CN105593367A

CN105593367A - CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene

Info

Publication number: CN105593367A
Application number: CN201580000476.8A
Authority: CN
Inventors: 蔡志明; 牟丽莎; 陈鹏飞; 谢崇伟; 张军方; 高汉超; 陆赢; 刘璐
Original assignee: Shenzhen Second Peoples Hospital
Current assignee: Shenzhen Second Peoples Hospital
Priority date: 2015-06-11
Filing date: 2015-06-11
Publication date: 2016-05-18
Also published as: WO2016197359A1; CN105593367A8

Abstract

The present invention discloses a pig SLA-1 gene knockout method using CRISPR-Cas9 specificity and sgRNA used for specific targeting SLA-1 gene. The target sequence of the sgRNA used for specific targeting SLA-1 gene in the SLA-1 gene complies with a 5'-N (20) NGG-3' sequence arrangement rule, wherein N (20) represents 20 consecutive basic groups, wherein each N represents a A or T or C or G; the target sequence in the SLA-1 gene is located at the four exon coding regions of the N-terminal of the SLA-1 gene or the junction of adjacent introns; and the target sequence in the SLA-1 gene is unique. The sgRNA used in the pig SLA-1 gene knockout method using CRISPR-Cas9 specificity, may fast, accurately, efficiently, and specifically knockout pig SLA-1 gene, effectively solve long cycle and high cost in construction of SLA-1 gene knockout pig.

Description

The method of CRISPR-Cas9 specificity knock-out pig SLA-1 gene and for the sgRNA of selectively targeted SLA-1 gene

Technical field

The present invention relates to gene engineering technology field, relate in particular to gene Knockout field, be specifically related toThe method of CRISPR-Cas9 specificity knock-out pig SLA-1 gene and for selectively targeted SLA-1 genesgRNA。

Background technology

Organ transplant is the most effective treatment means for the treatment of organs exhaustion disease. Up to now, the whole world is existing near1000000 patient continues life by organ transplant. Along with the progress of aging population and medical skill, needThe patient who carries out organ transfer operation is more and more, but the shortage of donor organ has seriously restricted organ transplantCarrying out of operation. Taking kidney transplant as example, the patient that China need to carry out kidney transplant every year reaches 300,000, andThe donation kidney that can be used for transplanting is no more than 10,000 examples, and most of patient dies from kidney failure. Rely on after death organContribute the needs that can not meet organ transplant. By genetic engineering modified other species, be appropriate to provideHuman implantation's organ, becomes the main path that solves mankind's donor organ shortage problem.

At present, according to many-sides such as biological safety, physiological function index, economy and rare species conservationsEvaluate, pig becomes ideal xenogenesis organ origin. But between pig and people, there is huge difference, straightConnect the organ transplant of pig can be produced to strong immunological rejection to people. Therefore, by genetic engineering to pigTransform, to produce the organ that is suitable for human implantation, become heteroplastic ultimate aim.

Thereby primate T cell can be identified the antigen in pig source and cause the immunological rejection of anti-xenogenesis. Primate THLA/the complex of polypeptides (SLA/peptidecomplex) on cell receptor and pig cell surface is mutualIdentification, can directly activate primate T cell. In heteroplastic transplantation experiment, activate primate T thinBorn of the same parents' the cell type that mainly contains two class donor sources: one is that animal migration antigen presenting cell is as thin in dendron shapeBorn of the same parents; Another kind is the vascular endothelial cell of high expressed SLA. Be expressed in the MHCClass on pig donorcells surfaceCD8T+ cell is identified and activated to I molecular energy. MHC-I quasi-molecule is two peptides that connected by non-covalent bondThe glycoprotein of chain composition; Wherein one is called heavy chain or α chain, and another is for light chain or be called β2-microglobulin(β 2m). The molecular weight of α chain is 44kd, and structure is polymorphism. The film outskirt peptide section of α chain is folded to formThree functional areas, are called α 1, α 2 and α 3rd district; Each functional areas approximately contain 90 amino acid residues,Its structure is similar to immunoglobulin (Ig) (Ig); The amino acid sequence in α 1 and α 2nd district changes greatly, is determiningThe polymorphism of I quasi-molecule. β 2m is not mhc gene coding, but individual gene on No. 15 chromosomeThe product of coding, molecular weight 12kd. Its structure and ig constant region (ch3) have larger homology, belong to IgThe super member of family, does not have allotypic determinant, but has species specificity. The important physiological function of I quasi-moleculeBe that the antigen recognizing function of CD8+T cell is played to restricted effect, namely participate in the cell delivery to CD8+TBe the process of antigen. CD8+T cell can only be identified with the antigen of identical I quasi-molecule combination and (mostly be endogenousCellular antigens, as cell and the tumour cell etc. of virus infections), it is restricted that this phenomenon is called MHC.Except CD8+T cell, when NK cell recognition target cell performance killing ability, also need MHC-I classThe participation of molecule. If can well control NK cell and CD8+T so knock out MHC-I quasi-moleculeThe killing functions of immunocytes of cell, will make significant contribution to heterograft. Just realize the best approach of this strategyIt is the genetic modification pig that builds MHC-I quasi-molecule disappearance.

