-F -0-CH 2 -cyclopropyl 1484 2-Me 7-F -0-CH 2 -(1-methylcyclopropyl) 1485 2-Me 7-F -O-CH 2

CH

2 -cyclopropyl 1486 2-Me 7-F -0-CH 2 -cyclobutyl 1487 2-Me 7-F -0-CH 2

CH

2 -cyclobutyl 1488 2-Me 7-F -0-benzyl 1489 2-Me 7-F -0-2,2,2-trifluoroethyl 1490 2-Me 7-F -0-trifluoromethyl 1491 2-Me 7-F -0-3,3,3-trifluoropropyl 1492 2-Me 7-F -0-allyl 1493 2-Me 7-F -0-propargyl 1494 2-Me 7-F -0-CH 2

CH

2

-N(CH

3

)

2 1495 2-Me 7-F -O-CH 2

CH

2 -(N-morpholinyl) 1496 2-Me 7-F -O-CH 2 -3-Pyridyl 1497 2-Me 7-F -0-CH 2 -4-Pyridyl 1498 2-Me 7-F -0-CH 2 -2-furanyl 1499 2-Me 7-F -0-CH 2 -3-furanyl 1500 2-Me 7-F -O-CH 2 -2-thienyl 1501 2-Me 7-F -0-CH 2 -3-thienyl 1502 2-Me 7-F -0-CH 2 -2-oxazolyl 1503 2-Me 7-F -0-CH 2 -2-thiazolyl 1504 2-Me 7-F -0-CH 2 -4-isoxazolyl 167 WO 01/29037 PCT/USOO/28824 1505 2-Me 7-F -O-CH 2 -2-imidazolyl 1506 2-Me 7-F -NH-methyl 1507 2-Me 7-F -NH -ethyl 1508 2-Me 7-F -NH-n-propyl 1509 2-Me 7-F -NH-i-propyl 1510 2-Me 7-F -NH-butyl 1511 2-Me 7-F -NH-CH 2 -cyclopropyl 1512 2-Me 7-F -NH-CH 2 -(1-methylcyclopropyl) 1513 2-Me 7-F -NH-CH 2

CH

2 -cyclopropyl 1514 2-Me 7-F -NH-CH 2 -cyclobutyl 1515 2-Me 7-F -NH-CH 2

CH

2 -cyclobutyl 1516 2-Me 7-F -NH-benzyl 1517 2-Me 7-F -NH-2,2,2-trifluoroethyl 1518 2-Me 7-F -NH-trifluoromethyl 1519 2-Me 7-F -NH-3,3,3-trifluoropropyl 1520 2-Me 7-F -NH-allyl 1521 2-Me 7-F -NH-propargyl 1522 2-Me 7-F -NH-CH 2

CH

2

-N(CH

3

)

2 1523 2-Me 7-F -NH-CH 2

CH

2 -(N-morpholinyl) 1524 2-Me 7-F -NH-CH 2 -3-Pyridyl 1525 2-Me 7-F -NH-CH 2 -4-Pyridyl 1526 2-Me 7-F -NH-CH 2 -2-furanyl 1527 2-Me 7-F -NH-CH 2 -3-furanyl 1528 2-Me 7-F -NH-CH 2 -2-thienyl 1529 2-Me 7-F -NH-CH 2 -3-thienyl 1530 2-Me 7-F -NH-CH 2 -2-oxazolyl 1531 2-Me 7-F -NH-CH 2 -2-thiazolyl 1532 2-Me 7-F -NH-CH 2 -4-isoxazolyl 168 WO 01/29037 PCT/USOO/28824 1533 2-Me 7-F -NH-CH 2 -2-imidazolyl 1534 2-Me 7-F -benzyl 1535 2-Me 7-F -2,2,2-trifluoroethyl 1536 2-Me 7-F -trifluoromethyl 1537 2-Me 7-F -methyl 1538 2-Me 7-F -ethyl 1539 2-Me 7-F -propyl 1540 2-Me 7-F -i-propyl 1541 2-Me 7-F -butyl 1542 2-Me 7-F -i-butyl 1543 2-Me 7-F -t-butyl 1544 2-Me 7-F -pentyl 1545 2-Me 7-F -CH 2

-CH

2 -cyclopropyl 1546 2-Me 7-F -CH 2

-CH

2 -(1-methylcyclopropyl) 1547 2-Me 7-F -CH2-CH 2

CH

2 -cyclopropyl 1548 2-Me 7-F -CH2-CH 2 -cyclobutyl 1549 2-Me 7-F -CH2-CH 2

CH

2 -cyclobutyl 1550 2-Me 7-F -CH2-benzyl 1551 2-Me 7-F -CH2-2,2,2-trifluoroethyl 1552 2-Me 7-F -CH2-trifluoromethyl 1553 2-Me 7-F -CH2-3,3,3-trifluoropropyl 1554 2-Me 7-F -CH2-allyl 1555 2-Me 7-F -CH2-propargyl 1556 2-Me 7-F -CH2-CH 2

CH

2

-N(CH

3

)

2 1557 2-Me 7-F -CH2-CH 2

CH

2 -(N-morpholinyl) 1558 2-Me 7-F -CH2-CH 2 -3-Pyridyl 1559 2-Me 7-F -CH2-CH 2 -4-Pyridyl 1560 2-Me 7-F -CH2-CH 2 -2-furanyl 169 WO 01/29037 PCT/USOO/28824 1561 2-Me 7-F -CH2-CH 2 -3-furanyl 1562 2-Me 7-F -CH2-CH 2 -2-thienyl 1563 2-Me 7-F -CH2-CH 2 -3-thienyl 1564 2-Me 7-F -CH2-CH 2 -2-oxazolyl 1565 2-Me 7-F -CH2-CH 2 -2-thiazolyl 1566 2-Me 7-F -CH2-CH 2 -4-isoxazolyl 1567 2-Me 7-F -CH2-CH 2 -2-imidazolyl 1568 2-Me 7-F -C=C-(2-OH)Ph 1569 2-Me 7-F -C=C-(3-OH)Ph 1570 2-Me 7-F -C=C-(4-OH)Ph 1571 2-Me 7-F -C=C-(2-OMe)Ph 1572 2-Me 7-F -C=C-(3-OMe)Ph 1573 2-Me 7-F -C=C-(4-OMe)Ph 1574 2-Me 7-F -C=C-(2-CN)Ph 1575 2-Me 7-F -C=C-(3-CN)Ph 1576 2-Me 7-F -C=C-(4-CN)Ph 1577 2-Me 7-F -C=C-(2-NO 2 )Ph 1578 2-Me 7-F -C=C-(3-NO 2 )Ph 1579 2-Me 7-F -C=C-(4-NO 2 )Ph 1580 2-Me 7-F -C=C-(2-NH 2 )Ph 1581 2-Me 7-F -C=C-(3-NH 2 )Ph 1582 2-Me 7-F -C=C-(4-NH 2 )Ph 1583 2-Me 7-F -C=C-(2-NMe 2 )Ph 1584 2-Me 7-F -C=C-(3-NMe 2 )Ph 1585 2-Me 7-F -C=C-(4-NMe 2 )Ph 1586 2-Me 7-F -C=C-3-Pyridyl 1587 2-Me 7-F -C=C-4-Pyridyl 170 WO 01/29037 PCT/USOO/28824 1588 2-Me 7-F -C=C-2-furanyl 1589 2-Me 7-F -C=C-3-furanyl 1590 2-Me 7-F -C=C-2-thienyl 1591 2-Me 7-F -C=C-3-thienyl 1592 2-Me 7-F -C=C-2-oxazolyl 1593 2-Me 7-F -C=C-2-thiazolyl 1594 2-Me 7-F -C=C-4-isoxazolyl 1595 2-Me 7-F -C=C-2-imidazolyl 1596 2-Me 7-F -CH 2

CH

2 -cycPr 1597 2-Me 7-F -CH 2

CH

2

CH

2

CH

2 OH 1598 2-Me 7-F -CH 2

CH

2 -CH(OH)Me 1599 2-Me 7-F -CH 2

CH

2 -Ph 1600 2-Me 7-F -CH 2

CH

2 -(2-Cl)Ph 1601 2-Me 7-F -CH 2

CH

2 -(3-Cl)Ph 1602 2-Me 7-F -CH 2

CH

2 -(4-Cl)Ph 1603 2-Me 7-F -CH 2

CH

2 -(2-F)Ph 1604 2-Me 7-F -CH 2

CH

2 -(3-F)Ph 1605 2-Me 7-F -CH 2

CH

2 -(4-F)Ph 1606 2-Me 7-F -CH 2

CH

2 -(2-OH)Ph 1607 2-Me 7-F -CH 2

CH

2 -(3-OH)Ph 1608 2-Me 7-F

-CH

2

CH

2 -(4-OH)Ph 1609 2-Me 7-F -CH 2

CH

2 -(2-OMe)Ph 1610 2-Me 7-F -CH 2

CH

2 -(3-OMe)Ph 1611 2-Me 7-F -CH 2

CH

2 -(4-OMe)Ph 1612 2-Me 7-F -CH 2

CH

2 -(2-CN)Ph 1613 2-Me 7-F -CH 2

CH

2 -(3-CN)Ph 1614 2-Me 7-F -CH 2

CH

2 -(4-CN)Ph 171 WO 01/29037 PCT/USOO/28824 1615 2-Me 7-F -CH 2

CH

2 -(2-N0 2 )Ph 1616 2-Me 7-F -CH 2

CH

2 -(3-NO 2 )Ph 1617 2-Me 7-F -CH 2

CH

2 -(4-NO 2 )Ph 1618 2-Me 7-F -CH 2

CH

2 -(2-NH 2 )Ph 1619 2-Me 7-F -CH 2

CH

2 -(3-NH 2 )Ph 1620 2-Me 7-F -CH 2

CH

2 -(4-NH 2 )Ph 1621 2-Me 7-F -CH 2

CH

2 -(2-NMe 2 )Ph 1622 2-Me 7-F -CH 2

CH

2 -(3-NMe 2 )Ph 1623 2-Me 7-F -CH 2

CH

2 -(4-NMe 2 )Ph 1624 2-Me 7-F -CH 2

CH

2 -2-Pyridyl 1625 2-Me 7-F -CH 2

CH

2 -3-Pyridyl 1626 2-Me 7-F -CH 2

CH

2 -4-Pyridyl 1627 2-Me 7-F -CH 2

CH

2 -2-furanyl 1628 2-Me 7-F -CH 2

CH

2 -3-furanyl 1629 2-Me 7-F -CH 2

CH

2 -4-furanyl 1630 2-Me 7-F -CH 2

CH

2 -3-thienyl 1631 2-Me 7-F -CH 2

CH

2 -2-oxazolyl 1632 2-Me 7-F -CH 2

CH

2 -2-thiazolyl 1633 2-Me 7-F -CH 2

CH

2 -4-isoxazolyl 1634 2-Me 7-F -CH 2

CH

2 -2-imidazolyl 1635 2-Me 7-F -C=C-cycPr 1636 2-Me 7-F -C=C-Ph 1637 2-Me 7-F -CEC-2-Pyridyl 1638 2-Me 7-F -C=C-3-Pyridyl 1639 2-Me 7-F -C=C-4-Pyridyl 1640 2-Me 7-F -C=C-2-furanyl 172 WO 01/29037 PCT/USOO/28824 1641 2-Me 7-F -CmC-3-furanyl 1642 2-Me 7-F -CEC-2-thienyl 1643 2-Me 7-F -CaC-3-thienyl 1644 2-Me 7-F -C=C-cycPr 1645 2-Me 7-F -C=C-Ph 1646 2-Me 7-F -C=C-2-Pyridyl 1647 2-Me 7-F -C=C-3-Pyridyl 1648 2-Me 7-F -C=C-4-Pyridyl 1649 2-Me 7-F -C=C-2-furanyl 1650 2-Me 7-F -C=C-3-furanyl 1651 2-Me 7-F -C=C-2-thienyl 1652 2-Me 7-F -C=C-3-thienyl 1653 2-Me 7-F -CH 2

