CN106414740A - Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene - Google Patents
Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene Download PDFInfo
- Publication number
- CN106414740A CN106414740A CN201580000474.9A CN201580000474A CN106414740A CN 106414740 A CN106414740 A CN 106414740A CN 201580000474 A CN201580000474 A CN 201580000474A CN 106414740 A CN106414740 A CN 106414740A
- Authority
- CN
- China
- Prior art keywords
- sla
- gene
- sequence
- sgrna
- target sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
- C12N15/867—Retroviral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Provided is a method for knockout of a swine SLA-3 gene using CRISPR-Cas9 specificity, and an sgRNA used for specifically targeting the SLA-3 gene. The target sequence of the sgRNA in the specifically targeted SLA-3 gene is located at the 5 exon coding regions, or the junction with the adjacent introns, of the N end of the SLA-3 gene.
Description
Technical field
The present invention relates to gene engineering technology field, more particularly, to gene Knockout field are and in particular to CRISPR-
The method of Cas9 specific knockdown pig SLA-3 gene and the sgRNA for selectively targeted SLA-3 gene.
Background technology
Organ transplant is the maximally effective treatment means for the treatment of organs debilitating diseases.So far, the whole world has nearly million
Patient continues life by organ transplant.With the progress of aging population and medical technology, need to carry out organ transplant hand
The patient of art gets more and more, but the shortage of donor organ seriously constrains the development of organ transfer operation.Taking kidney transplant as a example,
China needs to carry out the patient up to 300,000 of kidney transplant every year, and the donation kidney that can be used for transplanting is less than 10,000, most of
Patient dies from kidney failure.Rely on after death organ donation can not meet the needs of organ transplant.By genetic engineering modified other
Species, to provide the organ being appropriate to human implantation, become the main path solving the problems, such as non-human donor's organ shortage.
At present, according to many-sided evaluation such as biological safety, physiological function index, economy and rare species conservation, pig
Become ideal Xenogeneic organ source.But there is huge difference between pig and people, directly the organ transplant of pig is arrived
People can produce strong immunological rejection.Therefore, by genetic engineering, pig is transformed, be suitable for human implantation to produce
Organ, become heteroplastic ultimate aim.
Swine leukocyte antigen (swine leukocyte antigen, SLA) I quasi-molecule is to represent gene molecule heredity spy
The critical function gene levied.It is referred to as SLA-1 (PD1), SLA-2 (PD14) and SLA-3 (PD7), also referred to as SLA-C,
SLA-B and SLA-A.Mainly height is expressed in immune system and digestive system to classical SIJA gene, especially in immune system,
The tissue such as spleen, thymus gland, bronchial lymph nodes is rich in immunocyte.People's cd4 t cell passes through indirectly pathogen recognition approach and identifies pig
Heterogenetic antigen, and predominantly SLA I quasi-molecule is identified.Accordingly, it would be desirable to eliminate the SLA I quasi-molecule on pig cell surface to subtract
The immunogenicity of few xenogeneic organ.And the knock-out pig SLA-3 gene of precise and high efficiency, eliminate SLA I quasi-molecule and cause
The committed step of immunological rejection.
At present, common gene Knockout include homologous recombination (Homologus Recombination, HR) technology,
Class transcriptional activation effector nuclease (Transcription Activator-Like Effector Nuclease, TALEN)
The rule cluster of technology, Zinc finger nuclease (Zinc-Finger Nuclease, ZFN) technology and latest developments is spaced the short palindrome
Repeat (Clustered Regularly Interspaced Short Palindromic Repeat, CRISPR) technology.HR
Technology is due to the low (efficiency only about 10 of recombination efficiency-6), very time-consuming and poorly efficient to the screening operation of mutant, gradually
Substituted.The cutting efficiency of TALEN technology and ZFN technology typically can reach 20%, but be required for structure and can identify specific sequence
The protein module of row, previous work is loaded down with trivial details time-consuming.The module design of ZFN technology is complex and has higher miss rate, its
Application is limited.
CRISPR is that one kind comes from procaryotic acquired immune system, and this system executes the compound of interference function by egg
White matter Cas and CRISPR-RNA (crRNA) composition.This system has had been found that three types, wherein Equations of The Second Kind Cas9 system at present
Composition is simple, has actively been applied to genetic engineering field.Cas9 targeting cutting DNA is by two kinds of tiny RNA crRNA
(CRISPR RNA) and tracrRNA (trans-activating crRNA) and the principle realization of target complement sequence identification.Existing
, two kinds of tiny RNA are fused into a RNA chain, abbreviation sgRNA (single guide RNA), are capable of identify that specific base
Because of sequence, Cas9 albumen is guided to be cut.In eucaryote, DNA occurs non-homogeneous restructuring end to connect after being cut off, make
Become frameshift mutation, ultimately result in gene function and knock out.
Compared to above-mentioned 3 kinds of technology, CRISPR technical operation is simple, screening efficiency is high, is capable of accurately targetting and cuts
Cut.Therefore, SLA-3 gene is knocked out by CRISPR technology and can be greatly enhanced Neu5Gc deletion cells and genetic engineering pig
Screening efficiency.But the key technology difficulty in this path is to design and prepare the sgRNA of accurate targeting, because the targeting essence of gene
Exactness is highly dependent on sgRNA target sequence, and the sgRNA that success designs accurate targeting becomes the key knocking out genes of interest
Technical problem, the invention is intended to solve this technical problem thus providing solid foundation for knocking out SLA-3 gene.
Content of the invention
It is an object of the invention to provide the method for CRISPR-Cas9 specific knockdown pig SLA-3 gene and for special
Property targeting SLA-3 gene sgRNA.
