CN108660161B

CN108660161B - Method for preparing chimeric gene-free knockout animal based on CRISPR/Cas9 technology

Info

Publication number: CN108660161B
Application number: CN201710207362.1A
Authority: CN
Inventors: 杨辉; 熊志奇; 孙强; 左二伟
Original assignee: Center for Excellence in Brain Science and Intelligence Technology Chinese Academy of Sciences
Current assignee: Center for Excellence in Brain Science and Intelligence Technology Chinese Academy of Sciences
Priority date: 2017-03-31
Filing date: 2017-03-31
Publication date: 2023-05-09
Anticipated expiration: 2037-03-31
Also published as: CN108660161A; WO2018177351A1

Abstract

The invention relates to a method for preparing a gene function complete knockout animal based on CRISPR/Cas9 technology. The invention discloses a cocktail type CRISPR/Cas9 system (C-CRISPR) and a method for preparing a gene knockout animal with complete or most of gene functions by using the system. The method can efficiently obtain the gene knockout animal with complete or most of the gene functions knocked out in one breeding cycle.

Description

Method for preparing chimeric gene-free knockout animal based on CRISPR/Cas9 technology

Technical Field

The invention belongs to the field of molecular biology, and in particular relates to a method for efficiently obtaining a gene knockout animal with complete or most of target gene function knockout in the first generation of modification based on CRISPR/Cas9 technology.

Background

CRISPR/Cas9 is derived from the bacterial and archaeal immune systems, and target site specific RNAs can be used to bring Cas9 nucleases to specific locations on the genome, thus achieving precise cleavage of the gene site. The CRISPR/Cas9 technology has been applied to disease model establishment, drug target screening, and is becoming a new generation gene therapy approach.

CRISPR/Cas9 systems have been used for genome editing in a number of species, and currently one has been able to inject Cas9 mRNA and sgRNA (single-guide RNA) directly into fertilized eggs in the prokaryotic phase to introduce double-strand breaks (DSBs) at specific locations. Double strand breaks introduced by CRISPR/Cas9 would be treated by a mechanism called "non-homologous end joining" (non-homologous end joining, NHEJ) for error-prone repair, resulting in a frame shift mutation in genetically mutated animals. However, most mutant animals obtained by this method have chimeric phenomenon, that is, their gene mutation exists only in a part of cells and the other cells are not, mainly because the injected endonuclease completes the cleavage of DNA after cleavage. For studies involving phenotypes, chimeric gene-edited animals need to be further cross bred to obtain a complete gene knockout animal, which can become laborious when multiple genes need to be knocked out. The problem of chimerism is particularly acute when large animals, such as non-human primates, are involved, as the breeding cycle of macaques is as long as 5-6 years and only one pup is born per embryo, severely hampering the progress of research on such animals.

Many researchers have previously attempted to produce genetically modified animals, particularly large animals, that are not chimeric by a one-step process. Comprising injecting Cas9 mRNA and sgRNA into an oocyte instead of a fertilized egg, or injecting Cas9 protein. However, after analysis of the individual animal tissues by DNA sequencing, these methods were found to be quite inefficient in achieving a full double allele knockout.

Thus, there is an urgent need in the art to find new, more efficient gene knockout methods in the hope of obtaining a gene knockout animal with a complete or a large portion of its gene function knocked out in a shorter period of time.

Disclosure of Invention

The invention aims to provide a method for efficiently obtaining a gene knockout animal with complete gene function knockout in the first generation of modification based on CRISPR/Cas9 technology.

In a first aspect of the invention, there is provided a method of preparing a knockout animal cell, the method comprising: (1) Preparing two or more sgrnas targeting different target sites on a target gene according to the nucleic acid sequence of the target gene to be knocked out; (2) Co-transferring the sgRNA of (1) or a nucleic acid capable of forming the sgRNA, the Cas9 mRNA or a nucleic acid capable of forming the Cas9 mRNA into an animal cell to obtain a gene knockout animal cell.

In a preferred embodiment, the animal cell is an animal fertilized egg, and the fertilized egg may develop into a gene knockout animal in which the gene function of the target gene is completely knocked out or a majority of the gene is knocked out.

In another aspect of the present invention, there is provided a method of preparing a gene knockout animal having a complete or a substantial portion of the gene function of a target gene, the method comprising: (1) Preparing two or more sgrnas targeting different target sites on a target gene according to the nucleic acid sequence of the target gene to be knocked out; (2) Co-transferring the sgRNA of (1) or a nucleic acid capable of forming the sgRNA, the Cas9 mRNA or a nucleic acid capable of forming the Cas9 mRNA into a fertilized egg to obtain a gene knockout animal fertilized egg; (3) Allowing the fertilized egg of (2) to develop to produce a gene knockout animal in which the gene function of the target gene is completely or mostly knocked out.

In a preferred embodiment, the two or more sgrnas targeting different target sites on the target gene have a 9-500 bp separation between the target sites on the target gene; preferably 10 to 300bp, for example, 15bp,20bp,30bp,40bp,50bp,60bp,70bp,80bp,90bp,100bp,120bp,150bp,180bp,200bp,250bp,280bp.

In another preferred embodiment, multiple sgrnas are employed that target different target sites on the target gene; such as 3 to 30, e.g., 4,5,6,7,8,9, 10, 12, 15, 18, 20, 25.

In another preferred embodiment, the plurality of sgrnas targeting different target sites on the target gene, wherein at least 2 (preferably at least 3, e.g., 4,5,6,7,8,9, 10, 12, 15, 18, 20, 25) of the target sites on the target gene are located in the same exon region.

In another preferred embodiment, the plurality of sgrnas targeting different target sites on the target gene introduce frameshift mutations and/or introduce insertion deletions and/or introduce large fragment deletions at the targeted target site region on the target gene.

In another preferred embodiment, the nucleic acid capable of forming the sgRNA is a nucleic acid construct or an expression vector, or the nucleic acid capable of forming the Cas9 mRNA is a nucleic acid construct or an expression vector.

In another preferred embodiment, the animal is a mammal, including (but not limited to): humans, non-human primates, mice, livestock.

In another preferred embodiment, the nucleic acid sequence of the sgRNA carries a promoter upstream, preferably the promoter is a T7 promoter, a U6 promoter; or the nucleic acid sequence of Cas9 mRNA carries a promoter upstream, preferably the promoter is a T7 promoter.

In another preferred example, the cells in the body of the gene knockout animal whose gene functions are most knocked out, in which the target gene to be knocked out is not knocked out effectively, account for less than 20% of the total cell number; more preferably 15% or less; more preferably 10% or less; even more preferably 5% or less.

In another preferred example, the target gene to be knocked out is GFP gene, the number of sgRNAs is 2,3 or 4, and the interval between target sites on the target gene targeted by each sgRNA is 30-200 bp; preferably 40-150 bp; more preferably 50-130 bp; more preferably, the

sgrnas target

2,3 or 4 target sites on the target gene selected from the group consisting of: SEQ ID NO. 48,SEQ ID NO:49,SEQ ID NO:50,SEQ ID NO:51.

In another preferred example, the target gene to be knocked out is Tyr gene, the number of sgRNAs is 3,4,5 or 6, each sgRNA targets exon 4 of the target gene and optionally introns adjacent to the exons, and the interval between target sites targeted by the sgRNAs is 10-100 bp; preferably 10-70 bp; more preferably, the

sgrnas target

3,4,5 or 6 target sites on the target gene selected from the group consisting of: 52,SEQ ID NO:53,SEQ ID NO:54,SEQ ID NO:55,SEQ ID NO:56,SEQ ID NO:57 of SEQ ID NO; more preferably 3 or 4 selected from the group consisting of: SEQ ID NO. 53,SEQ ID NO:54,SEQ ID NO:55,SEQ ID NO:56.

In another preferred example, the target gene to be knocked out is a Tet1 gene, the number of sgRNAs is 3, the exon 2 of the target gene targeted by each sgRNA is 80-200 bp, and the interval between the target sites targeted by each sgRNA is 80-200 bp; preferably 100-190 bp; more preferably, the sgRNA targets a target site on a target gene that is: SEQ ID NO. 58,SEQ ID NO:59,SEQ ID NO:60.

In another preferred example, the target gene to be knocked out is a Tet2 gene, the number of sgRNAs is 3, the exon 3 of the target gene targeted by each sgRNA, and the interval between the target sites targeted by each sgRNA is 100-150 bp; preferably 110-135 bp; more preferably, the sgRNA targets a target site on a target gene that is: SEQ ID NO. 61,SEQ ID NO:62,SEQ ID NO:63.

In another preferred example, the target gene to be knocked out is a Tet3 gene, the number of sgRNAs is 3, the exon 4 of the target gene targeted by each sgRNA is 180-280 bp, and the interval between the target sites targeted by each sgRNA is 180-280 bp; preferably 190-270 bp; more preferably, the sgRNA targets a target site on a target gene that is: SEQ ID NO. 64,SEQ ID NO:65,SEQ ID NO:66.

In another preferred example, the target gene to be knocked out is Prrt2 gene, the sgRNA is 3 or 4, at least 3 sgRNAs target exon 3 of the target gene, and the spacing between the target sites of the sgRNA targets on the exon 3 is 10-50 bp; preferably 15-40 bp; more preferably, the sgRNA targets a target site on a target gene that is: 83,SEQ ID NO:84,SEQ ID NO:85,SEQ ID NO:86 of SEQ ID NO; more preferably: SEQ ID NO. 84,SEQ ID NO:85,SEQ ID NO:86.

In another preferred example, the target gene to be knocked out is ArntL gene, the sgRNA is 3,4,5,6,7,8 or 9 pieces, the targeted target gene is exon 13, and the interval between the targeted target sites of the sgRNA on the exon 13 is 10-80 bp; preferably 40-70 bp; more preferably, the

sgrnas target

3,4,5 or 6 target sites on the target gene selected from the group consisting of: 91,SEQ ID NO:92,SEQ ID NO:93,SEQ ID NO:94,SEQ ID NO:95,SEQ ID NO:96,SEQ ID NO:97,SEQ ID NO:98,SEQ ID NO:99 of SEQ ID NO; more preferably: SEQ ID NO. 92,SEQ ID NO:95,SEQ ID NO:98.

In another preferred embodiment, the target gene to be knocked out is a Y chromosome gene; preferably Zfy1; ube1y1; kdm5d; eif2s3y; ddx3y; usp9y; sry; erdr1;

more preferably, the target gene to be knocked out is Zfy1, and the target site on the sgRNA targeted target gene is SEQ ID NO. 67 and SEQ ID NO. 68; or (b)

The target gene to be knocked out is Ube1y1, and the target site on the sgRNA targeted target gene is SEQ ID NO 69 and SEQ ID NO 70; or (b)

The target gene to be knocked out is Kdm5d, and the target site on the sgRNA targeted target gene is SEQ ID NO. 71 and SEQ ID NO. 72; or (b)

The target gene to be knocked out is Eif2s3y, and the target site on the sgRNA targeted target gene is SEQ ID NO 73 and SEQ ID NO 74; or (b)

The target gene to be knocked out is Ddx y, and the target site on the sgRNA targeted target gene is SEQ ID NO 75 and SEQ ID NO 76; or (b)

The target gene to be knocked out is Usp9y, and the target site on the sgRNA targeted target gene is SEQ ID NO. 77 and SEQ ID NO. 78; or (b)

The target gene to be knocked out is Sry, and the target site on the target gene targeted by the sgRNA is SEQ ID NO. 79 and SEQ ID NO. 80; or (b)

The target gene to be knocked out is Erdr1, and the target site on the sgRNA targeted target gene is SEQ ID NO. 81 and SEQ ID NO. 82.

In another preferred embodiment, there is also provided the use of any of the foregoing methods for preparing a knockout animal cell, animal fertilized egg or animal, wherein said animal is a fully knockout or mostly knockout animal of the gene function of the target gene; in the body of the animal with most of the gene functions of the target gene knocked out, the cells which are not knocked out effectively with the target gene to be knocked out account for less than 20% of the total cell number; more preferably 15% or less; more preferably 10% or less; even more preferably 5% or less.

In another preferred embodiment, the animal with the gene function of the target gene completely knocked out or mostly knocked out is an animal obtained after only one breeding cycle (i.e., F0 generation animal).

In another preferred embodiment, it is also used for animal gene function studies; or for preparing animals with completely or mostly knocked-out gene functions of the target gene, and using the animals for gene function research or embryo development research. Preferably, the use is non-diagnostic or therapeutic.

In another aspect of the invention, there is provided a sgRNA or nucleic acid capable of forming said sgRNA for preparing a gene knockout animal with a completely or mostly knocked-out gene function of a target gene, wherein the target gene for knocking out the sgRNA is GFP gene, said sgRNA is 2,3 or 4, and the interval between target sites on the target gene targeted by each sgRNA is 30-200 bp; preferably 40-150 bp; more preferably 50-130 bp; more preferably, the

sgrnas target

In another aspect of the invention there is provided a sgRNA or nucleic acid capable of forming said sgRNA for use in the preparation of a gene knockout animal with a complete or substantial knockout of the gene function of the target gene, the target gene for which is the Tyr gene, said sgRNA being 3,4,5 or 6, each sgRNA targeting exon 4 of the target gene and optionally an intron adjacent to the exon, and the spacing between target sites targeted by the sgrnas being 10 to 100bp; preferably 10-70 bp; more preferably, the

sgrnas target

In another aspect of the invention, there is provided a sgRNA or a nucleic acid capable of forming the sgRNA for preparing a gene knockout animal with a completely or mostly knocked-out gene function of a target gene, wherein the target gene for knocking out the sgRNA is a Tet1 gene, the number of the sgRNAs is 3, each sgRNA targets exon 2 of the target gene, and the interval between target sites targeted by each sgRNA is 80-200 bp; preferably 100-190 bp; more preferably, the sgRNA targets a target site on a target gene that is: SEQ ID NO. 58,SEQ ID NO:59,SEQ ID NO:60.

In another aspect of the invention, there is provided a sgRNA or a nucleic acid capable of forming the sgRNA for preparing a gene knockout animal with a completely or mostly knocked-out gene function of a target gene, wherein the target gene for knocking out the sgRNA is a Tet2 gene, the number of the sgRNAs is 3, each sgRNA targets exon 3 of the target gene, and the interval between target sites targeted by each sgRNA is 100-150 bp; preferably 110-135 bp; more preferably, the sgRNA targets a target site on a target gene that is: SEQ ID NO. 61,SEQ ID NO:62,SEQ ID NO:63.

In another aspect of the invention, there is provided a sgRNA or a nucleic acid capable of forming the sgRNA for preparing a gene knockout animal with a completely or mostly knocked-out gene function of a target gene, wherein the target gene for knocking out the sgRNA is a Tet3 gene, the number of the sgRNAs is 3, each sgRNA targets exon 4 of the target gene, and the interval between target sites targeted by each sgRNA is 180-280 bp; preferably 190-270 bp; more preferably, the sgRNA targets a target site on a target gene that is: SEQ ID NO. 64,SEQ ID NO:65,SEQ ID NO:66.

In another aspect of the invention there is provided a sgRNA or nucleic acid capable of forming said sgRNA for use in the preparation of a gene knockout animal in which the gene function of the target gene is completely or mostly knocked out, the target gene for knocking out is Prrt2 gene, said sgRNA is 3 or 4, at least 3 sgRNAs target exon 3 of the target gene, and the spacing between the target sites on exon 3 targeted by the sgRNAs is 10-50 bp; preferably 15-40 bp; more preferably, the sgRNA targets a target site on a target gene that is: 83,SEQ ID NO:84,SEQ ID NO:85,SEQ ID NO:86 of SEQ ID NO; more preferably: SEQ ID NO. 84,SEQ ID NO:85,SEQ ID NO:86.

