CN105602987A - High-efficiency knockout method for XBP1 gene in DC cell - Google Patents
High-efficiency knockout method for XBP1 gene in DC cell Download PDFInfo
- Publication number
- CN105602987A CN105602987A CN201510814335.1A CN201510814335A CN105602987A CN 105602987 A CN105602987 A CN 105602987A CN 201510814335 A CN201510814335 A CN 201510814335A CN 105602987 A CN105602987 A CN 105602987A
- Authority
- CN
- China
- Prior art keywords
- cell
- xbp1
- gene
- pcas9
- gene knockout
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a high-efficiency knockout method for the XBP1 gene in a DC cell. The high-efficiency knockout method for the XBP1 gene in the DC cell comprises the following steps: designing of a gene knockout target and oligonucleotide; annealing of oligonucleotide; enzyme digestion of a linearized vector; connection and reaction of the linearized vector with double-strand oligonucleotide; transformation of competent cells and knockout of the XBP1 gene in the DC cell; etc. According to the invention, the knockout method provided by the invention employs an improved CRISPR/pCas9 gene knockout system, uses the XBP1 as a target gene for designing of a CRISPR targeting sequence and preparation of pCas9/gRNA1-XBP1 plasmid and further allows the plasmid to transfect the DC cell under the treatment action of an L189 drug; thus, the XBP1 gene in the DC cell can be effectively knocked out, the immunostimulation effect of the DC cells can be effectively guaranteed, and antineoplastic immunization effect of the DC cell is given to effective play.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of DC cell XBP1 gene knockout method efficiently.
Background technology
BMDC (DendriticCell, DC) is for exciting and maintain the anti tumor immune response that T cell relies onMost important. But, thereby tumour can be by weakening the lethal effect of DC cell function escape from immune system. There are some researches show DCThe activation of intracellular endoplasmic reticulum pressure experience factor XBP1 causes DC cell antineoplastic immune activity decreased, finally causes tumourProgress. XBP1 can regulate and control the intracellular lipid-metabolism of DC, and the byproduct of peroxidatic reaction of lipid can excite DC cell interior threeThe biosynthesis reaction of acyl glycerine, causes abnormal lipid accumulation, finally suppresses the function of DC, can not effectively inspire antitumorActive T cell. Therefore,, if can effectively suppress the expression of XBP1 gene in DC cell, will provide for the targeted therapy of tumourThe approach of effect.
The expression that suppresses at present XBP1 gene in DC cell is to adopt traditional siRNA method to suppress XBP1 gene, butBe to suppress about 50% XBP1 gene expression, suppression efficiency is lower. Therefore, if can find a kind of new inhibition DC thinIn born of the same parents, XBP1 gene expression method will have important biology and medical significance.
Summary of the invention
The object of the invention is to overcome the above-mentioned deficiency of prior art, knocking out of XBP1 gene in a kind of DC cell is providedMethod, is intended to solve in DC cell due to the existence of XBP1 gene and is activated and cause DC cell antineoplastic immune activity decreasedUnfavorable phenomenon.
In order to realize foregoing invention object, the invention provides a kind of DC cell XBP1 gene knockout method. The present invention is realExecuting routine DC cell XBP1 gene knockout method comprises the steps:
Carry out CRISPR target sequences Design taking endoplasmic reticulum pressure experience factor XBP1 as target gene, and according to describedCRISPR target sequences Design forward oligonucleotide sequence and reverse oligonucleotide sequence;
Described forward oligonucleotide sequence and reverse oligonucleotide sequence are carried out to the double-stranded few core of annealing reaction processing formationThuja acid;
Enzyme is cut pCas9/gRNA1 carrier and is obtained linearized vector;
Described double chain oligonucleotide and described linearized vector are carried out to coupled reaction processing in coupled reaction system, obtainMust connect product;
By described connection product transformed competence colibacillus cell, and after being expanded to cultivation, the cell after being converted carries out plasmidExtraction process, obtains pCas9/gRNA1-XBP1 plasmid;
Compared with prior art, DC cell XBP1 gene knockout method of the present invention adopts CRISPR/pCas9 gene knockout systemSystem, carries out CRISPR target sequences Design and prepares pCas9/gRNA1-XBP1 plasmid taking XBP1 as target gene, make it to DCCell carries out transfection, thereby can knock out efficiently the intracellular XBP1 gene of DC, thereby has effectively ensured the immunity thorn of DC cellSwash effect, effectively brought into play DC cell antitumor immune function.
