CN106755091A - Gene knockout carrier, MH7A cell NLRP1 gene knockout methods - Google Patents
Gene knockout carrier, MH7A cell NLRP1 gene knockout methods Download PDFInfo
- Publication number
- CN106755091A CN106755091A CN201611066999.5A CN201611066999A CN106755091A CN 106755091 A CN106755091 A CN 106755091A CN 201611066999 A CN201611066999 A CN 201611066999A CN 106755091 A CN106755091 A CN 106755091A
- Authority
- CN
- China
- Prior art keywords
- gene knockout
- nlrp1
- cell
- seq
- mh7a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0656—Adult fibroblasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Rheumatology (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to biology field, in particular to a kind of gene knockout carrier and its construction method and application, MH7A cell NLRP1 gene knockout methods.The present invention uses CRISPR Cas9 gene knockout systems, with NLRP1 as target gene carries out CRISPR targeting sequences Designs and has prepared knockout carrier for NLRP1 genes, MH7A cells are transfected using it, the NLRP1 genes in MH7A cells can efficiently be knocked out, so as to effectively erect a research platform for rheumatoid arthritis, the research of rheumatoid arthritis pathogenesis is greatly promoted, and the research to NLRP1 inflammatories body and the various inflammatory factors interaction molecular mechanism related to rheumatoid arthritis and synovitis morbidity can be promoted.
Description
Technical field
The present invention relates to biology field, in particular to a kind of gene knockout carrier and its construction method with
Using MH7A cell NLRP1 gene knockout methods.
Background technology
Rheumatoid arthritis (Rheumatoid Arthritis, RA) is a kind of slow with arthrosynovitis as principal character
Property autoimmune disease, China's RA incidences of disease are about 0.3%~0.6%, and the incidence of disease is high, and disability rate is high, the serious harm mankind
Health.
The RA causes of disease are not still very clear and definite so far, but the research for coming this year shows that its morbidity may be with nucleotides combination oligomerization
(nucleotide-binding, leucine-rich repeat the pyrin domain of domain sample receptor protein 1
Containing protein 1, NLRP1) it is related.Innate immune system passes through specific pattern recognition receptors (pattern-
Recognition receptor, PRR) recognize the microorganism of invasion and internal danger signal.PRR is broadly divided into two classes,
One type is positioned at intracytoplasmic Nod samples acceptor (NOD-like receptor, NLR), and NLP is in apoptosis correlation spot sample
Under the participation of albumen such as albumen and half Guang Aspartase, a kind of protein complex, referred to as inflammatory body can be formed.Wherein,
NLRP1 inflammatory bodies be NLRP1 identification intracellular pathogen-associated molecular pattern (PAMP) afterwards with apoptosis associated speck-like protein (ASC)
And half albumen composition for combining to form of Guang Aspartase (Caspase-1, Caspase-5) precursor equimolecular, after activation
Promote maturation and the release of the inflammatory factors such as IL-1 β, IL-18, IL-33, played a significant role in congenital immunity.
Rheumatoid arthritis synovioblast (MH7A) is the common pattern cell for studying rheumatoid arthritis, because
This, if a kind of MH7A cells of knockout NLRP1 genes can be constructed, can will effectively erect a research for rheumatoid arthritis
Platform, greatly promotes the research of rheumatoid arthritis pathogenesis, and can promote to NLRP1 inflammatories body and various inflammatory factor phases
Research of the interaction to rheumatoid arthritis and the related molecular mechanism of synovitis morbidity.
In view of this, it is special to propose the present invention.
The content of the invention
It is an object of the invention to provide a kind of gene knockout carrier, described gene knockout carrier can be used to knock out people
NLRP1 genes.
Construction method and application present invention also offers the gene knockout carrier；Specifically, the application exists for one kind
MH7A cell NLRP1 gene knockout methods.
In order to realize above-mentioned purpose of the invention, spy uses following technical scheme：
A kind of gene knockout carrier, the gene knockout carrier is by SEQ ID NO:1 or SEQ ID NO:Nucleosides shown in 2
Acid sequence is connected into and can express the plasmid of CRISPR-Cas9 gene editing system relevant enzymes and obtain final product.