CH

2 -cycPr 1654 2-Me 7-F -CH 2

CH

2 -Ph 1655 2-Me 7-F -CH 2

CH

2 -2-Pyridyl 1656 2-Me 7-F -CH 2

CH

2 -3-Pyridyl 1657 2-Me 7-F -CH 2

CH

2 -4-Pyridyl 1658 2-Me 7-F -CH 2

CH

2 -2-furanyl 1659 2-Me 7-F -CH 2

CH

2 -3-furanyl 1660 2-Me 7-F -CH 2

CH

2 -2-thienyl 1661 2-Me 7-F -CH 2

CH

2 -3-thienyl 1662 2-Me 7-F -CaC-cycPr 1663 2-Me 7-F -CmC-Ph 1664 2-Me 7-F -CmC-2-Pyridyl 1665 2-Me 7-F -CmC-3-Pyridyl 1666 2-Me 7-F -CmC-4-Pyridyl 1667 2-Me 7-F -CaC-2-furanyl 173 WO 01/29037 PCT/USOO/28824 1668 2-Me 7-F -C=C-3-furanyl 1669 2-Me 7-F -C=C-2-thienyl 1670 2-Me 7-F -C=C-3-thienyl 1671 2-Me 7-F -C=C-cycPr 1672 2-Me 7-F -C=C-Ph 1673 2-Me 7-F -C=C-2-Pyridyl 1674 2-Me 7-F -C=C-3-Pyridyl 1675 2-Me 7-F -C=C-4-Pyridyl 1676 2-Me 7-F -C=C-2-furanyl 1677 2-Me 7-F -C=C-3-furanyl 1678 2-Me 7-F -C=C-2-thienyl 1679 2-Me 7-F -C=C-3-thienyl 1680 2-Me 7-F -CH 2

CH

2 -cycPr 1681 2-Me 7-F -CH 2

CH

2 -Ph 1682 2-Me 7-F -CH 2

CH

2 -2-Pyridyl 1683 2-Me 7-F -CH 2

CH

2 -3-Pyridyl 1684 2-Me 7-F -CH 2

CH

2 -4-Pyridyl 1685 2-Me 7-F -CH 2

CH

2 -2-furanyl 1686 2-Me 7-F -CH 2

CH

2 -3-furanyl 1687 2-Me 7-F -CH 2

CH

2 -2-thienyl 1688 2-Me 7-F -CH 2

CH

2 -3-thienyl 1689 2-OH 7-F -OH 1690 2-OH 7-F -0-methyl 1691 2-OH 7-F -0-ethyl 1692 2-OH 7-F -O-n-propyl 1693 2-OH 7-F -0-i-propyl 1694 2-OH 7-F -0-butyl 1695 2-OH 7-F -O-CH 2 -cyclopropyl 174 WO 01/29037 PCT/USOO/28824 1696 2-OH 7-F -O-CH 2 -(1-methylcyclopropyl) 1697 2-OH 7-F -O-CH 2

CH

2 -cyclopropyl 1698 2-OH 7-F -O-CH 2 -cyclobutyl 1699 2-OH 7-F -O-CH 2

CH

2 -cyclobutyl 1700 2-OH 7-F -O-benzyl 1701 2-OH 7-F -0-2,2,2-trifluoroethyl 1702 2-OH 7-F -0-trifluoromethyl 1703 2-OH 7-F -0-3,3,3-trifluoropropyl 1704 2-OH 7-F -0-allyl 1705 2-OH 7-F -O-propargyl 1706 2-OH 7-F -O-CH 2

CH

2

-N(CH

3

)

2 1707 2-OH 7-F -O-CH 2

CH

2 -(N-morpholinyl) 1708 2-OH 7-F -O-CH 2 -3-Pyridyl 1709 2-OH 7-F -O-CH 2 -4-Pyridyl 1710 2-OH 7-F -O-CH 2 -2-furanyl 1711 2-OH 7-F -O-CH 2 -3-furanyl 1712 2-OH 7-F -O-CH 2 -2-thienyl 1713 2-OH 7-F -O-CH 2 -3-thienyl 1714 2-OH 7-F -O-CH 2 -2-oxazolyl 1715 2-OH 7-F -O-CH 2 -2-thiazolyl 1716 2-OH 7-F -O-CH 2 -4-isoxazolyl 1717 2-OH 7-F -O-CH 2 -2-imidazolyl 1718 2-OH 7-F -NH-methyl 1719 2-OH 7-F -NH -ethyl 1720 2-OH 7-F -NH-n-propyl 1721 2-OH 7-F -NH-i-propyl 1722 2-OH 7-F -NH-butyl 1723 2-OH 7-F -NH-CH 2 -cyclopropyl 175 WO 01/29037 PCT/USOO/28824 1724 2-OH 7-F -NH-CH 2 ~(1-methylcyclopropyl) 1725 2-OH 7-F -NH-CH 2

CH

2 -cyclopropyl 1726 2-OH 7-F -NH-CH 2 -cyclobutyl 1727 2-OH 7-F -NH-CH 2

CH

2 -cyclobutyl 1728 2-OH 7-F -NH-benzyl 1729 2-OH 7-F -NH-2,2,2-trifluoroethyl 1730 2-OH 7-F -NH-trifluoromethyl 1731 2-OH 7-F -NH-3,3,3-trifluoropropyl 1732 2-OH 7-F -NH-allyl 1733 2-OH 7-F -NH-propargyl 1734 2-OH 7-F -NH-CH 2

CH

2

-N(CH

3

)

2 1735 2-OH 7-F -NH-CH 2

CH

2 ~(N-morpholinyl) 1736 2-OH 7-F -NH-CH 2 -3-Pyridyl 1737 2-OH 7-F -NH-CH 2 -4-Pyridyl 1738 2-OH 7-F -NH-CH 2 -2-furanyl 1739 2-OH 7-F -NH-CH 2 -3-furanyl 1740 2-OH 7-F -NH-CH 2 -2-thienyl 1741 2-OH 7-F

-NH-CH

2 -3-thienyl 1742 2-OH 7-F

-NH-CH

2 -2-oxazolyl 1743 2-OH 7-F -NH-CH 2 -2-thiazolyl 1744 2-OH 7-F -NH-CH 2 -4-isoxazolyl 1745 2-OH 7-F -NH-CH 2 -2-imidazolyl 1746 2-OH 7-F -benzyl 1747 2-OH 7-F -2,2,2-trifluoroethyl 1748 2-OH 7-F -trifluoromethyl 1749 2-OH 7-F -methyl 1750 2-OH 7-F -ethyl 1751 2-OH 7-F -propyl 176 WO 01/29037 PCT/USOO/28824 1752 2-OH 7-F -i-propyl 1753 2-OH 7-F -butyl 1754 2-OH 7-F -i-butyl 1755 2-OH 7-F -t-butyl 1756 2-OH 7-F -pentyl 1757 2-OH 7-F -CH 2

-CH

2 -cyclopropyl 1758 2-OH 7-F -CH 2

-CH

2 -(1-methylcyclopropyl) 1759 2-OH 7-F -CH2-CH 2

CH

2 -cyclopropyl 1760 2-OH 7-F -CH2-CH 2 -cyclobutyl 1761 2-OH 7-F -CH2-CH 2

CH

2 -cyclobutyl 1762 2-OH 7-F -CH2-benzyl 1763 2-OH 7-F -CH2-2,2,2-trifluoroethyl 1764 2-OH 7-F -CH2-trifluoromethyl 1765 2-OH 7-F -CH2-3,3,3-trifluoropropyl 1766 2-OH 7-F -CH2-allyl 1767 2-OH 7-F -CH2-propargyl 1768 2-OH 7-F -CH2-CH 2

CH

2

-N(CH

3

)

2 1769 2-OH 7-F -CH2-CH 2

CH

2 -(N-morpholinyl) 1770 2-OH 7-F -CH2-CH 2 -3-Pyridyl 1771 2-OH 7-F -CH2-CH 2 -4-Pyridyl 1772 2-OH 7-F -CH2-CH 2 -2-furanyl 1773 2-OH 7-F -CH2-CH 2 -3-furanyl 1774 2-OH 7-F -CH2-CH 2 -2-thienyl 1775 2-OH 7-F -CH2-CH 2 -3-thienyl 1776 2-OH 7-F -CH2-CH 2 -2-oxazolyl 1777 2-OH 7-F -CH2-CH 2 -2-thiazolyl 1778 2-OH 7-F -CH2-CH 2 -4-isoxazolyl 1779 2-OH 7-F -CH2-CH 2 -2-imidazolyl 177 WO 01/29037 PCT/USOO/28824 1780 2-OH 7-F -C=C-(2-OH)Ph 1781 2-OH 7-F -C=C-(3-OH)Ph 1782 2-OH 7-F -C=C-(4-OH)Ph 1783 2-OH 7-F -C=C-(2-OMe)Ph 1784 2-OH 7-F -C=C-(3-OMe)Ph 1785 2-OH 7-F -C=C-(4-OMe)Ph 1786 2-OH 7-F -C=C-(2-CN)Ph 1787 2-OH 7-F -C=C-(3-CN)Ph 1788 2-OH 7-F -C=C-(4-CN)Ph 1789 2-OH 7-F -C=C-(2-NO 2 )Ph 1790 2-OH 7-F -C=C-(3-NO 2 )Ph 1791 2-OH 7-F -C=C-(4-NO 2 )Ph 1792 2-OH 7-F -C=C-(2-NH 2 )Ph 1793 2-OH 7-F -C=C-(3-NH 2 )Ph 1794 2-OH 7-F -C=C-(4-NH 2 )Ph 1795 2-OH 7-F -C=C-(2-NMe 2 )Ph 1796 2-OH 7-F -C=C-(3-NMe 2 )Ph 1797 2-OH 7-F -C=C-(4-NMe 2 )Ph 1798 2-OH 7-F -C=C-3-Pyridyl 1799 2-OH 7-F -C=C-4-Pyridyl 1800 2-OH 7-F -C=C-2-furanyl 1801 2-OH 7-F -C=C-3-furanyl 1802 2-OH 7-F -C=C-2-thienyl 1803 2-OH 7-F -C=C-3-thienyl 1804 2-OH 7-F -C=C-2-oxazolyl 1805 2-OH 7-F -C=C-2-thiazolyl 1806 2-OH 7-F -C=C-4-isoxazolyl 1807 2-OH 7-F -C=C-2-imidazolyl 178 WO 01/29037 PCT/USOO/28824 1808 2-OH 7-F