Further, by also add L189 reagent in transfection cultivating system, this L189 reagent can with CRISPR/PCas9 gene knockout system performance synergistic effect, has significantly improved effective CRISPR/pCas9 gene knockout system that improved and has struckExcept the efficiency of XBP1 gene.
Brief description of the drawings
Fig. 1 is for improving CRISPR/Cas9 systemic effect principle schematic;
Fig. 2 is pCAS9/gRNA1 plasmid vector collection of illustrative plates;
Fig. 3 is the expression of XBP1 gene in NC-DC, XBP1-DC and tri-groups of DC cells of XBP1/L189-DC in embodiment 2,3Horizontal block diagram;
Fig. 4 is that NC-DC-T, XBP1-DC-T and tri-kinds of DC-T cells of XBP1/L189-DC-T are to RB retinoblastomaThe killing-efficiency figure of cell.
Detailed description of the invention
In order to make object of the present invention, technical scheme and advantage clearer, below in conjunction with drawings and Examples, rightThe present invention is described in further detail. Should be appreciated that specific embodiment described herein is only in order to explain the present invention, noBe used for limiting the present invention.
The embodiment of the present invention provides a kind of efficient DC cell XBP1 gene knockout method. In one embodiment, thisInventive embodiments DC cell XBP1 gene knockout method comprises the steps:
Step S01. gene knockout target spot and oligonucleotide design: enter taking endoplasmic reticulum pressure experience factor XBP1 as target geneRow CRISPR target sequences Design, and according to described CRISPR target sequences Design forward oligonucleotide sequence and reverse few nucleosidesAcid sequence;
Step S02. oligonucleotides annealing reaction processing: by described forward oligonucleotide sequence and reverse oligonucleotide sequenceCarry out annealing reaction and process formation double chain oligonucleotide;
Step S03. linearization for enzyme restriction carrier: enzyme is cut pCas9/gRNA1 carrier and obtained linearized vector;
Step S04. linearized vector and double chain oligonucleotide coupled reaction: by few the two strands obtaining in step S02 nucleosidesThe described linearized vector obtaining in acid and step S03 carries out coupled reaction processing in coupled reaction system, obtains to connect to produceThing;
Step S05. transformed competence colibacillus cell: by the described connection product transformed competence colibacillus cell obtaining in step S04, andAfter cell after being converted is expanded to cultivation, carry out plasmid extraction processing, obtain pCas9/gRNA1-XBP1 plasmid;
Step S06.DC cell XBP1 gene knockout: described pCas9/gRNA1-XBP1 plasmid is carried out to transfection to DC cellCultivate and process.
Particularly, the CRISPR target sequences Design in above-mentioned steps S01 is with based on CRISPR/pCas9 gene knockoutSystem.
Wherein, the CRISPR in this CRISPR/pCas9 gene knockout system refers to the short palindrome weight in interval of rule clusterMultiple (Clusteredregularlyinterspacedshortpalindromicrepeats). CRISPR/Cas beA kind of natural immune system of finding in most of bacteriums and archeobacteria, can be used to virus and foreign DNA that antagonism is invaded.First CRISPR/Cas system produces the RNA sequence corresponding with target sequence, carries out complementation with the DNA of virus or plasmid,Then guide Cas restriction endonuclease to carry out two strands cutting to complementary sequence. Wherein the Cas9 in Cas gene family is widely used inIn this system, it is a kind of naturally occurring restriction endonuclease, has two enzymes and cuts active structure domain: HNH nuclease domain andRuv-Clike domain, cuts respectively complementary strand and incomplementarity chain. Cutting process needs the help of two other RNA, is respectivelyCRISPRRNA (crRNA) and trans CRISPRRNA (trans-actingCRISPRRNA, tracrRNA), peopleThese two kinds of RNA transformations are fused into a guide RNA (single-guideRNA, sgRNA), and single sgRNA is enough to helpCas9 realizes the effect of fixed point cutting.