CRISPR (clustered, regularly interspaced, short palindromic repeats) is one
Plant the immunologic mechanism of viral DNA or other exogenous DNAs from bacterial degradation invasion.In bacterium and archeobacteria, CRISPR systems
Altogether it is divided into 3 classes, wherein I class and III class need various CRISPR GAP-associated protein GAPs (Cas albumen) to play a role jointly, and II class system
System only needs to a kind of Cas albumen, and this can be extensively using the condition of providing convenience for it.
At present, the CRISPR-Cas9 systems from Streptococcus pyogenes are most widely used.Cas9 albumen
(contain two nuclease domains, DNA two can be respectively cut single-stranded.Cas9 is combined into crRNA and tracrRNA first
Compound, then combines and invades DNA by PAM sequences, forms RNA-DNA composite constructions, and then target DNA double-strand is carried out
Cutting, is broken DNA double chain.
Because PAM sequential structures are simple (5 '-NGG-3 '), a large amount of target spots can be almost found in all of gene, because
This is widely used.It is thin that CRISPR-Cas9 systems have been successfully applied to plant, bacterium, yeast, fish and mammal
Born of the same parents, are current most efficient genome editing systems.
In this application, SEQ ID NO:1 or SEQ ID NO:Nucleotide sequence shown in 2 is from the public codings of NLRP1
In area screening obtain with PAM sequence targets sequences.The two target sequence specificity are good, are difficult to miss the target, and knock out efficiency high.
Preferably, gene knockout carrier as described above, it is described to express CRISPR-Cas9 gene editing system relevant enzymes
Plasmid be pGK1.1linear vector.
The construction method of gene knockout carrier as described above, comprises the following steps：
1), choosing first extron of the public code area of NLRP1 five transcripts of gene carries out CRISPR targeting sequences
Row design, obtains SEQ ID NO:1 or SEQ ID NO:Nucleotide sequence shown in 2；
2), according to SEQ ID NO:1 or SEQ ID NO:The positive oligonucleotide sequence of the design of nucleotide sequence shown in 2 and anti-
To oligonucleotide sequence；
3) the positive oligonucleotide sequence and reverse oligonucleotide sequence, are carried out into annealing reaction and forms Double stranded oligonucleotide
Acid；
4), the double chain oligonucleotide is connected into the expressed CRISPR-Cas9 gene editing system relevant enzymes of linearisation
Plasmid obtain gene knockout carrier.
The method for designing of positive oligonucleotide sequence and reverse oligonucleotide sequence is the expressed CRISPR- according to used by
What the cohesive end of the plasmid of Cas9 gene editing system relevant enzymes was designed, in one embodiment of the application, there is pin
The specific embodiment of positive oligonucleotide sequence and reverse oligonucleotide sequence is designed pGK1.1linear vector.
Host cell containing gene knockout carrier as described above.
Because NLRP1 genes are more guarded, so the gene knockout carrier that the present invention is provided is applied to nearly all lactation
The cell of animal expression NLRP1 genes.
A kind of MH7A cells NLRP1 gene knockout methods, comprise the following steps：
A), by gene knockout carrier conversion G10Competent Cell described in claim 2, and with containing described in correspondence
The culture medium of the antibiotic of gene knockout carrier resistance is cultivated；
B), the universal primer VSP primer by the use of pGK1.1linear vector use SEQ ID as sense primer
NO:1 or SEQ ID NO:The 2 reverse oligonucleotide sequences designed are used as anti-sense primer screening positive clone and sequence verification；
C) plasmid, in extraction step b) in the correct positive colony of empirical tests simultaneously transfects MH7A cells to obtain cell pool thin
Born of the same parents；
D) puromycin medicine, is carried out to the cell pool cell after transfection 24h and kills treatment；
E), limiting dilution assay dilution MH7A cells to 96 orifice plates prepare monoclonal and the Dan Ke obtained to it after transfection 72h
It is grand to be cultivated；
F), the genomic DNA with the monoclonal is as template, with SEQ ID NO:3 or SEQ ID NO:Nucleotides shown in 4
Sequence enters performing PCR amplification for primer；
G) Cruiser, is usedTMDigestion primary dcreening operation positive colony and sequence verification are carried out to amplified production.
MH7A cells used of the invention are great along bio tech ltd, cell article No. purchased from Shanghai：C0878, derives from
Japanese RICKEN cell banks.