According to the first aspect of the invention, the present invention provides and uses in CRISPR-Cas9 specific knockdown pig SLA-3 gene
In the sgRNA of selectively targeted SLA-3 gene, this sgRNA has the characteristics that：
(1) target sequence on SLA-3 gene for this sgRNA meets the series arrangement rule of 5 '-N (20) NGG-3 ', wherein N
(20) 20 continuous bases are represented, wherein each N represents A or T or C or G, and legal target sequence may be located at positive-sense strand
Or antisense strand；
(2) target sequence on SLA-3 gene for this sgRNA is located at 5 exons coding districts of the N-terminal of SLA-3 gene, or
The major part of sequence is located at 5 extrons of the N-terminal of SLA-3 gene, and remainder crosses over the boundary with adjacent intron, position
In adjacent intron；
(3) target sequence on SLA-3 gene for this sgRNA is unique.
As the preferred version of the present invention, above-mentioned target sequence is SEQ ID NO in sequence table：Any bar sequence in 1～115
Shown sequence.
As the preferred version of the present invention, above-mentioned target sequence is SEQ ID NO in sequence table：4th, the sequence shown in 5 or 12.
According to the second aspect of the invention, the present invention provides the side of CRISPR-Cas9 specific knockdown pig SLA-3 gene
Method, the method comprises the steps：
(1) the 5 ' of the target sequence of the sgRNA described in first aspect-end adds for forming the sequence of cohesive end, closes
Become to obtain positive oligonucleotide sequence；The two ends of the corresponding complementary series of target sequence of the sgRNA described in first aspect add
The suitable sequence for forming cohesive end, synthesis obtains reverse oligonucleotide sequence；Positive oligonucleotides sequence by synthesis
Row and reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with cohesive end；
(2) above-mentioned double stranded oligonucleotide is connected into the linearizing expression vector carrying Cas9 gene, obtains carrying and contain
The corresponding sgRNA oligonucleotide of target sequence and the expression vector of Cas9 gene, transformed competence colibacillus bacterium, Screening and Identification goes out correctly
Positive colony, and positive colony is shaken bacterium, extract plasmid；
(3) with above-mentioned expression vector, packaging plasmid and the incasing cells carrying sgRNA oligonucleotide and Cas9 gene
The false type slow virus of sgRNA and Cas9 simultaneously carrying targeting SLA-3 gene is packed out by system；
(4) use above-mentioned vacation type slow-virus infection aim cell, and cultivate further；Then collect infected purpose thin
Born of the same parents, comprise the genetic fragment of above-mentioned target sequence with its genomic DNA for template amplification, through denaturation, renaturation and digestion, determine
The knockout situation of SLA-3 gene.
As the preferred version of the present invention, above-mentioned expression vector is SEQ ID NO in sequence table：The load of sequence shown in 116
Body.
As the preferred version of the present invention, said method comprises the steps：
(1) the 5 ' of the target sequence of the sgRNA described in first aspect-end adds CACCG sequence, and synthesis obtains positive widow's core
Nucleotide sequence；The 5 ' of the corresponding complementary series of target sequence of the sgRNA described in first aspect-end adds AAAC sequence, 3 '-end
Plus C, synthesis obtains reverse oligonucleotide sequence；The positive oligonucleotide sequence of synthesis is moved back with reverse oligonucleotide sequence
Fire, renaturation, form the double stranded oligonucleotide with cohesive end；
(2) above-mentioned double stranded oligonucleotide is connected into as SEQ ID NO in sequence table：The expression vector of sequence shown in 116
The linearized vector that lentiCRISPR v2 obtains through BsmB I digestion with restriction enzyme, obtains carrying sgRNA oligonucleotides
The recombinant expression carrier lentiCRISPR v2-SLA-3 of acid, transformed competence colibacillus bacterium, Screening and Identification goes out correct positive colony,
And positive colony is shaken with bacterium, extracts plasmid；
(3) packed out simultaneously with above-mentioned expression vector lentiCRISPR v2-SLA-3, packaging plasmid and package cell line
Carry the false type slow virus of sgRNA and Cas9 of targeting SLA-3 gene；
(4) use above-mentioned CRISPR vacation type slow-virus infection aim cell, and cultivate further；Then collect infected
Aim cell, comprises the genetic fragment of above-mentioned target sequence with its genomic DNA for template amplification, through denaturation, renaturation and digestion,
Determine the knockout situation of SLA-3 gene.
As the preferred version of the present invention, above-mentioned packaging plasmid is plasmid pLP1, plasmid pLP2 and plasmid pLP/VSVG；On
Stating package cell line is HEK293T cell.
As the preferred version of the present invention, above-mentioned purpose cell is pig PIEC cell.
As the preferred version of the present invention, the above-mentioned gene comprising above-mentioned target sequence with its genomic DNA for template amplification
Fragment, through denaturation, renaturation and digestion, determines the knockout situation of SLA-3 gene, specially：
(a) with the genomic DNA of the aim cell that infects virus as template, with the amplification of the upstream and downstream primer of SLA-3 gene
Comprise the SLA-3 genetic fragment of the target sequence of above-mentioned sgRNA, expand the wild-type cell of uninfecting virus simultaneously with same primers
Genomic DNA；
B () purifies the SLA-3 genetic fragment that above-mentioned amplification is arrived, then the SLA-3 of the aim cell of self-infection in future virus
Genetic fragment and the SLA-3 genetic fragment mixed in equal amounts from wild-type cell, heat denatured, renaturation, form hybrid dna and divide
Son；
C () uses the hybrid DNA molecule after Cruiser cleavage renaturation；
(d) electrophoresis detection digestion products, the SLA-3 gene knockout effect of detection target sequence mediation.
According to the third aspect of the invention we, the present invention is provided in the side of CRISPR-Cas9 specific knockdown pig SLA-3 gene
The recombinant expression carrier lentiCRISPR v2-SLA-3 using in method, the sequence such as sequence of the skeleton carrier of this recombinant expression carrier
SEQ ID NO in list：Shown in 116；The target sequence of the sgRNA of entrained target sequence such as first aspect, in preferred sequence table
SEQ ID NO：4th, the target sequence shown in 5 or 12.
According to the fourth aspect of the invention, the present invention is provided described in sgRNA as described in relation to the first aspect or the third aspect
Recombinant expression carrier lentiCRISPR v2-SLA-3 is in the method for CRISPR-Cas9 specific knockdown pig SLA-3 gene
Purposes.