At present, common gene Knockout comprises homologous recombination (HomologusRecombination, HR)Technology, class transcriptional activation effector nuclease (TranscriptionActivator-LikeEffectorNuclease,TALEN) technology, Zinc finger nuclease (Zinc-FingerNuclease, ZFN) technology and latest developmentsThe short palindrome in rule cluster interval repeats (ClusteredRegularlyInterspacedShortPalindromicRepeat, CRISPR) technology. Because recombination efficiency is low, (efficiency approximately only has 10 to HR technology^-6), rightThe very consuming time and poor efficiency of the screening operation of mutant, is substituted gradually. TALEN technology and ZFN technologyCutting efficiency generally can reach 20%, but all needs to build the protein module that can identify particular sequence, frontPhase work is loaded down with trivial details time-consuming. The modular design of ZFN technology is comparatively complicated and have higher miss rate, and its application hasLimit.

CRISPR is that one comes from procaryotic acquired immunity system, and this system is carried out the compound of interference functionThing is made up of protein C as and CRISPR-RNA (crRNA). This system has found that there is three kinds at presentType, wherein Equations of The Second Kind Cas9 system composition is simple, is actively applied to genetic engineering field. Cas9 targetCutting DNA is by two kinds of little RNA---crRNA (CRISPRRNA) and tracrRNA(trans-activatingcrRNA) realize with the principle of target complement sequence identification. Now little by two kindsRNA is fused into a RNA chain, is called for short sgRNA (singleguideRNA), can identify specificGene order, guiding Cas9 albumen cuts. In eucaryote, it is non-homogeneous that DNA is cut off rear generationRestructuring end connects, and causes frameshift mutation, finally causes gene function to knock out.

Than above-mentioned 3 kinds of technology, CRISPR technical operation is simple, screening effeciency is high, can realize accuratelyTarget cutting. Therefore, knock out SLA-1 gene by CRISPR technology and can greatly improve SLA-1The screening effeciency of disappearance cell and genetic engineering pig. But the key technology difficult problem in this path is design and prepareAccurately can the sgRNA of target, because the target accuracy height of gene depends on sgRNA target sequence, becomeThe sgRNA that merit is designed accurate target becomes the key technical problem that knocks out genes of interest, the invention is intended to separateCertainly thereby this technical problem provides solid foundation for knocking out SLA-1 gene.

Summary of the invention

The object of the present invention is to provide method and the use of CRISPR-Cas9 specificity knock-out pig SLA-1 geneIn the sgRNA of selectively targeted SLA-1 gene.

According to a first aspect of the invention, the invention provides at CRISPR-Cas9 specificity knock-out pig SLA-1In gene, for the sgRNA of selectively targeted SLA-1 gene, this sgRNA has following characteristics:

(1) target sequence of this sgRNA on SLA-1 gene meets the series arrangement of 5 '-N (20) NGG-3 'Rule, wherein N (20) represents 20 continuous bases, wherein each N represents A or T or C or G, symbolTarget sequence normally can be positioned at positive-sense strand or antisense strand;

(2) target sequence of this sgRNA on SLA-1 gene is positioned at outside 4 of N end of SLA-1 geneAobvious sub-code area, or the major part of sequence is positioned at 4 extrons of the N end of SLA-1 gene, its remaining partDivide the boundary of crossing over adjacent introne, be positioned at adjacent introne;

(3) target sequence of this sgRNA on SLA-1 gene is unique.

As preferred version of the present invention, above-mentioned target sequence is to appoint in SEQ ID NO:1～162, a sequence shown in sequence.

As preferred version of the present invention, above-mentioned target sequence is shown in SEQ ID NO:1 or 2Sequence.

According to a second aspect of the invention, the invention provides CRISPR-Cas9 specificity knock-out pig SLA-1 baseThe method of cause, the method comprises the steps:

(1) add and be used to form cohesive end at 5 ' of the target sequence of the sgRNA described in first aspect-endSequence, the synthetic forward oligonucleotide sequence that obtains; Target sequence at the sgRNA described in first aspect is correspondingThe two ends of complementary series add the suitable sequence that is used to form cohesive end, the synthetic reverse oligonucleotide that obtainsSequence; By the annealing of synthetic forward oligonucleotide sequence and reverse oligonucleotide sequence, renaturation, formation hasThe double-stranded oligonucleotide of cohesive end;

(2) above-mentioned double-stranded oligonucleotide is connected into the expression vector of the linearizing Cas9 of carrying gene,To carrying containing the sgRNA oligonucleotide of respective target sequence and the expression vector of Cas9 gene, transform impressionState bacterium, Screening and Identification goes out correct positive colony, and positive colony is shaken bacterium, extracts plasmid;

(3) with above-mentioned expression vector, the packaging plasmid that carries sgRNA oligonucleotide and Cas9 geneThe false type slow virus of packing out the sgRNA and the Cas9 that simultaneously carry target SLA-1 gene with package cell line;

(4) use above-mentioned false type slow-virus infection object cell, and further cultivate; Then collect infectedObject cell, comprise the genetic fragment of above-mentioned target sequence taking its genomic DNA as template amplification, through becomingProperty, renaturation and enzyme are cut, and determine the situation that knocks out of SLA-1 gene.