In another aspect of the invention, there is provided a sgRNA or a nucleic acid capable of forming said sgRNA for preparing a knockout animal with a complete or a major knockout of the gene function of a target gene, wherein the target gene for knockout of the sgRNA is an ArntL gene, said sgRNA is 3,4,5,6,7,8 or 9, exon 13 of the target gene is targeted, and the spacing between target sites targeted by the sgRNA on exon 13 is 10 to 80bp; preferably 40-70 bp; more preferably, the

sgrnas target

In another aspect of the invention there is provided a sgRNA or nucleic acid capable of forming said sgRNA for use in the preparation of a gene knockout animal in which the gene function of the target gene is completely or mostly knocked out, the target gene for which the sgRNA is knocked out being the Y chromosome gene Zfy1, the target site on the target gene to which the sgRNA targets being SEQ ID NO 67, SEQ ID NO 68; or (b)

The target gene for knocking out the sgRNA is a Y chromosome gene Ube1Y1, and the target site on the target gene targeted by the sgRNA is SEQ ID NO 69 and SEQ ID NO 70; or (b)

The target gene for knocking out the sgRNA is a Y chromosome gene Kdm5d, and the target site on the target gene targeted by the sgRNA is SEQ ID NO:71 and SEQ ID NO:72; or (b)

The target gene for knocking out the sgRNA is a Y chromosome gene Eif2s3Y, and the target site on the target gene targeted by the sgRNA is SEQ ID NO 73 and SEQ ID NO 74; or (b)

The target gene for knocking out the sgRNA is a Y chromosome gene Ddx Y, and the target site on the target gene targeted by the sgRNA is SEQ ID NO 75 and SEQ ID NO 76; or (b)

The target gene for knocking out the sgRNA is a Y chromosome gene Usp9Y, and the target site on the target gene targeted by the sgRNA is SEQ ID NO 77 and SEQ ID NO 78; or (b)

The target gene for knocking out the sgRNA is a Y chromosome gene Sry, and the target site on the target gene targeted by the sgRNA is SEQ ID NO. 79 and SEQ ID NO. 80; or (b)

The target gene for knocking out the sgRNA is a Y chromosome gene Erdr1, and the target site on the target gene targeted by the sgRNA is SEQ ID NO. 81 and SEQ ID NO. 82.

In another aspect of the invention, there is provided a kit for preparing a gene-functional complete-knockout or major-knockout animal of a target gene, the kit comprising any of the above-described sgrnas for preparing a gene-functional complete-knockout or major-knockout animal of a target gene, or nucleic acids capable of forming the sgrnas.

In a preferred embodiment, the kit further comprises: cas9 mRNA or a nucleic acid capable of forming the Cas9 mRNA; or instructions for use.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, complete knockdown of GFP gene in GFP embryos using C-CRISPR.

(A) Schematic representation of sgRNA target and experimental design at GFP site. Cas9 mRNA and single or multiple GFP-targeting sgrnas were co-injected into single mouse fertilized eggs, and then observed for GFP signal at the blastula stage. GFP IF and GFP IR: internal primers for GFP genotyping; GFP OF and GFP OR: external primers for GFP genotyping. In the figure

Indicating that 100bp bases are spaced between the target sites targeted by adjacent sgrnas. In the rear view, < >>

All represent bases of x (a specific number) bp spacing between target sites targeted by adjacent sgrnas.

(B) GFP signal patterns in blasts resulting from various GFP targeting patterns. In the first panel, GFP negative blasts (green arrow, no GFP signal in any cells in blasts), GFP positive chimeric blasts (red arrow, GFP signal in some cells in blasts).

(C) Proportion bar graph of GFP negative blasts (no chimerism) generated by various GFP targeting modes. Two or more sgRNA targets (sgRNA-GFP-a+b, a+b+c or a+b+c+d) produce a higher proportion of GFP-negative blastules than a single sgRNA target (sgRNA-GFP-a, B, C, D). The numbers on the bars represent the total number of blastula counted (×p <0.001, chi square test).

(D) Embryo blastocyst rates produced by various GFP targeting approaches. The numbers represent the total number of fertilized eggs injected.

(E) Genotyping of GFP-edited blastula. The PCR products of the tagged blasts were further sent for sequencing. All genotyped blasts have no GFP signal, small insertions (e.g., sgGFP-a+b#1), large fragment exons (e.g., sgGFP-a+b#16) or both (e.g., sgGFP-a+b#5). NC, negative control.

(F) The DNA sequences of blastula marked above.

(G) Frequency of large fragment exon deletions (LEDs) in GFP-edited blastules; the numbers represent the total number of blastula counted.

FIG. 2, one-step method, using C-CRISPR, chimeric-free Tyr knockout mice were obtained.

(A) Schematic representation of sgRNA targets at Tyr sites. Cas9 mRNA and single or multiple Tyr-targeting sgrnas are co-injected into a single mouse fertilized egg, followed by transplantation into a recipient. Tyr IF and Tyr IR: an internal primer for Tyr genotyping; tyr OF and Tyr OR: an external primer for Tyr genotyping.

(B) Schematic representation of the pigmentation phenotype of mice resulting from different Tyr targeting strategies. WT, wild-type mice with complete pigmentation; albino, mice without pigment; chimeras, mice with chimeric pigmentation.

(C) Tyr targets representative results of the mouse pigmentation phenotype obtained. Green arrow: albino whitening; red arrow: chimeric pigmentation.

(D) Proportional histogram of albino mice generated by Tyr targeting. Two and more sgRNA targets (sgRNA-Tyr-b+c, b+c+d, b+c+d+e, a+c+f or a+c+d+f) produced a higher proportion of albino mice than single sgRNA targets (sgRNA-Tyr-C or D). The numbers represent the total number of mice counted (×p <0.001, chi square test).

(E) Tyr targets the obtained mouse birth rate. The numbers represent the total number of embryos transferred.

FIG. 3, DNA sequence analysis of Tyr Gene editing mice.

(A) Schematic of experimental design. The tail of the mice, the whole blastocysts, or single blastomeres at the eight-cell stage of the injected embryo were used for genotyping.

(B) Sequencing identification was performed from the tail of albino mice generated by sgRNA-Tyr-B+C+D+E targeting. The #2 mouse had large fragment exon deletions and insert deletions. LED, large fragment exon deletion; indel, insertion or deletion of bases. Numbers above each column: total number of TA clones sequenced.

(C) Blastocyst ratio of different mutation types resulting from Tyr targeting. The numbers represent the total number of TA clones sequenced and analyzed. WT, wild type allele.

(D) Blastocyst ratio of different genotypes resulting from Tyr targeting. Pure KO: blastula possessing a complete knockout mutation. Chimeric: blastula with both wild-type allele and knockout mutation. The numbers represent the total number of blastula counted.

(E & F) targeting of representative sequences of individual blastomeres in 16-cell embryos produced by sgRNA-Tyr-C (E) and sgRNA-Tyr-B+C+D+E (F). About 50% of blastomeres per embryo were successfully amplified and sequenced. The sgRNA targeted sequence is labeled green, while PAM sequence is labeled red; deleted nucleotides are indicated by hyphens, while the dashed lines indicate omitted regions.

(G & H) the ratio of different mutation types (G) and genotypes (H) of individual blastomeres of 8 to 16 cell embryos resulting from Tyr targeting. LED, large fragment exon deletion; bi-allelic, biallelic mutation; mono-allelic, monoallelic mutation. The numbers represent the total number of alleles or blastomeres analyzed.

(I) Different mutant ratios of 8 to 16 cell embryos resulting from Tyr targeting. The numbers represent the total number of all embryos analyzed.

FIG. 4, one-step method using C-CRISPR to obtain chimeric-free trite knockout mice.

(A) Schematic of sgrnas designed for Tet1, tet2 and Tet3 sites, three sgrnas per site.

(B) Ratio of intact Tet gene edited E7.5 day embryo to control embryo. Numbers represent total number of embryos counted (×p <0.001, ×p <0.01, chi-square test).

(C) Levels of 5hmC (red) and 5mC (green) in E7.5 day embryos resulting from different Tet targeting strategies were observed by immunostaining of tissue sections. White dotted line: the ectoderm of the E7.5 day embryo, the area in the right border is a higher definition image. "5hmC", 5-hydroxymethylcytosine; "5mC", 5-cytosine; bar:50 μm.

(D) Relative proportions of 5mC and 5hmC in the E7.5 day embryo. Each data point represents the ratio of the mean fluorescence intensities measured from one tissue section (5 hmC/5 mC). Error bars, standard deviation (< P <0.001, < P <0.01, unpaired t-test).

(E) Birth rates of mice obtained with different Tet gene targeted formats and control mice. The numbers represent the total number of embryos (P <0.001, chi square test) in all transplanted surrogate mice.

FIG. 5, F0 phenotyping results of single Y chromosome gene knockdown with C-CRISPR.

(A) Schematic representation of eight targeted genes located on the Y chromosome. Two sgrnas were designed for each gene. Red represents the gene knocked out from mice in previous studies by conventional methods; the green color represents genes located on both the X and Y chromosomes.

(B) Mouse birth rate obtained by knocking out single Y chromosome gene by C-CRISPR method. The numbers represent the total number of transferred embryos. Targeting the Erdr1 gene leads to embryonic lethality.

(C) The sex ratio of mice after deletion of different Y chromosome genes.

(D to F) proportion of testis weight in mice knocked out of different Y chromosome genes (D), sperm concentration (E) and proportion of motile sperm in the forward direction (F). The numbers represent the number of samples counted (×p <0.001, ×p <0.01, ×p <0.05, chi-square test).

(G) Columnar analysis of testis sections of adult mice deleted for different Y chromosome genes. Arrow, abnormal vacuoles in the aspergillosis tubules; arrow, sperm. The abnormality was found only in the testis knocked out by Eif2s3 y. Bar:100 μm.

FIG. 6, one-step method using C-CRISPR to obtain a bi-allelic Prrt2 mutant cynomolgus monkey.

(A) Schematic representation of the sgRNA targeting position of the Prrt2 site.

(B) PCR products including the targeting site were amplified from individual blastomeres of the sgRNA-Prrt2-C or sgRNA-Prrt2-B+C+D targeted octacell embryos and Sanger sequenced. The sgRNA targeted sequence is labeled green, while PAM sequence is labeled red; deleted nucleotides are indicated by hyphens, while the dashed lines indicate omitted regions.

(C & D) Prrt2 targets the ratio of different mutation types (C) and genotypes (D) of individual blastomeres of the obtained eight-cell embryo. LED, large fragment exon deletion.

(E) Proportion of genotypes of whole eight-cell embryos obtained targeted by Prrt 2.

(F) Prrt2 targets the ratio of different mutation types in tail, ear and blood cells in aborted and surviving monkeys. Obtaining aborted monkeys from sgRNA-Prrt2-a targeting: monkey #2, #3; survival monkeys were obtained from sgRNA-Prrt2-a targeting: monkeys #4, #8, #10; viable monkeys were obtained from sgRNA-Prrt2-b+c+d targeting: monkey #11, #12.

(G) Single cell analysis of two surviving monkeys (# 11, # 12) with double allelic variants of blood cells and fibroblasts. The numbers represent the total number of cells analyzed.

(H) Photographs of Prrt2 knockout monkeys with PDK-like behavior.

(I) Western blotting examined Prrt2 expression in cortex and cerebellum in multiple samples of one aborted Prrt2 edited monkey (# 3) and control wild type monkey (# 6). Notably, prrt2 expression was significantly reduced, but not completely removed, in the cerebellum of monkey # 3.

Figure 7, mouse chimerism rates obtained after co-injection of Cas9 mRNA and sgRNA into mouse MII oocytes.

(A) Injection process is schematically shown.

(B) Expression of mCherry after injection into MII oocytes. A red signal was observed after 4 hours of injection and was able to remain for 24 hours.

(C) Schematic of sgrnas designed for Tet1, tet2 sites. Tet1 or Tet2IF and IR: internal primers for identifying the genotypes of Tet1 and Tet 2; tet1 OR Tet2OF and OR: external primers for identifying the genotypes of Tet1 and Tet 2.

(D) Representative sequences of chimeric embryos obtained by one-step and two-step injection. The sgRNA targeted sequence is labeled green, while PAM sequence is labeled red; the deleted nucleotides are indicated by hyphens.

(E) And (3) judging the ratio bar graph of the chimeric blastula obtained by a one-step method and a two-step method according to the DNA sequencing result. Numbers on the line represent total blastula sequenced.

(F) Embryo blastocyst rate obtained by one-step and two-step injection. The numbers represent the total number of embryos injected. The blastula rate of the two-step injection was lower than the one-step injection (P <0.001, chi-square test).

(G) Edited allele phase profile.

(H) Size distribution of insertions and deletions found at the targeted site.

FIG. 8, representative PCR products and sequences of mouse tail, blastocyst and cleavage obtained by targeting gene Tyr.

(A) The sgRNA-Tyr-B+C+D+E targets the PCR products of the nine mice obtained. The PCR products of mice #1 to #6 were all TA cloned linked and sequenced. Sequencing results of PCR products labeled with tail are shown in fig. 8B. NC, negative control.

(B) sgRNA-Tyr-b+c+d+e targeting a representative sequence of the tail of mouse #5 was obtained. The sgRNA targeted sequence is labeled green, while PAM sequence is labeled red; deleted nucleotides are indicated by hyphens, while the dashed lines indicate omitted regions.

(C) Representative PCR products of the obtained blastula are targeted by sgRNA-Tyr-C or sgRNA-Tyr-B+C+D+E. The PCR products of the blastula labeled were further sequenced, see FIGS. 2D and 2E.

(D & E) sgRNA-Tyr-C targeting representative sequences of obtained blastula #1 (D) and sgRNA-Tyr-B+C+D+E targeting obtained blastula #5 (E).

(F) Insertion and deletion at the targeted location and size distribution of large fragment exon deletions.

(G) The sgRNA-Tyr-C or sgRNA-Tyr-B+C+D+E targets representative PCR products of blastomeres.

(H) Targeting gene Tyr resulted in a proportion of successfully amplified blastomeres in the embryo. The numbers represent the total number of blastomeres isolated from embryos obtained from the targeting gene Tyr.

FIG. 9, DNA sequencing analysis results of two-cell embryos obtained targeting gene Tyr.

(A) Experiment design. Single blastomeres of two-cell injected embryos were used for genotyping.

(B) The proportion of successfully amplified blastomeres in the embryo after Tyr gene editing. The numbers represent the total number of blastomeres isolated from embryos obtained from the targeting gene Tyr.

(C) The proportion of different genotypes in the two-cell embryo obtained by targeting gene Tyr. Pure KO: two-cell embryos with complete knockout mutations; chimeric: two-cell embryos containing both wild-type alleles and knockout mutations. The numbers represent the total number of two cell embryos counted.

(D & E) ratio of different mutation types (G) and genotypes (H) of individual blastomeres of two-cell embryos resulting from Tyr targeting. LED, large fragment exon deletion; bi-allelic, biallelic mutation; mono-allelic, monoallelic mutation. The numbers represent the total number of alleles or blastomeres analyzed.

(F & G) sgRNA-Tyr-C (F) or sgRNA-Tyr-B+C+D+E (G) targeting a representative sequence of a single blastomere in a two-cell embryo obtained. The sgRNA targeted sequence is labeled green, while PAM sequence is labeled red; deleted nucleotides are indicated by hyphens, while the dashed lines indicate omitted regions.

FIG. 10 DNA sequence analysis of mice obtained by editing Y chromosome gene by C-CRISPR method. The tail DNA of the obtained mice was sequenced with different genes on the Y chromosome targeted. LED, large fragment exon deletion; indel: insertion or deletion of bases; number on each column: total number of TA clones sequenced.

FIG. 11, monkey blastomeres, blastocysts and tissues obtained by targeting gene Prrt2, representative PCR products and sequences.

(A) Cleavage efficiency of each sgRNA for Prrt2 targeting. Cas9 mRNA and sgRNA were co-injected into fertilized eggs, then cultured to blastula and genotyping was performed. The numbers represent the total number of blastula used for genotyping.