The present invention for CRISPR-Cas9 specific knockdown pig SLA-3 gene, be successfully found selectively targeted SLA-
The sgRNA of 3 genes, the sgRNA of the present invention is used in the method for CRISPR-Cas9 specific knockdown pig SLA-3 gene, can
Quickly, accurately, efficiently, specifically knock-out pig SLA-3 gene, efficiently solve structure SLA-3 gene knock-out pig cycle length and
The technical problem of high cost.
Brief description
Fig. 1 is the plasmid map of vector plasmid lentiCRISPR v2 used in the embodiment of the present invention；
Fig. 2 is the plasmid map of packaging plasmid pLP1 used in the embodiment of the present invention；
Fig. 3 is the plasmid map of packaging plasmid pLP2 used in the embodiment of the present invention；
Fig. 4 is the plasmid map of packaging plasmid pLP/VSVG used in the embodiment of the present invention；
Fig. 5 is the electrophoresis detection result figure of the gene knockout effect of digestion verification target sequence in the embodiment of the present invention, wherein M
Represent DNA Marker, 4,5 and 12 represent No. 4, No. 5 and No. 12 targeting to SLA-3 gene for the target sequence in table 1 respectively
Cutting effect, WT represents the PCR primer Cruiser digestion detection knot of the wild-type cell without virus infection and Cas9 cutting
Really, represent the small fragment obtaining through Cruiser cleavage at arrow.
Specific embodiment
With specific embodiment, technical scheme is described further below in conjunction with the accompanying drawings.These accompanying drawings and concrete
Embodiment is not limited to the scope of the present invention.If not specializing, in embodiment, technological means used is art technology
Conventional meanses known to personnel, raw materials used are commercial goods.
The test material being related in following examples and reagent：LentiCRISPR v2 plasmid is purchased from Addgene company, bag
Dress plasmid pLP1, pLP2 and pLP/VSVG are purchased from Invitrogen company, and package cell line HEK293T cell is purchased from US mode
Culture collection warehousing (ATCC), PIEC cell is purchased from Chinese Academy of Sciences's cell bank, DMEM culture medium, Opti-MEM culture medium and tire
Cow's serum FBS is purchased from Gibco company, and Lipofectamine 2000 is purchased from Invitrogen company.
Do not make the experimental methods of molecular biology illustrating, equal reference in following examples《Molecular Cloning:A Laboratory guide》
Concrete grammar described in (third edition) J. Pehanorm Brooker one book is carried out, or carries out according to kit and product description.
The recapitulative technical scheme of the present invention includes following five parts：
First, the selection of Sus scrofa (pig) SLA-3 gene sgRNA target sequence and design
1.SLA-3 the sgRNA target sequence of gene selects：
Find suitable 20bp oligonucleotide sequence in SLA-3 gene extron sub-district as target sequence.
2.SLA-3 the sgRNA target sequence design of gene：
Above-mentioned target sequence and complementary series are added joint respectively, forms positive oligonucleotide sequence and reverse oligonucleotide
Sequence.
2nd, build the CRISPR carrier of SLA-3 gene
1. synthesis above-mentioned forward direction oligonucleotide sequence and reverse oligonucleotide sequence, renaturation is formed has the double of cohesive end
Chain DNA fragment (i.e. double stranded target sequence oligonucleotide).
2. build CRISPR-sgRNA expression vector：
Above-mentioned double chain DNA fragment is built to destination carrier (such as lentiCRISPR v2, its plasmid map such as Fig. 1 institute
Show), form the slow virus CRISPR carrier as lentiCRISPR v2-SLA-3.
3rd, obtain the false type slow virus of expression SLA-3sgRNA
The CRISPR producing expression SLA-3sgRNA using packaging plasmid, package cell line and slow virus CRISPR carrier is false
Type slow virus.
4th, infect aim cell and detect SLA-3 gene knockout effect
1. slow-virus infection aim cell：
The false type slow virus of such as lentiCRISPR v2-SLA-3 is added aim cell culture medium to carry out infection and goes forward side by side one
Step culture.
2. detect SLA-3 gene knockout effect：
Collect aim cell, comprise the genetic fragment of target sequence with genomic DNA for template amplification, through denaturation, renaturation
And digestion, determine the knockout situation of SLA-3 gene.
5th, SLA-3 gene knockout is monoclonal selects and identifies
1. determine, for having, the aim cell group knocking out effect, by dilution and Colony Culture, isolate some slender
The cell line in born of the same parents source.
2. the monoclonal SLA-3 of identification knocks out situation.
Describe technical scheme and its advantage by the following examples in detail.
Embodiment one, the selection of Sus scrofa (pig) SLA-3 gene sgRNA target sequence and design
Target sequence determines the targeting specific of sgRNA and induction Cas9 cuts the efficiency of genes of interest.Therefore, efficiently special
Different target sequence selects and design is the premise building sgRNA expression vector.
1.SLA-3 the sgRNA target sequence of gene selects
For SLA-3 gene, following principle should be followed on target sequence selects：
(1) target sequence meeting 5 '-N (20) NGG-3 ' rule, wherein N are found in SLA-3 gene extron code area
(20) 20 continuous bases are represented, wherein each N represents A or T or C or G, and legal target sequence may be located at positive-sense strand
Or antisense strand；
(2) 5 exons coding region sequences near N-terminal are selected, the cutting of such coding region sequence can cause SLA-3
The function of gene knocks out, and remains the sequence truncating and will not form functional albumen；
(3) if there is multiple spliced bodies, then selected in common exon code area, for SLA-3 gene selects
5 exons coding region sequences near N-terminal can meet this condition；
(4) utilize online sequence analysis tools (http://crispr.mit.edu/) analyze above target sequence in pig gene
Homology situation in group, gives up the target sequence that there is notable homologous sequence, is selected further according to scoring, the target sequence selected
SLA-3 gene is unique.