Preferably, MH7A cells NLRP1 gene knockout methods as described above, in step c), the concentration of the plasmid
It is 1 μ g/ μ l~3 μ g/ μ l, the concentration of the MH7A cells is 2 × 106~3 × 106Individual/mL.
It is further preferred that in step c), the transfection turns for electricity；
It is described electricity turn condition be：It is described electricity turn condition be：Electricity turn voltage 1000V~1100V, electricity turn time 28ms~
32ms, electricity turn 1 time.
Institute's electricity consumption revolving cup volume of the present invention is 200 μ l.
In one embodiment of the invention, there is provided electricity turns the specific implementation process that condition is groped.
Preferably, MH7A cells NLRP1 gene knockout methods as described above, thin to the cell pool in step d)
When born of the same parents carry out puromycin medicine and kill treatment, the concentration of puromycin used is 0.45 μ g/mL~0.55 μ g/mL.
Preferably, MH7A cells NLRP1 gene knockout methods as described above, after step g), also including following step
Suddenly：
For the different positive colony weight of two allelic mutation situations in the correct positive colony of checking in step g)
New being after TA is cloned send sequencing, is compared with wild type, determines the catastrophe of each allele.
Usual people's cell is dliploid, single if two parent's missing base situations of positive colony cell are inconsistent
Cloning and sequencing peak figure be occur set peak, it is necessary to further PCR amplify positive colony cell genes of interest fragment, be then attached to
In carrier T, look at what situation two parent's base deletions are respectively using the sequencing of universal sequencing primer thing.
Preferably, the MH7A for having knocked out NLRP1 genes that prepared by MH7A cells NLRP1 gene knockout methods as described above is thin
Born of the same parents.
Compared with prior art, beneficial effects of the present invention are：
The present invention uses CRISPR-Cas9 gene knockout systems, is set as target gene carries out CRISPR targetings sequence with NLRP1
The knockout carrier for NLRP1 genes is counted and prepared, MH7A cells are transfected using it, can efficiently knock out MH7A
NLRP1 genes in cell, so as to effectively erect a research platform for rheumatoid arthritis, greatly promote rheumatoid arthrosis
The research of scorching pathogenesis, and can promote to interact NLRP1 inflammatories body and various inflammatory factors to rheumatoid arthritis and
The research of the related molecular mechanism of synovitis morbidity.
Brief description of the drawings
In order to illustrate more clearly of the specific embodiment of the invention or technical scheme of the prior art, below will be to specific
The accompanying drawing to be used needed for implementation method or description of the prior art is briefly described, it should be apparent that, in describing below
Accompanying drawing is some embodiments of the present invention, for those of ordinary skill in the art, before creative work is not paid
Put, other accompanying drawings can also be obtained according to these accompanying drawings.
Fig. 1 is 1000V in embodiment 1, the photo after 30ms, 1pulse condition electricity turn after 24h under the microscope；Figure 1A is
Photo under light microscopic；Figure 1B is the green fluorescence photo that cell is sent out after electricity turns；
Fig. 2 is the plasmid map of pGK1.1linear vector；
Fig. 3 is with carrier nucleic acids electrophoretogram after BbsI digestion pGK1.1 carrier recoveries in the step 3 of embodiment 2；
After Fig. 4 with VSP primer and downstream minus strand Oligo primers in the step 2 of embodiment 3 to carry out colony PCR amplification
Electrophoretogram.
Fig. 5 is the pool sequencing peak figures in Guide#1 sites；
Fig. 6 is the pool sequencing peak figures in Guide#2 sites；
Fig. 7 is the pool sequencing peak figures in Guide#3 sites.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art will
Understand, the following example is merely to illustrate the present invention, and is not construed as limiting the scope of the present invention.It is unreceipted specific in embodiment
Condition person, the condition advised according to normal condition or manufacturer is carried out.Agents useful for same or the unreceipted production firm person of instrument, are
The conventional products that can be obtained by commercially available purchase.
The preliminary experiment of embodiment 1 is operated
1st, monoclonal growth checking test.