(B) PCR products amplified from blastomeres of embryo #4 obtained from sgRNA-Prrt2-C targeting and embryo #3 obtained from sgRNA-Prrt2-B+C+D targeting. The PCR products of the blastomeres were TA cloned and sequenced.

(C) sgRNA-Prrt2-b+c+d targets DNA sequences representative results in ears, tails and blood cells of obtained monkeys #11 and # 12. The sgRNA targeted sequence is labeled green, while PAM sequence is labeled red; deleted nucleotides are indicated by hyphens, while the dashed lines indicate omitted regions.

Representative PCR products and sequences of single fibroblasts and blood cells of (D & E) monkeys #11 and # 12. PCR products of the single cells labeled are further sequenced and shown on the right column.

FIG. 12 Arntl gene complete knockdown in monkey embryos using the C-CRISPR one-step method.

(A) Schematic of sgrnas designed for the arttl locus.

(B) Cleavage efficiency of each sgRNA for arttl targeting. Cas9 mRNA and sgRNA (Arntl-1 to 6) were co-injected into fertilized eggs and then cultured to blastocysts for genotyping. The numbers represent the total number of blastula used for genotyping.

(C) Schematic of sgRNA targeting in COS-7 cells. After transfer of Cas9, sgrnas and mCherry into COS-7 cells, mCherry positive cells were sorted out and then used for T7E1 analysis.

(D) Arntl-targeted T7E1 assay. The arrow indicates the position of action of the T7E1 product. The control was normal COS-7 cell genomic DNA.

(E) Arntl-X +X+X obtained by targeting eight cell embryos were sequenced. LED, large fragment exon deletion; indels, insertion or deletion of bases. Number on each column: total number of TA clones sequenced.

(F) Size distribution of insertion deletions and large fragment exon deletions found at the targeting site.

(G) Arntl-X+X +X targeting the obtained octacell representative sequences in embryos. The sgRNA targeted sequence is labeled green, while PAM sequence is labeled red; deleted nucleotides are indicated by hyphens, while the dashed lines indicate omitted regions.

FIG. 13 analysis of off-target effects in Tyr-targeted mice and Prrt 2-targeted monkeys

(A) six mice obtained with sgRNA-Tyr-b+c+d+e targeting were used for off-target analysis. The inventors selected up to 10 possible mutation sites per sgRNA. And PCR products were amplified from these genomic sites, TA-cloned linked, and sequenced. Red: unpaired with the targeting sequence.

(B) Two living monkeys (# 11 and # 12) obtained from sgRNA-Prrt2-B+C+D targeting were used for off-target analysis. The inventors selected as many as three base mismatched off-target sites for detection per sgRNA. Red: unpaired with the targeting sequence.

Detailed Description

The present inventors have conducted intensive studies, and for the first time, disclosed a cocktail-type CRISPR/Cas9 system and a method for preparing a gene knockout animal (a chimeric-free or low chimeric-rate gene knockout animal) in which the gene function of a target gene is completely knocked out or most knocked out by using the same.

As used herein, the term "animal" refers to mammalian animals, including humans, non-human primates (monkeys, chimpanzees), farm animals and farm animals (e.g., pigs, sheep, cattle), mice (mice), and rodents (e.g., mice, rats, rabbits). The gene function is completely knocked out of the animal individual, and the gene function of each cell is destroyed, but the genotype of each cell is not necessarily completely consistent.

As used herein, the term "gene of interest" refers to a gene of interest in an animal genome that requires a knockout operation.

As used herein, the "target site on a target gene" refers to a fragment of the "target gene" that can be recognized by a sgRNA designed based on the "target site on the target gene" whereby cleavage of the Cas 9-encoded protein occurs at that location. The length of the target site on the target gene is 18-26 nucleotides.

As used herein, the "sgrnas" are either "Single-guide RNAs" or "Single-guide RNAs" designed based on "target sites on the gene of interest" which comprise sequences sufficient to cooperate with endonuclease Cas9 to guide the occurrence of Cas 9-mediated DNA double strand breaks at the target sites.

As used herein, the term "allele" refers to a pair of genes occupying the same locus on a pair of homologous chromosomes, which control a pair of relative traits. When a gene of an individual has two identical alleles, the individual is said to be homozygous for the gene or allele. When a gene of an individual has two different alleles, the individual is said to be heterozygous for that gene.

As used herein, the "low chimeric rate gene knockout animal" is an animal in which cells in the body in which the target gene to be knocked out has not been knocked out effectively account for less than 20% of the total cell number; more preferably 15% or less; more preferably 10% or less; even more preferably 5% or less. More particularly, in the present invention, the "low chimeric rate knockout animal" is an animal obtained after only one breeding cycle, that is, an animal of the F0 generation.

As used herein, unless otherwise indicated, the term "large fragment deletion" refers to the presence of a continuous base deletion of 30bp or more in the target gene after the gene editing operations according to the present invention.

As used herein, unless otherwise indicated, the term "indels" refers to the presence of a contiguous base deletion of less than 30bp in a target gene after a gene editing operation as described herein.

As used herein, a "cocktail-like CRISPR/Cas9 system" (Cocktail of CRISPR/Cas9 system), abbreviated as "C-CRISPR", i.e., a method based on CRISPR/Cas9 technology, to obtain high efficiency gene knockout by introducing Cas9 mRNA and cocktail of two or more sgrnas into animal cells, particularly animal fertilized egg cells.

Gene editing method

The CRISPR/Cas9 system is a very efficient method of gene editing, but most genetically edited animals are chimeric, i.e. they have only some of the cellular genes edited. The inventors have found that by introducing Cas9 mRNA and a plurality of contiguous (typically 10-300bp apart) individual guide RNAs (sgrnas) for the critical exons of each gene into animal cells (particularly fertilized eggs), up to 100% knockout rates of one or more genes can be achieved in animal embryos.

Accordingly, the present invention provides a method of preparing a knockout animal cell, the method comprising: (1) Preparing two or more sgrnas targeting different target sites on a target gene according to the nucleic acid sequence of the target gene to be knocked out; and (2) co-transferring the sgRNA of (1) or a nucleic acid (e.g., DNA) capable of forming the sgRNA, cas9 mRNA, or a nucleic acid (e.g., DNA) capable of forming the Cas9 mRNA into an animal cell to obtain a knockout animal cell.

The present invention also provides a method of preparing a gene knockout animal in which the gene function of a target gene is completely knocked out or a major portion thereof is knocked out, the method comprising: (1) Preparing two or more sgrnas targeting different target sites on a target gene according to the nucleic acid sequence of the target gene to be knocked out; (2) Co-transferring the sgRNA of (1) or a nucleic acid (such as DNA) capable of forming the sgRNA, cas9 mRNA or a nucleic acid (such as DNA) capable of forming the Cas9 mRNA into a fertilized egg to obtain a gene knocked-out animal fertilized egg; (3) Allowing the fertilized egg of (2) to develop to produce a gene knockout animal in which the gene function of the target gene is completely or mostly knocked out.

In the method of the invention, the animal cells are animal fertilized eggs, and the fertilized eggs can develop into gene knockout animals with complete or most of the target gene functions.

The appropriate sgRNA target site brings higher gene editing efficiency, so it is important to design and find the appropriate target site before proceeding with gene editing. Although the preparation of sgrnas is a technique known in the art, there are also some software available for the aided design of sgrnas, the selection of appropriate target sites is still crucial and difficult to do by means of software analysis alone. After designing specific target sites, in vitro cell activity screening is also required to obtain effective target sites for subsequent experiments.

As a preferred mode of the invention, when designing the sgRNA for two or more target sites on different target genes, it is preferable that the spacing between the target sites on the target genes targeted by the sgRNA is 9-500 bp. Preferably, the interval can be 10-300 bp; for example, 15bp,20bp,30bp,40bp,50bp,60bp,70bp,80bp,90bp,100bp,120bp,150bp,180bp,200bp,250bp,280bp. It will be appreciated that other options are possible depending on the different lengths and different distributions of exons of the gene, and that a person skilled in the art can obtain a suitable choice according to the technical scheme presented in the present invention.

In designing sgrnas for two or more different target sites on a target gene, the number of sgrnas is typically between 3 and 30, and may be, for example, 4,5,6,7,8,9, 10, 12, 15, 18, 20, 25.

As a preferred mode of the invention, the plurality of sgRNAs targeting different target sites on the target gene, wherein at least 2, preferably at least 3, target sites on the target gene are located in the same exon region. Preferably, the exon is a key exon of the target gene, which is edited to significantly alter or disable gene function.

As a preferred mode of the invention, the sgRNAs targeting different target sites on the target gene can introduce frame shift mutations in the target site regions of the target gene targeted by the sgRNAs. Preferably, the design of the sgrnas within the functional or coding regions of the target genes facilitates the introduction of frame shift mutations.

As a preferred mode of the invention, the sgRNAs targeting different target sites on the target gene can introduce large fragment deletions in the target site region of the target gene targeted by the sgRNAs. Preferably, the large fragment deletion is a large fragment deletion of an exon region. The inventors have found that relatively short-distance contiguous sgrnas can lead to high frequency exon large fragment deletions rather than common indels, which can lead to higher probability of total gene deletion, more effectively improving the efficiency of gene knockout.

As a preferred mode of the invention, the sgRNAs targeting different target sites on the target gene can simultaneously introduce indels and large fragment deletions in the target site region of the target gene.

To ensure efficient gene knockout, the C-CRISPR method of the present invention preferably satisfies one or more of the following conditions: (a) targeting one exon of a gene using multiple sgrnas; (b) Several sites on multiple sgrnas targeting exons that are relatively close together (the spacing is as described previously); (3) The key exons of the target genes, sometimes on the key structural domain of the protein, can thoroughly disturb the function of the protein by only one or two amino acid mutations; (4) The cleavage efficiency of sgrnas was detected in advance in embryos, and in particular, high-efficiency sgrnas were screened in advance for gene editing in monkeys. These conditions may promote the creation of large fragment deletions of exons in addition to the general indels, which in turn allow complete gene knockout.

After the target site is determined, known methods can be used to allow the sgrnas and Cas9 to be introduced into the cell. Some contemplated ways of introducing cells are: transient expression, such as transfection, electroporation, or non-integrated virus (AAV or adenovirus), and the like. When applied to fertilized egg cells, microinjection is preferably used to allow sgrnas and Cas9 to be introduced into the cell. Alternatively, the nucleic acid capable of forming the sgRNA is a nucleic acid construct or an expression vector, or the nucleic acid capable of forming the Cas9 mRNA is a nucleic acid construct or an expression vector, and these expression vectors are introduced into a cell, thereby forming active sgRNA and Cas9 mRNA in the cell. Alternatively, cas9 mRNA carrying a promoter and sgRNA carrying a promoter may be obtained by in vitro transcription and injected into cells. Such promoters include, but are not limited to, the T7 promoter, the U6 promoter.

Use of the same

The method can be used for preparing animal cells, fertilized eggs or animals with the gene knocked out, wherein the animals are the gene knocked out animals with the complete or most knocked out gene functions of target genes; in the body of the gene knockout animal with low chimeric rate, the cells which are not subjected to effective knockout of the target gene to be knocked out account for less than 20% of the total cell number; more preferably 15% or less; more preferably 10% or less; even more preferably 5% or less. The target gene is completely knocked out or most knocked out, namely, the animal is obtained after only one breeding cycle.

The gene knockout animal with the target gene completely knocked out or mostly knocked out can be used for researching the animal gene function, and knowing the functions of the genes of interest in various links and states of animal growth and development, and involved biological regulation and control mechanisms and signal paths. The method of the invention can be used for animal embryo development research and understanding the functions of genes of interest in the embryo development process.

The methods of the invention are applicable to targeting a variety of genes of interest for which functional studies are desired, including but not limited to: the reporter gene (such as fluorescent protein gene), the phenotype marker gene, the structural gene, the functional gene and the like are subjected to gene knockout to obtain the F0 generation non-chimeric or chimeric gene knockout animal. As a preferred mode of the present invention, the genes include, but are not limited to: GFP, tyr, tet1, tet2, tet3, prrt2, arntL, Y chromosome genes (e.g., zfy1, ube1Y1, kdm5d, eif2s3Y, ddx Y, usp9Y, sry, erdr 1).

The CRISPR/Cas9 system is a very efficient gene editing approach, but most gene editing animals exhibit chimerism, which prevents one from efficiently phenotyping gene knockouts. In the present invention, using C-CRISPR, it is possible to have CRISPR/Cas9 injected animals exhibit efficient gene deletion in nearly 100% in all cells, whether single or multiple genes are deleted. This would be a highly ethical perspective, especially when non-human primates are used as animal models for research.

In a specific embodiment of the invention, the phenotypic analysis of F0 mice in which eight genes (e.g., zfy1, ube1Y1, kdm5d, eif2s3Y, ddx Y, usp9Y, sry, erdr 1) on the Y chromosome were each knocked out, is sufficient to demonstrate the stability of the methods of the invention in making a knockout animal. Importantly, the method can be used for efficiently knocking out the whole gene.

In a specific embodiment of the invention, a C-CRISPR method knockout study was performed for a phenotypic marker gene. Phenotypic marker genes such as: fluorescence of GFP, skin whitening of Tyr, 5' hydroxymethylated cytosine of Tet-1, 2, 3, sex determination of Sry, and the like. The results of these examples all indicate that complete knockouts of the target gene in embryos and animals can occur and complete loss of function can be achieved.

In a specific embodiment of the invention, the monoblastocyst or monoblastomere genotype of a gene-edited mouse, monkey embryo was also analyzed, wherein all cells had a double allelic mutation of the gene of interest, wherein most (80%) had a large fragment deletion of the exon, which in any case was a strong evidence of complete deletion of the gene. The deletion of large fragments of exons greatly increases the likelihood of loss of gene function over conventional insertion deletions, as this may result in a gene product that is free of frameshift mutations but has lost function.

Gene knockout monkeys were obtained in several studies, but these monkeys all had high chimerism. This can result in the difficulty of these genetically edited monkeys to exhibit a clear phenotype. In the prior art, it is necessary to go through at least two fertility cycles (12 years or more) in order to produce monkeys that can be used for phenotyping. Using the C-CRISPR method of the present invention, the inventors obtained non-chimeric gene editing monkeys directly at F0 generation, and the inventors used only six months from the start of embryo injection, which fully demonstrated that the method of the present invention was very suitable for rapid establishment of gene editing monkey models.

In a specific embodiment of the invention, a monkey model of human paroxysmal non-motor dyskinesia (human dyskinesia, PKD) was constructed in one step without chimerism by knocking out the Prrt2 gene by C-CRISPR method. PKD was found to be a single gene-induced neurological disease, rooted at mutations in the Prrt2 gene. Constructing monkey models of PKD would help understand the pathological mechanisms of PKD and develop potential therapeutic approaches. To the inventors' knowledge, this is the first time that CRISPR technology was successfully used to obtain knockout monkeys with disease behavioral phenotypes. The high efficiency of C-CRISPR demonstrated herein makes gene studies in F0 generation monkeys no longer a dream.

In particular embodiments of the invention, comprehensive off-target analysis was also performed on those animals targeted with multiple sgrnas, with no apparent off-target effect found.

Gene editing kit

The invention also provides a kit for preparing a gene knockout animal with complete or most of the gene functions of a target gene, wherein the kit comprises sgRNA and Cas 9mRNA aiming at a gene of interest and applied to C-CRISPR method operation or a reagent capable of forming the sgRNA and Cas 9mRNA in vivo or in vitro.

The genes of interest include: GFP, tyr, tet1, tet2, tet3, prrt2, arntL, zfy1, ube1y1, kdm5d, eif2s3y, ddx y, usp9y, sry, erdr1, etc. For these genes of interest, the inventors have conducted intensive studies and screens to obtain sgRNAs suitable for achieving efficient knockdown, respectively, and established a C-CRISPR system.