As preferred version of the present invention, above-mentioned expression vector is order shown in SEQ ID NO:163The carrier of row.

As preferred version of the present invention, said method comprises the steps:

(1) add CACCG sequence at 5 ' of the target sequence of the sgRNA described in first aspect-end, syntheticObtain forward oligonucleotide sequence; At complementary series corresponding to the target sequence of the sgRNA described in first aspect5 '-end adds that AAAC sequence, 3 '-end adds C, the synthetic reverse oligonucleotide sequence that obtains; To just synthesizeTo the annealing of oligonucleotide sequence and reverse oligonucleotide sequence, renaturation, form the two strands widow with cohesive endPolynucleotide;

(2) above-mentioned double-stranded oligonucleotide is connected into as shown in SEQ ID NO:163 sequenceThe linearized vector that expression vector lentiCRISPRv2 obtains through BsmBI digestion with restriction enzyme, obtainsThe recombinant expression carrier lentiCRISPRv2-SLA-1 that carries sgRNA oligonucleotide, transformed competence colibacillus is thinBacterium, Screening and Identification goes out correct positive colony, and positive colony is shaken bacterium, extracts plasmid;

(3) pack with above-mentioned expression vector lentiCRISPRv2-SLA-1, packaging plasmid and package cell lineGo out to carry the false type slow virus of sgRNA and the Cas9 of target SLA-1 gene simultaneously;

(4) use the false type slow-virus infection of above-mentioned CRISPR object cell, and further cultivate; Then receiveCollect infected object cell, comprise the genetic fragment of above-mentioned target sequence taking its genomic DNA as template amplification,Cut through sex change, renaturation and enzyme, determine the situation that knocks out of SLA-1 gene.

As preferred version of the present invention, above-mentioned packaging plasmid is plasmid pLP1, plasmid pLP2 and plasmidPLP/VSVG; Above-mentioned incasing cells is HEK293T cell.

As preferred version of the present invention, above-mentioned purpose cell is pig PIEC cell.

As preferred version of the present invention, above-mentioned taking its genomic DNA as template amplification comprises above-mentioned target sequenceGenetic fragment, cut through sex change, renaturation and enzyme, determine the situation that knocks out of SLA-1 gene, be specially:

(a) taking the genomic DNA that infects viral object cell as template, upper and lower with SLA-1 geneThe SLA-1 genetic fragment of the target sequence that trip primer amplification comprises above-mentioned sgRNA increases by same primers simultaneouslyThe genomic DNA of the wild-type cell of uninfecting virus;

(b) the SLA-1 genetic fragment that the above-mentioned amplification of purifying is arrived, then the object cell of self-infection virus in the futureSLA-1 genetic fragment with from the SLA-1 genetic fragment mixed in equal amounts of wild-type cell, heat denatured,Renaturation, forms hybrid dna molecule;

(c) with the hybrid dna molecule after Cruiser enzyme cutting renaturation;

(d) electrophoresis detection enzyme is cut product, detects the SLA-1 gene knockout effect of target sequence mediation.

According to a third aspect of the invention we, the invention provides at CRISPR-Cas9 specificity knock-out pig SLA-1The recombinant expression carrier lentiCRISPRv2-SLA-1 using in the method for gene, the bone of this recombinant expression carrierThe sequence of frame carrier is as shown in SEQ ID NO:163; Entrained target sequence is as first aspectThe target sequence of sgRNA, the target sequence shown in SEQIDNO:1 or 2 in preferred sequence table.

According to a forth aspect of the invention, the invention provides sgRNA or the third aspect as described in first aspectDescribed recombinant expression carrier lentiCRISPRv2-SLA-1 is at CRISPR-Cas9 specificity knock-out pigPurposes in the method for SLA-1 gene.

Of the present invention for CRISPR-Cas9 specificity knock-out pig SLA-1 gene, successfully find specificityThe sgRNA of target SLA-1 gene, knocks out sgRNA of the present invention for CRISPR-Cas9 specificityIn the method for pig SLA-1 gene, can be fast, accurately, efficiently, knock-out pig SLA-1 gene specifically,Effectively solve and build SLA-1 gene knock-out pig cycle length and the high technical problem of cost.

Brief description of the drawings

Fig. 1 is the plasmid map of the vector plasmid lentiCRISPRv2 that uses in the embodiment of the present invention;

Fig. 2 is the plasmid map of the packaging plasmid pLP1 that uses in the embodiment of the present invention;

Fig. 3 is the plasmid map of the packaging plasmid pLP2 that uses in the embodiment of the present invention;

Fig. 4 is the plasmid map of the packaging plasmid pLP/VSVG that uses in the embodiment of the present invention;

Fig. 5 is the electrophoresis detection result figure that in the embodiment of the present invention, enzyme is cut the gene knockout effect of checking target sequence,Wherein M represents DNAMarker, and Ctrl represents the target of control sequence that can not efficient targeting SLA-1 geneTo cutting effect, 1 and 2 represent respectively No. 1 and the target of No. 2 target sequence to SLA-1 gene in table 1To cutting effect, arrow place represents the small fragment obtaining through the cutting of Cruiser enzyme.