Based on above principle, select the target sequence set shown in table 1.
Table 1 target sequence set
2.SLA-3 the sgRNA target sequence design of gene：
(1) using lentiCRISPR v2 plasmid as expression vector, according to the feature of lentiCRISPR v2 plasmid, upper
CACCG sequence is added at the 5 '-end stating N (20) target sequence, forms positive oligonucleotide sequence：
5’-CACCGNNNNNNNNNNNNNNNNNNNN-3’；
(2) add sequence at the two ends of the reverse complementary sequence of above-mentioned N (20) target sequence, form reverse oligonucleotide sequence
Row：
5’-AAACNNNNNNNNNNNNNNNNNNNNC-3’；
Positive oligonucleotide sequence and reverse oligonucleotide sequence can be complementarily shaped to the double-stranded DNA piece with cohesive end
Section：
5’-CACCGNNNNNNNNNNNNNNNNNNNN-3’
3’-CNNNNNNNNNNNNNNNNNNNNCAAA-5’.
Embodiment two, the sgRNA expression vector of structure SLA-3 gene
1. synthetic DNA Insert Fragment
(1) synthesize the forward and reverse oligonucleotide sequence of above-mentioned design
Oligonucleotide sequence specifically can be closed according to the sequence providing by business-like company (as Invitrogen company)
Become.The present embodiment and following examples have studied listed in table 1 No. 4, No. 5 and No. 12 target sequence pair shown in sequence
The knockout effect of SLA-3 gene.
No. 4 target sequence corresponding forward direction oligonucleotide sequence and reverse oligonucleotide sequence are as follows：
5’-CACCGGGCCCTGACTGGTACCCGGG-3’(SEQ ID NO：117)；
5’-AAACCCCGGGTACCAGTCAGGGCCC-3’(SEQ ID NO：118).
No. 5 target sequence corresponding forward direction oligonucleotide sequence and reverse oligonucleotide sequence are as follows：
5’-CACCGGCCCTGACTGGTACCCGGGA-3’(SEQ ID NO：119)；
5’-AAACTCCCGGGTACCAGTCAGGGCC-3’(SEQ ID NO：120).
No. 12 target sequence corresponding forward direction oligonucleotide sequence and reverse oligonucleotide sequence are as follows：
5’-CACCG CCTGGCCCTGACTGGTACCC-3’(SEQ ID NO：121)；
5’-AAACGGGTACCAGTCAGGGCCAGGC-3’(SEQ ID NO：122).
By the annealing of corresponding forward and reverse oligonucleotide sequence, renaturation, form the double-stranded DNA piece with cohesive end
Section.
Reaction system (20 μ L) is as follows：
Positive oligonucleotides (10 μM)：1μL
Reverse oligonucleotide (10 μM)：1μL
10×PCR buffer：2μL
ddH2O：16μL
Above-mentioned reaction system is put into PCR instrument, and is reacted by following procedure.
Response procedures：
95℃,5min；
80℃,5min；
70℃,5min；
60℃,5min；
50℃,5min；
Naturally it is down to room temperature.
2. build sgRNA expression vector
(1) utilize BsmB I digestion with restriction enzyme destination carrier lentiCRISPR v2 plasmid (its sequence such as sequence
SEQ ID NO in table：Shown in 116).
Prepared according to following reaction system：
LentiCRISPR v2 plasmid：1μg
10 × digestion buffer：2μL
BsmB I restriction enzyme：2μL
Supplement ddH2O to cumulative volume 20 μ L
Endonuclease reaction system is placed in 37 DEG C of reaction 4h.
(2) electrophoretic separation cmy vector fragment
After digestion terminates, digestion mixture is carried out separating by agarose gel electrophoresis, selects carrier segments (about
12kb) cut, and reclaimed by DNA gel recovery column.
(3) double chain DNA fragment of synthesis and carrier main leaf section are attached and convert Escherichia coli
The double chain DNA fragment that renaturation is obtained is attached reacting with reclaiming the carrier segments obtaining, according to following reaction
System is prepared：
LentiCRISPR v2 carrier segments：100ng
Double chain DNA fragment：200ng
T4 ligase：1μL
T4 coupled reaction buffer：1μL
Supplement ddH2O to cumulative volume 10 μ L
It is placed in 25 DEG C of reaction 2h by connecting mixture.
Reaction will connect mixture conversion e.colistraindh5α after terminating：Add 100 μ L big to connecting in mixture
Enterobacteria DH5 α competent cell, is incubated 30min on ice；Mixture is put into 42 DEG C of water-baths, puts into cold on ice after heat shock 90s
But；Add 100 μ L LB culture mediums, 37 DEG C of shaking table cultures 20min to mixture；Mixture is applied Amp LB flat board, 37 DEG C of cultures
14h.
(4) identify correct transformed clone
Some bacterium colonies are selected from Amp LB flat board be enlarged cultivating, extract plasmid and carry out digestion identification.Select possibility
Correct clone is sequenced, and whether checking insetion sequence is correct.For correct lentiCRISPR v2-SLA-3 carrier gram
Grand carry out conservation.
Embodiment three, the false type slow virus of acquisition expression SLA-3sgRNA
1. material prepares
Expand and extract packaging plasmid pLP1, pLP2 and pLP/VSVG (purchased from Invitrogen, its collection of illustrative plates respectively as Fig. 2,
Shown in Fig. 3 and Fig. 4)；Expand and extract vector plasmid lentiCRISPR v2-SLA-3；Package cell line HEK293T is thin for culture
Born of the same parents (purchased from ATCC)；DMEM culture medium, Opti-MEM culture medium and hyclone FBS (purchased from Gibco)；
Lipofectamine2000 (purchased from Invitrogen)；HEK293T cell culture is in containing 5%CO237 DEG C of culture environment in,
Culture medium is the DMEM culture medium containing 10%FBS.