Other reagents commonly used in performing transgenic procedures may also be included in the kit to facilitate use by those skilled in the art, such as reagents for microinjection, etc. In addition, instructions for use directing the operation of those skilled in the art may be included in the kit.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out according to conventional conditions such as those described in J.Sam Brookfield et al, molecular cloning guidelines, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Acquisition of Cas9 mRNA and sgRNA

The Cas9 coding region on plasmid px260 (adedge) was amplified with primers Cas9F and R (forward: TAATACGACTCACTATAGGGAGATT TCAGGTTGGACCGGTG; reverse: GACGTCAGCGTTCGAATTGC) using PCR methods, while the T7 promoter was added to the product. The T7-Cas9 PCR product was purified and used as a template for In Vitro Transcription (IVT) of mRNA using a kit of mMESSAGE mMACHINE T ULTRA kit (Life Technologies), thereby obtaining Cas9 mRNA.

Plasmid px330 (obtained from Addgene) was amplified using the PCR method using the primers in the list (table 1) while the T7 promoter was added to the sgRNA template. The T7-sgRNA PCR product was purified and used as a template for In Vitro Transcription (IVT) of the sgRNA using a kit of MEGA shortscript T7kit (Life Technologies) to obtain the sgRNA.

Both Cas9 mRNA and sgRNA were purified with MEGA clear kit (Life Technologies) and eluted with RNase-free water.

When applied to injection, sgrnas designed for the corresponding genes, along with Cas9 mRNA, were co-microinjected into fertilized eggs.

TABLE 1 preparation of primers used as in vivo transcription templates for sgRNA

/>

TABLE 2 sgRNA target sequences

/>

/>

Fertilized egg injection, embryo culture and embryo transfer

When the mice were subjected to gene editing, first hormone superb C57BL/6 female mice (three weeks old) or B6D2F1 female mice (C57 BL/6X DBA 2J) female mice (7-8 weeks old), then mating with C57BL/6 male mice or B6D2F1 male mice, respectively, and then collecting fertilized eggs from oviducts. For editing of GFP gene, homozygous Actin-GFP transgenic male mice (Okabe, m., et al (1997) FEBS letters 407, 313-319) were mated with wild type female mice and fertilized eggs were collected. After mixing Cas9 mRNA (50 μg/μl) and sgRNA (50 μg/μl), the mixture was injected into the cytoplasm of the fertilized egg where the prokaryote was clearly visible using a continuous water flow pattern of a FemtoJet microinjection apparatus (Eppendorf), the injection was completed in HEPES-CZB medium containing 5 μg/ml Cytochalasin (CB), and the embryos after injection were cultured in amino acid-containing KSOM medium at 37 ℃ and 5% co2 for 1.5 days as two-cell embryos. Subsequently, 25-30 two-cell embryos were transplanted into the oviduct of a 0.5 day pseudopregnant ICR female.

When the monkey is subjected to gene editing, oocyte collection is performed using a laparoscope. After 32-36 hours of hCG stimulation, oocytes were aspirated from follicles of 2-8mm diameter, and the collected oocytes were cultured in pre-equilibrated maturation medium. Oocytes arrested in metaphase II were used for intracytoplasmic sperm injection (ICSI) and then the appearance of both prokaryotes was observed to determine if they were fertilized. Cas9 mRNA (100. Mu.g/. Mu.l) and sgRNA (50. Mu.g/. Mu.l) were injected into fertilized eggs. Following injection, embryos are placed in HECM-9 medium for culture until the next day for transfer into the pseudopregnant mother. Some embryos are cultured to the morula or blastocyst stage, then the extracted genome is collected and analyzed.

Single cell PCR analysis

Individual cells were collected and transferred under a stereoscopic microscope using a glass tube. Embryos from 8-16 cell stages of mice or monkeys were digested with benchtop acid to remove zona pellucida, and then embryos transferred to 0.25% pancreatin, gently blown to isolate individual blastomeres. Finally, the blastomeres were washed 7 to 10 times in 0.25% pancreatin and transferred to a PCR tube. Fibroblasts or leukocytes were gradually diluted with KSOM until the cells were completely dispersed. After 7 to 10 washes in KSOM, individual cells were transferred to one PCR tube. Mu.l of lysate (0.1% Tween 20, 0.1% Triton X-100 and 4. Mu.g/ml proteinase K) was added to the PCR tube and then centrifuged to facilitate mixing. The mixture was reacted at 56℃for 30 minutes, followed by 95℃for 5 minutes. The cleavage product was used as template for the next nested PCR.

Genotyping

The genotype of the mutant mice was detected by extracting genomic DNA from tail tissue followed by PCR reaction (primers used for detection are shown in Table 3). ExTaq was activated at 95℃for 3 minutes, and then PCR was performed at 95℃for 30s,62℃for 30s and 72℃for 1 minute, and then the PCR was repeated for 34 cycles, followed by extension at 72℃for 5 minutes. The PCR products were purified by tapping and analyzed by DNA sequencing. For blasts, after KSOM was washed 6 times, individual blasts were transferred into PCR tubes containing 1.5. Mu.l of lysate (0.1% Tween 20, 0.1% Triton X-100 and 4. Mu.g/ml proteinase K) and then reacted at 56℃for 30 minutes followed by 95℃for 10 minutes to inactivate proteinase K. PCR amplification was performed using nested primers. ExTaq was activated at 95℃for 3 minutes, and then PCR was performed at 95℃for 30s,62℃for 30s and 72℃for 1 minute, and then the PCR was repeated for 34 cycles, followed by extension at 72℃for 5 minutes. The second round of PCR reaction was performed using 0.5. Mu.l of the PCR product of the previous round as a template and nested internal primers as PCR primers. The PCR reaction system is the same as above.

TABLE 3 primers for genotyping

/>

HE staining and immunostaining

For testis analysis, a portion of the testis was fixed overnight with bouin's solution. The fixed tissue was embedded in paraffin and then cut to a thickness of 5 μm with a Microtome. After dewaxing, the reconstituted sections were stained with hematoxylin-eosin. For 5hmC staining, embryos were dissected from pregnant female mice after implantation at specific days, then fixed with 4% paraformaldehyde, and embedded with OCT (Sakura) and cut to 8 μm thickness. After washing with PBS, the sections were treated with hydrochloric acid solution (4N hydrochloric acid, 0.1% Triton X-100 in distilled water), followed by washing with PBS, and permeabilization with blocking solution (1% BSA,10% sheep serum and PBS containing 0.3% Triton X-100). Next, the sections were incubated with primary antibody (mouse anti-5 mC antibody, 1:500, eurogentec#BI-MECY-0100; rabbit anti-5 hmC antibody, 1:1000,Active Motif#39792) overnight at 4℃and secondary antibody at room temperature for one hour. Finally, these sections were blocked with anti-quencher (Invitrogen) and photographed under observation using a LEICA TCS SP II confocal microscope. The intensity of the signal was measured with Leica Application Suite software.

Sperm analysis using computer-assisted means

The formula of the buffer solution comprises the following steps: naCl 7.0g/L, KCl 149mg/L, caCl ₂ .2H ₂ O 147mg/L，NaHCO ₃ 2.1g/L，MgSO ₄ .7H ₂ O 296mg/L，NaH ₂ PO ₄ -H ₂ 49.7mg/L O, 1g/L Glucose, 121mg/L Na pyruvate, 6.63g/L Sucrose, 2.59g/L TAPSO (buffer) (10 mM), 57mg/L Penicilline, 29mg/L Streptomycin, pH=7.3 to 7.4. Sperm are diluted to 3-6X10 with the buffer ⁶ Each ml was then incubated in dishes at 37℃for 20 minutes. Sperm suspensions were gently mixed prior to viability determination. For each viability assay, a 5. Mu.l drop of sperm suspension was drawn by capillary action using a large-bore gun head and placed into a number of wells (depth, 10 μm) of a previously preheated Lejia slide, followed by a Computer Aided Semen Analysis (CASA) instrument (HTM-TOX IVOS sperm viability analyzer, animal mobility, version 12.3A;Hamilton Thorne Research). The magnification was 10×. All samples were counted at least twice to avoid errors due to erroneous sampling. At least five zones and at least 100 viable sperm were recorded per sample. Drawing of the figureSuch as preservation and subsequent analysis.

Behavioural analysis of monkeys

The shapers (F0) of Prrt2 mutant monkeys performed behavioral observations since their birth. Typical anomaly characteristics were recorded with a video camera (Sony HDR-XR520 Handicam). Each monkey was placed in a platform or box (1.5 x 1x 1.1) for recording according to the different viewing purposes.

Western blotting method

Brain tissue was removed from the dead fetus of the monkey and then lysed with RIPA lysate (50 mM Tris-HCl (pH 7.4), 150mM NaCl,1%Triton X-100,1%sodium orthovanadate,1mM EDTA and 0.1%SDS) supplemented with 1mM PMSF and protease inhibitor Cocktail (CST). The proteins were then extracted by centrifugation and an equal amount of the proteins were electrophoresed on a 9% SDS-polyacrylamide gel and then transferred to a polyvinylidene fluoride membrane (Millipore) which was blocked in TBST containing 5% skim milk powder for one hour at room temperature and then incubated overnight with the appropriate primary antibody at 4 ℃. The primary antibodies used herein are: rabbit anti-PRRT 2 antibody (1:2000, sigma) and HRP conjugated anti-GAPDH antibody (1:8000, kangchen). The next day the membranes were each washed 3 times with TBST for 10 minutes each and then with HRP conjugated anti-rabbit secondary antibody for two hours at room temperature. After washing again, the strips can be developed with ECL Plus Western Blot detection reagent (Tiangen).

SURVEYOR assay

Cos-7 cells were seeded into 6-well plates 24 hours prior to transfection. Cells were plasmid transfected with Lipofectamine 3000 (Life Technologies) at 80-90%. Cells were transiently transfected with the pX 330-mCherry-sgRNA plasmid (established based on addgene 42230). 72 hours after transfection, mCherry positive cells were sorted by flow cytometry and cells resuspended in lysate (0.1% tween 20, 0.1% triton x-100 and 4 μg/ml proteinase K) and reacted at 56 ℃ for 30 min followed by 95 ℃ for 10 min to inactivate proteinase K. The SURVEYOR method is consistent with the procedure reported previously. The primers used for PCR amplification are detailed in Table 3.

Whole genome sequencing and off-target analysis

Whole genome sequencing was performed using Illumina HiSeq X Ten instruments with average coverage of 10-fold (Tyr-B+C+D+E- #1, #2, #3, #4, #5, # 6) and 15-fold (Prrt 2-B+C+D- #11, # 12), respectively. Qualified measured sequence data were mapped to the mouse reference genome (mm 10) and the spliced cynomolgus monkey genome (v 5) using BWA (v0.7.10) according to default parameters. Data measured to have less than 50bp pairing or greater than 0 mismatch with the referenced genome were removed. The predictive protocol for regions where sgrnas are likely to cause off-target is as previously reported (Hsu et al (2013). Nature biotechnology, 827-832) and ranking is scored using CRISPR design software. The inventors selected the first 20 off-target sites for each sgRNA, and 60bp of their adjacent region. Sequencing data in these regions are then BLAST compared to the reference sequence to search for possible insertion and deletion patterns within the sample due to off-target effects. Similarly, the first 10 most likely off-target sites were also amplified by PCR and DNA sequencing was performed. The primers for amplifying off-target sites are detailed in Table 4.Illumina HiSeq sequence data have been uploaded and saved at NCBI, serial No. BioProjectID PRJNA352101.

TABLE 4 primers for off-target analysis

/>

/>

/>

Data analysis

All P values were obtained analytically according to the t-test and chi-square test. All error bars represent standard deviations.

EXAMPLE 1 complete deletion of Green fluorescent Gene from transgenic Green fluorescent embryos

The present inventors first want to know whether pre-injection of Cas9 mRNA and sgRNA into mouse MII eggs in fertilized eggs can reduce their chimerism. The targeted gene is Tet1 and Tet2; primers used to make in vivo transcription templates are shown in Table 1 with the corresponding sequences (Tet 1 and Tet2 and sgRNA-R); the sgRNA target sequence is as the corresponding sequence in table 2; primers used in genotyping were as corresponding sequences in Table 3. Two-step injection: cas9 mRNA and sgRNA were injected into mouse MII oocytes, and sperm were injected into the MII oocytes after 4 hours. Injection in one step: cas9 mRNA and sgRNA were injected into the mouse zygote embryo. As a result, no significant effect was found, and the chimeric phenomenon was not significantly reduced, as shown in FIGS. 7A-F.

Although the inventors have designed a number of sgrnas for one-to-one experiments, the effect is still not ideal. Then, the inventors tried to use multiple rather than one sgRNA to see that the chimeric phenomenon when CRISPR/Cas9 edited embryo genes could not be reduced. To allow easy estimation of the chimeric rate, the inventors used homozygous Actin-EGFP male transgenic mice (broadly expressing GFP throughout) and wild-type female mice to breed fertilized eggs, and injected Cas9 mRNA and GFP-targeting sgrnas into them simultaneously, and analyzed GFP expression at the blastula stage (fig. 1A). The inventors designed four sgrnas for the same exon of GFP, whose target sequences were spaced 10-200bp apart from each other. Primers used to make in vivo transcription templates were as set forth in the corresponding sequences in Table 1 (GFP-A, GFP-B, GFP-C, GFP-D); the sgRNA target sequence is as in Table 2 (GFP-A, GFP-B, GFP-C, GFP-D); primers used in genotyping were as corresponding sequences (GFP) in Table 3.

After injection of large numbers of embryos, the inventors found that 31-44% of blasts injected with only one sgRNA had no green fluorescent signal, while the remainder appeared as chimeras, i.e. a portion of the blastomeres remained green fluorescent signal (fig. 1B and 1C). As a control, all blasts obtained without gene editing were GFP positive (FIGS. 1B and 1C).

However, after injection of multiple (2, 3 or 4) GFP-targeting sgrnas, no green fluorescent signal could be detected in either blastocyst (fig. 1B and 1C). Furthermore, injection of multiple sgrnas did not show any toxicity to embryo development compared to injection of a single sgRNA (fig. 1D). Then, the present inventors have performed genotyping of GFP-negative blasts obtained by injecting sgrnas, and as a result, found that blasts showed large fragment deletions (considered >30bp or=30 bp) at GFP sites instead of general indels (considered <30 bp), and this ratio was gradually increased with increasing number of sgrnas used (up to 90%, fig. 1E to 1G).

These results indicate that a single allele can be completely knocked out using two or more closely adjacent sgrnas for a single exon, and the inventors named this approach as "cocktail CRISPR/Cas9 system" (Cocktail of CRISPR/Cas9 system, abbreviated as C-CRISPR). The inventors analysis suggested that the complete deletion of genes could be so efficient as to be due to the simultaneous introduction of frame shift mutations and exon deletion.

EXAMPLE 2 complete deletion of the Tyr Gene in mice

To further examine whether C-CRISPR can completely delete endogenous biallelies, the inventors targeted the Tyrosinase gene of fertilized eggs (Tyr for pigmentation) and obtained gene-edited mice by two-cell embryo transfer (fig. 2A). Mice with one or two wild type Tyr copies will show complete staining whereas mice with both alleles null will be albino, so that chimerism of the mice can be seen by visual inspection. Primers used for preparing in vivo transcription templates are shown as corresponding sequences (Tyr-A-Tyr-F and sgRNA-R) in Table 1; the sgRNA target sequences are as set forth in table 2. The sgRNA target sites A (Tyr-A), F (Tyr-F) are located at the intron positions immediately adjacent to the exon 4 at both ends; the sgRNA target sites B (Tyr-B), C (Tyr-C), D (Tyr-D), E (Tyr-E) are located in exon 4.