-CH

2

CH

2 -cycPr 1809 2-OH 7-F -CH 2

CH

2

CH

2

CH

2 OH 1810 2-OH 7-F -CH 2

CH

2 -CH(OH)Me 1811 2-OH 7-F

-CH

2

CH

2 -Ph 1812 2-OH 7-F -CH 2

CH

2 -(2-Cl)Ph 1813 2-OH 7-F -CH 2

CH

2 -(3-Cl)Ph 1814 2-OH 7-F

-CH

2

CH

2 -(4-Cl)Ph 1815 2-OH 7-F -CH 2

CH

2 -(2-F)Ph 1816 2-OH 7-F

-CH

2

CH

2 -(3-F)Ph 1817 2-OH 7-F -CH 2

CH

2 -(4-F)Ph 1818 2-OH 7-F

-CH

2

CH

2 -(2-OH)Ph 1819 2-OH 7-F

-CH

2

CH

2 -(3-OH)Ph 1820 2-OH 7-F

-CH

2

CH

2 -(4-OH)Ph 1821 2-OH 7-F -CH 2

CH

2 -(2-OMe)Ph 1822 2-OH 7-F -CH 2

CH

2 -(3-OMe)Ph 1823 2-OH 7-F -CH 2

CH

2 -(4-OMe)Ph 1824 2-OH 7-F

-CH

2

CH

2 -(2-CN)Ph 1825 2-OH 7-F -CH 2

CH

2 -(3-CN)Ph 1826 2-OH 7-F

-CH

2

CH

2 -(4-CN)Ph 1827 2-OH 7-F -CH 2

CH

2 -(2-N0 2 )Ph 1828 2-OH 7-F -CH 2

CH

2 -(3-NO 2 )Ph 1829 2-OH 7-F

-CH

2

CH

2 -(4-NO 2 )Ph 1830 2-OH 7-F -CH 2

CH

2 -(2-NH 2 )Ph 1831 2-OH 7-F -CH 2

CH

2 -(3-NH 2 )Ph 1832 2-OH 7-F

-CH

2

CH

2 -(4-NH 2 )Ph 1833 2-OH 7-F

-CH

2

CH

2 -(2-NMe 2 )Ph 1834 2-OH 7-F -CH 2

CH

2 -(3-NMe 2 )Ph 179 WO 01/29037 PCT/USOO/28824 1835 2-OH 7-F -CH 2

CH

2 -(4-NMe 2 )Ph 1836 2-OH 7-F -CH 2

CH

2 -2-Pyridyl 1837 2-OH 7-F -CH 2

CH

2 -3-Pyridyl 1838 2-OH 7-F -CH 2

CH

2 -4-Pyridyl 1839 2-OH 7-F -CH 2

CH

2 -2-furanyl 1840 2-OH 7-F -CH 2

CH

2 -3-furanyl 1841 2-OH 7-F -CH 2

CH

2 -4-furanyl 1842 2-OH 7-F -CH 2

CH

2 -3-thienyl 1843 2-OH 7-F -CH 2

CH

2 -2-oxazolyl 1844 2-OH 7-F -CH 2

CH

2 -2-thiazolyl 1845 2-OH 7-F -CH 2

CH

2 -4-isoxazolyl 1846 2-OH 7-F -CH 2

CH

2 -2-imidazolyl 1847 2-OH 7-F -C=C-cycPr 1848 2-OH 7-F -C=C-Ph 1849 2-OH 7-F -C=C-2-Pyridyl 1850 2-OH 7-F -C=C-3-Pyridyl 1851 2-OH 7-F -C=C-4-Pyridyl 1852 2-OH 7-F -C=C-2-furanyl 1853 2-OH 7-F -C=C-3-furanyl 1854 2-OH 7-F -C=C-2-thienyl 1855 2-OH 7-F -C=C-3-thienyl 1856 2-OH 7-F -C=C-cycPr 1857 2-OH 7-F -C=C-Ph 1858 2-OH 7-F -C=C-2-Pyridyl 1859 2-OH 7-F -C=C-3-Pyridyl 1860 2-OH 7-F -C=C-4-Pyridyl 1861 2-OH 7-F -C=C-2-furanyl 180 WO 01/29037 PCT/USOO/28824 1862 2-OH 7-F -C=C-3-furanyl 1863 2-OH 7-F -C=C-2-thienyl 1864 2-OH 7-F -C=C-3-thienyl 1865 2-OH 7-F

-CH

2

CH

2 -cycPr 1866 2-OH 7-F -CH 2

CH

2 -Ph 1867 2-OH 7-F -CH 2

CH

2 -2-Pyridyl 1868 2-OH 7-F -CH 2

CH

2 -3-Pyridyl 1869 2-OH 7-F -CH 2

CH

2 -4-Pyridyl 1870 2-OH 7-F -CH 2

CH

2 -2-furanyl 1871 2-OH 7-F -CH 2

CH

2 -3-furanyl 1872 2-OH 7-F -CH 2

CH

2 -2-thienyl 1873 2-OH 7-F -CH 2

CH

2 -3-thienyl 1874 2-OH 7-F -C=C-cycPr 1875 2-OH 7-F -C=C-Ph 1876 2-OH 7-F -C=C-2-Pyridyl 1877 2-OH 7-F -C=C-3-Pyridyl 1878 2-OH 7-F -C=C-4-Pyridyl 1879 2-OH 7-F -C=C-2-furanyl 1880 2-OH 7-F -C=C-3-furanyl 1881 2-OH 7-F -C=C-2-thienyl 1882 2-OH 7-F -C=C-3-thienyl 1883 2-OH 7-F -C=C-cycPr 1884 2-OH 7-F -C=C-Ph 1885 2-OH 7-F -C=C-2-Pyridyl 1886 2-OH 7-F -C=C-3-Pyridyl 1887 2-OH 7-F -C=C-4-Pyridyl 1888 2-OH 7-F -C=C-2-furanyl 181 WO 01/29037 PCT/USOO/28824 1889 2-OH 7-F -C=C-3-furanyl 1890 2-OH 7-F -C=C-2-thienyl 1891 2-OH 7-F -C=C-3-thienyl 1892 2-OH 7-F -CH 2