2. transfection and virus packaging
First day：Package cell line HEK293T is passaged to 10cm dish, about 30% degrees of fusion；
Second day：Transfected according to following formula when HEK293T reaches 80% degrees of fusion：
Preparating mixture 1, comprises：
lentiCRISPR v2-SLA-3：6μg
pLP1：6μg
pLP2：6μg
pLP/VSVG：3μg
Opti-MEM：500μL.
Preparating mixture 2, comprises：
Lipofectamine 2000：30μL
Opti-MEM：500μL.
After standing 5min, mixture 1 and mixture 2 are mixed into transfection mixture, stand 20min.
HEK293T culture medium is changed to plasma-free DMEM medium, adds transfection mixture, be changed to after 37 DEG C of culture 8h
The DMEM culture medium of 20%FBS, continues culture.
3. collection virus and preservation
3rd day：The HEK293T culture medium supernatant containing virus is collected after transfection 48h, after being filtered with 0.45 μm of filter, point
Dress, places -80 DEG C of preservations.
Example IV, infect aim cell and detect the knockout effect of target sequence
1. material prepares
Culture aim cell system pig hip arterial endothelium cells PIEC (purchased from Chinese Academy of Sciences's cell bank)；DMEM cultivates
Base and hyclone FBS (purchased from Gibco)；The lentiCRISPR v2- of different target sequences (sequence 4, sequence 5 and sequence 12)
SLA-3 vacation type slow virus；PIEC cell culture is in containing 5%CO237 DEG C of culture environment in, culture medium is containing 10%FBS's
DMEM culture medium.
2. slow-virus infection aim cell
First day：Aim cell is passaged to 6 orifice plates, about 20% fusion density.Each virus needs 6 holes, with
When need efficiency compare 6 holes.
Second day：Add 1mL lentiCRISPR v2-SLA-3 vacation type sick slowly when aim cell about 40% merges density
Malicious supernatant and 1mL DMEM culture medium.Efficiency comparison does not need to add slow virus.
3rd day：Remove base containing Virus culture after infection 24h, change normal incubation medium into, add puromycin to final concentration 2
μ g/mL, the efficiency control sample not infecting virus is also simultaneously introduced puromycin as comparison, cultivates 48h.
3. cell infection Efficiency testing and culture
5th day：The efficiency compared with control cells being uninfected by the presence of puromycin should all apoptosis (>95%).According to
The apoptosis situation of infection slow virus cell judges the efficiency of infection of cell, can generally achieve more than 90% efficiency of infection and (withers
Die rate<10%).Viral supernatants can be concentrated if necessary or gradient dilution after infected to reach suitable infection effect
Rate.
After puromycin screening, the apoptosis that are uninfected by.Aim cell is passed on again and is changed to common
Medium culture 48h.
4. detect SLA-3 gene knockout effect
(1) design upstream and downstream primer is as follows to expand SLA-3 genetic fragment, wherein upstream and downstream primer sequence：
CTCGGGGTCTCAGGCTCCAGGGCGG(SEQ ID NO：123)
GGGCAGGAAACAAGGGAGGG(SEQ ID NO：124).
Purpose amplified fragments comprise sgRNA target sequence, and size is 487bp.Target sequence is no less than to the position at fragment two ends
100bp.
(2) collection portion divides aim cell, extracts genomic DNA using promega genomic DNA kit.Extract simultaneously
The genomic DNA of wild type aim cell.
(3) the SLA-3 genetic fragment comprising target sequence for template amplification with genomic DNA (includes the mutagenic samples of infection
And wild-type samples).
Amplification reaction system (20 μ L) is as follows：
Upstream primer (10 μM)：1μL
Downstream primer (10 μM)：1μL
2×PCR Mix：10μL
Genomic DNA：100ng
Prepared with above-mentioned reaction system, put into PCR instrument, and reacted by following procedure.
Response procedures：
95℃,3min
95℃,30s
58℃,20s
72℃,20s
72℃,3min；
Wherein second step to the 4th step repeats 35 circulations.
(4) electrophoresis detection PCR primer recovery purifying
(5) by respectively heat denatured, the renaturation of DNA fragmentation after purification, formed hybrid DNA molecule (include mutagenic samples and
Wild-type samples).
Reaction system is as follows：
Genomic PCR fragment：200ng
5 × reaction buffer：2μL
Reaction system totally 9 μ L
Prepared with above-mentioned reaction system, put into PCR instrument, and reacted by following procedure.
Response procedures：
95℃,5min；
80℃,5min；
70℃,5min；
60℃,5min；
50℃,5min；
Naturally it is down to room temperature.
(6) use the hybrid dna after Cruiser cleavage renaturation (including mutagenic samples and wild-type samples)
Add 1 μ L Cruiser enzyme, 45 DEG C of incubation 20min to the reactant mixture through denaturation, renaturation.
(7) electrophoresis detection digestion products, the SLA-3 gene knockout effect of detection target sequence mediation.
DNA fragmentation through digestion is carried out electrophoretic analysis, 100V, 25min with 2% Ago-Gel.Determine purpose
The cutting situation of fragment, judges the gene knockout effect of target sequence.
Cutting identification to mutant DNA is based on following principle：SgRNA and Cas9 can be expressed through the cell of infection.Gene
If the Cas9 targeting proteins that group DNA is mediated by sgRNA cut, mutation can be introduced after repairing near cleavage site (wild
Raw type is changed into saltant type).Because wild type and mutant sequences mismatch in this position, the wild type going out as template amplification
The hybrid molecule that DNA is formed through refolding strategy with mutant DNA can just produce annular (loop) structure of local.And the latter is permissible
Identified and cut off by Cruiser enzyme, lead to hybrid DNA molecule to be cut into small fragment.
Result is as shown in figure 5, be not detected by small fragment without the PCR primer of the wild-type cell of virus infection；And sequence
Row 4, sequence 5 and sequence 12 can produce cutting by efficient targeting SLA-3 gene, the presence of small fragment is therefore detected, show sequence
Row 4, sequence 5 and sequence 12 can be used as the target sequences of CRISPR-Cas9 specific knockdown pig SLA-3 gene.