Detailed description of the invention

Below in conjunction with the drawings and specific embodiments, technical scheme of the present invention is described further. These accompanying drawingsBe not used for limiting the scope of the invention with specific embodiment. If do not specialize, technology used in embodimentThe conventional means that means are well known to those skilled in the art, the raw materials used commercial goods that is.

The test material relating in following examples and reagent: lentiCRISPRv2 plasmid is purchased from AddgeneCompany, packaging plasmid pLP1, pLP2 and pLP/VSVG are purchased from Invitrogen company, package cell lineHEK293T cell is purchased from US mode culture collection warehousing (ATCC), and PIEC cell is purchased from the Chinese Academy of SciencesCell bank, DMEM culture medium, Opti-MEM culture medium and hyclone FBS be purchased from Gibco company,Lipofectamine2000 is purchased from Invitrogen company.

In following examples, do not make the experimental methods of molecular biology illustrating, all with reference to " molecular cloning is realTest guide " concrete grammar described in (third edition) J. Pehanorm Brooker one book carries out, or according to kit andProduct description carries out.

Recapitulative technical scheme of the present invention comprises following five parts:

One, the Choice and design of Susscrofa (pig) SLA-1 gene sgRNA target sequence

The sgRNA target sequence of 1.SLA-1 gene is selected:

Find suitable 20bp oligonucleotide sequence as target sequence in SLA-1 gene extron subarea.

The sgRNA target sequence design of 2.SLA-1 gene:

Above-mentioned target sequence and complementary series are added respectively to joint, form forward oligonucleotide sequence and oppositely fewNucleotide sequence.

Two, build the CRISPR carrier of SLA-1 gene

1. synthetic above-mentioned forward oligonucleotide sequence and reverse oligonucleotide sequence, renaturation forms has viscosity endThe double chain DNA fragment (being double-stranded target sequence oligonucleotide) of end.

2. build CRISPR-sgRNA expression vector:

By above-mentioned double chain DNA fragment build up to destination carrier (as lentiCRISPRv2, its plasmid map asShown in Fig. 1), form as the slow virus CRISPR carrier of lentiCRISPRv2-SLA-1.

Three, obtain the false type slow virus of expressing SLA-1sgRNA

Utilize packaging plasmid, package cell line and slow virus CRISPR carrier to produce and express SLA-1sgRNAThe false type slow virus of CRISPR.

Four, infect object cell and detect SLA-1 gene knockout effect

1. slow-virus infection object cell:

Add object cell culture medium to infect also the false type slow virus as lentiCRISPRv2-SLA-1Further cultivate.

2. detect SLA-1 gene knockout effect:

Collect object cell, comprise the genetic fragment of target sequence taking genomic DNA as template amplification, through becomingProperty, renaturation and enzyme are cut, and determine the situation that knocks out of SLA-1 gene.

Five, SLA-1 gene knockout is monoclonal selects and identifies

1. determine for having the object cell mass that knocks out effect, cultivate by dilution and monoclonal, if isolateThe cell line in dry unicellular source.

2. the monoclonal SLA-1 of qualification knocks out situation.

Describe by the following examples technical scheme of the present invention and beneficial effect thereof in detail.

The Choice and design of embodiment mono-, Susscrofa (pig) SLA-1 gene sgRNA target sequence

Target sequence has determined the efficiency of targeting specific and the induction Cas9 cutting genes of interest of sgRNA. CauseThis, efficient special target sequence Choice and design is the prerequisite that builds sgRNA expression vector.

1.SLA-1 the sgRNA target sequence of gene is selected

For SLA-1 gene, on selecting, target sequence should follow following principle:

(1) find the target sequence that meets 5 '-N (20) NGG-3 ' rule in SLA-1 gene extron code area,Wherein N (20) represents 20 continuous bases, and wherein each N represents A or T or C or G, meets ruleTarget sequence can be positioned at positive-sense strand or antisense strand;

(2) select 4 exons coding region sequences near N end, the cutting meeting of such coding region sequenceCause the function of SLA-1 gene to knock out, the sequence of residual brachymemma can not be formed with the albumen of function;

(3) if there is multiple spliced body, select in common exon code area, for SLA-1Gene is selected can meet this condition near 4 exons coding region sequences of N end;

(4) utilize online sequence analysis instrument (http://crispr.mit.edu/) to analyze above target sequence at pig baseBecause of the homology situation in group, give up the target sequence that has remarkable homologous sequence, further select according to scoring,The target sequence of selecting is unique on SLA-1 gene.

Based on above principle, select the target sequence set shown in table 1.