Limiting dilution：MH7A cells are made after cell suspension cell count and are taken a certain amount of cell suspension and is diluted, made
Per hole cell number it is 1 or 5 in final 96 orifice plate, (per μ l of hole 100) will be diluted after 37 DEG C after it is determined that dilution is accurate,
5%CO2Quiescent culture in incubator；Microscopic observation finds that monoclonal can be formed after 7~10 days, and cell has propagation trend and energy shape
Into cell cluster.
2nd, MH7A cells electricity turns condition and gropes
After MH7A cells are made uniform single cell suspension, taking part mixing carries out blood platelet Trypan Blue counting
(living cell rate ＞ 95% can carry out electricity and turn), calculates concentration of cell suspension；Take 1 × 107Individual cell is suspended from sterile tube,
1000rpm is centrifuged 4min；Cell precipitation is taken, a certain amount of DPBS is added thereto to, pEGFP-N1 plasmid (total amounts 10 are added after mixing
μ g, go endotoxin to process), make final total system in 410 μ l or so；After mixing electricity consumption turn pipette tips be separately added into 2 electric shock cups in,
Make mouth of pipe liquid level raised, bubble-free is formed in cup, is closed the lid after being marked, carry out electricity and turn.Electricity turns voltage conditions：1000V、
1100V；(30ms, 1pulse)；Mix cell after electric shock and take and wait part cell to be respectively placed in ready to preheat 6 orifice plates each holes
In.Microscopic observation after 24h~48h, (the visible and fluorescence visual field) takes pictures, and cell state is as shown in Figure 1 after electricity turns 24h.Can from Fig. 1
Know the Cell viability and fluoresced green cell percentage of 1000V electricity turn relatively more preferably.
3rd, the minimum full lethasl concentration of MH7A cells is groped (Puro)
Attached cell：After cell suspension is counted, 50000 cells (per hole 500ul) are inoculated with per hole in 24 orifice plates, treat cell
The puromycin of various concentrations is added thereto to after adherent, and (Puro, mother liquid concentration 1mg/ml, medicine kills concentration gradient and is：0,0.5,
1ug/ml), Microscopic observation cell after 2~3 days, the complete lethal least concentration of selection cell is dense as the drug screening of subsequent experimental
Degree.The Puro drug screenings concentration for groping to obtain is 0.5 μ g/ml.
The construction method of the gene knockout carrier of embodiment 2
In the present embodiment, there is provided a kind of construction method for knocking out the gene knockout carrier of NLRP1 genes, including
Following steps：
1st, target site design and synthesis
1) design CRISPR-Cas9 knocks out target site
Firstly, it is necessary to the Oligo DNA of a pair of 20bp or so are designed in target region of DNA domain, by following online tool
Design：
The CRISPR Design of the Massachusetts Institute of Technology：http://crispr.mit.edu/
The public CDS areas of NLRP1 five transcripts of gene are chosen, first extron for finding out public CDS areas carries out target
Design in site.Preferably once merely enter an extron, it is to avoid Guide sequences are across introne.
Wherein, what uppercase base was represented is extron, and what the base of overstriking and under band marking was represented is choosing
Fixed target sequence.
The NCBI marking situation of target sequence is as follows：
2nd, primer addition joint
Primer synthesis need to add extra base, forward primer addition CACC, reverse primer addition in target sequence head
AAAC, it is necessary to it is specifically intended that first base of target sequence must be G, if first base of target sequence that you choose is not
It is G, a G can be voluntarily added before target sequence, target sequence primer design is as follows：
Guide#1
NLRP1-1F:TCGCCAATAAAGCGCACTCC
NLRP1-1R:GGAGTGCGCTTTATTGGCGA
Guide#2
NLRP1-2F:CATGGAGGTGGCCTCGTACC
NLRP1-2R:GGTACGAGGCCACCTCCATG
Guide#3
NLRP1-3F:GGCCGCCTGGCCTGTTACT
NLRP1-3R:AGTAACAGGCCAGGCGGCCC
Wherein, the part of overstriking and underscore is the extra sequence for adding, and is mutually complementary with the carrier after BbsI digestions
Part.
3rd, knockout carrier builds
1) Oligo hybridization, knockout carrier coupled reaction
2 single-stranded Oligo DNA after by synthesis are diluted to 10 μM, and annealing forms dsDNA, then with linearisation after
PGK1.1linear vector carriers are connected, and directly can be connected with T4DNA Ligase, and annealing reaction system is as follows：
With BbsI digestions by pGK1.1linear vector carriers
PGK1.1linear vector are linearized vectors, without digestion treatment, can be directly used for T4DNA Ligase companies
It is reversed should, pGK1.1 carriers optimized mistake, its transfection and the efficiency for knocking out are higher than general CRISPR carriers.