The inventors divided the gene editing experiments into five groups and explored the efficiency and potential mechanism of C-CRISPR by observing the mouse pigment deposition phenomenon (fig. 2B). If a single sgRNA targeting the Tyr gene exon (group I, only indels) was used, a very high proportion of mice (77%) were chimeric (fig. 2C and 2D), which was consistent with previous reports (Yen et al, 2014). In contrast, targeting one exon (group II, with insertion deletion and large fragment deletion of the exon) with two sgrnas greatly reduced the proportion of chimeric mice (only 26%). In group III (exon deletion only), two sgrnas target two introns next to the exons, which also resulted in a higher chimeric mouse proportion (68%) (fig. 2C and 2D). Interestingly, the present inventors found that the use of three or more sgrnas targeting one exon could completely eliminate the chimeric phenomenon (0%, group IV), a method that uses multiple sgrnas could be blocked when some exons were too small to accommodate that many sgRNA sites. To explore alternatives to such short exons, the inventors have designed a scheme (panel V) with two sgrnas targeting adjacent exons plus one sgRNA targeting the interior of the exon, which was found to reduce the rate of chimeras to 7-8% (fig. 2C and 2D).

The inventors also compared the effect of increasing sgrnas on the birth rate of mice, and as a result found that increasing the sgrnas of the targeted genes did not reduce the birth rate of mice (30-50%, fig. 2E).

After mating with ICR mice (albino strain), four sgrnas (sgRNA-Tyr-b+c+d+e) targeted genetically modified mice were normal in fertility, with 100% of the offspring albino, indicating complete knockdown of the Tyr gene in germ cells of these mice (table 4).

TABLE 4 reproduction and genetic Capacity of C-CRISPR genetically modified mice

In summary, C-CRISPR can generate chimeric-free gene knockout mice in F0 generation with high efficiency, and the experimental data of the five groups show that the introduction of frame shift mutation and exon large fragment deletion can bring about high-efficiency gene deletion.

Example 3 mechanism of complete deletion of Gene by C-CRISPR

To further elucidate the mechanism of C-CRISPR, the inventors performed DNA sequence analysis on Tyr gene edited embryos and mice. After identifying tail tissues of 6 mice with four sgrnas targeting Tyr (sgRNA-Tyr-b+c+d+e targeted albino mice), the inventors found that the Tyr knockdown in five mice was due entirely to the knockdown of the entire exon, while 80% of Tyr knockdown in the remaining one was due to exon knockdown and 20% was due to the frameshift mutation resulting from indels (fig. 3A and 3B; fig. 8A and 8B).

Considering that tail tissue is not necessarily representative, the inventors have performed full blasts for the single sgRNA group (group I) and the four sgRNA groups (group IV). As expected, all blasts of group IV (n=12) exhibited complete deletion of the wild-type Tyr allele, including 74% deletion of large fragments of exons (> 30 bp) and 26% indels (< 30 bp). In contrast, group I blasts (8 of 12 embryos were chimeric) exhibited different proportions of wild-type Tyr alleles (FIGS. 3C and 3D, FIGS. 8C-8F).

To rule out the possibility of underestimating the wild-type Tyr gene content in the whole blastocyst due to PCR bias, the inventors further examined the gene-edited embryo at the single cell level. The inventors determined the Tyr gene for each blastomere of 8 to 16 cell stage embryos using PCR techniques, with approximately 53% of the blastocysts being successfully amplified (FIGS. 8G and 8H). Examination of blastomeres from 21 embryos from 3 to 4 sgRNA targeting groups (group IV) revealed that each blastomere (n=116) exhibited a deletion of the wild-type Tyr gene, either an indel or an exon large fragment deletion, or both (fig. 3E to 3I). In contrast, of the 58 blastomeres from 9 embryos in group I (with only one sgRNA), only 8 exhibited either wild-type Tyr gene or Tyr gene monoallelic mutation, meaning 67% of the embryos were chimeric (fig. 3E to 3I).

The inventors also performed single cell analysis of two-cell embryos subjected to Tyr gene editing and found that C-CRISPR mediated gene editing occurred as early as two-cell stages in all two-cell blastomeres (n=46), and that all embryos were double allelic Tyr knockouts. In contrast, there was a very high rate of chimerism (62%) in embryos targeted with a single sgRNA at the two cell stage (fig. 9A-G).

Example 4 three Gene knockout without chimeric phenomenon

To examine whether injection of C-CRISPR into fertilized eggs can knock out multiple genes at once, three genes involved in DNA oxidation and functionally redundant to each other were targeted at Tet1, tet2 and Tet3 simultaneously (fig. 4A). Primers used for preparing in vivo transcription templates are shown as corresponding sequences (Tet 1-A-C; tet 2-A-C; tet 3-A-C; and sgRNA-R) in Table 1; the sgRNA target sequences are as set forth in table 2. sgRNA-Tet1-A, sgRNA-Tet1-B, sgRNA-Tet1-C targets exon 2 of Tet 1; sgRNA-Tet2-A, sgRNA-Tet2-B, sgRNA-Tet2-C targets exon 3 of Tet 2; the sgRNA-Tet3-A, sgRNA-Tet3-B, sgRNA-Tet3-C targets exon 4 of Tet 1.

After embryo transfer, the inventors collected E7.5 embryos and examined the expression of the Tet gene by analyzing the content of 5 'hydroxymethylated cytosine (5 hmC), because 5hmC is the major product of oxidation of 5' methylcytosine (5 mC) by the Tet protein. In embryos targeting the Tet gene (group I: targeting both Tet1 and Tet2 genes with six sgRNAs, tet1,2-A+B+C; group III: targeting three genes Tet1, tet2 and Tet3 with nine sgRNAs, tet1,2, 3-A+B+C), approximately half of the embryos degenerated at E7.5 (FIG. 4B), consistent with previous reports. Immunostaining of 5hmC and 5mC in ectodermal tissue sections showed that wild-type embryos had very high levels of 5hmC in all cells (fig. 4C), in contrast to embryos triple-targeted with three sgrnas for the Tet1, tet2 and Tet3 genes (group II, one sgRNA for each gene, tet1,2, 3-a) which showed chimeric 5hmC staining, with very high levels of 5hmC in some cells (fig. 4C). Furthermore, embryos double-targeted with six sgrnas for Tet1 and Tet2 (three sgrnas per gene) also showed similar 5hmc chimeric staining. However, the 5hmC of embryos triple-targeted with nine sgrnas for the Tet1, tet2 and Tet3 genes (three sgrnas for each gene, tet1,2, 3-a) was completely absent (fig. 4C), indicating that all three Tet genes were deleted.

The inventors calculated an average ratio of 5hmC/5mC using immunofluorescence density, and the results showed that the ratio was halved in groups I and II and lower in group III (fig. 4D).

Embryo birth rates were reduced with six sgrnas double deleted Tet genes, whereas nine sgrnas triple deleted Tet genes were not alive (fig. 4E).

These results are well documented as to the efficiency of deleting multiple genes in one step using the C-CRISP method.

EXAMPLE 5 phenotyping of F0 mice made by C-CRISPR

The inventors then performed phenotypic analysis of the functions of multiple Y chromosome genes using the C-CRISPR method, while also testing the efficiency of one-step gene knockout for rapid functional screening of large numbers of genes in mice. The Y chromosome is highly specialized and is specially used for sex differentiation and fertility of males. However, only a few genes have been targeted to knockdown and their biological efficacy tested so far. Therefore, the inventors decided to target eight single copy Y chromosome genes therein separately: zfy1; ube1y1; kdm5d; eif2s3y; ddx3y; usp9y; sry; erdr1 (FIG. 5A). Sry and Eif2s3y in these genes were knocked out by conventional methods. Primers used for preparing in vivo transcription templates are shown as corresponding sequences (Zfy 1-A-B; ube1y 1-A-B; kdm5 d-A-B; eif2s3 y-A-B; ddx y-A-B; usp9 y-A-B; sry-A-B; erdr 1-A-B; and sgRNA-R) in Table 1; the sgRNA target sequences are as set forth in table 2.

Among the eight genes tested, the inventors found that the Erdr1 gene, which is targeted for deletion and exists on both the X and Y chromosomes, was embryonic lethal. The deletion of the remaining seven genes, respectively, had no significant effect on birth rate, and genotyping of these mice confirmed that the entire gene was deleted (fig. 10). Consistent with previous studies, all mice with the Sry gene knocked out had female external genitalia and papillae, suggesting that deletion of the Sry gene resulted in sex reversal in the mice. In contrast, mice targeted to the other six genes had normal sex ratios (fig. 5B and 5C). Male mice targeted for deletion of the Eif2s3y gene were not fertile and testis dysplasia (FIGS. 5D to 5F, table 5), consistent with previous results of one study. Interestingly, male mice deleted for the other five genes (Zfy 1, ube1y1, kdm5d, ddx y, usp9 y) were fertile and offspring could be bred with wild-type female mice (table 5, table 6). However, mice deleted for Zfy1 or Kdm5D gene had lower testis body weights, while mice deleted for Ube1y1 or Dxd y gene had lower normal sperm fractions (fig. 5D to 5F, table 5). Histological analysis of testis tissue also showed that only the Eif2s3y gene among the six genes resulted in a defect in differentiation of spermatogenic cells (fig. 5G). These results indicate that the C-CRISPR method can be used for rapid phenotypic analysis of gene function by creating F0 mice with complete knockouts of gene function.

TABLE 5 average litter size of F0 and F1 mice with Y chromosome gene deletion due to C-CRISPR

/>

TABLE 6 phenotype of F0 and F1 mice with Y chromosome Gene deletion caused by C-CRISPR

/>

/>

WT: wild type; pure KO: mutant mice were completely knocked out.

Example 6 one-step method to obtain chimeric-free Gene knockout monkey

The inventors next examined whether the C-CRISPR method could be used to construct non-chimeric gene editing monkeys. The inventors targeted knockout of the Prrt2 gene of cynomolgus monkey (Macaca fascicularis) in order to construct animal models of human episodic exercise-induced dyskinesia (Paroxysmal Kinesigenic Dyskinesia, PKD).

The inventors first designed ten sgrnas for exon 2 of the Prrt2 gene (meaning one sgRNA per single injection), injected (one at a time) into embryos using the traditional CRISPR/Cas9 strategy, and then tested at the blastula stage. Primers used to make in vivo transcription templates are shown in the corresponding sequences (Prrt 2-A and sgRNA-R) in Table 1; the sgRNA target sequences are as set forth in table 2. As a result, it was found that only one of the sgRNAs (sgRNA-Prrt 2-A) was more efficient in targeting genes (FIGS. 6A and 11). Next, the inventors injected sgRNA-Prrt2-a and Cas9 mRNA into monkey fertilized eggs at once, and transplanted 55 such embryos into 17 surrogate mothers in the two-cell phase. 6 abortions of dead fetus and 4 living monkeys were obtained. After genomic analysis of the tails of ten monkeys, two stillbirth (# 2 and # 3) and 3 live monkeys (# 4, #8 and # 10) were found to have 20-60% different levels of Prrt2 deleted, while the remaining 5 monkeys were not genetically edited (FIG. 6F, table 7).

In order to try the C-CRISPR method, the present inventors have additionally constructed 3 sgRNAs targeting exon 3 of Prrt2 gene (sgPrrt 2-B to sgPrrt 2-D), and examined the efficiency of embryo development to blastocyst stage after injection of these sgRNAs respectively among fertilized eggs. Primers used to make in vivo transcription templates are shown in the corresponding sequences (Prrt 2-B-D) in Table 1; the sgRNA target sequences are as set forth in table 2. The inventors found that all of these sgrnas could introduce DNA cleavage at the targeting site (fig. 11A). All of these sgrnas (sgRNA-Prrt 2-b+c+d) were then injected into monkey fertilized eggs along with Cas9 mRNA. After waiting for embryo development to the eight-cell stage, the inventors examined all blastomeres of the injected embryos and found that all other blastomeres with PCR signals had a bi-allelic mutation of the Prrt2 gene (n=33, 11 embryos) except that one blastomere was a single allelic mutation, indicating almost no chimerism (10 fully knocked-out embryos out of 11 embryos) (fig. 6B to 6E, fig. 11B). In contrast, the control group, i.e., blastomeres of eight-cell embryos injected with only a single sgRNA (sgPrrt 2-C), were 90% wild-type, and 10% of the eight-cell embryos were single-allele mutated, consistent with the high chimerism profile (3 chimeric embryos versus 5 wild-type embryos) (FIGS. 6B through 6E; table 7).

Homozygous mutations in the PRRT2 gene in patients are accompanied by a range of clinical symptoms such as paroxysmal dyskinesia, benign familial infant epilepsy, hemiplegic migraine, paroxysmal torticollis, episodic ataxia, and even mental disorders. Next, whether Prrt2 knockout monkeys can also exhibit these symptoms was examined. The inventors observed that abnormalities in motor function resemble paroxysmal dyskinesia: the survival of monkey #11, which was obtained by targeting sgRNA-Prrt2-B+C+D, was not significantly defective at birth and showed normal activity for a period of time immediately after birth (FIG. 6H). By 18 days the monkey showed symptoms similar to episodic exercise-induced dyskinesia with abnormal movements of the limbs (trunk bending and occasionally a tight fist). This action is not observed in wild type monkeys of normal age, and these abnormal actions may be induced by sudden voluntary movements (PKD-like symptoms). At day 61, monkey #11 exhibited severe movement disorders including tremor of the limbs and failure of the monkey to walk and sit down as a result of stiff lower limbs. At day 105, monkey #11 recovered walking ability after receiving lower limb training. These PKD-like symptoms disappear, but under certain stresses, such as heel-strike or tail-swing, abnormal limb movements and fist-making in the hands and feet (Paroxysmal nonkinesigenic dyskinesia, paroxysmal dyskinesia, PNKD) can also be induced. The inventors have also observed abnormal behavior such as making a fist with hands and feet while touching and extremely drowsy. At 5 months of age, monkey #11 also developed headache-like symptoms that frequently hit the cage contents or cage floor with his head while making a fist and swaying his body for about one month. Monkey #11 also presents a learning disorder at age one, in that it cannot learn to use his hands and eat food, so it is eating by leaning down the head to get up to the food on the floor, rather than taking it with his hands. Many of these phenotypes are similar to the symptoms that manifest human Prrt 2-associated abnormalities.

In contrast, the #4, #8 and #10 monkeys obtained by injecting single sgrnas with the CRISPR/Cas9 system and the #12 monkeys obtained by the C-CRISPR method, which are chimeric, were found to have no dyskinesia for an observation period of up to 1 year. By sequence analysis of fibroblasts (n=25) and blood cells (n=43) from #12 monkeys, it was found that there was a Prrt2 point mutation in 46-64% of the cells (335N changed to 335A), with large fragment exons deleted in the remaining cells (fig. 6G; fig. 11D to F). This point mutation may not be sufficient to disrupt the function of Prrt2, thus resulting in this abnormal behavior-free phenotype. For the aborted chimeric #3 monkeys obtained with single sgRNA injection, western blot analysis results indicated that Prrt2 expression was largely, but not entirely, removed from the cortex and cerebellum (fig. 6I). These results indicate that complete deletion of monkey Prrt2 is necessary for the creation of a model of PKD-like syndrome monkeys.

To demonstrate the reliability of complete knockdown in monkey embryos, the inventors have also used the C-CRISPR approach to target the aromatic receptor nuclear transport protein-like protein 1 (arttl), a core component of the clock. The inventors first designed 4 sgrnas (sgRNA-artl-a, B, G and J) to target two functional PAS domains of arttl (

exons

8 and 13, respectively), and then examined DNA cleavage efficiency in monkey embryos (fig. 12A).

The inventors found that both sgRNA-Artl-G and sgRNA-Artl-J act on exon 13 significantly (FIG. 12B). To select more sgrnas to target arttl, the inventors designed an additional 7 sgrnas for exon 13 (sgRNA-artl-C, D, E, F, H, I and K) (fig. 12A). When the cleavage efficiency of sgRNA was examined in monkey cells COS-7 by T7E1 assay, the present inventors found that 5 sgRNAs (sgRNA-Artl-D, E, H, I and K) had high DNA cleavage efficiency (37% to 60%) as the two sgRNAs (sgRNA-Artl-G and J) previously tested on monkey embryos (FIGS. 12C and 12D). Considering the distance between each sgRNA, the inventors selected that sgRNA-Arntl-D, sgRNA-Arntl-G and also sgRNA-Arntl-J were co-injected into monkey embryos and then genotyping was performed in eight-cell stage embryos. The inventors found that there was a complete deletion of the Arntl gene in all eight embryos examined (FIGS. 12E to 12G, table 1). Taken together, these results indicate that the C-CRISPR method is capable of complete gene knockout in monkeys.