The set of table 1 target sequence

The sgRNA target sequence design of 2.SLA-1 gene:

(1) using lentiCRISPRv2 plasmid as expression vector, according to the spy of lentiCRISPRv2 plasmidPoint, adds CACCG sequence at 5 ' of above-mentioned N (20) target sequence-end, forms forward oligonucleotide sequence:

5’-CACCGNNNNNNNNNNNNNNNNNNNN-3’；

(2) add sequence at the two ends of the reverse complementary sequence of above-mentioned N (20) target sequence, form reverse few coreNucleotide sequence:

5’-AAACNNNNNNNNNNNNNNNNNNNNC-3’；

Forward oligonucleotide sequence and reverse oligonucleotide sequence can complementaryly form the two strands with cohesive endDNA fragmentation:

5’-CACCGNNNNNNNNNNNNNNNNNNNN-3’

3’-CNNNNNNNNNNNNNNNNNNNNCAAA-5’。

The sgRNA expression vector of embodiment bis-, structure SLA-1 gene

1. synthetic DNA Insert Fragment

(1) forward and the reverse oligonucleotide sequence of synthetic above-mentioned design

Oligonucleotide sequence can be by business-like company (as Invitrogen company) according to the sequence tool providingBody is synthetic. The present embodiment and following examples have been studied shown in listed in table 1 No. 1 and No. 2 sequenceThe knock out effect of target sequence to SLA-1 gene.

Forward oligonucleotide sequence and reverse oligonucleotide sequence that No. 1 target sequence is corresponding are as follows:

CACCGTCAGGGAGTGGGGACCCGCC(SEQIDNO：164)；

AAACGGCGGGTCCCCACTCCCTGAC(SEQIDNO：165)。

Forward oligonucleotide sequence and reverse oligonucleotide sequence that No. 2 target sequence is corresponding are as follows:

CACCGCAGGGAGTGGGGACCCGCCT(SEQIDNO：166)；

AAACAGGCGGGTCCCCACTCCCTGC(SEQIDNO：167)。

By the annealing of corresponding forward and reverse oligonucleotide sequence, renaturation, form the two strands with cohesive endDNA fragmentation.

(20 μ L) is as follows for reaction system:

Forward oligonucleotides (10 μ M): 1 μ L

Reverse oligonucleotide (10 μ M): 1 μ L

10×PCRbuffer：2μL

ddH₂O：16μL

Above-mentioned reaction system is put into PCR instrument, and react by following program.

Response procedures:

95℃,5min；

80℃,5min；

70℃,5min；

60℃,5min；

50℃,5min；

Naturally be down to room temperature.

2. build sgRNA expression vector

(1) utilize BsmBI digestion with restriction enzyme destination carrier lentiCRISPRv2 plasmid (its orderRow are as shown in SEQ ID NO:163).

Prepare according to following reaction system:

LentiCRISPRv2 plasmid: 1 μ g

10 × enzyme is cut buffer:2 μ L

BsmBI restriction enzyme: 2 μ L

Supplement ddH₂O is to cumulative volume 20 μ L

Endonuclease reaction system is placed in to 37 DEG C of reaction 4h.

(2) electrophoretic separation cmy vector fragment

Enzyme is cut after end, enzyme is cut to mixture and separate by agarose gel electrophoresis, selects carrier segments(about 12kb) cuts, and reclaims post by DNA gel and reclaim.

(3) synthetic double chain DNA fragment be connected with carrier main leaf section and transform Escherichia coli

The double chain DNA fragment that renaturation is obtained with reclaim the carrier segments that obtains and carry out coupled reaction, according toLower reaction system is prepared:

LentiCRISPRv2 carrier segments: 100ng

Double chain DNA fragment: 200ng

T4 ligase: 1 μ L

T4 coupled reaction buffer:1 μ L

Supplement ddH₂O is to cumulative volume 10 μ L

Connection mixture is placed in to 25 DEG C of reaction 2h.

After reaction finishes, will connect mixture and transform e.colistraindh5α: add to connecting in mixture100 μ L bacillus coli DH 5 alpha competent cells, hatch 30min on ice; Mixture is put into 42 DEG C of water-baths,After heat shock 90s, put into cooled on ice; Add 100 μ LLB culture mediums to mixture, 37 DEG C of shaking tables are cultivated 20min;Mixture is coated with to AmpLB flat board, cultivates 14h for 37 DEG C.

(4) identify correct transformed clone

Select some bacterium colonies from AmpLB flat board and expand cultivation, extraction plasmid carries out enzyme and cuts qualification.Select and may check order by correct clone, whether checking insetion sequence is correct. For correct lentiCRISPRV2-SLA-1 carrier cloning carries out conservation.

The false type slow virus of SLA-1sgRNA is expressed in embodiment tri-, acquisition

1. material is prepared

Amplification extracting packaging plasmid pLP1, pLP2 and pLP/VSVG (purchased from Invitrogen, its collection of illustrative platesRespectively as shown in Figure 2, Figure 3 and Figure 4); Amplification extracting vector plasmid lentiCRISPRv2-SLA-1;Cultivate package cell line HEK293T cell (purchased from ATCC); DMEM culture medium, Opti-MEM trainingSupport base and hyclone FBS (purchased from Gibco); Lipofectamine2000 (purchased from Invitrogen);HEK293T cell is incubated at containing 5%CO₂37 DEG C of culture environment in, culture medium is containing 10%FBSDMEM culture medium.