The plasmid map of pGK1.1linear vector is as shown in Figure 2.Before building target site knockout carrier, with BbsI digestions pGK1.1
Glue reclaim carrier segments after carrier, carrier nucleic acids electrophoretogram is as shown in Figure 3 after recovery.
After by above system brief centrifugation, 95 DEG C of incubations 3min, natural cooling 20min after incubation in PCR instrument are placed in.Take 1 μ
DsDNA after the hybridization of l carries out T4DNA ligase coupled reactions, and reaction system is as follows：
After by above system brief centrifugation, 16 DEG C of incubation 30min in PCR instrument are placed in.
Embodiment 3
In the present embodiment, there is provided a kind of MH7A cells NLRP1 gene knockout methods.
1st, the gene knockout carrier obtained in embodiment 2 is transformed into G10Competent Cell：
1 pipe G10Competent Cell are taken from -80 DEG C of refrigerators, is put and is melted on ice.
10 μ l connection products are added after melting, mixing is flicked, 30min is incubated on ice.
42 DEG C of water-bath thermal shock 60sec, take out put 2~3min of cooled on ice rapidly.
Xiang Guanzhong adds 800 μ l nonreactive SOC fluid nutrient mediums, to shaking table (37 DEG C/160rpm) renewal cultivation culture
45min。
4500rpm is centrifuged 5min, discards 800 μ l supernatants, and precipitation is suspended in remaining 100 μ l supernatants, is spread evenly across
In screening flat board containing Kan resistances, overnight incubation is inverted.
2nd, positive recombinant is screened
Transfection carries out bacterium colony PCR in second day using sense primer VSP primer with respective downstream minus strand Oligo primers
Screening, the correct sizes of positive colony PCR should be 100bp, and the electrophoresis result after PCR amplifications is as shown in figure 4, positive gram for screening
It is grand to take out the further sequence verification of plasmid.
Correct plasmid is sequenced to be concentrated to more than 1 μ g/ μ l concentration.
The sequence of sense primer VSP primer is：GGACTATCATATGCTTACCG.
3rd, electrotransfection target cell
1), take exponential phase MH7A cell suspensions trypan blue in good condition to count, determine cell number and cell viability
(cell viability>95%)
2) 5 × 10, are taken6In 15ml centrifuge tubes, supernatant (1000rpm/4min) is abandoned in centrifugation to cell.
3), cell precipitation is suspended in 210 μ l DPBS, is transferred in 1.5ml EP pipes, add what aequum built
μ g~8 μ the g of plasmid 5 (plasmid concentration requirement 1 μ g/ μ l~3 μ g/ μ l) is knocked out, is gently mixed.
4) above-mentioned bioblast mixed liquor Special electric, is turned into pipette tips to be transferred in electric shock cup, it is determined that solution in electric shock cup
After bubble-free, and liquid level projection, electric shock cup lid is covered and as electroporation, setting after electricity turns condition carries out electricity turn.It is to be shown
Peak figure is normally taken out cell liquid and is transferred in six orifice plate culture mediums (culture medium needs prior 37 DEG C of preheatings and antibiotic-free) afterwards；Electricity turns
After obtain pool cells
It is described electricity turn condition be：1000V、30ms、1pulse.
5th, pool cells sequencing detection knocks out efficiency
24h puro medicines kill treatment after electricity turns；The concentration of puro used is 0.5 μ g/mL.
After electricity turns 72hr, pool cells trypan blue is counted；
Before screening positive clone, the knockout efficiency of pool cells (mixing clone) need in vivo be verified, but its
Result can only be used as reference；
In sequence near general target site, positive set should occur in sequence in target position and afterwards
Peak, when such as knocking out less efficient, signal intensity is often relatively low, and influence judges.From the knot of pool sequencings peak figure (Fig. 5, Fig. 6, Fig. 7)
From the point of view of fruit, peak is not almost covered near Guide#3 target sites, knock out efficiency low；Thus cast out the site, only retain Guide#1
With Guide#2 sites.The gene knockout carrier that i.e. final the application is obtained is by SEQ ID NO:1 (Guide#1 sequences removal end
The AGG at end) or SEQ ID NO:Nucleotide sequence shown in 2 (Guide#2 sequences remove the TGG of end) is connected into pGK1.1linear
Vector is obtained.