TABLE 7C-CRISPR mediated Gene editing in monkeys

/, undetermined; WT, wild-type; negative; positive.

¹ The edited Prrt2 contains a large fragment exon deletion in almost all cells.

² The edited Prrt2 contained a large fragment exon deletion in about 50-80% of the cells, with the remainder exhibiting only Prrt2 point mutations (335 n→335A).

EXAMPLE 7 off-target Effect of C-CRISPR method in mice and monkeys

The inventors examined whether multiple sgRNA targeting of the C-CRISPR method would bring more off-target effect than single sgRNA targeting. The inventors tested up to 10 possible off-target sites per sgRNA used in six mice with four sgRNA targets (Tyr-b+c+d+e- #1, #2, #3, #4, #5, # 6) and in two monkeys with three sgRNA targets (# 11, # 12). DNA sequencing of PCR products amplified from these genomic sites indicated that no mutation occurred at these sites (fig. 13). The inventors also performed Whole Genome Sequencing (WGS) on the samples, as well as did not find off-target effects at the 20 sites where off-target was most likely to occur. Thus, C-CRISPR does not introduce significant off-target alterations in genetically edited mice and monkeys, beyond what is generally expected for CRISPR/Cas9 mediated editing.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Sequence listing

<110> Shanghai life science institute of China academy of sciences

<120> method for preparing chimeric gene-free knockout animals based on CRISPR/Cas9 technology