2. transfection and virus packaging

First day: package cell line HEK293T is passaged to 10cmdish, approximately 30% degrees of fusion;

Second day: in the time that HEK293T reaches 80% degrees of fusion, carry out transfection according to following formula:

Preparating mixture 1, comprises:

lentiCRISPRv2-SLA-1：6μg

pLP1：6μg

pLP2：6μg

pLP/VSVG：3μg

Opti-MEM：500μL。

Preparating mixture 2, comprises:

Lipofectamine2000：30μL

Opti-MEM：500μL。

Leave standstill after 5min, mixture 1 and mixture 2 are mixed into transfection mixture, leave standstill 20min.

HEK293T culture medium is changed to serum-free DMEM culture medium, adds transfection mixture, 37 DEG C of trainingsAfter foster 8h, be changed to the DMEM culture medium of 20%FBS, continue to cultivate.

3. collection virus and preservation

The 3rd day: after transfection 48h, collect containing viral HEK293T culture medium supernatant, with 0.45 μ m filterAfter filtration, packing, places-80 DEG C of preservations.

Embodiment tetra-, infect object cell and detect the effect that knocks out of target sequence

1. material is prepared

Cultivate object clone pig hip arteries endothelial cell PIEC (purchased from Chinese Academy of Sciences's cell bank);DMEM culture medium and hyclone FBS (purchased from Gibco); Different target sequences (sequence 1 and sequence 2)The false type slow virus of lentiCRISPRv2-SLA-1; PIEC cell is incubated at containing 5%CO₂37 DEG C of cultivationsIn environment, culture medium is the DMEM culture medium containing 10%FBS.

2. slow-virus infection object cell

First day: by object passage to 6 orifice plate, approximately 20% merges density. Each virus needs oneIndividual 6 holes need 6 holes of efficiency contrast simultaneously.

Second day: in the time that object cell approximately 40% merges density, add 1mLlentiCRISPRv2-SLA-1 vacationType slow virus supernatant and 1mLDMEM culture medium. Efficiency contrast does not need to add slow virus.

The 3rd day: after infecting 24h, remove containing Virus culture base, change normal culture medium into, add puromycinTo final concentration 2 μ g/mL, do not infect viral efficiency control sample and add puromycin in contrast simultaneously yet,Cultivate 48h.

3. cell infection efficiency detects and cultivates

The 5th day: the efficiency control cells not infecting whole apoptosis (> 95% under the effect of puromycin).The efficiency of infection that judges cell according to the apoptosis situation that infects slow virus cell, can reach more than 90% conventionallyEfficiency of infection (apoptosis rate < 10%). Viral supernatant can be concentrated if desired or gradient dilution after carry outInfect to reach suitable efficiency of infection.

After puromycin screening, the cell generation apoptosis not infecting. Object cell is again gone down to posterity and changedFor ordinary culture medium is cultivated 48h.

4. detect SLA-1 gene knockout effect

(1) design upstream and downstream primer is with amplification SLA-1 genetic fragment, the wherein following institute of upstream and downstream primer sequenceShow:

GCGCCACTGCGGTTCCCGGTTAT(SEQIDNO：168)；

GAGGGTGAGACACGACCCTC(SEQIDNO：169)。

Object amplified fragments comprises sgRNA target sequence, and size is 450bp. Target sequence is to the position at fragment two endsPut and be no less than 100bp.

(2) collection unit is divided object cell, uses promega genomic DNA kit extracting genomeDNA. The genomic DNA of the wild type of extracting simultaneously object cell.

(3) the SLA-1 genetic fragment that comprises target sequence taking genomic DNA as template amplification (comprises infectionSudden change sample and wild type sample).

(20 μ L) is as follows for amplification reaction system:

Upstream primer (10 μ M): 1 μ L

Downstream primer (10 μ M): 1 μ L

2×PCRMix：10μL

Genomic DNA: 100ng

Prepare with above-mentioned reaction system, put into PCR instrument, and react by follow procedure.

Response procedures:

95℃,3min

95℃,30s

58℃,20s

72℃,20s

72℃,3min；

Wherein second step to the four steps repeat 35 circulations.

(4) electrophoresis detection PCR product reclaim purifying

(5) by heat denatured, the renaturation respectively of the DNA fragmentation after purifying, form hybrid dna molecule (bagDraw together sudden change sample and wild type sample).

Reaction system is as follows:

Genomic PCR fragment: 200ng

5 × reaction buffer:2 μ L

Reaction system is totally 9 μ L

Response procedures:

95℃,5min；

80℃,5min；

70℃,5min；

60℃,5min；

50℃,5min；

Naturally be down to room temperature.

(6) with the hybrid dna (comprising sudden change sample and wild type sample) after Cruiser enzyme cutting renaturation

To adding 1 μ LCruiser enzyme through the reactant mixture of sex change, renaturation, hatch 20min for 45 DEG C.

(7) electrophoresis detection enzyme is cut product, detects the SLA-1 gene knockout effect of target sequence mediation.

DNA fragmentation 2% the Ago-Gel of cutting through enzyme is carried out to electrophoretic analysis, 100V, 25min.Determine the cutting situation of object fragment, judge the gene knockout effect of target sequence.