6th, the preparation and growth of monoclonal
In limiting dilution assay diluting cells to 10 piece of 96 orifice plate, 37 DEG C, CO2Quiescent culture in incubator；Observed after one week
Monoclonal growing state, will grow the monoclonal for getting up and is transferred to Amplification Culture in 48 holes after about two weeks；When cell covers with 48 holes 1/2
When, you can take out a part (102~104), carried using Genloci TNA extraction agents box (cat.no.GP0155, GP0156)
Take cellular genome.
7th, the extraction of monoclonal genomic DNA
1) 10, are taken2~104In 1.5ml EP pipes, room temperature 1500rpm centrifugation 5min carefully sop up nutrient solution to individual cell.
2) 150 μ l PBS re-suspended cells, room temperature 1500rpm centrifugation 5min, careful supernatant discarded, are added.
3), repeat step 2 is once.
4), to (recommendation volume is 50 μ l~200 μ l) the pre-made solution A of addition appropriate volume in centrifuge tube and solution
The mixed liquor of B, pipette tips are blown and beaten 5 times, and 10min is placed on ice, cell is fully cracked.
5) absolute ethyl alcohol of two volumes, is added, is overturned and is mixed, more than 20min is precipitated under the conditions of -20 DEG C.
6), 4 DEG C, 12000rpm is centrifuged 20min, abandons supernatant.
7) the 75% ethanol washing precipitation of 400 μ l~500 μ l precoolings, is added, 4 DEG C, 12000rpm is centrifuged 10min, carefully
Supernatant discarded, dries (be advisable no more than 5min) naturally.
8) the distilled water dissolution precipitation of appropriate volume (recommendation volume is 10 μ l~30 μ l) sterilizing, is added, solution can be direct
For PCR reactions, or in -20 DEG C of preservations.
8th, PCR amplifications purpose fragment
1), thing design is drawn
The Primers of design high specific near target site is being knocked out, amplified production length is for about 340bp.Primers draws
Thing sequence is as follows：
PrimerF:SEQ ID NO:3
PrimerR:SEQ ID NO:4
2), PCR amplifications obtain hybrid dna
Be formulated as follows reaction system in the PCR pipe that sterilizes, using the Primers of high specific, amplification obtain wild type and
The DNA product that saltant type fully hybridizes.
3), PCR response procedures are as follows：
Naturally cool to less than 40 DEG C (wild-type fragment hybridizes with saltant type fragment).
After PCR terminates, taking 2~3 μ l carries out electrophoresis detection, it is desirable to which purpose fragment is bright and single.
9、CruiserTMEnzyme digestion screening positive clones
Reaction system is formulated as follows in the PCR pipe that sterilizes：
Pcr amplification product
Immediately to 2 μ l 6 × Stop Buffer are added in above-mentioned 10 μ l reaction systems after 45 DEG C of reaction 20min, with laggard
Row agarose electrophoresis detects or is placed in -20 DEG C of preservations.
10th, screening positive clone is sequenced
Sequence verification is carried out to Crusier digestions preliminary screening positive colony out, positive colony is further confirmed that.
11st, TA clones
In for positive colony, two different positive colonies of allelic mutation situation send after being TA clones again
Sequencing, compares with wild type, determines the catastrophe of each allele.
Finally it should be noted that：Various embodiments above is merely illustrative of the technical solution of the present invention, rather than its limitations；To the greatest extent
Pipe has been described in detail with reference to foregoing embodiments to the present invention, but it will be understood by those within the art that：Its
The technical scheme described in foregoing embodiments can still be modified, or to which part or all technical characteristic
Carry out equivalent；And these modifications or replacement, the essence of appropriate technical solution is departed from various embodiments of the present invention skill
The scope of art scheme.