CH

2 -cycPr 1893 2-OH 7-F

-CH

2

CH

2 -Ph 1894 2-OH 7-F -CH 2

CH

2 -2-Pyridyl 1895 2-OH 7-F -CH 2

CH

2 -3-Pyridyl 1896 2-OH 7-F -CH 2

CH

2 -4-Pyridyl 1897 2-OH 7-F -CH 2

CH

2 -2-furanyl 1898 2-OH 7-F -CH 2

CH

2 -3-furanyl 1899 2-OH 7-F

-CH

2

CH

2 -2-thienyl 1900 2-OH 7-F -CH 2

CH

2 -3-thienyl Utility The compounds of this invention possess reverse transcriptase inhibitory activity and HIV inhibitory 5 efficacy. The compounds of formula (I) possess HIV reverse transcriptase inhibitory activity and are therefore useful as antiviral agents for the treatment of HIV infection and associated diseases. The compounds of formula (I) possess HIV reverse transcriptase 10 inhibitory activity and are effective as inhibitors of HIV growth. The ability of the compounds of the present invention to inhibit viral growth or infectivity is demonstrated in standard assay of viral growth or infectivity, for example, using the assay described 15 below. The compounds of formula (I) of the present invention are also useful for the inhibition of HIV in an ex vivo sample containing HIV or expected to be exposed to HIV. Thus, the compounds of the present 20 invention may be used to inhibit HIV present in a body 182 WO 01/29037 PCT/USOO/28824 fluid sample (for example, a serum or semen sample) which contains or is suspected to contain or be exposed to HIV. The compounds provided by this invention are also 5 useful as standard or reference compounds for use in tests or assays for determining the ability of an agent to inhibit viral replication and/or HIV reverse transcriptase, for example in a pharmaceutical research program. Thus, the compounds of the present invention 10 may be used as a control or reference compound in such assays and as a quality control standard. The compounds of the present invention may be provided in a commercial kit or container for use as such standard or reference compound. 15 Since the compounds of the present invention exhibit specificity for HIV reverse transcriptase, the compounds of the present invention may also be useful as diagnostic reagents in diagnostic assays for the detection of HIV reverse transcriptase. Thus, 20 inhibition of the reverse transcriptase activity in an assay (such as the assays described herein) by a compound of the present invention would be indicative of the presence of HIV reverse transcriptase and HIV virus. As used herein "pg" denotes microgram, "mg" denotes 25 milligram, "g" denotes gram, "pL" denotes microliter, "mL" denotes milliliter, "L" denotes liter, "nM" denotes nanomolar, "plM" denotes micromolar, "mM" denotes millimolar, "M" denotes molar and "nm" denotes nanometer. "Sigma" stands for the Sigma-Aldrich Corp. 30 of St. Louis, MO. Compounds tested in the assay described below are considered to be active if they exhibit a Ki of <10 pM. Preferred compounds of the present invention have Ki's of <1 pM. More preferred compounds of the present 35 invention have Ki's of <0.1 pM. Even more preferred 183 WO 01/29037 PCT/USOO/28824 compounds of the present invention have Ki's of <0.01 piM. Still more preferred compounds of the present invention have Ki's of <0.001 piM. Using the methodology described below, a number of 5 compounds of the present invention were found to exhibit a Ki of <10 pM, thereby confirming the utility of the compounds of the present invention as effective HIV reverse transcriptase inhibitors. HIV RNA Assay 10 DNA Plasmids and in vitro RNA transcripts: Plasmid pDAB 72 containing both gag and pol sequences of BH10 (bp 113-1816) cloned into PTZ 19R was prepared according to Erickson-Viitanen et al. AIDS Research and Human Retroviruses 1989, 5, 577. The 15 plasmid was linearized with Bam HI prior to the generation of in vitro RNA transcripts using the Riboprobe Gemini system II kit (Promega) with T7 RNA polymerase. Synthesized RNA was purified by treatment with RNase free DNAse (Promega), phenol-chloroform 20 extraction, and ethanol precipitation. RNA transcripts were dissolved in water, and stored at -70 0 C. The concentration of RNA was determined from the A260. Probes: 25 Biotinylated capture probes were purified by HPLC after synthesis on an Applied Biosystems (Foster City, CA) DNA synthesizer by addition of biotin to the 5' terminal end of the oligonucleotide, using the biotin-phosphoramidite reagent of Cocuzza, Tet. Lett. 30 1989, 30, 6287. The gag biotinylated capture probe (5-biotin-CTAGCTCCCTGCTTGCCCATACTA 3') was complementary to nucleotides 889-912 of HXB2 and the pol biotinylated capture probe (5'-biotin -CCCTATCATTTTTGGTTTCCAT 3' was complementary to nucleotides 2374-2395 of HXB2. 184 WO 01/29037 PCT/USOO/28824 Alkaline phosphatase conjugated oligonucleotides used as reporter probes were prepared by Syngene (San Diego, CA.). The pol reporter probe (5' CTGTCTTACTTTGATAAAACCTC 3') was complementary to 5 nucleotides 2403-2425 of HXB2. The gag reporter probe (5' CCCAGTATTTGTCTACAGCCTTCT 3') was complementary to nucleotides 950-973 of HXB2. All nucleotide positions are those of the GenBank Genetic Sequence Data Bank as accessed through the Genetics Computer Group Sequence 10 Analysis Software Package (Devereau Nucleic Acids Research 1984, 12, 387). The reporter probes were prepared as 0.5 pM stocks in 2 x SSC (0.3 M NaCl, 0.03 M sodium citrate), 0.05 M Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture probes were prepared as 100 pM 15 stocks in water. Streptavidin coated plates: Streptavidin coated plates were obtained from DuPont Biotechnology Systems (Boston, MA). 20 Cells and virus stocks: MT-2 and MT-4 cells were maintained in RPMI 1640 supplemented with 5% fetal calf serum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2 mM L-glutamine and 50 25 pg/mL gentamycin, all from Gibco. HIV-1 RF was propagated in MT-4 cells in the same medium. Virus stocks were prepared approximately 10 days after acute infection of MT-4 cells and stored as aliquots at -70 0 C. Infectious titers of HIV-1(RF) stocks were 1-3 x 107 PFU 30 (plaque forming units)/mL as measured by plaque assay on MT-2 cells (see below). Each aliquot of virus stock used for infection was thawed only once. For evaluation of antiviral efficacy, cells to be infected were subcultured one day prior to infection. 35 On the day of infection, cells were resuspended at 5 x 185 WO 01/29037 PCT/USOO/28824 105 cells/mL in RPMI 1640, 5% FCS for bulk infections or at 2 x 10 6 /mL in Dulbecco's modified Eagles medium with 5% FCS for infection in microtiter plates. Virus was added and culture continued for 3 days at 37 0 C. 5 HIV RNA assay: Cell lysates or purified RNA in 3 M or 5 M GED were mixed with 5 M GED and capture probe to a final guanidinium isothiocyanate concentration of 3 M and a 10 final biotin oligonucleotide concentration of 30 niM. Hybridization was carried out in sealed U bottom 96 well tissue culture plates (Nunc or Costar) for 16-20 hours at 37 0 C. RNA hybridization reactions were diluted three-fold with deionized water to a final guanidinium 15 isothiocyanate concentration of 1 M and aliquots (150 pL) were transferred to streptavidin coated microtiter plates wells. Binding of capture probe and capture probe-RNA hybrid to the immobilized streptavidin was allowed to proceed for 2 hours at room temperature, 20 after which the plates were washed 6 times with DuPont ELISA plate wash buffer (phosphate buffered saline(PBS), 0.05% Tween 20) A second hybridization of reporter probe to the immobilized complex of capture probe and hybridized target RNA was carried out in the washed 25 streptavidin coated well by addition of 120 il of a hybridization cocktail containing 4 X SSC, 0.66% Triton X 100, 6.66% deionized formamide, 1 mg/mL BSA and 5 nM reporter probe. After hybridization for one hour at 37 0 C, the plate was again washed 6 times. Immobilized 30 alkaline phosphatase activity was detected by addition of 100 pL of 0.2 mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in buffer (2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 M MgCl2, 5 mM zinc acetate dihydrate and 5 mM 186 WO 01/29037 PCT/USOO/28824 N-hydroxyethyl-ethylene-diamine-triacetic acid). The plates were incubated at 37 0 C. Fluorescence at 450 nM was measured using a microplate fluorometer (Dynateck) exciting at 365 nJM. 5 Microrlate based compound evaluation in HIV-1 infected MT-2 cells: Compounds to be evaluated were dissolved in DMSO and diluted in culture medium to twice the highest 10 concentration to be tested and a maximum DMSO concentration of 2%. Further three-fold serial dilutions of the compound in culture medium were performed directly in U bottom microtiter plates (Nunc). After compound dilution, MT-2 cells (50 pL) were added 15 to a final concentration of 5 x 10 5 per mL (1 x 105 per well). Cells were incubated with compounds for 30 minutes at 37 0 C in a C02 incubator. For evaluation of antiviral potency, an appropriate dilution of HIV-1 (RF) virus stock (50 pL) was added to culture wells 20 containing cells and dilutions of the test compounds. The final volume in each well was 200 pL. Eight wells per plate were left uninfected with 50 pL of medium added in place of virus, while eight wells were infected in the absence of any antiviral compound. For 25 evaluation of compound toxicity, parallel plates were cultured without virus infection. After 3 days of culture at 37 0 C in a humidified chamber inside a C02 incubator, all but 25 iL of medium/well was removed from the HIV infected plates. 30 Thirty seven pL of 5 M GED containing biotinylated capture probe was added to the settled cells and remaining medium in each well to a final concentration of 3 M GED and 30 nM capture probe. Hybridization of the capture probe to HIV RNA in the cell lysate was 187 WO 01/29037 PCT/USOO/28824 carried out in the same microplate well used for virus culture by sealing the plate with a plate sealer (Costar), and incubating for 16-20 hrs in a 370C incubator. Distilled water was then added to each well 5 to dilute the hybridization reaction three-fold and 150 pL of this diluted mixture was transferred to a streptavidin coated microtiter plate. HIV RNA was quantitated as described above. A standard curve, prepared by adding known amounts of pDAB 72 in vitro RNA 10 transcript to wells containing lysed uninfected cells, was run on each microtiter plate in order to determine the amount of viral RNA made during the infection. In order to standardize the virus inoculum used in the evaluation of compounds for antiviral activity, 15 dilutions of virus were selected which resulted in an IC90 value (concentration of compound required to reduce the HIV RNA level by 90%) for dideoxycytidine (ddC) of 0.2 pg/mL. IC90 values of other antiviral compounds, both more and less potent than ddC, were reproducible 20 using several stocks of HIV-1 (RF) when this procedure was followed. This concentration of virus corresponded to -3 x 105 PFU (measured by plaque assay on MT-2 cells) per assay well and typically produced approximately 75% of the maximum viral RNA level achievable at any virus 25 inoculum. For the HIV RNA assay, IC90 values were determined from the percent reduction of net signal (signal from infected cell samples minus signal from uninfected cell samples) in the RNA assay relative to the net signal from infected, untreated cells on the 30 same culture plate (average of eight wells). Valid performance of individual infection and RNA assay tests was judged according to three criteria. It was required that the virus infection should result in an RNA assay signal equal to or greater than the signal generated 188 WO 01/29037 PCT/USOO/28824 from 2 ng of pDAB 72 in vitro RNA transcript. The IC90 for ddC, determined in each assay run, should be between 0.1 and 0.3 ig/mL. Finally, the plateau level of viral RNA produced by an effective reverse transcriptase 5 inhibitor should be less than 10% of the level achieved in an uninhibited infection. A compound was considered active if its IC 90 was found to be less than 20pM. For antiviral potency tests, all manipulations in microtiter plates, following the initial addition of 2X 10 concentrated compound solution to a single row of wells, were performed using a Perkin Elmer/Cetus ProPette. Protein Binding and Mutant Resistance In order to characterize NNRTI compounds for their 15 clinical efficacy potential the effect of plasma proteins on antiviral potency and measurements of antiviral potency against wild type and mutant variants of HIV which carry amino acid changes in the known binding site for NNRTIs were examined. The rationale 20 for this testing strategy is two fold: 1. Many drugs are extensively bound to plasma proteins. Although the binding affinity for most drugs for the major components of human plasma, namely, human serum albumin (HSA) or alpha-l-acid glycoprotein (AAG), 25 is low, these major components are present in high concentration in the blood. Only free or unbound drug is available to cross the infected cell membrane for interaction with the target site (i.e., HIV-1 reverse transcriptase, HIV-1 RT). Therefore, the effect of 30 added HSA+AAG on the antiviral potency in tissue culture more closely reflects the potency of a given compound in the clinical setting. The concentration of compound required for 90% inhibition of virus replication as measured in a sensitive viral RNA-based detection method 35 is designated the IC90. The fold increase in apparent 189 WO 01/29037 PCT/USOO/28824 IC90 for test compounds in the presence or added levels of HSA and AAG that reflect in vivo concentrations (45 mg/ml HSA, 1 mg/ml AAG) was then calculated. The lower the fold increase, the more compound will be available 5 to interact with the target site. 2. The combination of the high rate of virus replication in the infected individual and the poor fidelity of the viral RT results in the production of a quasi-species or mixtures of HIV species in the infected 10 individual. These species will include a majority wild type species, but also mutant variants of HIV and the proportion of a given mutant will reflect its relative fitness and replication rate. Because mutant variants including mutants with changes in the amino acid 15 sequence of the viral RT likely pre-exist in the infected individual's quasi-species, the overall potency observed in the clinical setting will reflect the ability of a drug to inhibit not only wild type HIV-1, but mutant variants as well. We thus have constructed, 20 in a known genetic background, mutant variants of HIV-1 which carry amino acid substitutions at positions thought to be involved in NNRTI binding, and measured the ability of test compounds to inhibit replication of these mutant viruses. The concentration of compound 25 required for 90% inhibition of virus replication as measured in a sensitive viral RNA-based detection method is designated the IC90. It is desirable to have a compound which has high activity against a variety of mutants. 30 Dosage and Formulation The antiviral compounds of this invention can be administered as treatment for viral infections by any means that produces contact of the active agent with the 35 agent's site of action, i.e., the viral reverse 190 WO 01/29037 PCT/USOO/28824 transcriptase, in the body of a mammal. They can be administered by any conventional means available for use in conjunction with pharmaceuticals, either as individual therapeutic agents or in a combination of 5 therapeutic agents. They can be administered alone, but preferably are administered with a pharmaceutical carrier selected on the basis of the chosen route of administration and standard pharmaceutical practice. The dosage administered will, of course, vary 10 depending upon known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, health and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent 15 treatment; the frequency of treatment; and the effect desired. A daily dosage of active ingredient can be expected to be about 0.001 to about 1000 milligrams per kilogram of body weight, with the preferred dose being about 0.1 to about 30 mg/kg. 20 Dosage forms of compositions suitable for administration contain from about 1 mg to about 100 mg of active ingredient per unit. In these pharmaceutical compositions the active ingredient will ordinarily be present in an amount of about 0.5-95% by weight based on 25 the total weight of the composition. The active ingredient can be administered orally in solid dosage forms, such as capsules, tablets and powders, or in liquid dosage forms, such as elixirs, syrups and suspensions. It can also be administered parenterally, 30 in sterile liquid dosage forms. Gelatin capsules contain the active ingredient and powdered carriers, such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. Similar diluents can be used to make compressed 35 tablets. Both tablets and capsules can be manufactured 191 WO 01/29037 PCT/USOO/28824 as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from 5 the atmosphere, or enteric coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain coloring and flavoring to increase patient acceptance. In general, water, a suitable oil, saline, aqueous 10 dextrose (glucose), and related sugar solutions and glycols such as propylene glycol or polyethylene glycols are suitable carriers for parenteral solutions. Solutions for parenteral administration preferably contain a water soluble salt of the active ingredient, 15 suitable stabilizing agents, and if necessary, buffer substances. Antioxidizing agents such as sodium bisulfite, sodium sulfite, or ascorbic acid, either alone or combined, are suitable stabilizing agents. Also used are citric acid and its salts, and sodium 20 EDTA. In addition, parenteral solutions can contain preservatives, such as benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences, supra, a standard reference 25 text in this field. Useful pharmaceutical dosage-forms for administration of the compounds of this invention can be illustrated as follows: 30 Capsules A capsule formulation of the present invention can be prepared by filling standard two-piece hard gelatin capsules each with 100 mg of powdered active ingredient, 150 mg of lactose, 50 mg of cellulose, and 6 mg 35 magnesium stearic. 192 WO 01/29037 PCT/USOO/28824 Soft Gelatin Capsules A soft gelatin capsule formulation of the present invention can be prepared as follows. A mixture of 5 active ingredient in a digestible oil such as soybean oil, cottonseed oil or olive oil can be prepared and injected by means of a positive displacement pump into gelatin to form soft gelatin capsules containing 100 mg of the active ingredient. The capsules should then be 10 washed and dried. Tablets A tablet formulation of the present invention can be prepared by conventional procedures so that the 15 dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon dioxide, 5 milligrams of magnesium stearate, 275 mg of microcrystalline cellulose, 11 mg of starch and 98.8 mg of lactose. Appropriate coatings may be applied to increase palatability or delay absorption. 20 Suspension An aqueous suspension formulation can be prepared for oral administration so that each 5 mL contain 25 mg of finely divided active ingredient, 200 mg of sodium 25 carboxymethyl cellulose, 5 mg of sodium benzoate, 1.0 g of sorbitol solution, U.S.P., and 0.025 mg of vanillin. Inlectable A parenteral formulation suitable for 30 administration by injection can be prepared by stirring 1.5% by weight of active ingredient in 10% by volume propylene glycol and water. The solution is sterilized by commonly used techniques. 193 WO 01/29037 PCT/USOO/28824 Combination Administration of Therapeutic Agents The present invention provides a method for the treatment of HIV infection which comprises administering, in combination, to a host in need thereof 5 a therapeutically effective amount of the following: (a) a compound of formula (I); and (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile 10 containers. Each therapeutic agent component of this combination method (i.e., component (a) and (b) set forth above) can independently be administered in any separate dosage form, such as those described above, and 15 can be administered in various ways, as described above. In the following description component (b) is to be understood to represent one or more agents as described previously. Each individual therapeutic agent comprising component (b) may also be independently be 20 administered in any separate dosage form, such as those described above, and can be administered in various ways, as described above. Components (a) and any one or more of the agents comprising component (b) of the combination method of 25 the present invention may be formulated together, in a single dosage unit (that is, combined together in one capsule, tablet, powder, or liquid, etc.) as a combination product. When component (a) and (b) are not formulated together in a single dosage unit, the 30 component (a) may be administered at the same time as component (b) or in any order; for example component (a) of this invention may be administered first, followed by administration of component (b), or they may be administered in the revserse order. If component (b) 35 contains more that one agent, e.g., one RT inhibitor and 194 WO 01/29037 PCT/USOO/28824 one protease inhibitor, these agents may be administered together or in any order. When not administered at the same time, preferably the administration of component (a) and (b) occurs less than about one hour apart. 5 Preferably, the route of administration of component (a) and (b) is oral. The terms oral agent, oral inhibitor, oral compound, or the like, as used herein, denote compounds which may be orally administered. Although it is preferable that component (a) and component (b) both 10 be administered by the same route (that is, for example, both orally) or dosage form, if desired, they may each be administered by different routes or dosage forms (for example, one component of the combination method may be administered orally, and another component may be 15 administered intravenously). As is appreciated by a medical practitioner skilled in the art, the dosage of the combination therapy of the invention may vary depending upon various factors such as the pharmacodynamic characteristics of the particular 20 agent and its mode and route of administration, the age, health and weight of the recipient, the nature and extent of the symptoms, the kind of concurrent treatment, the frequency of treatment, and the effect desired, as described above. 25 The proper dosage of components (a) and (b) of the combination method of this invention will be readily ascertainable by a medical practitioner skilled in the art, based upon the present disclosure. By way of general guidance, typically a daily dosage may be about 30 100 milligrams to about 1.5 grams of each component. If component (b) represents more than one compound, then typically a daily dosage may be about 100 milligrams to about 1.5 grams of each agent of component (b). By way of general guidance, when the compounds of component (a) 35 and component (b) are administered in combination, the 195 WO 01/29037 PCT/USOO/28824 dosage amount of each component may be reduced by about 70-80% relative to the usual dosage of the component when it is administered alone as a single agent for the treatment of HIV infection, in view of the synergistic 5 effect of the combination. The combination products of this invention may be formulated such that, although the active ingredients are combined in a single dosage unit, the physical contact between the active ingredients is minimized. In 10 order to minimize contact, for example, where the product is orally administered, one active ingredient may be enteric coated. By enteric coating one of the active ingredients, it is possible not only to minimize the contact between the combined active ingredients, but 15 also, it is possible to control the release of one of these components in the gastrointestinal tract such that one of these components is not released in the stomach but rather is released in the intestines. Another embodiment of this invention where oral administration 20 is desired provides for a combination product wherein one of the active ingredients is coated with a sustained-release material which effects a sustained-release throughout the gastrointestinal tract and also serves to minimize physical contact between the 25 combined active ingredients. Furthermore, the sustained-released component can be additionally enteric coated such that the release of this component occurs only in the intestine. Still another approach would involve the formulation of a combination product in 30 which the one component is coated with a sustained and/or enteric release polymer, and the other component is also coated with a polymer such as a lowviscosity grade of hydroxypropyl methylcellulose or other appropriate materials as known in the art, in order to 35 further separate the active components. The polymer 196 WO 01/29037 PCT/USOO/28824 coating serves to form an additional barrier to interaction with the other component. In each formulation wherein contact is prevented between components (a) and (b) via a coating or some other 5 material, contact may also be prevented between the individual agents of component (b). Dosage forms of the combination products of the present invention wherein one active ingredient is enteric coated can be in the form of tablets such that 10 the enteric coated component and the other active ingredient are blended together and then compressed into a tablet or such that the enteric coated component is compressed into one tablet layer and the other active ingredient is compressed into an additional layer. 15 Optionally, in order to further separate the two layers, one or more placebo layers may be present such that the placebo layer is between the layers of active ingredients. In addition, dosage forms of the present invention can be in the form of capsules wherein one 20 active ingredient is compressed into a tablet or in the form of a plurality of microtablets, particles, granules or non-perils, which are then enteric coated. These enteric coated microtablets, particles, granules or non-perils are then placed into a capsule or compressed 25 into a capsule along with a granulation of the other active ingredient. These as well as other ways of minimizing contact between the components of combination products of the present invention, whether administered in a single 30 dosage form or administered in separate forms but at the same time or concurrently by the same manner, will be readily apparent to those skilled in the art, based on the present disclosure. Pharmaceutical kits useful for the treatment of HIV 35 infection, which comprise a therapeutically effective 197 WO 01/29037 PCT/USOO/28824 amount of a pharmaceutical composition comprising a compound of component (a) and one or more compounds of component (b), in one or more sterile containers, are also within the ambit of the present invention. 5 Sterilization of the container may be carried out using conventional sterilization methodology well known to those skilled in the art. Component (a) and component (b) may be in the same sterile container or in separate sterile containers. The sterile containers of materials 10 may comprise separate containers, or one or more multi-part containers, as desired. Component (a) and component (b) may be separate, or physically combined into a single dosage form or unit as described above. Such kits may further include, if desired, one or more 15 of various conventional pharmaceutical kit components, such as for example, one or more pharmaceutically acceptable carriers, additional vials for mixing the components, etc., as will be readily apparent to those skilled in the art. Instructions, either as inserts or 20 as labels, indicating quantities of the components to be administered, guidelines for administration, and/or guidelines for mixing the components, may also be included in the kit. As will be appreciated by one of skill in the art, 25 numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein. 198