<130> 170634

<160> 299

<170> PatentIn version 3.3

<210> 1

<211> 59

<212> DNA

<213> primer

<400> 1

taatacgact cactataggg aagggcgagg agctgttcac gttttagagc tagaaatag 59

<210> 2

<211> 59

<212> DNA

<213> primer

<400> 2

taatacgact cactataggg ctgaagttca tctgcaccac gttttagagc tagaaatag 59

<210> 3

<211> 59

<212> DNA

<213> primer

<400> 3

taatacgact cactataggg ggagcgcacc atcttcttca gttttagagc tagaaatag 59

<210> 4

<211> 59

<212> DNA

<213> primer

<400> 4

taatacgact cactataggg ggtgaaccgc atcgagctga gttttagagc tagaaatag 59

<210> 5

<211> 59

<212> DNA

<213> primer

<400> 5

taatacgact cactataggg gggaagggtt actcagagtc gttttagagc tagaaatag 59

<210> 6

<211> 59

<212> DNA

<213> primer

<400> 6

taatacgact cactataggg gcgaaggcac cgccctcttt gttttagagc tagaaatag 59

<210> 7

<211> 59

<212> DNA

<213> primer

<400> 7

taatacgact cactataggg ccagaagcca atgcacctat gttttagagc tagaaatag 59

<210> 8

<211> 59

<212> DNA

<213> primer

<400> 8

taatacgact cactataggg cttcataaca tccaaggatc gttttagagc tagaaatag 59

<210> 9

<211> 59

<212> DNA

<213> primer

<400> 9

taatacgact cactataggg tacagctacc tccaagagtc gttttagagc tagaaatag 59

<210> 10

<211> 59

<212> DNA

<213> primer

<400> 10

taatacgact cactataggg caatgtgggt aacctctttg gttttagagc tagaaatag 59

<210> 11

<211> 59

<212> DNA

<213> primer

<400> 11

taatacgact cactataggg ggcatgctgg acttcattct gttttagagc tagaaatag 59

<210> 12

<211> 59

<212> DNA

<213> primer

<400> 12

taatacgact cactataggg gatgtccatg ccggttacac gttttagagc tagaaatag 59

<210> 13

<211> 59

<212> DNA

<213> primer

<400> 13

taatacgact cactataggg gaagccagag gccacctcac gttttagagc tagaaatag 59

<210> 14

<211> 59

<212> DNA

<213> primer

<400> 14

taatacgact cactataggg cagggagcaa gagattccga gttttagagc tagaaatag 59

<210> 15

<211> 59

<212> DNA

<213> primer

<400> 15

taatacgact cactataggg tcagtcctcc actctcagac gttttagagc tagaaatag 59

<210> 16

<211> 59

<212> DNA

<213> primer

<400> 16

taatacgact cactataggg gtgaaccaag gaccgtctcc gttttagagc tagaaatag 59

<210> 17

<211> 59

<212> DNA

<213> primer

<400> 17

taatacgact cactataggg ccctacttcc acagagcctc gttttagagc tagaaatag 59

<210> 18

<211> 59

<212> DNA

<213> primer

<400> 18

taatacgact cactataggg gcctgttagg cagattgttc gttttagagc tagaaatag 59

<210> 19

<211> 59

<212> DNA

<213> primer

<400> 19

taatacgact cactataggg acaagctgga ggagctcatc gttttagagc tagaaatag 59

<210> 20

<211> 59

<212> DNA

<213> primer

<400> 20

taatacgact cactataggg ggatagtgac cagattgttg gttttagagc tagaaatag 59

<210> 21

<211> 58

<212> DNA

<213> primer

<400> 21

aatacgactc actatagggc ctgagcaagt tctcaatttg ttttagagct agaaatag 58

<210> 22

<211> 59

<212> DNA

<213> primer

<400> 22

taatacgact cactataggg gaaaccccta cttgcctcgc gttttagagc tagaaatag 59

<210> 23

<211> 59

<212> DNA

<213> primer

<400> 23

taatacgact cactataggg ctcagcacag caggcctcct gttttagagc tagaaatag 59

<210> 24

<211> 59

<212> DNA

<213> primer

<400> 24

taatacgact cactataggg gatggtacct acagaagttg gttttagagc tagaaatag 59

<210> 25

<211> 59

<212> DNA

<213> primer

<400> 25

taatacgact cactataggg ggacttatct cctgaagaaa gttttagagc tagaaatag 59

<210> 26

<211> 59

<212> DNA

<213> primer

<400> 26

taatacgact cactataggg acaattggtc atgttgctca gttttagagc tagaaatag 59

<210> 27

<211> 59

<212> DNA

<213> primer

<400> 27

taatacgact cactataggg aggaatatta ccataaaact gttttagagc tagaaatag 59

<210> 28

<211> 59

<212> DNA

<213> primer

<400> 28

taatacgact cactataggg gtctgtgata aggacagttc gttttagagc tagaaatag 59

<210> 29

<211> 59

<212> DNA

<213> primer

<400> 29

taatacgact cactataggg gtgatcgtgg aagtggatcc gttttagagc tagaaatag 59

<210> 30

<211> 59

<212> DNA

<213> primer

<400> 30

taatacgact cactataggg actctggctc tgtgtttccc gttttagagc tagaaatag 59

<210> 31

<211> 59

<212> DNA

<213> primer

<400> 31

taatacgact cactataggg aggattagac tacctttgga gttttagagc tagaaatag 59

<210> 32

<211> 59

<212> DNA

<213> primer

<400> 32

taatacgact cactataggg gcatttatgg tgtggtcccg gttttagagc tagaaatag 59

<210> 33

<211> 59

<212> DNA

<213> primer

<400> 33

taatacgact cactataggg cgaaaaaagg ccctttttcc gttttagagc tagaaatag 59

<210> 34

<211> 59

<212> DNA

<213> primer

<400> 34

taatacgact cactataggg acggacggac tccacaaggt gttttagagc tagaaatag 59

<210> 35

<211> 59

<212> DNA

<213> primer

<400> 35

taatacgact cactataggg tggcacatac atcttgaccg gttttagagc tagaaatag 59

<210> 36

<211> 59

<212> DNA

<213> primer

<400> 36

taatacgact cactataggg tggcacatac atcttgaccg gttttagagc tagaaatag 59

<210> 37

<211> 64

<212> DNA

<213> primer

<400> 37

gaaattaata cgactcacta taggggccaa gctcttaagc atcggtttta gagctagaaa 60

tagc 64

<210> 38

<211> 64

<212> DNA

<213> primer

<400> 38

gaaattaata cgactcacta tagggcctcc tgcgtcatca acttgtttta gagctagaaa 60

tagc 64

<210> 39

<211> 64

<212> DNA

<213> primer

<400> 39

gaaattaata cgactcacta taggcaggca ggggaggaat ggaagtttta gagctagaaa 60

tagc 64

<210> 40

<211> 59

<212> DNA

<213> primer

<400> 40

taatacgact cactataggg cccatattat acacaccttg gttttagagc tagaaatag 59

<210> 41

<211> 59

<212> DNA

<213> primer

<400> 41

taatacgact cactataggg aaagagcatc attgagacca gttttagagc tagaaatag 59

<210> 42

<211> 59

<212> DNA

<213> primer

<400> 42

taatacgact cactataggg ctggacattg cgttgcatgt gttttagagc tagaaatag 59

<210> 43

<211> 59

<212> DNA

<213> primer

<400> 43

taatacgact cactataggg caacatgcaa cgcaatgtcc gttttagagc tagaaatag 59

<210> 44

<211> 59

<212> DNA

<213> primer

<400> 44

taatacgact cactataggg gctggccacc cacaaagatg gttttagagc tagaaatag 59

<210> 45

<211> 59

<212> DNA

<213> primer

<400> 45

taatacgact cactataggg gcagtcgtcc aattgcaacg gttttagagc tagaaatag 59

<210> 46

<211> 59

<212> DNA

<213> primer

<400> 46

taatacgact cactataggg gtttctcggc acgcgataga gttttagagc tagaaatag 59

<210> 47

<211> 20

<212> DNA

<213> primer

<400> 47

aaaagcaccg actcggtgcc 20

<210> 48

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 48

aagggcgagg agctgttcac cgg 23

<210> 49

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 49

ctgaagttca tctgcaccac cgg 23

<210> 50

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 50

ggagcgcacc atcttcttca agg 23

<210> 51

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 51

ggtgaaccgc atcgagctga agg 23

<210> 52

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 52

gggaagggtt actcagagtc agg 23

<210> 53

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 53

gcgaaggcac cgccctcttt tgg 23

<210> 54

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 54

ccagaagcca atgcacctat cgg 23

<210> 55

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 55

cttcataaca tccaaggatc tgg 23

<210> 56

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 56

tacagctacc tccaagagtc agg 23

<210> 57

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 57

caatgtgggt aacctctttg ggg 23

<210> 58

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 58

ggcatgctgg acttcattct cgg 23

<210> 59

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 59

gatgtccatg ccggttacac agg 23

<210> 60

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 60

gaagccagag gccacctcac agg 23

<210> 61

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 61

cagggagcaa gagattccga agg 23

<210> 62

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 62

tcagtcctcc actctcagac cgg 23

<210> 63

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 63

gtgaaccaag gaccgtctcc agg 23

<210> 64

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 64

ccctacttcc acagagcctc agg 23

<210> 65

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 65

gcctgttagg cagattgttc tgg 23

<210> 66

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 66

acaagctgga ggagctcatc cgg 23

<210> 67

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 67

ggatagtgac cagattgttg tgg 23

<210> 68

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 68

cctgagcaag ttctcaattt agg 23

<210> 69

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 69

gaaaccccta cttgcctcgc tgg 23

<210> 70

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 70

ctcagcacag caggcctcct cgg 23

<210> 71

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 71

gatggtacct acagaagttg tgg 23

<210> 72

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 72

ggacttatct cctgaagaaa agg 23

<210> 73

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 73

acaattggtc atgttgctca tgg 23

<210> 74

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 74

aggaatatta ccataaaact tgg 23

<210> 75

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 75

gtctgtgata aggacagttc agg 23

<210> 76

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 76

gtgatcgtgg aagtggatcc agg 23

<210> 77

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 77

actctggctc tgtgtttccc agg 23

<210> 78

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 78

aggattagac tacctttgga agg 23

<210> 79

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 79

gcatttatgg tgtggtcccg tgg 23

<210> 80

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 80

cgaaaaaagg ccctttttcc agg 23

<210> 81

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 81

acggacggac tccacaaggt agg 23

<210> 82

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 82

tggcacatac atcttgaccg cgg 23

<210> 83

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 83

gatggcagcc agcagctctg agg 23

<210> 84

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 84

ggccaagctc ttaagcatcg tgg 23

<210> 85

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 85

gcctcctgcg tcatcaactt agg 23

<210> 86

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 86

caggcagggg aggaatggaa cgg 23

<210> 87

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 87

cccatattat acacaccttg ggg 23

<210> 88

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 88

aaagagcatc attgagacca tgg 23

<210> 89

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 89

ctggacattg cgttgcatgt tgg 23

<210> 90

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 90

caacatgcaa cgcaatgtcc agg 23

<210> 91

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 91

ttctgcacaa tccacagcac agg 23

<210> 92

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 92

gctggccacc cacaaagatg ggg 23

<210> 93

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 93

acaatgaacc agacaatgag ggg 23

<210> 94

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 94

ctcagctgcc tcgttgcaat tgg 23

<210> 95

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 95

gcagtcgtcc aattgcaacg agg 23

<210> 96

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 96

gtagttccac aaccagtgaa tgg 23

<210> 97

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 97

ggaaatcagg gtgaaatcta tgg 23

<210> 98

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 98

gtttctcggc acgcgataga tgg 23

<210> 99

<211> 23

<212> DNA

<213> sgRNA target sequence

<400> 99

agtatgtaga ctcttacctc tgg 23

<210> 100

<211> 20

<212> DNA

<213> primer

<400> 100

catgttcatg ccttcttctt 20

<210> 101

<211> 18

<212> DNA

<213> primer

<400> 101

gctcaggtag tggttgtc 18

<210> 102

<211> 18

<212> DNA

<213> primer

<400> 102

ctggttgttg tgctgtct 18

<210> 103

<211> 18

<212> DNA

<213> primer

<400> 103

ggtgttctgc tggtagtg 18

<210> 104

<211> 19

<212> DNA

<213> primer

<400> 104

atcacaggaa tctggaagc 19

<210> 105

<211> 21

<212> DNA

<213> primer

<400> 105

ctactaagca actgtcacat c 21

<210> 106

<211> 18

<212> DNA

<213> primer

<400> 106

caggctcaca gaggtcta 18

<210> 107

<211> 21

<212> DNA

<213> primer

<400> 107

actcatcagg tgtactactt c 21

<210> 108

<211> 19

<212> DNA

<213> primer

<400> 108

cacaataaga aatatatgc 19

<210> 109

<211> 26

<212> DNA

<213> primer

<400> 109

cagataatcc tcacagttga ttttgt 26

<210> 110

<211> 22

<212> DNA

<213> primer

<400> 110

gttacataac ctaaaagtag ac 22

<210> 111

<211> 23

<212> DNA

<213> primer

<400> 111

tataggatca gtgatgactt ctg 23

<210> 112

<211> 19

<212> DNA

<213> primer

<400> 112

gcaaaggcac agattagac 19

<210> 113

<211> 18

<212> DNA

<213> primer

<400> 113

ggttgtcagt agcaggag 18

<210> 114

<211> 18

<212> DNA

<213> primer

<400> 114

tggaggcatt gtcagtca 18

<210> 115

<211> 18

<212> DNA

<213> primer

<400> 115

atggcatcag aagcacac 18

<210> 116

<211> 18

<212> DNA

<213> primer

<400> 116

gcaggctaca caggagta 18

<210> 117

<211> 19

<212> DNA

<213> primer

<400> 117

agggacagta acaggcata 19

<210> 118

<211> 18

<212> DNA

<213> primer

<400> 118

ttggtgagat ggctgact 18

<210> 119

<211> 20

<212> DNA

<213> primer

<400> 119

ggacagtaac aggcatatga 20

<210> 120

<211> 21

<212> DNA

<213> primer

<400> 120

cactatacta ccaagccaca t 21

<210> 121

<211> 22

<212> DNA

<213> primer

<400> 121

ccaagacatc caatctcata ag 22

<210> 122

<211> 20

<212> DNA

<213> primer

<400> 122

ttctcacaat gtagctcagt 20

<210> 123

<211> 22

<212> DNA

<213> primer

<400> 123

aggtaagtag gtagacagat tc 22

<210> 124

<211> 20

<212> DNA

<213> primer

<400> 124

agatgtaagt tcagctaggt 20

<210> 125

<211> 22

<212> DNA

<213> primer

<400> 125

cacactttct actaacagtc ac 22

<210> 126

<211> 20

<212> DNA

<213> primer

<400> 126

gttgggtatg tctttaggtt 20

<210> 127

<211> 19

<212> DNA

<213> primer

<400> 127

catgaaggac aacaggtaa 19

<210> 128

<211> 20

<212> DNA

<213> primer

<400> 128

gcacattttg gtcagtggct 20

<210> 129

<211> 20

<212> DNA

<213> primer

<400> 129

gctctactcc agtcttgcct 20

<210> 130

<211> 21

<212> DNA

<213> primer

<400> 130

gttcagccct acagccacat g 21

<210> 131

<211> 21

<212> DNA

<213> primer

<400> 131

gcaggctgta aaatgccact c 21

<210> 132

<211> 20

<212> DNA

<213> primer

<400> 132

ccattctgaa gctgaaactg 20

<210> 133

<211> 20

<212> DNA

<213> primer

<400> 133

aaggaaggca tgattactcc 20

<210> 134

<211> 20

<212> DNA

<213> primer

<400> 134

ttctgaagct gaaactggtc 20

<210> 135

<211> 20

<212> DNA

<213> primer

<400> 135

ggatggcaag gatgatgtag 20

<210> 136

<211> 20

<212> DNA

<213> primer

<400> 136

ggagggatat ggaaacacat 20

<210> 137

<211> 20

<212> DNA

<213> primer

<400> 137

gatgccaaga caatggaagt 20

<210> 138

<211> 20

<212> DNA

<213> primer

<400> 138

tttccacctg atcccttctg 20

<210> 139

<211> 20

<212> DNA

<213> primer

<400> 139

gaggtccaga gaatttggga 20

<210> 140

<211> 19

<212> DNA

<213> primer

<400> 140

aagagccaga agtccaatg 19

<210> 141

<211> 19

<212> DNA

<213> primer

<400> 141

aatagcctga cctcaacac 19

<210> 142

<211> 20

<212> DNA

<213> primer

<400> 142

ccaaacaaag agaacaaagc 20

<210> 143

<211> 19

<212> DNA

<213> primer

<400> 143

tcaacacaag tctcggaag 19

<210> 144

<211> 18

<212> DNA

<213> primer

<400> 144

ctgagcaagg aggaagtc 18

<210> 145

<211> 20

<212> DNA

<213> primer

<400> 145

caccaggagt atctgattct 20

<210> 146

<211> 20

<212> DNA

<213> primer

<400> 146

ctcagaagga cactcagaag 20

<210> 147

<211> 19

<212> DNA

<213> primer

<400> 147

catcgtcgag aacagaaca 19

<210> 148

<211> 21

<212> DNA

<213> primer

<400> 148

gttatcctca cactacttct g 21

<210> 149

<211> 21

<212> DNA

<213> primer

<400> 149

gtaatcctac caagagtctc a 21

<210> 150

<211> 20

<212> DNA

<213> primer

<400> 150

tcctcacact acttctgatg 20

<210> 151

<211> 20

<212> DNA

<213> primer

<400> 151

gtctcaagat ggaagatcac 20

<210> 152

<211> 22

<212> DNA

<213> primer

<400> 152

gaattctaag gatgaggtaa ac 22

<210> 153

<211> 24

<212> DNA

<213> primer

<400> 153

gtgagacatc agagcagtat cgtg 24

<210> 154

<211> 24

<212> DNA

<213> primer

<400> 154

ctaatactga cctggcagtg agac 24

<210> 155

<211> 26

<212> DNA

<213> primer

<400> 155

catagcctga ttacatgcat atacag 26

<210> 156

<211> 22

<212> DNA

<213> primer

<400> 156

ccagtacctc caatttcact tc 22

<210> 157

<211> 21

<212> DNA

<213> primer

<400> 157

cagagactca catcacttgt c 21

<210> 158

<211> 20

<212> DNA

<213> primer

<400> 158

atacattcta gtccctcagc 20

<210> 159

<211> 20

<212> DNA

<213> primer

<400> 159

ggtacaatca cagcttactg 20

<210> 160

<211> 20

<212> DNA

<213> primer

<400> 160

ccatttacct cataggacct 20

<210> 161

<211> 20

<212> DNA

<213> primer

<400> 161

gttgctgatc tgaagaagtg 20

<210> 162

<211> 20

<212> DNA

<213> primer

<400> 162

ggtattcaca gcaatagagc 20

<210> 163

<211> 20

<212> DNA

<213> primer

<400> 163

gcagtgactt ctcatcttgt 20

<210> 164

<211> 20

<212> DNA

<213> primer

<400> 164

ttctctatct gaggcatctg 20

<210> 165

<211> 20

<212> DNA

<213> primer

<400> 165

gactctactg ttgtaggacc 20

<210> 166

<211> 21

<212> DNA

<213> primer

<400> 166

aactcctgcc ctacttagaa g 21

<210> 167

<211> 22

<212> DNA

<213> primer

<400> 167

caatgatgac ctgtaactcg tg 22

<210> 168

<211> 21

<212> DNA

<213> primer

<400> 168

aagatgcctc ctgttctgaa g 21

<210> 169

<211> 21

<212> DNA

<213> primer

<400> 169

caatccatca tgcctctgaa g 21

<210> 170

<211> 21

<212> DNA

<213> primer

<400> 170

ctgtcctgga actcactcta t 21

<210> 171

<211> 21

<212> DNA

<213> primer

<400> 171

gacattggtt ctcagacttc c 21

<210> 172

<211> 21

<212> DNA

<213> primer

<400> 172

gctaatgcta agccctaact g 21

<210> 173

<211> 21

<212> DNA

<213> primer

<400> 173

cattctctgt gtctgactct g 21

<210> 174

<211> 21

<212> DNA

<213> primer

<400> 174

gtatatgtgt atgcctgcgt c 21

<210> 175

<211> 21

<212> DNA

<213> primer

<400> 175

acagagtgag ttctaggaca g 21

<210> 176

<211> 21

<212> DNA

<213> primer

<400> 176

agtgcgatac cttactgtct c 21

<210> 177

<211> 21

<212> DNA

<213> primer

<400> 177

catgtagcag cctagttctt c 21

<210> 178

<211> 21

<212> DNA

<213> primer

<400> 178

gatacttctg gtcttcagca g 21

<210> 179

<211> 21

<212> DNA

<213> primer

<400> 179

catccacagc agatactaag g 21

<210> 180

<211> 20

<212> DNA

<213> primer

<400> 180

gcctgtaatg attggactgt 20

<210> 181

<211> 21

<212> DNA

<213> primer

<400> 181

ggacctaact attgtgggaa g 21

<210> 182

<211> 21

<212> DNA

<213> primer

<400> 182

catagactgt aggaccaaga c 21

<210> 183

<211> 20

<212> DNA

<213> primer

<400> 183

acccttacca cctgtttatg 20

<210> 184

<211> 20

<212> DNA

<213> primer

<400> 184

aggagctgca tcatcttatg 20

<210> 185

<211> 20

<212> DNA

<213> primer

<400> 185

acaatctgga aggcgaatag 20

<210> 186

<211> 21

<212> DNA

<213> primer

<400> 186

caacctcaag agtcagacaa g 21

<210> 187

<211> 21

<212> DNA

<213> primer

<400> 187

ccagcagtga atttccatca g 21

<210> 188

<211> 22

<212> DNA

<213> primer

<400> 188

ctgtgtattt gtgggaccta tg 22

<210> 189

<211> 22

<212> DNA

<213> primer

<400> 189

gattagtcca tcagaagcag ag 22

<210> 190

<211> 22

<212> DNA

<213> primer

<400> 190

gtcctctact attctgtgtc tg 22

<210> 191

<211> 22

<212> DNA

<213> primer

<400> 191

gattggtctc tgtatagttg gc 22

<210> 192

<211> 21

<212> DNA

<213> primer

<400> 192

ccaatgacat actcagtgct c 21

<210> 193

<211> 21

<212> DNA

<213> primer

<400> 193

agagatgaga gttggagaca g 21

<210> 194

<211> 21

<212> DNA

<213> primer

<400> 194

ctctacttcc actgagggta c 21

<210> 195

<211> 21

<212> DNA

<213> primer

<400> 195

ggacaattct cttggttctc c 21

<210> 196

<211> 21

<212> DNA

<213> primer

<400> 196

taacctacct taccaccatc c 21

<210> 197

<211> 21

<212> DNA

<213> primer

<400> 197

gcctattgac cagagttagt g 21

<210> 198

<211> 21

<212> DNA

<213> primer

<400> 198

tagtgtcacc tagtagagtc c 21

<210> 199

<211> 21

<212> DNA

<213> primer

<400> 199

gagtagccag tatgcttaac c 21

<210> 200

<211> 19

<212> DNA

<213> primer

<400> 200

agacagagga agcattgag 19

<210> 201

<211> 19

<212> DNA

<213> primer

<400> 201

ctccaggtca tacactgag 19

<210> 202

<211> 20

<212> DNA

<213> primer

<400> 202

cctggatatg gcagtctcta 20

<210> 203

<211> 21

<212> DNA

<213> primer

<400> 203

ctgattctct gagaggtggt a 21

<210> 204

<211> 20

<212> DNA

<213> primer