SEQUENCE LISTING
<110>Xinan Hospital, Chongqing
<120>Gene knockout carrier, MH7A cell NLRP1 gene knockout methods
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
tcgccaataa agcgcactcc 20
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence
<400> 2
catggaggtg gcctcgtacc 19
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
taagagccaa ggcaaaggac 20
<210> 4
<211> 20
<212> DNA
<213>Artificial sequence
<400> 4
cagtgacctc agccccatct 20
Claims (10)
1. a kind of gene knockout carrier, it is characterised in that the gene knockout carrier is by SEQ ID NO:1 or SEQ ID NO:
Nucleotide sequence shown in 2 is connected into and can express the plasmid of CRISPR-Cas9 gene editing system relevant enzymes and obtain final product.
2. gene knockout carrier according to claim 1, it is characterised in that described to express CRISPR-Cas9 genes volume
The plasmid for collecting system relevant enzyme is pGK1.1linear vector.
3. the construction method of the gene knockout carrier described in claim 1 or 2, it is characterised in that comprise the following steps：
1), choose NLRP1 five transcripts of gene public code area first extron carry out CRISPR targeting sequence set
Meter, obtains SEQ ID NO:1 or SEQ ID NO:Nucleotide sequence shown in 2；
2), according to SEQ ID NO:1 or SEQ ID NO:The positive oligonucleotide sequence of the design of nucleotide sequence shown in 2 and reversely widow
Nucleotide sequence；
3) the positive oligonucleotide sequence and reverse oligonucleotide sequence, are carried out into annealing reaction and forms double chain oligonucleotide；
4), the double chain oligonucleotide is connected into the matter of the expressed CRISPR-Cas9 gene editing system relevant enzymes of linearisation
Grain obtains gene knockout carrier.
4. the host cell of gene knockout carrier described in claim 1 or 2 is contained.
5.MH7A cell NLRP1 gene knockout methods, it is characterised in that include following steps：
A), by gene knockout carrier conversion G10Competent Cell described in claim 2, and the gene is corresponded to containing
The culture medium of the antibiotic of knockout carrier resistance is cultivated；
B), by the use of the universal primer VSP primer of pGK1.1linear vector as sense primer, with SEQ ID NO:1
Or SEQ ID NO:The 2 reverse oligonucleotide sequences designed are used as anti-sense primer screening positive clone and sequence verification；
C) plasmid, in extraction step b) in the correct positive colony of empirical tests simultaneously transfects MH7A cells and obtains cell pool cell；
D) puromycin medicine, is carried out to the cell pool cell after transfection 24h and kills treatment；
E), limiting dilution assay dilution MH7A cells to 96 orifice plates prepare monoclonal and the monoclonal that it is obtained are entered after transfection 72h
Row culture；
F), the genomic DNA with the monoclonal is as template, with SEQ ID NO:3 or SEQ ID NO:Nucleotide sequence shown in 4
For primer enters performing PCR amplification；
G) Cruiser, is usedTMDigestion primary dcreening operation positive colony and sequence verification are carried out to amplified production.
6. MH7A cells NLRP1 gene knockout methods according to claim 5, it is characterised in that described in step c)
The concentration of plasmid is 1 μ g/ μ l~3 μ g/ μ l, and the concentration of the MH7A cells is 2 × 106~3 × 106Individual/mL.
7. MH7A cells NLRP1 gene knockout methods according to claim 6, it is characterised in that described in step c)
Transfect as electricity turns；
It is described electricity turn condition be：Electricity turns voltage 1000V~1100V, electricity and turns time 28ms~32ms, electricity turn 1 time.
8. MH7A cells NLRP1 gene knockout methods according to claim 5, it is characterised in that in step d), to institute
When stating cell pool cell and carrying out puromycin medicine and kill treatment, the concentration of puromycin used is 0.45 μ g/mL~0.55 μ g/mL.
9. MH7A cell NLRP1 gene knockout methods according to any one of claim 5~8, it is characterised in that in step
G) it is further comprising the steps of after：
Done again for the two different positive colonies of allelic mutation situation in the correct positive colony of checking in step g)
Sequencing is sent after TA clones, is compared with wild type, determine the catastrophe of each allele.