Embodiment five, SLA-3 gene knockout are monoclonal to be selected and identifies
1. monoclonal select (target sequence based on sequence 4, sequence 5 and sequence 12)
(1) the aim cell group of part infection is passed on, take 100 unicellular 10cm dish that are transferred to cultivate.
(2), after cultivating about 10 days, a considerable amount of monoclonals are had to grow into macroscopic level.
(3) use the independent clone of pipettor head scraping, cell is transferred to culture in 24 orifice plates, corresponding one gram of each hole
Grand.
(4) again after the culture of about a week, there is part clone long to enough quantity, go to further identification.
2. the monoclonal SLA-3 of identification knocks out situation
(1) collect monoclonal to be checked and wild-type cell, extract genomic DNA respectively.
(2) according to preceding method, the SLA-3 genetic fragment of amplification monoclonal and wild-type cell respectively, the base being expanded
Because fragment comprises sgRNA target sequence.
(3) the monoclonal PCR fragment of equivalent is mixed with wild type PCR fragment, heat denatured, renaturation, form hybrid dna
Molecule.
(4) hybrid dna after the annealing of Cruiser cleavage, 45 DEG C of incubation 20min are used.
(5) electrophoresis detection digestion products, according to whether there is cutting fragment to determine whether monoclonal occurs effectively to be mutated.
Result shows, the lentiCRISPR v2-SLA-3 vacation type slow-virus infection mesh based on the target sequence shown in sequence 4
Cell, 20 monoclonals selected at random from 100 unicellular through Cruiser enzyme restriction enzyme digestion and electrophoresis detect, wherein have 17
Monoclonal can detect cutting small fragment, shows that gene knockout occurs, gene knockout efficiency can reach more than 85%, sequence is described
Target sequence shown in row 4 has the effect of very high targeting knock out SLA-3 gene.Based on the target sequence shown in sequence 5
LentiCRISPR v2-SLA-3 vacation type slow-virus infection aim cell, 20 Dan Ke selecting at random from 100 are unicellular
Grand through Cruiser enzyme restriction enzyme digestion and electrophoresis detection, wherein have 19 monoclonals cutting small fragment can be detected, show that gene knockout is sent out
Raw, gene knockout efficiency can reach more than 95%, illustrate that the target sequence shown in sequence 5 has very high targeting knock out SLA-3
The effect of gene.LentiCRISPR v2-SLA-3 vacation type slow-virus infection purpose based on the target sequence shown in sequence 12 is thin
Born of the same parents, 20 monoclonals selected at random from 100 unicellular detect wherein there are 18 Dan Ke through Cruiser enzyme restriction enzyme digestion and electrophoresis
Grand cutting small fragment can be detected, show that gene knockout occurs, gene knockout efficiency can reach more than 90%, sequence 12 is described
Shown target sequence has the effect of very high targeting knock out SLA-3 gene.
Above content is to further describe it is impossible to assert this with reference to specific embodiment is made for the present invention
Bright it is embodied as being confined to these explanations.For general technical staff of the technical field of the invention, do not taking off
On the premise of present inventive concept, some simple deduction or replace can also be made.
Claims (10)
1. it is used for the sgRNA of selectively targeted SLA-3 gene in CRISPR-Cas9 specific knockdown pig SLA-3 gene, it is special
Levy and be：
（1）Target sequence on SLA-3 gene for the described sgRNA meets the series arrangement rule of 5 '-N (20) NGG-3 ', wherein N
(20) 20 continuous bases are represented, wherein each N represents A or T or C or G, and legal target sequence may be located at positive-sense strand
Or antisense strand；
（2）Target sequence on SLA-3 gene for the described sgRNA is located at 5 exons coding districts of the N-terminal of SLA-3 gene, or sequence
The major part of row is located at 5 extrons of the N-terminal of SLA-3 gene, and remainder crosses over the boundary with adjacent intron, is located at
Adjacent intron；
（3）Target sequence on SLA-3 gene for the described sgRNA is unique.
2. the sgRNA for selectively targeted SLA-3 gene according to claim 1 is it is characterised in that described target sequence
It is classified as SEQ ID NO in sequence table：Sequence shown in any bar sequence in 1 ~ 115.
3. the sgRNA for selectively targeted SLA-3 gene according to claim 1 is it is characterised in that described target sequence
It is classified as SEQ ID NO in sequence table：4th, the sequence shown in 5 or 12.
4. the method for CRISPR-Cas9 specific knockdown pig SLA-3 gene is it is characterised in that methods described includes walking as follows
Suddenly：
（1）The 5 ' of the target sequence of the sgRNA described in any one of claim 1-3-end adds for forming the sequence of cohesive end
Row, synthesis obtains positive oligonucleotide sequence；The corresponding complementation of target sequence of the sgRNA described in any one of claim 1-3
The two ends of sequence add the suitable sequence for forming cohesive end, and synthesis obtains reverse oligonucleotide sequence；By synthesis
Described forward direction oligonucleotide sequence and reverse oligonucleotide sequence anneals, renaturation, form the double-strand oligomerization core with cohesive end
Thuja acid；
（2）Described double stranded oligonucleotide is connected into the linearizing expression vector carrying Cas9 gene, obtains carrying containing corresponding
The sgRNA oligonucleotide of target sequence and the expression vector of Cas9 gene, transformed competence colibacillus bacterium, Screening and Identification goes out correct sun
Property clone, and described positive colony is shaken bacterium, extract plasmid；
（3）With described expression vector, packaging plasmid and the package cell line bag carrying sgRNA oligonucleotide and Cas9 gene
Take on the false type slow virus of sgRNA and Cas9 simultaneously carrying targeting SLA-3 gene；
（4）Using described vacation type slow-virus infection aim cell, and cultivate further；Then collect infected aim cell,
Comprise the genetic fragment of described target sequence with its genomic DNA for template amplification, through denaturation, renaturation and digestion, determine SLA-3
The knockout situation of gene.