To the cutting identification of mutant DNA based on following principle: through cell infection can express sgRNA andCas9. If the Cas9 targeting proteins that genomic DNA is mediated by sgRNA cuts, after repairing, meeting existsNear cleavage site, introduce sudden change (wild type becomes saltant type). Because wild type and saltant type sequence are in this positionPut and do not mate, the wild type DNA going out as template amplification and mutant DNA form through change renaturationHybrid molecule can just produce local annular (loop) structure. And the latter can be identified and cut by Cruiser enzymeDisconnected, cause hybrid dna molecule to be cut into small fragment.

As shown in Figure 5, control sequence can not produce cutting by efficient targeting SLA-1 gene to result, therefore not inspectionMeasure small fragment; Sequence 1 and sequence 2 can produce cutting by efficient targeting SLA-1 gene, therefore detectThe existence of small fragment, shows that sequence 1 and sequence 2 can serve as CRISPR-Cas9 specificity knock-out pig SLA-1The target sequence of gene.

Embodiment five, SLA-1 gene knockout is monoclonal selects and identify

Monoclonal selecting (based on the target sequence of sequence 1 and sequence 2)

(1) object cell mass part being infected goes down to posterity, and gets 100 unicellular 10cmdish of being transferred toCultivate.

(2) cultivate after approximately 10 days, have a considerable amount of monoclonals to grow into macroscopic level.

(3) independently clone by pipettor head scraping, cell is transferred in 24 orifice plates and is cultivated, Mei GekongA corresponding clone.

(4) again after the cultivation of approximately a week, there is part clone to grow to enough quantity, go to furtherQualification.

2. the monoclonal SLA-1 of qualification knocks out situation

(1) collect monoclonal to be checked and wild-type cell, respectively extracting genomic DNA.

(2) according to preceding method, the SLA-1 genetic fragment of increase respectively monoclonal and wild-type cell, instituteThe genetic fragment of amplification comprises sgRNA target sequence.

(3) the monoclonal PCR fragment of equivalent is mixed with wild type PCR fragment, heat denatured, renaturation,Form hybrid dna molecule.

(4) with the hybrid dna after Cruiser enzyme cutting annealing, hatch 20min for 45 DEG C.

(5) whether electrophoresis detection enzyme is cut product, according to having cutting fragment to determine whether monoclonal occurs effectively to dash forwardBecome.

Result shows, the false type slow virus of lentiCRISPRv2-SLA-1 of the target sequence based on shown in sequence 1Infect object cell, unicellular from 100 20 monoclonals of random choose cut electricity through Cruiser enzyme enzymeSwimming detects, and wherein has 18 monoclonals cutting small fragment can be detected, shows that gene knockout occurs, clpp geneExcept efficiency can reach more than 90%, illustrate that the target sequence shown in sequence 1 has very high target and knocks out SLA-1The effect of gene. The false type slow virus of the lentiCRISPRv2-SLA-1 sense of the target sequence based on shown in sequence 2Dye object cell, unicellular from 100 20 monoclonals of random choose through Cruiser enzyme restriction enzyme digestion and electrophoresisDetect, wherein have 17 monoclonals cutting small fragment can be detected, show that gene knockout occurs, gene knockoutEfficiency can reach more than 85%, illustrates that the target sequence shown in sequence 2 has very high target and knocks out SLA-1The effect of gene.

Above content is in conjunction with concrete embodiment further description made for the present invention, can not recognizeDetermine specific embodiment of the invention and be confined to these explanations. For the ordinary skill of the technical field of the inventionPersonnel, without departing from the inventive concept of the premise, can also make some simple deduction or replace.

Claims

In CRISPR-Cas9 specificity knock-out pig SLA-1 gene for the sgRNA of selectively targeted SLA-1 gene, it is characterized in that:

(1) target sequence of described sgRNA on SLA-1 gene meets the series arrangement rule of 5 '-N (20) NGG-3 ', wherein N (20) represents 20 continuous bases, wherein each N represents A or T or C or G, and legal target sequence can be positioned at positive-sense strand or antisense strand;

(2) target sequence of described sgRNA on SLA-1 gene is positioned at 4 exons coding districts of the N end of SLA-1 gene, or the major part of sequence is positioned at 4 extrons of the N end of SLA-1 gene, remainder is crossed over the boundary with adjacent introne, is positioned at adjacent introne;

(3) target sequence of described sgRNA on SLA-1 gene is unique.
2. the sgRNA for selectively targeted SLA-1 gene according to claim 1, is characterized in that, described target sequence is the sequence shown in arbitrary sequence in SEQ ID NO:1 ~ 162.
3. the sgRNA for selectively targeted SLA-1 gene according to claim 1, is characterized in that, described target sequence is the sequence shown in SEQ ID NO:1 or 2.
The method of 4.CRISPR-Cas9 specificity knock-out pig SLA-1 gene, is characterized in that, described method comprises the steps:

(1) add at 5 ' of the target sequence of the sgRNA described in claim 1-3 any one-end the sequence that is used to form cohesive end, the synthetic forward oligonucleotide sequence that obtains; Two ends at complementary series corresponding to the target sequence of the sgRNA described in claim 1-3 any one add the suitable sequence that is used to form cohesive end, the synthetic reverse oligonucleotide sequence that obtains; By synthetic described forward oligonucleotide sequence and the annealing of reverse oligonucleotide sequence, renaturation, formation has the double-stranded oligonucleotide of cohesive end;

(2) described double-stranded oligonucleotide is connected into the expression vector of the linearizing Cas9 of carrying gene, obtain carrying containing the sgRNA oligonucleotide of respective target sequence and the expression vector of Cas9 gene, transformed competence colibacillus bacterium, Screening and Identification goes out correct positive colony, and described positive colony is shaken bacterium, extracts plasmid;

(3) with described in carry the false type slow virus that expression vector, packaging plasmid and the package cell line of sgRNA oligonucleotide and Cas9 gene are packed out the sgRNA and the Cas9 that carry target SLA-1 gene simultaneously;

(4) use described false type slow-virus infection object cell, and further cultivate; Then collect infected object cell, comprise the genetic fragment of described target sequence taking its genomic DNA as template amplification, cut through sex change, renaturation and enzyme, determine the situation that knocks out of SLA-1 gene.
5. the method for CRISPR-Cas9 specificity knock-out pig SLA-1 gene according to claim 4, is characterized in that, described expression vector is the carrier of sequence shown in SEQ ID NO:163.
6. according to the method for the CRISPR-Cas9 specificity knock-out pig SLA-1 gene described in claim 4 or 5, it is characterized in that, described method comprises the steps:

(1) add CACCG sequence at 5 ' of the target sequence of the sgRNA described in claim 1-3 any one-end, the synthetic forward oligonucleotide sequence that obtains; Add that at 5 ' of complementary series corresponding to the target sequence of the sgRNA described in claim 1-3 any one-end AAAC sequence, 3 '-end adds C, the synthetic reverse oligonucleotide sequence that obtains; By synthetic described forward oligonucleotide sequence and the annealing of reverse oligonucleotide sequence, renaturation, formation has the double-stranded oligonucleotide of cohesive end;

(2) described double-stranded oligonucleotide is connected into the linearized vector that the expression vector lentiCRISPRv2 of sequence as shown in SEQ ID NO:163 obtains through BsmBI digestion with restriction enzyme, obtain carrying the recombinant expression carrier lentiCRISPRv2-SLA-1 of sgRNA oligonucleotide, transformed competence colibacillus bacterium, Screening and Identification goes out correct positive colony, and described positive colony is shaken bacterium, extracts plasmid;

(3) pack out the false type slow virus of the sgRNA and the Cas9 that simultaneously carry target SLA-1 gene with described expression vector lentiCRISPRv2-SLA-1, packaging plasmid and package cell line;

(4) use described false type slow-virus infection object cell, and further cultivate; Then collect infected object cell, comprise the genetic fragment of described target sequence taking its genomic DNA as template amplification, cut through sex change, renaturation and enzyme, determine the situation that knocks out of SLA-1 gene.
7. the method for CRISPR-Cas9 specificity knock-out pig SLA-1 gene according to claim 6, is characterized in that, described packaging plasmid is plasmid pLP1, plasmid pLP2 and plasmid pLP/VSVG; Described incasing cells is HEK293T cell.
8. the method for CRISPR-Cas9 specificity knock-out pig SLA-1 gene according to claim 6, is characterized in that, described object cell is pig PIEC cell;

The described genetic fragment that comprises described target sequence taking its genomic DNA as template amplification, cuts through sex change, renaturation and enzyme, determines the situation that knocks out of SLA-1 gene, is specially:

(a) taking the genomic DNA that infects viral object cell as template, the SLA-1 genetic fragment of the target sequence that comprises described sgRNA with the upstream and downstream primer amplification of SLA-1 gene, simultaneously with the genomic DNA of the wild-type cell of same primers amplification uninfecting virus;

(b) the SLA-1 genetic fragment that the above-mentioned amplification of purifying is arrived, then in the future the SLA-1 genetic fragment of the object cell of self-infection virus and SLA-1 genetic fragment mixed in equal amounts, heat denatured, renaturation from wild-type cell, forms hybrid dna molecule;

(c) with the hybrid dna molecule after Cruiser enzyme cutting renaturation;

(d) electrophoresis detection enzyme is cut product, detects the SLA-1 gene knockout effect of target sequence mediation.
9. the recombinant expression carrier lentiCRISPRv2-SLA-1 using in the method for CRISPR-Cas9 specificity knock-out pig SLA-1 gene, is characterized in that, the sequence of the skeleton carrier of described recombinant expression carrier is as shown in SEQ ID NO:163; The target sequence of the sgRNA of entrained target sequence as described in claim 1-3 any one, the target sequence shown in SEQIDNO:1 or 2 in preferred sequence table.
10. the sgRNA as described in claim 1-3 any one or recombinant expression carrier lentiCRISPRv2-SLA-1 claimed in claim 9 purposes in the method for CRISPR-Cas9 specificity knock-out pig SLA-1 gene.