Generally be divided into two kinds through engineered CRISPR/Cas system, one mainly by Cas9, tracrRNA andCrRNA tri-parts form; Another kind is mainly made up of Cas9 and sgRNA two parts. The building process of carrier is simple and efficient, only needsArtificial synthetic one section of sequence identical with target sequence, is connected to carrier specific site, has the high efficiency spy of high fluxPoint.
As shown in Figure 1, its platform is from streptococcus pyogenes (Streptococcus to CRISPR/Cas9 systemic effect principlePyogenes) II type CRISPR system optimization, is made up of SpCas9 nuclease and gRNA. Wherein SpCas9 nuclease is knownPAM (Protospaceradjacentmotif, PAM) sequence in other genome, the guiding order that is about 20bp in gRNARow determine targeting specific. When being arranged in the precursor intervening sequence (Protospacer) of PAM5' end and drawing of gRNA on genomeWhile leading sequence complementation, the startup of Cas9 nuclease is cut DNA double chain, forms DNA double chain fracture breach (Double-strandbreaks,DSBs)。
DSBs can the interior non-homologous end joining (Non-homologousendjoining, NHEJ) of active cell and homologyRestructuring (Homologydirectedrepair, HDR) two kinds of DNA repair mechanisms. NHEJ repair process can be introduced baseRadom insertion or disappearance (Insertionordeletion); And in the situation that From Template exists outside, cell also can lead toCrossing the mode of HDR accurately repairs genome. The frequency ratio NHEJ that HDR occurs in cell is low, only betides cell divisionS phase and G2 phase, and NHEJ betides the whole cell cycle. HDR and NHEJ exist in cell simultaneously, but exist and lack at NHEJIn sunken cell, HDR occurrence frequency is higher, therefore suppresses NHEJ and can improve the occurrence frequency of HDR.
The approach that NHEJ comprises two types: (1) DNA ligase IV dependence NHEJ (classical NHEJ, C-NHEJ) approach,Being mainly used in end connects; (2) selective N HEJ (alt-NHEJ/A-NHEJ/A-EJ) approach, needs DNA ligase I/III,When C-NHEJ approach disappearance, can bring out.
Therefore, the target spot of CRISPR/Cas9 gene knockout system is made up of 19 bases. It before target spot, is transcription initiation letterNumber G is PAM sequence NGG after target spot. The sequence that can be used as like this target spot is GN20GG. Based on this, in above-mentioned steps S01, beTaking endoplasmic reticulum pressure experience factor XBP1 as target gene, by online software (http://crispr.mit.edu) for XBP1Gene carries out CRISPR target sequences Design and the site estimation that misses the target. So according to the few nucleosides of described CRISPR target sequences DesignAcid sequence.
In one embodiment, this crosses the final CRISPR target sequence of selecting of comprehensive analysis as in following SEQIDNO:1Shown in underscore:
“...CGGTGCGCGGTGCGTAGTCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACGGGACCCCTAAAGTTCTGCTTCTGTCGGGGCAGCCCGCCTCCGCCGCCGGAGCCCCGGCCGGCCAGGCCCTGCCGCTCATGGTGCCAGCCCAGAGAGGGGC...”(SEQIDNO：1)
In further embodiment, comprise the few core of forward according to the oligonucleotide sequence of described CRISPR target sequences DesignNucleotide sequence and reverse oligonucleotide sequence, in one embodiment, described forward oligonucleotide sequence is as following SEQIDShown in NO:2:
5’GAAACACCGCCGCGCCGAACCCGGCCGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT3’(SEQIDNO：2)
Reverse oligonucleotide sequence is as shown in following SEQIDNO:3:
5’AACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTCGGCCGGGTTCGGCGCGGCGGTGTTTC3’(SEQIDNO：3)
Annealing reaction processing in above-mentioned steps S02 is carried out in annealing reaction system, in this process, and stepThe forward oligonucleotide sequence designing in S01 and reverse oligonucleotide sequence form double-stranded few nucleosides in this annealing reaction systemAcid.