Claims (19)

1. A compound of formula (I): R 1 R 2 ,W X, A B) Z N 5 8 (I) or a stereoisomeric form or mixture of stereoisomeric forms or a pharmaceutically acceptable salt form thereof, wherein: 10 n is selected from 0, 1, 2 and 3; A is a ring selected from the group: N , an <'IIr /INI and -/Y N N 15 N wherein a ring nitrogen in ring A may optionally be in an N-oxide form; 20 said ring A being substituted with 0-3 B, said substituent B being independently selected from the group C 1 4 alkyl, -OH, C 1 _ 4 alkoxy, -S-Cl_ 4 alkyl, OCF 3 , CF 3 , F, Cl, Br, I, -NO 2 , -CN, and -NR 5 R 5 a; 25 W is N or CR 3 ; 199 WO 01/29037 PCT/USOO/28824 X is N or CR 3 a; Y is N or CR 3 b; 5 Z is N or CR 3 c; provided that if two of W, X, Y, and Z are N, then the remaining are other than N; 10 R1 is selected from the group C 1 - 3 alkyl substituted with 0-7 halogen, and cyclopropyl substituted with 0-5 halogen; R 2 is selected from the group -R 2 c, -OH, -CN, -OR 2 c, 15 -OCHR 2 aR 2 b, -OCH 2 CHR 2 aR 2 b, -O(CH 2 ) 2 CHR 2 aR 2 b, -OCHR 2 aC(R 2 a)=C(R 2 b) 2 , -OCHR 2 aC(R 2 a)=C(R 2 b) 2 , -OCHR 2 aC=C-R 2 b, -SR 2 c, -SCHR 2 aR 2 b, -SCH 2 CHR 2 aR 2 b, -S(CH 2 ) 2 CHR 2 aR 2 b, -SCHR 2 aC(R 2 a)=C(R 2 b) 2 , -SCHR 2 aC (R 2 a) = (R 2 b) 2, -SCHR 2 aC=C-R 2 b, -NR 2 aR 2 c, 20 -NHCHR 2 aR 2 b, -NHCH 2 CHR 2 aR 2 b, -NH (CH 2 ) 2 CHR 2 aR 2 b, -NHCHR 2 aC(R 2 a)=C(R 2 b) 2 , -NHCHR 2 aC(R 2 a)=(R 2 b) 2 , and -NHCHR 2 aC=C-R 2 b; R2a is selected from the group H, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , 25 and CH 2 CH 2 CH 3 ; R2b is H or R2c; R 2 c is selected from the group methyl substituted with 30 0-3 R 3 f, C 1 - 6 alkyl substituted with 0-3 R 4 , C2-5 alkenyl substituted with 0-2 R 4 , C2- 5 alkynyl substituted with 0-1 R 4 , C3- 6 cycloalkyl 200 WO 01/29037 PCT/USOO/28824 substituted with 0-2 R 3 d, phenyl substituted with 0-2 R3d, and 3-6 membered heterocyclic system containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-2 R 3 d; 5 alternatively, the group -NR 2 aR 2 c represents a 4-7 membered cyclic amine, wherein 0-1 carbon atoms are replaced by 0 or NR 5 ; 10 R 3 is selected from the group H, C 1 4 alkyl, -OH, C 1 4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5 R 5 a, -NO 2 , -CN, -C(O)R 6 , -NHC(O)R 7 , -NHC(O)NR 5 R 5 a, -NHSO 2 Rio, -SO 2 NR 5 R 5 a, and a 5-6 membered heteroaromatic ring containing 1-4 heteroatoms selected from the group 15 0, N, and S; R 3 a is selected from the group H, C 1 _ 4 alkyl, -OH, C 1 4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5 R 5 a, -NO 2 , -CN, -C(O)R 6 , -NHC(O)R 7 , -NHC(O)NR 5 R 5 a, -NHSO 2 R 1 0 , 20 -SO 2 NR 5 R 5 a, and a 5-6 membered heteroaromatic ring containing 1-4 heteroatoms selected from the group 0, N, and S; alternatively, R 3 and R 3 a together form -OCH 2 0-; 25 R3b is selected from the group H, C 1 4 alkyl, -OH, Ci_ 4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5 R 5 a, -NO 2 , -CN, -C(O)R 6 , -NHC(O)R 7 , -NHC(O)NR 5 R 5 a, -NHSO 2 R 10 , and -SO 2 NR 5 R 5 a; 30 alternatively, R 3 a and R 3 b together form -OCH 2 0-; 201 WO 01/29037 PCT/USOO/28824 R 3 c is selected from the group H, C 1 - 4 alkyl, -OH, C 1 -4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5 R 5 a, -NO 2 , -CN, -C(O)R 6 , -NHC(0)R 7 , -NHC(O)NR 5 R 5 a, -NHSO 2 R 1 0 , and -SO 2 NR 5 R 5 a; 5 alternatively, R3b and R 3 c together form -OCH 2 0-; R 3 d, at each occurrence, is independently selected from the group H, C 1 _ 4 alkyl, -OH, C 1 - 4 alkoxy, OCF 3 , F, 10 Cl, Br, I, -NR 5 R 5 a, -NO 2 , -CN, -C(O)R 6 , -NHC(O)R 7 , -NHC(O)NR 5 R 5 a, -NHSO 2 R 1 0 , and -SO 2 NR 5 R 5 a; R 3 e, at each occurrence, is independently selected from the group H, C 1 4 alkyl, -OH, C 1 _ 4 alkoxy, OCF 3 , F, 15 Cl, Br, I, -NR 5 R 5 a, -NO 2 , -CN, -C(O)R 6 , -NHC(O)R 7 , -NHC(O)NR 5 R 5 a, -NHSO 2 R 1 0 , and -SO 2 NR 5 R 5 a; R 3 f, is selected from the group group H, F, Cl, Br, I, -OH, -O-R 11 , -O-C 3 - 1 0 carbocycle substituted with 0 20 2 R 3 e, -O(CO)-R 1 3 , -OS(O) 2 C 1 _ 4 alkyl, -NR1 2 R1 2 a, -C(O)R 1 3 , -NHC(O)R 1 3 , -NHSO 2 R 1 0 , and -SO 2 NR1 2 R1 2 a; R 4 is selected from the group H, F, Cl, Br, I, -OH, -O-R 1 l, -O-C 3 - 1 0 carbocycle substituted with 0-2 25 R 3 e, -OS (0) 2 C 1 _ 4 alkyl, -NR1 2 R1 2 a, C 1 - 6 alkyl substituted with 0-2 R 3 e, C 3 - 1 0 carbocycle substituted with 0-2 R 3 e, phenyl substituted with 0-5 R 3 e, and a 5-10 membered heterocyclic system containing 1-3 heteroatoms selected from the group 30 0, N, and S, substituted with 0-2 R 3 e; 202 WO 01/29037 PCT/USOO/28824 R 5 and R 5 a are independently selected from the group H and C 1 4 alkyl; alternatively, R 5 and R 5 a, together with the nitrogen to 5 which they are attached, combine to form a 5-6 membered ring containing 0-1 0 or N atoms; R 6 is selected from the group H, OH, C 1 4 alkyl, C 1 -4 alkoxy, and NR 5 R 5 a; 10 R 7 is selected from the group H, C 1 - 3 alkyl and C 1 -3 alkoxy; R 8 is selected from the group H, (C 1 - 6 alkyl)carbonyl, 15 C1- 6 alkoxyalkyl, (C 1 - 4 alkoxy)carbonyl, C6- 10 aryloxyalkyl, (C 6 - 1 0 aryl)oxycarbonyl, (C 6 -10 aryl)methylcarbonyl, (C 1 - 4 alkyl)carbonyloxy(Ci-4 alkoxy)carbonyl, C6-10 arylcarbonyloxy(Ci-4 alkoxy)carbonyl, C 1 - 6 alkylaminocarbonyl, 20 phenylaminocarbonyl, phenyl(Ci_ 4 alkoxy)carbonyl, and (C 1 - 6 alkyl substitued with NR 5 R 5 a)carbonyl; and R 1 0 is selected from the group Ci_ 4 alkyl and phenyl 25 R 11 is selected from C 1 - 6 alkyl, C 1 - 6 haloalkyl, C 1 -6 alkyl substituted with C 3 - 6 cycloalkyl, C 2 - 6 alkenyl, C 2 - 6 alkynyl, C 3 - 6 cycloalkyl; R 1 2 and R 1 2 a are independently selected from H, C 1 -6 30 alkyl, and C 3 -6 cycloalkyl; 203 WO 01/29037 PCT/USOO/28824 alternatively, R 1 2 and R12a can join to form 4-7 membered ring; and R1 3 is selected from the group H, C 1 - 6 alkyl, C 1 -6 5 haloalkyl, C 1 - 6 alkoxy, C2- 6 alkenyl, C2- 6 alkynyl, -0-C2- 6 alkenyl, -0-C2- 6 alkynyl, NR1 2 R1 2 a, C 3 - 6 carbocycle, and -O-C 3 - 6 carbocycle.