5. CRISPR-Cas9 specific knockdown pig SLA-3 gene according to claim 4 method it is characterised in that
Described expression vector is SEQ ID NO in sequence table：The carrier of sequence shown in 116.
6. the method for the CRISPR-Cas9 specific knockdown pig SLA-3 gene according to claim 4 or 5, its feature exists
In methods described comprises the steps：
（1）The 5 ' of the target sequence of the sgRNA described in any one of claim 1-3-end adds CACCG sequence, and synthesis just obtains
To oligonucleotide sequence；The 5 ' of the corresponding complementary series of target sequence of the sgRNA described in any one of claim 1-3-end adds
Upper AAAC sequence, 3 '-end add C, and synthesis obtains reverse oligonucleotide sequence；By synthesis described forward direction oligonucleotide sequence with
Reverse oligonucleotide sequence anneals, renaturation, form the double stranded oligonucleotide with cohesive end；
（2）Described double stranded oligonucleotide is connected into as SEQ ID NO in sequence table：The expression vector of sequence shown in 116
The linearized vector that lentiCRISPR v2 obtains through BsmB I digestion with restriction enzyme, obtains carrying sgRNA oligonucleotides
The recombinant expression carrier lentiCRISPR v2- SLA-3 of acid, transformed competence colibacillus bacterium, Screening and Identification goes out correctly positive gram
Grand, and described positive colony is shaken with bacterium, extracts plasmid；
（3）Packed out and carried simultaneously with described expression vector lentiCRISPR v2- SLA-3, packaging plasmid and package cell line
The false type slow virus of sgRNA and Cas9 of targeting SLA-3 gene；
（4）Using described vacation type slow-virus infection aim cell, and cultivate further；Then collect infected aim cell,
Comprise the genetic fragment of described target sequence with its genomic DNA for template amplification, through denaturation, renaturation and digestion, determine SLA-3
The knockout situation of gene.
7. the method for CRISPR-Cas9 specific knockdown pig SLA-3 gene according to claim 6 is it is characterised in that institute
Stating packaging plasmid is plasmid pLP1, plasmid pLP2 and plasmid pLP/VSVG；Described package cell line is HEK293T cell.
8. the method for CRISPR-Cas9 specific knockdown pig SLA-3 gene according to claim 6 is it is characterised in that institute
Stating aim cell is pig PIEC cell；
The described genetic fragment comprising described target sequence with its genomic DNA for template amplification, through denaturation, renaturation and digestion,
Determine the knockout situation of SLA-3 gene, specially：
（a）With the genomic DNA of the aim cell of infection virus as template, comprised with the upstream and downstream primer amplification of SLA-3 gene
The SLA-3 genetic fragment of the target sequence of described sgRNA, expands the base of the wild-type cell of uninfecting virus simultaneously with same primers
Because organizing DNA；
（b）Purify the SLA-3 genetic fragment that above-mentioned amplification is arrived, then the SLA-3 gene of the aim cell of self-infection in future virus
Fragment and the SLA-3 genetic fragment mixed in equal amounts from wild-type cell, heat denatured, renaturation, form hybrid DNA molecule；
（c）With the hybrid DNA molecule after Cruiser cleavage renaturation；
（d）Electrophoresis detection digestion products, the SLA-3 gene knockout effect of detection target sequence mediation.
9. the recombinant expression carrier used in the method for CRISPR-Cas9 specific knockdown pig SLA-3 gene
LentiCRISPR v2- SLA-3 is it is characterised in that the sequence of the skeleton carrier of described recombinant expression carrier is as in sequence table
SEQ ID NO：Shown in 116；The target sequence of sgRNA as described in any one of claim 1-3 for the entrained target sequence, preferably sequence
SEQ ID NO in list：4th, the target sequence shown in 5 or 12.
10. the sgRNA as described in any one of claim 1-3 or the recombinant expression carrier as described in claim 9
Purposes in the method for CRISPR-Cas9 specific knockdown pig SLA-3 gene for the lentiCRISPR v2- SLA-3.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2015/081229 WO2016197357A1 (en) | 2015-06-11 | 2015-06-11 | Method for specific knockout of swine sla-3 gene using crispr-cas9 specificity, and sgrna used for specifically targeting sla-3 gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106414740A true CN106414740A (en) | 2017-02-15 |
Family
ID=57502928
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201580000474.9A Pending CN106414740A (en) | 2015-06-11 | 2015-06-11 | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106414740A (en) |
| WO (1) | WO2016197357A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108373997A (en) * | 2018-02-08 | 2018-08-07 | 西北农林科技大学 | A kind of porcine somatic cell and its preparation method and application of pMKRN1 gene knockouts |
| CN109280643A (en) * | 2018-09-30 | 2019-01-29 | 北京鼎成肽源生物技术有限公司 | A kind of RFFT cell |
| CN110172505A (en) * | 2019-04-23 | 2019-08-27 | 中国农业大学 | Application of the TRIM33 gene as PRRSV infection correlation factor |
| CN111041027A (en) * | 2019-12-19 | 2020-04-21 | 广东省农业科学院动物卫生研究所 | Construction method and application of Atg12 gene knockout cell line |
Families Citing this family (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| EP3177718B1 (en) | 2014-07-30 | 2022-03-16 | President and Fellows of Harvard College | Cas9 proteins including ligand-dependent inteins |
| EP3365356B1 (en) | 2015-10-23 | 2023-06-28 | President and Fellows of Harvard College | Nucleobase editors and uses thereof |
| GB2568182A (en) | 2016-08-03 | 2019-05-08 | Harvard College | Adenosine nucleobase editors and uses thereof |
| AU2017308889B2 (en) | 2016-08-09 | 2023-11-09 | President And Fellows Of Harvard College | Programmable Cas9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR102622411B1 (en) | 2016-10-14 | 2024-01-10 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | AAV delivery of nucleobase editor |