<400> 204

gtgaaggact caggttacta 20

<210> 205

<211> 20

<212> DNA

<213> primer

<400> 205

atgatacagt ggtagcagac 20

<210> 206

<211> 23

<212> DNA

<213> primer

<400> 206

catggctcag gtacatgcta tga 23

<210> 207

<211> 21

<212> DNA

<213> primer

<400> 207

gggcttccga tggtgcgtgt c 21

<210> 208

<211> 21

<212> DNA

<213> primer

<400> 208

gtgggcacag ttgctgatga t 21

<210> 209

<211> 22

<212> DNA

<213> primer

<400> 209

gcagttccaa cccaatgctc ac 22

<210> 210

<211> 23

<212> DNA

<213> primer

<400> 210

atgaatcaga ccttgcccgt cac 23

<210> 211

<211> 22

<212> DNA

<213> primer

<400> 211

catgctgggt gaaggcaaga tc 22

<210> 212

<211> 22

<212> DNA

<213> primer

<400> 212

tggaccatta gacagtggga ga 22

<210> 213

<211> 21

<212> DNA

<213> primer

<400> 213

aggcagaaga gggtgagtgg t 21

<210> 214

<211> 23

<212> DNA

<213> primer

<400> 214

taccttgggt ccttatggtt gtt 23

<210> 215

<211> 25

<212> DNA

<213> primer

<400> 215

ttggcagtag ttgatgagga gaagt 25

<210> 216

<211> 25

<212> DNA

<213> primer

<400> 216

tctgtaagga cacgagttag ggatc 25

<210> 217

<211> 23

<212> DNA

<213> primer

<400> 217

tttgctccta tgacctgggt tcc 23

<210> 218

<211> 26

<212> DNA

<213> primer

<400> 218

gtactacttg aattagcagc cactgc 26

<210> 219

<211> 22

<212> DNA

<213> primer

<400> 219

aagtagccat gcaaagccaa gc 22

<210> 220

<211> 20

<212> DNA

<213> primer

<400> 220

gctttgatgt actgggaatc 20

<210> 221

<211> 20

<212> DNA

<213> primer

<400> 221

gcttagaatg gaggtcactt 20

<210> 222

<211> 20

<212> DNA

<213> primer

<400> 222

gacagaagga tgaggaatga 20

<210> 223

<211> 20

<212> DNA

<213> primer

<400> 223

ccaaccacta ttgaactcac 20

<210> 224

<211> 20

<212> DNA

<213> primer

<400> 224

cttgtcatag cagtgtcctg 20

<210> 225

<211> 20

<212> DNA

<213> primer

<400> 225

gctccttgag agtccattag 20

<210> 226

<211> 22

<212> DNA

<213> primer

<400> 226

tagcccgcag tgcctcccac ag 22

<210> 227

<211> 22

<212> DNA

<213> primer

<400> 227

ctagtcgcgg cggcacctgc tc 22

<210> 228

<211> 23

<212> DNA

<213> primer

<400> 228

cctgcatcca gctaaatggc aca 23

<210> 229

<211> 21

<212> DNA

<213> primer

<400> 229

aggctgccat acctccaaca a 21

<210> 230

<211> 21

<212> DNA

<213> primer

<400> 230

cagccaaggt gggcacaagg t 21

<210> 231

<211> 25

<212> DNA

<213> primer

<400> 231

caggcatcct cacaggaaat tatgg 25

<210> 232

<211> 23

<212> DNA

<213> primer

<400> 232

tgagcatgtc tgacttccca gtt 23

<210> 233

<211> 24

<212> DNA

<213> primer

<400> 233

aaggttacat tatgcctcag ttgt 24

<210> 234

<211> 22

<212> DNA

<213> primer

<400> 234

cagggacagc atccaggttt at 22

<210> 235

<211> 25

<212> DNA

<213> primer

<400> 235

gtgccatcaa tcactaaggc aaatc 25

<210> 236

<211> 21

<212> DNA

<213> primer

<400> 236

aagctgaaag tgactgggag a 21

<210> 237

<211> 22

<212> DNA

<213> primer

<400> 237

ctgggtgtat ttgtgcctgt gt 22

<210> 238

<211> 22

<212> DNA

<213> primer

<400> 238

catttgtcaa acaggagcca cg 22

<210> 239

<211> 22

<212> DNA

<213> primer

<400> 239

tggtaatgag gtagggacag gc 22

<210> 240

<211> 21

<212> DNA

<213> primer

<400> 240

ggtaggtatt gccagatcca a 21

<210> 241

<211> 21

<212> DNA

<213> primer

<400> 241

cgggttcaag tgattcttct g 21

<210> 242

<211> 21

<212> DNA

<213> primer

<400> 242

gttgaggatc actgttctac c 21

<210> 243

<211> 21

<212> DNA

<213> primer

<400> 243

cttgtcctgt ttgtaggttg g 21

<210> 244

<211> 21

<212> DNA

<213> primer

<400> 244

acagacctac agaagtgact c 21

<210> 245

<211> 21

<212> DNA

<213> primer

<400> 245

gcacggaatc tatacagaga c 21

<210> 246

<211> 21

<212> DNA

<213> primer

<400> 246

acagacctac agaagtgact c 21

<210> 247

<211> 22

<212> DNA

<213> primer

<400> 247

cagagacagg ctaagatatt gc 22

<210> 248

<211> 21

<212> DNA

<213> primer

<400> 248

gagtgtcttg tatgggctag a 21

<210> 249

<211> 21

<212> DNA

<213> primer

<400> 249

ctctgtgatt cctggtatct g 21

<210> 250

<211> 20

<212> DNA

<213> primer

<400> 250

acaagtctgg agattccttc 20

<210> 251

<211> 20

<212> DNA

<213> primer

<400> 251

gatgttcctt ggtgtgattc 20

<210> 252

<211> 21

<212> DNA

<213> primer

<400> 252

cccaccatca acctagattt g 21

<210> 253

<211> 21

<212> DNA

<213> primer

<400> 253

gtcctcacag aactctcatt c 21

<210> 254

<211> 21

<212> DNA

<213> primer

<400> 254

ccagagcagt tacttcagaa g 21

<210> 255

<211> 21

<212> DNA

<213> primer

<400> 255

ggctagtggt tacagtattg g 21

<210> 256

<211> 21

<212> DNA

<213> primer

<400> 256

gcacagacct agctaatctc g 21

<210> 257

<211> 21

<212> DNA

<213> primer

<400> 257

cttccttcct tccttccttc c 21

<210> 258

<211> 21

<212> DNA

<213> primer

<400> 258

ggacatggat gaagttggaa g 21

<210> 259

<211> 22

<212> DNA

<213> primer

<400> 259

tcagtaatct acagaggagg tg 22

<210> 260

<211> 21

<212> DNA

<213> primer

<400> 260

atgacctaat ccatgctcca g 21

<210> 261

<211> 21

<212> DNA

<213> primer

<400> 261

gaactcctga cctcagatga t 21

<210> 262

<211> 22

<212> DNA

<213> primer

<400> 262

caattcagtg ggaagtatag gg 22

<210> 263

<211> 22

<212> DNA

<213> primer

<400> 263

gacacagttg ttcaccatct ac 22

<210> 264

<211> 21

<212> DNA

<213> primer

<400> 264

cctaaactcc cttgacttct g 21

<210> 265

<211> 21

<212> DNA

<213> primer

<400> 265

cctgttgtaa ctcacttcct g 21

<210> 266

<211> 21

<212> DNA

<213> primer

<400> 266

gatacagact cagaggaatg g 21

<210> 267

<211> 21

<212> DNA

<213> primer

<400> 267

caggaggtct tcatcttcaa c 21

<210> 268

<211> 21

<212> DNA

<213> primer

<400> 268

ggtaggcaag tatggtaaag g 21

<210> 269

<211> 21

<212> DNA

<213> primer

<400> 269

ggattgtatc ctggtgactt c 21

<210> 270

<211> 21

<212> DNA

<213> primer

<400> 270

gatcacctga ggttaggagt t 21

<210> 271

<211> 21

<212> DNA

<213> primer

<400> 271

cagattctag ctgagtggat g 21

<210> 272

<211> 21

<212> DNA

<213> primer

<400> 272

cctcatcatc ttcatgtcga g 21

<210> 273

<211> 21

<212> DNA

<213> primer

<400> 273

catctactca cttcctctag c 21

<210> 274

<211> 21

<212> DNA

<213> primer

<400> 274

gggaactgaa tgaactgatg g 21

<210> 275

<211> 21

<212> DNA

<213> primer

<400> 275

cctgaagtga ggcaataaga g 21

<210> 276

<211> 21

<212> DNA

<213> primer

<400> 276

gagaacagtg tccttgatga g 21

<210> 277

<211> 21

<212> DNA

<213> primer

<400> 277

ggaggtagag gttgtagtga g 21

<210> 278

<211> 21

<212> DNA

<213> primer

<400> 278

caacagacaa ggctaactca g 21

<210> 279

<211> 21

<212> DNA

<213> primer

<400> 279

gacagagtga gactccatta c 21

<210> 280

<211> 21

<212> DNA

<213> primer

<400> 280

ggtaagtctg gaaccaatag g 21

<210> 281

<211> 21

<212> DNA

<213> primer

<400> 281

cagtcaagca gtatctctga g 21

<210> 282

<211> 22

<212> DNA

<213> primer

<400> 282

ctccttacat ctcattggtc ag 22

<210> 283

<211> 21

<212> DNA

<213> primer

<400> 283

ctatccatcc ttcgtgatct g 21

<210> 284

<211> 21

<212> DNA

<213> primer

<400> 284

ctcatcctgt tctacaccaa g 21

<210> 285

<211> 21

<212> DNA

<213> primer

<400> 285

gagtaaggga atccatctct c 21

<210> 286

<211> 22

<212> DNA

<213> primer

<400> 286

cctactatac acaaggtact gg 22

<210> 287

<211> 21

<212> DNA

<213> primer

<400> 287

ctagaggaag actgctaagt g 21

<210> 288

<211> 22

<212> DNA

<213> primer

<400> 288

gctcaccata tccaactcat ac 22

<210> 289

<211> 21

<212> DNA

<213> primer

<400> 289

ctccatccac tctccatcta t 21

<210> 290

<211> 21

<212> DNA

<213> primer

<400> 290

cggttctctc cactaacatt c 21

<210> 291

<211> 21

<212> DNA

<213> primer

<400> 291

gttagaggca tcagggattt c 21

<210> 292

<211> 21

<212> DNA

<213> primer

<400> 292

cccaccatca acctagattt g 21

<210> 293

<211> 21

<212> DNA

<213> primer

<400> 293

gtcctcacag aactctcatt c 21

<210> 294

<211> 22

<212> DNA

<213> primer

<400> 294

gtgtggactg agttctataa gg 22

<210> 295

<211> 21

<212> DNA

<213> primer

<400> 295

gatcacttga ggtcaggagt t 21

<210> 296

<211> 21

<212> DNA

<213> primer

<400> 296

ggcagcactt ggcatttaac c 21

<210> 297

<211> 21

<212> DNA

<213> primer

<400> 297

ctaggctcgg cttggatgtt c 21

<210> 298

<211> 21

<212> DNA

<213> primer

<400> 298

gcagagatca gttgcttgtt c 21

<210> 299

<211> 21

<212> DNA

<213> primer

<400> 299

ctgggctagt gttcttaatg g 21

Claims

1. A method of making a knockout animal cell, the method comprising:

(1) Preparing 3-30 sgrnas targeting different target sites on a target gene according to the nucleic acid sequence of the target gene to be knocked out, wherein the different target sites on the target gene targeted by at least 3 sgrnas are located in the same exon region; the interval between target sites on the sgRNA targeted target genes of 3-30 targeted target genes at different target sites is 10-300 bp;

(2) Co-transferring the sgRNA of (1) or a nucleic acid capable of forming the sgRNA, cas9 mRNA or a nucleic acid capable of forming the Cas9 mRNA into an animal cell to obtain a gene knockout animal cell; the animal is mammal.

2. The method of claim 1, wherein the animal cell is an animal fertilized egg which develops into a knockout animal with a completely or mostly knocked-out gene function of the target gene; in vivo of the gene knockout animal with most of the gene functions of the target gene knocked out, the cells which are not knocked out effectively with the target gene to be knocked out account for less than 20% of the total cell number.

3. A method of making a gene knockout animal having a complete or substantial knockout of the gene function of a target gene, the method comprising:

(2) Co-transferring the sgRNA of (1) or a nucleic acid capable of forming the sgRNA, the Cas9 mRNA or a nucleic acid capable of forming the Cas9 mRNA into a fertilized egg to obtain a gene knockout animal fertilized egg;

(3) Developing the fertilized egg of (2) to produce a gene knockout animal in which the gene function of the target gene is completely or mostly knocked out; in vivo of the gene knockout animal with most of the gene functions of the target gene knocked out, the cells which are not knocked out effectively with the target gene to be knocked out account for less than 20% of the total cell number.

4. The method of claim 1, wherein 3 to 30 sgrnas targeting different target sites on the target gene introduce frame shift mutations in the targeted target site region on the target gene; and/or introducing indels; and/or introducing large fragment deletions.

5. A method according to any one of claims 1 to 3 wherein the animal comprises: humans, non-human primates, mice, livestock.

6. A method according to any one of claims 1 to 3, wherein the nucleic acid sequence of the sgRNA carries a promoter upstream thereof; or, the nucleic acid sequence of Cas9 mRNA carries a promoter upstream.

7. The method of claim 6, wherein the nucleic acid sequence of the sgRNA carries a T7 promoter or a U6 promoter upstream; or, the nucleic acid sequence of Cas9 mRNA carries a T7 promoter upstream.

8. A method according to any one of claims 1 to 3, wherein the target gene to be knocked out isGFPThe interval between target sites on the target genes targeted by the sgRNAs is 30-200 bp, and the animals are mice; the target sites on the sgRNA targeted target gene are 3 or 4 selected from the following groups: SEQ ID NO. 48, SEQ ID NO. 49, SEQ ID NO. 50, SEQ ID NO. 51.

9. A method according to any one of claims 1 to 3, wherein the target gene to be knocked out isTyrThe exon 4 of the target gene targeted by each sgRNA and the introns adjacent to the exon, and the interval between the targeted sites of the sgRNA is 10-100 bp; the animal is a mouse; the target sites on the sgRNA targeted target gene are 3,4,5 or 6 selected from the following groups: SEQ ID NO. 52, SEQ ID NO. 53, SEQ ID NO. 54, SEQ ID NO. 55, SEQ ID NO. 56, SEQ ID NO. 57.

10. The method of claim 9, wherein the sgrnas target 3 or 4 target sites on the target gene selected from the group consisting of: SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56.

11. A method according to any one of claims 1 to 3, wherein the target gene to be knocked out isTet1Genes, the sgRNAs are 3, each sgRNA targets the exon 2 of the target gene, and each sgRNA targets the exon 2 of the target geneThe interval between target sites targeted by sgRNA is 80-200 bp; the animal is a mouse; the target sites on the sgRNA targeted target genes are as follows: SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60.

12. A method according to any one of claims 1 to 3, wherein the target gene to be knocked out isTet2The number of the sgRNAs is 3, the exon 3 of the target gene targeted by each sgRNA, and the interval between the targeted sites of each sgRNA is 100-150 bp; the animal is a mouse; the target sites on the sgRNA targeted target genes are as follows: SEQ ID NO. 61, SEQ ID NO. 62, SEQ ID NO. 63.

13. A method according to any one of claims 1 to 3, wherein the target gene to be knocked out is Tet3The number of the sgRNAs is 3, the exons 4 of the target genes targeted by the sgRNAs are arranged, and the intervals between the target sites targeted by the sgRNAs are 180-280 bp; the animal is a mouse; the target sites on the sgRNA targeted target genes are as follows: SEQ ID NO. 64, SEQ ID NO. 65, SEQ ID NO. 66.

14. A method according to any one of claims 1 to 3, wherein the target gene to be knocked out isPrrt2The gene comprises 3 or 4 sgRNAs, wherein at least 3 sgRNAs target exons 3 of a target gene, and the interval between target sites of the targeted sgRNAs on the exons 3 is 10-50 bp; the animal is a monkey; the target sites on the sgRNA targeted target genes are as follows: 83, 84, 85, 86.

15. A method according to any one of claims 1 to 3, wherein the target gene to be knocked out isArntLThe exon 13 of the target gene is targeted, and the interval between the target sites of sgRNA targeting on the exon 13 is 10-80 bp; the animal is a monkey; the target sites on the sgRNA targeted target gene are 3,4,5 or 6 selected from the following groups: SEQ ID NO 91, SEQ ID NO: 92，SEQ ID NO: 93，SEQ ID NO: 94，SEQ ID NO: 95，SEQ ID NO: 96，SEQ ID NO: 97，SEQ ID NO: 98，SEQ ID NO: 99。

16. The method of claim 15, wherein the sgRNA targets a target site on the target gene of SEQ ID No. 92, SEQ ID No. 95, and SEQ ID No. 98.

17. Use of the method of any one of claims 1 to 16 for the preparation of a gene knockout animal cell or animal, wherein the animal is a gene functional complete knockout or a major portion knockout animal of a gene of interest; in the body of the animal with most of the gene functions of the target gene knocked out, the cells which are not knocked out effectively with the target gene to be knocked out account for less than 20% of the total cell number; the animal is a mammal.

18. The use of claim 17, wherein the animal cell is an animal fertilized egg.

19. Use of the method of any one of claims 1 to 16 for performing animal gene function studies; or for preparing animals with completely or mostly knocked-out gene functions of the target genes, and using the animals for gene function research or embryo development research; the animal is a mammal; in vivo of the gene knockout animal with most of the gene functions of the target gene knocked out, the cells which are not knocked out effectively with the target gene to be knocked out account for less than 20% of the total cell number.

20. A composition for preparing a gene knockout animal having a complete or a substantial portion of the gene function of a target gene, said composition comprising:

(1) 3-30 sgrnas targeting different target sites on a target gene or nucleic acids capable of forming the sgrnas prepared according to a nucleic acid sequence of the target gene to be knocked out, wherein the different target sites on the target gene targeted by at least 3 sgrnas are located in the same exon region; the interval between target sites on the sgRNA targeted target genes of 3-30 targeted target genes at different target sites is 10-300 bp;

(2) Cas9 mRNA or a nucleic acid capable of forming the Cas9 mRNA;

the animal is a mammal; in vivo of the gene knockout animal with most of the gene functions of the target gene knocked out, the cells which are not knocked out effectively with the target gene to be knocked out account for less than 20% of the total cell number.

21. The composition of claim 20, wherein the target gene for knockout of the sgRNA isGFPThe interval between target sites on the target genes targeted by the sgRNAs is 30-200 bp; the target sites on the sgRNA targeted target gene are 3 or 4 selected from the group consisting of: 48, 49, 50 and 51 respectively; the animal is a mouse.

22. The composition of claim 20, wherein the target gene for knockout of the sgRNA is TyrThe gene comprises 3,4,5 or 6 sgRNAs, wherein each sgRNA targets exon 4 of the target gene and introns adjacent to the exons, and the interval between target sites of the sgRNA targets is 10-100 bp; the target sites on the sgRNA targeted target gene are 3,4,5 or 6 selected from the following groups: 52, 53, 54, 55, 56, 57; the animal is a mouse.

23. The composition of claim 22, wherein the sgrnas target 3 or 4 target sites on the target gene selected from the group consisting of: SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56.

24. The composition of claim 20, wherein the target gene for knockout of the sgRNA isTet1Genes, the sgRNAs are 3, each sgRNA targets the exon 2 of the target gene, and each sgRNA targets the exon 2 of the target geneThe interval between target sites targeted by sgRNA is 80-200 bp; the animal is a mouse; the target sites on the sgRNA targeted target genes are as follows: SEQ ID NO 58, SEQ ID NO 59, SEQ ID NO 60.

25. The composition of claim 20, wherein the target gene for knockout of the sgRNA is Tet2The number of the sgRNAs is 3, the exon 3 of the target gene targeted by each sgRNA, and the interval between the targeted sites of each sgRNA is 100-150 bp; the animal is a mouse; the target sites on the sgRNA targeted target genes are as follows: SEQ ID NO. 61, SEQ ID NO. 62, SEQ ID NO. 63.

26. The composition of claim 20, wherein the target gene for knockout of the sgRNA isTet3The number of the sgRNAs is 3, the exons 4 of the target genes targeted by the sgRNAs are arranged, and the intervals between the target sites targeted by the sgRNAs are 180-280 bp; the animal is a mouse; the target sites on the sgRNA targeted target genes are as follows: SEQ ID NO. 64, SEQ ID NO. 65, SEQ ID NO. 66.

27. The composition of claim 20, wherein the target gene for knockout of the sgRNA isPrrt2The gene comprises 3 or 4 sgRNAs, wherein at least 3 sgRNAs target exons 3 of a target gene, and the interval between target sites of the targeted sgRNAs on the exons 3 is 10-50 bp; the animal is a monkey; the target sites on the sgRNA targeted target genes are as follows: 83, 84, 85, 86.

28. The composition of claim 27, wherein the sgRNA targets a target site on a target gene that is: SEQ ID NO. 84, SEQ ID NO. 85, SEQ ID NO. 86.

29. The composition of claim 20, wherein the target gene for knocking out the sgRNA isArntLGene, targetingExon 13 of the target gene, and the interval between target sites targeted by sgRNA on exon 13 is 10-80 bp; the animal is a monkey; the target sites on the sgRNA targeted target gene are 3,4,5 or 6 selected from the group consisting of: 91, 92, 93, 94, 95, 96, 97, 98, 99.

30. The composition of claim 29, wherein the sgRNA targets a target site on a target gene that is: 92 SEQ ID NO, 95 SEQ ID NO, 98 SEQ ID NO.

31. A kit for preparing a gene knockout animal with a complete or a substantial portion of the gene function of a target gene, comprising the composition of any one of claims 20 to 30.

32. The kit of claim 31, further comprising:

Instructions for use.