2. A compound of claim 1 or pharmaceutically 10 acceptable salt forms thereof, wherein: R 1 is selected from the group C 1 - 3 alkyl substituted with 1-7 halogen, and cyclopropyl; 15 R 2 is selected from the group -R 2 c, -OH, -CN, -OR 2 c, -OCHR 2 aR 2 b, -OCH 2 CHR 2 aR 2 b, -O(CH 2 ) 2 CHR 2 aR 2 b, -OCHR 2 aCH=CHR 2 b, -OCHR 2 aCH=CHR 2 c, -OCHR 2 aC=CR 2 b, -NR 2 aR 2 c, -SR 2 c, -SCHR 2 aR 2 b, -SCH 2 CHR 2 aR 2 b, -SCHR 2 aCH=CHR 2 b, -SCHR 2 aCH=CHR 2 c, and -SCHR 2 aC=CR 2 b; 20 R 2 a is selected from the group H, CH

3 , CH 2 CH 3 , CH(CH 3 ) 2 , and CH 2 CH 2 CH 3 ; R2b is H or R 2 c; 25 R 2 c is selected from the group methyl substituted with 0-3 R 3 f, C 1 - 5 alkyl substituted with 0-3 R 4 , C2-5 alkenyl substituted with 0-2 R 4 , C2- 5 alkynyl substituted with 0-1 R 4 , C3- 6 cycloalkyl 30 substituted with 0-2 R3d, and phenyl substituted with 0-2 R 3 d; 204 WO 01/29037 PCT/USOO/28824 R 3 and R 3 a, at each occurrence, are independently selected from the group H, C 1 - 4 alkyl, OH, C 1 4 alkoxy, F, Cl, Br, I, NR 5 R 5 a, NO 2 , -CN, C(O)R 6 , NHC(O)R 7 , NHC(O)NR 5 R 5 a, and a 5-6 membered 5 heteroaromatic ring containing 1-4 heteroatoms selected from the group 0, N, and S; alternatively, R 3 and R 3 a together form -OCH 2 0-; 10 R 3 b and R 3 c, at each occurrence, are independently selected from the group H, C 1 - 4 alkyl, OH, C 1 -4 alkoxy, F, Cl, Br, I, NR 5 R 5 a, NO 2 , -CN, C(O)R 6 , NHC(O)R 7 , and NHC(O)NR 5 R 5 a; 15 alternatively, R 3 a and R3b together form -OCH 2 0-; R 4 is selected from the group H, Cl, F, -OH, -O-Ci- 6 alkyl, -O-C 3 - 5 carbocycle substituted with 0 2 R 3 e, -OS(O) 2 C 1 _ 4 alkyl, -NR1 2 R1 2 a, C 1 4 alkyl 20 substituted with 0-2 R 3 e, C 3 - 5 carbocycle substituted with 0-2 R 3 e, phenyl substituted with 0-5 R 3 e, and a 5-6 membered heterocyclic system containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-2 R 3 e; 25 R 5 and R 5 a are independently selected from the group H, CH 3 and C 2 H 5 ; R 6 is selected from the group H, OH, CH 3 , C 2 H 5 , OCH 3 , 30 OC 2 H 5 , and NR 5 R 5 a; and 205 WO 01/29037 PCT/USOO/28824 R 7 is selected from the group CH 3 , C 2 H 5 , CH(CH 3 ) 2 , OCH 3 , OC 2 H 5 , and OCH(CH 3 ) 2 3. A compound of claim 2, wherein: 5 ring A is selected from NN and N O O R 1 is selected from the group CF 3 , C 2 F 5 , CHF 2 , CF 2 CH 3 and 10 cyclopropyl; R 2 is selected from the group -R 2 c, -OH, -CN, -OR 2 c, -OCHR 2 aR2b, -OCH 2 CHR 2 aR2b, -OCHR 2 aCH=CHR 2 b, -OCHR 2 aCH=CHR 2 c, -OCHR 2 aC=CR 2 b, and -NR 2 aR 2 c; 15 R 2 a is selected from the group H, CH 3 , CH 2 CH 3 , CH(CH 3 ) 2 , and CH 2 CH 2 CH 3 ; R2b is H or R 2 c; 20 R 2 c is selected from the group methyl substituted with 0-3 R 3 f, C 1 - 3 alkyl substituted with 0-3 R 4 , C 2 -3 alkenyl substituted with 0-2 R 4 , C2- 3 alkynyl substituted with 0-1 R 4 , and C3- 6 cycloalkyl 25 substituted with 0-2 R3d; 206 WO 01/29037 PCT/USOO/28824 R 3 , R 3 a, R 3 b, and R 3 c, at each occurrence, are independently selected from the group H, C 1 -3 alkyl, OH, C 1 - 3 alkoxy, F, Cl, Br, I, NR5R 5 a, NO 2 , CN, C(O)R 6 , NHC(O)R 7 , and NHC(O)NR 5 R 5 a; 5 alternatively, R 3 and R 3 a together form -OCH 2 0-; R 3 e, at each occurrence, is independently selected from the group H, C 1 4 alkyl, -OH, C 1 - 4 alkoxy, OCF 3 , F, 10 Cl, -NR 5 R 5 a, -C(O)R 6 , and -SO 2 NR 5 R 5 a; R 3 f is selected from the group group H, F, Cl, Br, -OH, -O-R 11 , -0-cyclopropyl substituted with 0-2 R 3 e, 0-cyclobutyl substituted with 0-2 R 3 e, -0-phenyl 15 substituted with 0-2 R 3 e, -O(CO)-R1 3 , -OS(O) 2 Ci_ 4 alkyl, -NR1 2 R1 2 a, -C(O)R1 3 , -NHC(0)R 1 3 , -NHSO 2 R 1 0 , and -SO 2 NR1 2 R1 2 a; R 4 is selected from the group H, Cl, F, -OH, 20 -O-C 1 - 6 alkyl, -O-C 3 - 1 0 carbocycle substituted with 0-2 R 3 e, -OS(O) 2 C 1 _ 4 alkyl, -NR1 2 R1 2 a C 1 4 alkyl substituted with 0-1 R 3 e, C 3 - 5 carbocycle substituted with 0-2 R 3 e, phenyl substituted with 0-2 R 3 e, and a 5-6 membered heterocyclic system 25 containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-1 R 3 e; R 5 and R 5 a are independently selected from the group H, CH 3 and C 2 H 5 ; 30 R 6 is selected from the group H, OH, CH 3 , C 2 H 5 , OCH 3 , OC 2 H 5 , and NR 5 R 5 a; and 207 WO 01/29037 PCT/USOO/28824 R 7 is selected from the group CH 3 , C 2 H 5 , OCH 3 , and OC 2 H 5 ; R 1 l is selected from methyl, ethyl, propyl, i-propyl, 5 butyl, pentyl, hexyl, CF 3 , CH 2 CF 3 , CH 2 CH 2 CF 3 , -CH 2 -cyclopropyl, and cyclopropyl; R 1 2 and R12a are independently selected from H, methyl, ethyl, propyl, i-propyl, butyl, pentyl, and 10 cyclopropyl; R 13 is selected from the group H, methyl, ethyl, propyl, i-propyl, butyl, pentyl, hexyl, C 1 - 6 haloalkyl, methoxy, ethoxy, propoxy, i-propoxy, butoxy, 15 NR1 2 R1 2 a, cyclopropyl, cyclobutyl, cyclopropoxy, and cyclobutoxy.

4. A compound of claim 3, or a pharmaceutically acceptable salt form thereof, wherein: 20 R 1 is CF 3 , CF 2 CH 3 , or CHF 2 ; R 2 is selected from the group -R 2 c, -OH, -CN, -OCH 2 R 2 b, -OCH 2 CH 2 R 2 b, -OCH 2 CH=CHR 2 b, -OCH 2 C=CR 2 b, and 25 NR 2 aR 2 c; R2b is H or R 2 c; R 2 c is selected from the group methyl substituted with 30 0-3 R 3 f, C 1 - 3 alkyl substituted with 0-3 R 4 , C 2 -3 alkenyl substituted with 1 R 4 , and C 2 - 3 alkynyl substituted with 1 R 4 ; 208 WO 01/29037 PCT/USOO/28824 R 3 , R 3 a, R3b, and R 3 c, at each occurrence, are independently selected from the group H, C 1 -3 alkyl, OH, C 1 - 3 alkoxy, F, Cl, NR