In one embodiment, this annealing reaction system is except comprising forward oligonucleotide sequence mentioned above and reverse few coreOutside nucleotide sequence, also comprise NaCl and Tris-Cl reagent, in specific embodiment, this annealing reaction system is as below implementedReagent shown in table 1 in example 1. In further embodiment, the program of this annealing reaction is: 90 DEG C of 4min, and 70 DEG C of 10min,55 DEG C of 10min, 40 DEG C of 10min, 25 DEG C of 10min. By the control to annealing reaction system and condition, can effectively improve annealing insteadAnswer efficiency.
In one embodiment, the enzyme that in above-mentioned steps S03, enzyme is cut pCas9/gRNA1 carrier selects EcoRV. Wherein, pCas9/As shown in Figure 2, this EcoRV carries out enzyme at the restriction enzyme site shown in Fig. 2 and cuts the collection of illustrative plates of gRNA1 carrier, and enzyme is cut rear solidifying with agaroseGlue reclaims linearized vector.
In one embodiment, the coupled reaction system in above-mentioned steps S04 is except comprising the few nucleosides of two strands mentioned aboveOutside acid and linearized vector, also comprise T4DNA ligase, EcoRV, ligase Buffer, PEG4000 reagent, in concrete realityExecute in example the reagent of this coupled reaction system as shown in table 2 in embodiment 1 below. In further embodiment, this connection is anti-The condition of answering is: 22 DEG C of 30min, 37 DEG C of 15min. By the control to coupled reaction system and condition, can effectively improve connectionReaction efficiency.
In above-mentioned steps S05, competent cell can be the conventional competent cell in this area, in one embodiment,This competent cell can be bacillus coli DH 5 alpha competent cell. Bacillus coli DH 5 alpha competent cell after being converted is existedOn the agar plate of ammonia benzyl resistance, cultivate after conversion for 37 DEG C, approximately within 14-16 hour, on rear plate, occur single bacterial clump. PickingMultiple bacterium colonies are cultivated laggard performing PCR qualification to the culture medium of ammonia benzyl resistance, and screening positive cell expands cultivation, then obtainsGet plasmid, now, this plasmid is pCas9/gRNA1-XBP1 plasmid.
The transfection of above-mentioned steps S06 is cultivated in the step of processing, and the DC cell after transfected is at pCas9/gRNA1-XBP1Under the effect of plasmid, the XBP1 gene in DC cell is knocked.
In order to improve transfection efficiency, in one embodiment, in transfection process, in rotaring redyeing system, also add L189 reagent.In further embodiment, the concentration of the L189 reagent adding in described transfection cultivating system is 0.1 μ M-10 μ M. To transfectionIn cultivating system, add after L189 reagent, this L189 can targeting in the DNA of DNA ligase I, III and IV in conjunction with territory, reduceThe affinity of these three kinds of DNA ligases and DSBs, thus its function suppressed. Therefore, L189 and CRISPR/Cas9 system are total toWith turning the occurrence frequency that can strengthen by hindering NHEJ HDR into cell, greatly improve the accuracy of gene editing, thereby improveXBP1 gene in DC cell is knocked rate. Concentration by further control L189 in rotaring redyeing system, to realize furtherThe XBP1 gene improving in DC cell is knocked rate.
Above-mentioned L189 reagent (another name: 6-Amino-2,3-dihydro-5-[(phenylmethylene) amino]-2-4(1H)-pyrimidineone) molecular structural formula is following structural formula A.
In each embodiment of above-mentioned DC cell XBP1 gene knockout method, in one embodiment, control in rotaring redyeing systemIt is 10-20 μ g/ml that pCas9/gRNA1-XBP1 plasmid adds the concentration of DC cell. By optimizing pCas9/gRNA1-XBP1 plasmidConcentration, improve transfection efficiency to DC cell to realize.
In another embodiment, the rotaring redyeing system in the various embodiments described above comprises Polyfect-V transfection reagent 4.8ul,Alys505 culture medium.