| WO2018119359A1 (en) | 2016-12-23 | 2018-06-28 | President And Fellows Of Harvard College | Editing of ccr5 receptor gene to protect against hiv infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| WO2018165629A1 (en) | 2017-03-10 | 2018-09-13 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| EP3601562A1 (en) | 2017-03-23 | 2020-02-05 | President and Fellows of Harvard College | Nucleobase editors comprising nucleic acid programmable dna binding proteins |
| WO2018209320A1 (en) | 2017-05-12 | 2018-11-15 | President And Fellows Of Harvard College | Aptazyme-embedded guide rnas for use with crispr-cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| EP3676376A2 (en) | 2017-08-30 | 2020-07-08 | President and Fellows of Harvard College | High efficiency base editors comprising gam |
| KR20200121782A (en) | 2017-10-16 | 2020-10-26 | 더 브로드 인스티튜트, 인코퍼레이티드 | Uses of adenosine base editor |
| BR112021018606A2 (en) | 2019-03-19 | 2021-11-23 | Harvard College | Methods and compositions for editing nucleotide sequences |
| DE112021002672T5 (en) | 2020-05-08 | 2023-04-13 | President And Fellows Of Harvard College | METHODS AND COMPOSITIONS FOR EDIT BOTH STRANDS SIMULTANEOUSLY OF A DOUBLE STRANDED NUCLEOTIDE TARGET SEQUENCE |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104480144A (en) * | 2014-12-12 | 2015-04-01 | 武汉大学 | CRISPR/Cas9 recombinant lentiviral vector for human immunodeficiency virus gene therapy and lentivirus of CRISPR/Cas9 recombinant lentiviral vector |
| CN105567738A (en) * | 2016-01-18 | 2016-05-11 | 南开大学 | Method for inducing CCR5-delta32 deletion with genome editing technology CRISPR-Cas9 |
-
2015
- 2015-06-11 CN CN201580000474.9A patent/CN106414740A/en active Pending
- 2015-06-11 WO PCT/CN2015/081229 patent/WO2016197357A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104480144A (en) * | 2014-12-12 | 2015-04-01 | 武汉大学 | CRISPR/Cas9 recombinant lentiviral vector for human immunodeficiency virus gene therapy and lentivirus of CRISPR/Cas9 recombinant lentiviral vector |
| CN105567738A (en) * | 2016-01-18 | 2016-05-11 | 南开大学 | Method for inducing CCR5-delta32 deletion with genome editing technology CRISPR-Cas9 |
Non-Patent Citations (1)
| Title |
|---|
| REYES LM等: "Creating Class I MHC Null Pigs Using gRNA and the Cas9 Endonuclease", 《J IMMUNOL》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108373997A (en) * | 2018-02-08 | 2018-08-07 | 西北农林科技大学 | A kind of porcine somatic cell and its preparation method and application of pMKRN1 gene knockouts |
| CN108373997B (en) * | 2018-02-08 | 2020-10-27 | 西北农林科技大学 | pMKRN1 gene knockout pig somatic cell and preparation method and application thereof |
| CN109280643A (en) * | 2018-09-30 | 2019-01-29 | 北京鼎成肽源生物技术有限公司 | A kind of RFFT cell |
| CN109280643B (en) * | 2018-09-30 | 2020-11-06 | 北京鼎成肽源生物技术有限公司 | RFFT cell |
| CN110172505A (en) * | 2019-04-23 | 2019-08-27 | 中国农业大学 | Application of the TRIM33 gene as PRRSV infection correlation factor |
| CN111041027A (en) * | 2019-12-19 | 2020-04-21 | 广东省农业科学院动物卫生研究所 | Construction method and application of Atg12 gene knockout cell line |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2016197357A1 (en) | 2016-12-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106414740A (en) | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene | |
| CN105492609A (en) | Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene | |
| CN105518134A (en) | Method for pig SLA-2 gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting SLA-2 gene | |
| CN105518139A (en) | Method for knocking out pig FGL2 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting FGL2 genes | |
| CN105518135A (en) | Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene | |
| CN105593367A (en) | CRISPR-Cas9 specificity pig SLA-1 gene knockout method and sgRNA used for specific targeting SLA-1 gene | |
| CN105518137A (en) | Method for specifically removing pig SALL1 gene by CRISPR-Cas9 and sgRNA used for specific targeting SALL1 gene | |
| CN105492608B (en) | Method for specifically knocking out pig PDX1 gene by CRISPR-Cas9 and sgRNA for specifically targeting PDX1 gene | |
| CN105518138A (en) | Method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting GFRA1 genes | |
| CN105518140A (en) | Method for pig vWF gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting vWF gene | |
| CN106047877B (en) | A kind of sgRNA and CRISPR/Cas9 slow virus system of targeting knockout FTO gene and application | |
| Becker | Cancer a Comprehensive Treatise 2: Etiology: Viral Carcinogenesis | |
| WO2016187904A1 (en) | Method for pig cmah gene specific knockout by means of crispr-cas9 and sgrna for specially targeting cmah gene | |
| CN106244557B (en) | The method of rite-directed mutagenesis ApoE gene and LDLR gene | |
| CN108795902A (en) | A kind of safe and efficient CRISPR/Cas9 gene editings technology | |
| CN105907758A (en) | CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-Cas9) homing sequences and primers thereof, and transgenic expression vector and establishment method thereof | |
| CN106755091A (en) | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods | |
| WO2017124652A1 (en) | Method for inducing ccr5-delta32 defect by using crispr-cas9 genome editing technology | |
| CN107502608A (en) | Construction method and application for sgRNA, ALDH2 gene delection cell line for knocking out people's ALDH2 genes | |
| CN107630018A (en) | A kind of kit for being used to editing or repairing HBB gene | |
| CN107893076A (en) | CRISPR Cas9 targeting knock outs human breast cancer cell RASSF2 genes and its specific sgRNA | |
| CN107794272A (en) | A kind of CRISPR genome editor's systems of high specific | |
| CN111849979B (en) | sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line | |
| CN105950656A (en) | Method for rapidly obtaining gene knockout cell strains | |
| CN108148866A (en) | A kind of HCBP6 Knockout cells system and its construction method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170215 |