5 R 5 a, NO 2 , -CN, C(O)R 6 , NHC(O)R 7 , and NHC(O)NR 5 R 5 a; 5 alternatively, R 3 and R 3 a together form -OCH 2 0-; R 3 e, at each occurrence, is independently selected from the group CH 3 , -OH, OCH 3 , OCF 3 , F, Cl, and -NR 5 R 5 a; 10 R 3 f, is selected from the group group H, F, Cl, -OH, -O-R 1 1 , -O (CO) -R 1 3 , -OS(0) 2 C 1 4 alkyl, -NR1 2 R1 2 a, and -NHC (0) NR1 2 R1 2 a; 15 R 4 is selected from the group H, Cl, F, CH 3 , CH 2 CH 3 , cyclopropyl substituted with 0-1 R 3 e, 1-methyl cyclopropyl substituted with 0-1 R 3 e, cyclobutyl substituted with 0-1 R 3 e, phenyl substituted with 0-2 R 3 e, and a 5-6 membered heterocyclic system 20 containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-1 R 3 e, wherein the heterocyclic system is selected from the group 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 25 2-thiazolyl, 4-isoxazolyl, 2-imidazolyl, morpholinyl, piperidinyl, pyrrolidinyl, and piperazinyl; R 5 and R 5 a are independently selected from the group H, 30 CH 3 and C 2 H 5 ; R 6 is selected from the group H, OH, CH 3 , C 2 H 5 , OCH 3 , OC 2 H 5 , and NR 5 R 5 a; and 209 WO 01/29037 PCT/USOO/28824 R 7 is selected from the group CH 3 , C 2 H 5 , OCH 3 , and OC 2 H 5 5 5. A compound of claim 1, or a pharmaceutically acceptable salt form thereof, wherein: n is 0 or 1; 10 ring A is optionally in an N-oxide form; R 1 is CF 3 , CHF 2 , or CF 2 CH 3 ; R 2 is selected from the group -R 2 c, -OR 2 c, -OH, -CN, 15 -OCH 2 R 2 b, -OCH 2 CH 2 R 2 b, -OCH 2 C=C-R 2 b, -OCH 2 C=C-R 2 b, -NR 2 aR 2 c, -SR 2 c, -SCH 2 R 2 b, -SCH 2 CH 2 R 2 b, -SCH 2 CH=CHR 2 b, and -SCH 2 C=CR 2 b; R2b is H or R 2 c; 20 R 2 c is selected from the group methyl substituted with 0-2 R 3 f, ethyl substituted with 0-3 R 4 , propyl substituted with 0-2 R 4 , ethenyl substituted with 0-2 R 4 , 1-propenyl substituted with 0-2 R 4 , 25 2-propenyl substituted with 0-2 R 4 , ethynyl substituted with 0-2 R 4 , 1-propynyl substituted with 0-2 R 4 , 2-propynyl substituted with 0-2 R 4 , and cyclopropyl substituted with 0-1 R 3 d. 30 R 3 e, at each occurrence, is independently selected from the group CH 3 , -OH, OCH 3 , OCF 3 , F, Cl, and -NR5R 5 a; 210 WO 01/29037 PCT/USOO/28824 R 3 f, is selected from the group group H, F, Cl, -OH, -O-R 11 , -O (CO) -R1 3 , -OS(0) 2 Ci_ 4 alkyl, -NR1 2 R1 2 a, and -NHC (0) NR1 2 R1 2 a; 5 R 4 is selected from the group H, Cl, F, CH 3 , CH 2 CH 3 , cyclopropyl substituted with 0-1 R 3 e, 1-methyl cyclopropyl substituted with 0-1 R 3 e, cyclobutyl substituted with 0-1 R 3 e, phenyl substituted with 0-2 R 3 e, and a 5-6 membered heterocyclic system 10 containing 1-3 heteroatoms selected from the group 0, N, and S, substituted with 0-1 R 3 e, wherein the heterocyclic system is selected from the group 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furanyl, 3-furanyl, 2-thienyl, 3-thienyl, 2-oxazolyl, 15 2-thiazolyl, 4-isoxazolyl, 2-imidazolyl, morpholinyl, piperidinyl, pyrrolidinyl, and piperazinyl; R 5 and R 5 a are independently selected from the group H, 20 CH 3 and C 2 H 5 ; R 6 is selected from the group H, OH, CH 3 , C 2 H 5 , OCH 3 , OC 2 H 5 , and NR 5 R 5 a; 25 R 7 is selected from the group CH 3 , C 2 H 5 , OCH 3 , and OC 2 H 5 ; R 8 is H.

6. A compound of claim 4, or a pharmaceutically 30 acceptable salt form thereof, wherein: n is selected from 0 or 1; 211 WO 01/29037 PCT/USOO/28824 A is selected from 'J , and o0. B is selected from methyl, ethyl, propyl, -OH, Cl, Br, 5 -S-CH 3 , W is CR 3 ; X is CR 3 a; 10 Y is CR 3 a; Z is N or CR 3 a; 15 R1 is selected from CF 3 , CHF 2 , and CF 2 CH 3 ; R 2 is selected from -R 2 c, -OH, -CN, -OR 2 c, -OCH 2 C=C-R 2 b, -OCH 2 C=C-R 2 b, and -NR 2 aR 2 c; 20 R 2 a is H; R2b is H; R 2 c is selected from the group methyl substituted with 25 0-3 R 3 f, ethyl substituted with 0-3 R 4 , propyl substituted with 0-3 R 4 , i-propyl substituted with 0-3 R 4 , butyl substituted with 0-3 R 4 , 1-propenyl substituted with 0-2 R 4 , 2-propenyl substituted with 0-2 R 4 , 1-propynyl substituted with 0-2 R 4 , 30 2-propynyl substituted with 0-2 R 4 ; 212 WO 01/29037 PCT/USOO/28824 R 3 is H; R 3 a is H, F, Cl, or Br; 5 R3b is H; R3c is H; 10 R 3 e, at each occurrence, is independently selected from the group H, methyl, and ethyl, -OH, C 1 _ 4 alkoxy, OCF 3 , F, Cl, Br, I, -NR 5 R 5 a, -NO 2 , -CN, -C(O)R 6 , -NHC(O)R 7 , -NHC(O)NR 5 R 5 a, -NHSO 2 R 1 0 , and -SO 2 NR 5 R 5 a; 15 R 3 f is selected from H, F, Cl, OH, -OR 1 1 , -OSO 2 methyl, NR1 2 R1 2 a, and -NHC(O)NR 5 R 5 a; R 4 is selected from H, F, -OH, -O-i-propyl, -OS(0) 2 CH 3 , cyclopropyl substituted with 0-1 R 3 e, cyclobutyl 20 substituted with 0-1 R 3 e, phenyl, N-morpholinyl, 2 pyridyl, 3-pyridyl, 4-pyridiyl, N2-methyl-N1 piperidinyl, N-piperidinyl, N-pyrrolidinyl, and N piperazinyl; 25 R 8 is H; R 11 is selected from H, methyl, ethyl, propyl, i-propyl, CH 2 cyclopropyl, and cyclopropyl; and 30 R 1 2 and R 12 a are independently selected from H, methyl, ethyl, propyl, i-propyl, and cyclopropyl. 213 WO 01/29037 PCT/USOO/28824

7. A compound of claim 1, or a pharmaceutically acceptable salt form thereof, wherein the compound is of formula (Ic): R ,R 2 W ' \ A B Z N 8 5 (Ic)

8. A compound of claim 1, or a pharmaceutically acceptable salt form thereof, wherein the compound is of 10 formula (Id): R 2 ,R 1 A B Z N (Id) 15