10. what prepared by MH7A cells NLRP1 gene knockout methods described in any one of claim 5~9 has knocked out NLRP1 genes
MH7A cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611066999.5A CN106755091A (en) | 2016-11-28 | 2016-11-28 | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611066999.5A CN106755091A (en) | 2016-11-28 | 2016-11-28 | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106755091A true CN106755091A (en) | 2017-05-31 |
Family
ID=58902126
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611066999.5A Pending CN106755091A (en) | 2016-11-28 | 2016-11-28 | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755091A (en) |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004778A (en) * | 2014-06-06 | 2014-08-27 | 重庆高圣生物医药有限责任公司 | CRISPR/Cas9 system-containing targeted knockout vector and adenovirus and applications thereof |
| CN105602987A (en) * | 2015-11-23 | 2016-05-25 | 深圳市默赛尔生物医学科技发展有限公司 | High-efficiency knockout method for XBP1 gene in DC cell |
-
2016
- 2016-11-28 CN CN201611066999.5A patent/CN106755091A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004778A (en) * | 2014-06-06 | 2014-08-27 | 重庆高圣生物医药有限责任公司 | CRISPR/Cas9 system-containing targeted knockout vector and adenovirus and applications thereof |
| CN105602987A (en) * | 2015-11-23 | 2016-05-25 | 深圳市默赛尔生物医学科技发展有限公司 | High-efficiency knockout method for XBP1 gene in DC cell |
Non-Patent Citations (3)
| Title |
|---|
| ANDREA D’OSUALDO ET AL.: ""Transcription Factor ATF4 Induces NLRP1 Inflammasome Expression during Endoplasmic Reticulum Stress"", 《PLOS ONE》 * |
| RIYUESHENBAISE: ""CRISPR-Cas9操作流程（https://wenku.baidu.com/view/e5b280619ec3d5bbfc0a745b.html）"", 《百度文库》 * |
| 王令 等: ""快速构建CRISPR/Cas9基因靶向编辑系统"", 《中国生物化学与分子生物学报》 * |
Cited By (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755091A (en) | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods | |
| CN108753772B (en) | Construction method of human neuroblastoma cell line with CAPNS1 gene knocked out based on CRISPR/Cas technology | |
| CN105907758B (en) | CRISPR-Cas9 guide sequence and primer thereof, transgenic expression vector and construction method thereof | |
| CN108660161B (en) | Method for preparing chimeric gene-free knockout animal based on CRISPR/Cas9 technology | |
| CN106916820B (en) | SgRNA and its application of porcine ROSA 26 gene can effectively be edited | |
| WO2017190664A1 (en) | Use of chemosynthetic crrna and modified crrna in crispr/cpf1 gene editing systems | |
| CN107893076A (en) | CRISPR Cas9 targeting knock outs human breast cancer cell RASSF2 genes and its specific sgRNA | |
| CN108642055A (en) | The sgRNA of pig miR-17-92 gene clusters can effectively be edited | |
| CN107418974A (en) | It is a kind of to sort the quick method for obtaining CRISPR/Cas9 gene knockout stable cell lines using monoclonal cell | |
| CN106414740A (en) | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene | |
| CN105593367A (en) | CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene | |
| JP2017513477A5 (en) | ||
| WO2019086007A1 (en) | Sgrna for targeting and guiding cas9 protein to efficiently cleave tcr and b2m gene loci | |
| CN111849979B (en) | sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line | |
| US20230212612A1 (en) | Genome editing system and method | |
| WO2020173150A1 (en) | Off-target single nucleotide variants caused by single-base editing and high-specificity off-target-free single-base gene editing tool | |
| CN108220338A (en) | A kind of construction method of the IPEC-J2 cells of APN gene knockouts | |
| CN108148866B (en) | HCBP6 gene knockout cell line and construction method thereof | |
| CN105018523B (en) | A kind of ZB Transposon System and its gene transfer method of mediation | |
| CN104928292B (en) | The design method of sgRNA a kind of and slow virus carrier, the plasmid of building | |
| CN104745551B (en) | The method for knocking out human papillomavirus E 6/E 7 oncogene using TALEN | |
| CN108949832A (en) | A kind of targeting vector and its application for knock-out pig GHR gene | |
| CN105950656A (en) | Method for rapidly obtaining gene knockout cell strains | |
| WO2019014917A1 (en) | Gene editing system and method for editing plant genome by using same | |
| CN107034234B (en) | A kind of kit for being used to knock out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |
|
| RJ01 | Rejection of invention patent application after publication |