9. A compound of claim 1, or a pharmaceutically acceptable salt form thereof or an N-oxide form thereof, wherein the compound of formula (I) is selected from: 7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-5 20 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(benzyloxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 25 7-Chloro-5-(cyclobutylmethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, -214 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(ethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(hydroxy)-5,10-dihydro-5 5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(n-propoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 10 7-Chloro-5-(i-propoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(butyl)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 15 7-Chloro-5-(methoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5(S)-(cyclopropylmethoxy)-5,10-dihydro-5 20 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5(R)-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 25 7-Chloro-5-(2-cyclopropylethyl)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(2,2,2-trifluoroethoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 30 7-Chloro-5-(propargoxy)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(ethyl)-5,10-dihydro-5 35 (trifluoromethyl)benzo[b][1,8]naphthyridine, 215 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(cyclopropylmethoxy)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 5 7-Chloro-5-(n-butyl)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(2-cyclopropylethyl)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 10 7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-2 (methylthio)-5-(trifluoromethyl)pyrimido[4,5 b]quinoline, 15 7-Chloro-5-(i-butoxy)-5,10-dihydro-2-(methylthio)-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(benzyloxy)-5,10-dihydro-2-(methylthio)-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 20 7-Chloro-5-(2-pyridylmethoxy)-5,10-dihydro-2 (methylthio)-5-(trifluoromethyl)pyrimido[4,5 b]quinoline, 25 7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(cyclopropylamino)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 30 7-Chloro-5-(i-propylamino)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(N,N-dimethylaminoethoxy)-5,10-dihydro-5 35 (trifluoromethyl)benzo[b][1,8]naphthyridine, 216 WO 01/29037 PCT/USOO/28824 7-Chloro-5- (N-morpholinylethylamino) -5, 10-dihydro-5 (trifluoromethyl)benzo [bl l, 8]naphthyridine, 5 7-Chloro-5- ( (-methylcyclopropyl)methoxy) -5, 10-dihydro 5- (trifluoromethyl)benzo [b] [1, 8]naphthyridine, 7-Chloro-5- (3, 3, 3-trifluoroprop-1-oxy) -5, 1O-dihydro-5 (trifluoromethyl)benzo lb] [1, 8]naphthyridine, 10 7-Chloro-5-(cyclopropylmethylamino) -5, 10-dihydro-5 (trifluoromethyl)benzo [b] [1, 8]riaphthyridine, 7-Chloro-5- (methylamino) -5,10-dihydro-5 15 (trifluoromethyl)benzo [b][1l, 8]naphthyridine, 7-Chloro-5-(ethylamino) -5,10-dihydro-5 (trifluoromethyl)benzo Eb]El, 8]naphthyridine, 20 (S)-7-Chloro-5-(cyclopropylethyl) -5,10-dihydro-5 (trifluoromethyl)benzo Eb]El, 8]naphthyridine, (R) -7-Chloro-5-(cyclopropylethyl) -5, lO-dihydro-5 (trifluoromethyl)benzo [b] [1, 8]naphthyridine, 25 7-Fluoro-5- (cyclopropylmethoxy) -5, 10-dihydro-5 (trifluoromethyl)benzo [b] l, 8]naphthyridine, 7-Fluoro-5- (cyclopropylethoxy) -5,l0-dihydro-5 30 (trifluoromethyl)benzo Eb] [1, 8]naphthyridine, 7-Fluoro-5- (allyloxy) -5, 10-dihydro-5 (trifluoromethyl)benzo [b] [1, 8]naphthyridine, 217 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(phenylamino)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(cyclopropylmethoxy)-2-methyl-5,10-dihydro-5 5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(n-butyl)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 10 7-Chloro-5-(cyclopropylethyl)-2-methyl-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]naphthyridine, 7-Chloro-5-(cyclobutylmethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 15 7-Chloro-5-(methoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, (S)-7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-5 20 (trifluoromethyl)pyrimido[4,5-b]quinoline, (R)-7-Chloro-5-(cyclopropylmethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 25 7-Chloro-5-(N-piperidinylethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(N-pyrrolidinylethoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 30 7-Chloro-5-((4-methylpiperazin-1-yl)prop-1-oxy)-5,10 dihydro-5-(trifluoromethyl)pyrimido[4,5 b]quinoline, 218 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(prop-1-oxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(N,N-dimethylaminoprop-1-yl)-5,10-dihydro-5 5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(benzyloxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 10 7-Chloro-5-(3-pyridinylmethyl)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 7-Chloro-5-(allyloxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, 15 7-Chloro-5-(propargoxy)-5,10-dihydro-5 (trifluoromethyl)pyrimido[4,5-b]quinoline, and 7-Chloro-5-(N,N-dimethylaminoethyl)-5,10-dihydro-5 20 (trifluoromethyl)pyrimido[4,5-b]quinoline; 7-Chloro-5-cyclopropylmethoxy-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 25 5-Allyloxy-7-fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine; 7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine-5-carbonitrile; 30 7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-ol; 219 WO 01/29037 PCT/USOO/28824 5-Cyclopropylmethoxy-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 7-Chloro-5-prop-2-ynyloxy-5-trifluoromethyl-5,10 5 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 7-Chloro-5-(1-methyl-cyclopropylmethoxy)-5 trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 10 7-Chloro-5-(2-cyclopropyl-ethoxy)-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; (7-Chloro-5-trifluoromethyl-5,10-dihydro 15 benzo[b][1,8]naphthyridin-5-yl)-isopropyl-amine; (7-Chloro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-cyclobutylmethyl amine; 20 7-Chloro-5-(2-cyclopropyl-ethyl)-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 5-Cyclobutylmethoxy-7-fluoro-5-trifluoromethyl-5,10 25 dihydro-benzo[b][1,8]naphthyridine 1-oxide; (7-Fluoro-1-oxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-isopropyl-amine; 30 5-Cyclobutylmethoxy-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridin-2-ol; 220 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(pyridin-2-ylmethoxy)-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine; 5-Butyl-7-fluoro-5-trifluoromethyl-5,10-dihydro 5 benzo[b][1,8]naphthyridine; 7-Chloro-1-oxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-ol; 10 7-Chloro-5-cyclopropylmethoxy-5-trifluoromethyl-5,10 dihydro-benzojb][1,8]naphthyridine 1-oxide; 7-Chloro-5-pyridin-2-ylmethyl-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 15 7-Fluoro-5-pyridin-2-ylmethyl-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine; 5-Cyclopropylmethoxy-7-fluoro-5-trifluoromethyl-5,10 20 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 7-Chloro-5-pyridin-2-ylmethyl-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine; 25 3,7-Dichloro-5-cyclopropylmethoxy-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine; 3,7-Dichloro-5-cyclopropylmethoxy-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 30 3,7-Dichloro-5-pentyl-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 221 WO 01/29037 PCT/USOO/28824 5-(2-Cyclopropyl-ethyl)-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine; 5-(2-Cyclopropyl-ethyl)-7-fluoro-5-trifluoromethyl-5,10 5 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 3,7-Dichloro-5-cyclopropylmethoxy-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 10 5-(2-Cyclopropyl-ethyl)-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 3-Chloro-5-cyclopropylmethoxy-7-fluoro-5 trifluoromethyl-5,10-dihydro 15 benzo[b][1,8]naphthyridine; 3-Chloro-5-cyclopropylmethoxy-7-fluoro-5 trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 20 7-Chloro-5-isobutoxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 5-Butyl-7-chloro-5-trifluoromethyl-5,10-dihydro 25 benzo[b][1,8]naphthyridine 1-oxide; (S) 3-Chloro-5-cyclopropylmethoxy-7-fluoro-5 trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 30 (7-Chloro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-methanol; 222 WO 01/29037 PCT/USOO/28824 7-Fluoro-5-isobutoxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 7-Fluoro-5-isopropoxy-5-trifluoromethyl-5,10-dihydro 5 benzo[b][1,8]naphthyridine 1-oxide; Methanesulfonic acid 7-chloro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridin-5-ylmethyl ester; 10 7-Chloro-5-isopropoxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; (7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetonitrile; 15 7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine-5-carbaldehyde; 3-Bromo-5-cyclopropylmethoxy-7-fluoro-5-trifluoromethyl 20 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 5-Butyl-7-fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 25 5-Diisopropoxymethyl-7-fluoro-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine; 7-Fluoro-5-isopropoxymethyl-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 30 7-Chloro-5-isobutyl-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 223 WO 01/29037 PCT/USOO/28824 7-Chloro-5-propoxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; (S) 7-Fluoro-5-isobutoxy-5-trifluoromethyl-5,10-dihydro 5 benzo[b][1,8]naphthyridine 1-oxide; (R) 7-Fluoro-5-isobutoxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridine 1-oxide; 10 (7-Chloro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetaldehyde; 7-Chloro-5-(2,2-diisopropoxy-ethyl)-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine; 15 7-Chloro-5-(2-isopropoxy-ethyl)-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine; 2-(7-Chloro-5-trifluoromethyl-5,10-dihydro 20 benzo[b][1,8]naphthyridin-5-yl)-ethanol; 7-Chloro-5-(2-isopropoxy-ethyl)-5-trifluoromethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 25 (R) 7-Fluoro-5-(2-isopropoxy-ethyl)-5-trifluoromethyl 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; (7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetic acid tert 30 butyl ester; 224 WO 01/29037 PCT/USOO/28824 (7-Fluoro-1-oxy-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetic acid tert butyl ester; 5 (7-Fluoro-5-trifluoromethyl-5,10-dihydro benzo[b][1,8]naphthyridin-5-yl)-acetic acid; 7-Chloro-5-cyclopropylmethoxy-2-methylsulfanyl-5 trifluoromethyl-5,10-dihydro-pyrimido[4,5 10 b]quinoline; 7-Chloro-5-isobutoxy-2-methylsulfanyl-5-trifluoromethyl 5,10-dihydro-pyrimido[4,5-b]quinoline; 15 5-Benzyloxy-7-chloro-2-methylsulfanyl-5-trifluoromethyl 5,10-dihydro-pyrimido[4,5-b]quinoline; 7-Chloro-2-methylsulfanyl-5-(pyridin-2-ylmethoxy)-5 trifluoromethyl-5,10-dihydro-pyrimido[4,5 20 blquinoline; 7-Chloro-5-cyclopropylmethoxy-5-trifluoromethyl-5,10 dihydro-pyrimido[4,5-blquinoline 1-oxide; 25 7-Chloro-5-cyclopropylmethoxy-5-(1,1-difluoro-ethyl) 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 5-Cyclopropylmethoxy-5-(1,1-difluoro-ethyl)-7-fluoro 5,10-dihydro-benzo[b][1,8]naphthyridine; 30 5-Cyclopropylmethoxy-5-(1,1-difluoro-ethyl)-7-fluoro 5,10-dihydro-benzo[b][1,8]naphthyridine 1-oxide; 225 WO 01/29037 PCT/USOO/28824 7-Chloro-5-(1,1-difluoro-ethyl)-5-isobutoxy-5,10 dihydro-benzo[b][1,8]naphthyridine; 7-Chloro-5-(1,1-difluoro-ethyl)-5-isobutoxy-5,10 5 dihydro-benzo[b][1,8]naphthyridine 1-oxide; (R) 7-Chloro-5-cyclopropylmethoxy-5-(1,1-difluoro ethyl)-5,10-dihydro-benzo[b][1,8]naphthyridine 1 oxide; 10 (S) 7-Chloro-5-cyclopropylmethoxy-5-(1,1-difluoro ethyl)-5,10-dihydro-benzo[b][1,8]naphthyridine 1 oxide; 15 3-Chloro-10-cyclopropylmethoxy-10-trifluoromethyl-9,10 dihydro-1,8,9-triaza-anthracene; 3-Chloro-10-cyclopropylmethoxy-10-trifluoromethyl-9,10 dihydro-1,8,9-triaza-anthracene 8-oxide; 20 3,6-Dichloro-10-cyclopropylmethoxy-10-trifluoromethyl 9,10-dihydro-1,8,9-triaza-anthracene; 3-Chloro-10-isobutoxy-10-trifluoromethyl-9,10-dihydro 25 1,8,9-triaza-anthracene; 3-Chloro-10-isobutoxy-10-trifluoromethyl-9,10-dihydro 1,8,9-triaza-anthracene 8-oxide; 30 7-Chloro-5-difluoromethyl-5-isopropoxymethyl-5,10 dihydro-benzo[b][1,8]naphthyridine; 7-Chloro-5-difluoromethyl-5-isopropoxymethyl-5,10 dihydro-benzo[b][1,8]naphthyridine 1-oxide; 35 226 WO 01/29037 PCT/USOO/28824 7-chloro-1,5-dihydro-5-(N-ethylaminomethyl)-5 (trifluoromethyl)benzo[b][1,8]napthyridine; 7-chloro-5,10-dihydro-5-(N-isopropylaminomethyl)-5 5 (trifluoromethyl)benzo[b][1,8]napthyridine; 7-chloro-5,10-dihydro-5-(N-isopropyl-N ethylaminomethyl)-5 (trifluoromethyl)benzo[b][1,8]napthyridine; 10 7-chloro-5-(N,N-diethylaminomethyl)-5,10-dihydro-5 (trifluoromethyl)benzo[b][1,8]napthyridine; 5-(acetamidomethyl)-7-chloro-5,10-dihydro-5 15 (trifluoromethyl) [b][1,8]napthyridine; 5,10-dihydro-7-fluoro-5-(N-methylsulfonylmethyl)-5 (trifluoromethyl) [b][1,8]napthyridine; 20 5,10-dihydro-7-fluoro-5-(isopropylamidomethyl)-5 (trifluoromethyl) [b][1,8]napthyridine; 5,10-dihydro-7-fluoro-5-(isopropylguanadinomethyl)-5 (trifluormethyl) [b][1,8]napthyridine; 25 1,5-dihydro-7-fluoro-5-(N-isopropylmethyl)-5 (trifluoromethyl) [b][1,8]napthyridine-1-(N-oxide); 5-(N,N-diethylaminomethyl)-5,10-dihydro-7-fluoro-5 30 (trifluoromethyl) [b][1,8]napthyridine-1-(N-oxide); 5,10-dihydro-5-(N,N-dimethylaminomethyl)-7-fluoro-5 (trifluoromethyl) [b][1,8]napthyridine-1-(N-oxide); 227 WO 01/29037 PCT/USOO/28824 7-chloro-5,10-dihydro-5-(N-isopropylaminomethyl)-5 (trifluoromethyl) [b][1,8]napthyridine-l-(N-oxide); 5 7-chloro-5-(N,N-diethylaminomethyl)-5,10-dihydro-5 (trifluoromethyl) [b][1,8]napthyridine-l-(N-oxide); and 7-chloro-5,10-dihydro-5-(N,N-dimethylaminomethyl)-5 10 (trifluoromethyl) [b][1,8]napthyridine-1-(N-oxide.

10. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a compound of claim 15 1-9 or pharmaceutically acceptable salt form thereof.

11. A method for treating HIV infection which comprises administering to a host in need of such treatment a therapeutically effective amount of a 20 compound of claim 1-9 or pharmaceutically acceptable salt form thereof.

12. A method of treating HIV infection which comprises administering, in combination, to a host in 25 need thereof a therapeutically effective amount of: (a) a compound of claim 1-9; and, (b) at least one compound selected from the group consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors. 30

13. A method of claim 12, wherein the reverse transcriptase inhibitor is selected from the group AZT, ddC, ddI, d4T, 3TC, delavirdine, efavirenz, nevirapine, Ro 18,893, trovirdine, MKC-442, HBY 097, HBY1293, GW867, 228 WO 01/29037 PCT/USOO/28824 ACT, UC-781, UC-782, RD4-2025, MEN 10979 and AG1549 (S1153) , and the protease inhibitor is selected from the group saquinavir, ritonavir, indinavir, amprenavir, nelfinavir, palinavir, BMS-232623, GS3333, KNI-413, 5 KNI-272, LG-71350, CGP-61755, PD 173606, PD 177298, PD 178390, PD 178392, U-140690, and ABT-378.

14. A method of claim 13, wherein the reverse transcriptase inhibitor is selected from the group AZT, 10 efavirenz, and 3TC and the protease inhibitor is selected from the group saquinavir, ritonavir, nelfinavir, and indinavir.

15. A method of claim 14, wherein the reverse 15 transcriptase inhibitor is AZT.

16. A method of claim 14, wherein the protease inhibitor is indinavir. 20

17. A pharmaceutical kit useful for the treatment of HIV infection, which comprises a therapeutically effective amount of: (a) a compound of claim 1-8; and, (b) at least one compound selected from the group 25 consisting of HIV reverse transcriptase inhibitors and HIV protease inhibitors, in one or more sterile containers.

18. A compound of claim 1-9 for use in therapy. 30

19. The use of a compound of claim 1-9 for the manufacture of a medicament for the treatment of HIV infection. 229