Therefore, the invention described above embodiment DC cell XBP1 gene knockout method adopts CRISPR/pCas9 gene knockout systemSystem, utilize pCas9/gRNA1-XBP1 plasmid of the present invention to carry out transfection to DC cell, thereby it is intracellular to knock out efficiently DCXBP1 gene, thus the immunostimulation of DC cell effectively ensured, effectively bring into play DC cell antitumor immune function. ExcellentChoosing to by also add L189 reagent in transfection cultivating system, this L189 reagent can with CRISPR/pCas9 gene knockoutSystem performance synergistic effect, has significantly improved effective effect that has improved CRISPR/pCas9 gene knockout system and knock out XBP1 geneRate.
Now taking concrete pCas9/gRNA1-XBP1 plasmid and preparation method thereof and DC cell XBP1 gene knockout method asExample, is described in further details the present invention.
Embodiment 1
The embodiment of the present invention 1 provides a kind of DC cell XBP1 gene knockout method, comprises the steps:
S11. gene knockout target spot and oligonucleotide design
Taking endoplasmic reticulum pressure experience factor XBP1 as target gene, by online software (http://crispr.mit.edu)Carry out CRISPR target sequences Design and the site estimation that misses the target for XBP1 gene. Through the comprehensive target order of analyzing final selectionRow are as shown in underscore.
“...CGGTGCGCGGTGCGTAGTCTGGAGCTATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACGGGACCCCTAAAGTTCTGCTTCTGTCGGGGCAGCCCGCCTCCGCCGCCGGAGCCCCGGCCGGCCAGGCCCTGCCGCTCATGGTGCCAGCCCAGAGAGGGGC...”(SEQIDNO：1)
The insertion oligonucleotide sequence of design is as follows:
Forward oligonucleotide sequence is:
5’GAAACACCGCCGCGCCGAACCCGGCCGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT3’
Reverse oligonucleotide sequence is:
5’AACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTCGGCCGGGTTCGGCGCGGCGGTGTTTC3’
S12.pCas9/gRNA1 gene knockout carrier connects and qualification
The annealing of S121 oligonucleotides
Water is 100 μ M by the oligonucleotides dilution of step S11 design. Anti-by the system preparation annealing shown in following table 1Answer system:
Table 1
| Positive MODN (100 μ M) | 5μl |
| ASON (100 μ M) | 5μl |
| NaCl | 100mM |
| Tris-Cl pH7.4 | 50mM 5 --> |
| Add water and supply | 50μl |
The annealing reaction buffer solution preparing is repeated to mix, of short durationly puts to PCR instrument after centrifugal, move following program:90 DEG C of 4min, 70 DEG C of 10min, 55 DEG C of 10min, 40 DEG C of 10min, 25 DEG C of 10min. Oligonucleotides after annealing can use at onceOr preserve at-20 DEG C long-term.
S122 linearization for enzyme restriction carrier
Cut 2 μ gpCas9/gRNA1 carriers (concrete collection of illustrative plates see accompanying drawing 1) with EcoRV enzyme. Enzyme is cut and is returned with Ago-Gel afterwardsReceive linearized vector. By reclaim after linearized vector quantitatively to concentration be 500ng/ μ l.
S123 connects
Water is by for subsequent use 100 times of double chain oligonucleotide (10 μ M) dilutions after step S121 annealing. According to shown in following table 2System preparation coupled reaction system:
Table 2
| T4 DNA ligase | 5U |
| EcoRV | 5U |
| Linearized vector | 2μl |
| Double chain oligonucleotide after diluting 100 times | 1μl |
| 10 × ligase Buffer | 1μl |
| 50％PEG4000 | 1μl |
| Add water and supply | 10μl |
Reaction condition: 22 DEG C of 30min, 37 DEG C of 15min.
S124 transformed competence colibacillus cell and PCR qualification positive colony
Connect afterproduct with step S123 and transform bacillus coli DH 5 alpha competent cell. On the agar plate of ammonia benzyl resistanceCultivate for 37 DEG C and transform rear bacterium, approximately, after 14-16 hour, on flat board, occur single bacterial clump. The multiple bacterium colonies of picking are to ammonia benzylIn the culture medium of resistance, cultivate laggard performing PCR qualification.
Qualification primer:
gRNA-FGACTATCATATGCTTACCGTAACT
gRNA-RCAAGTTGATAACGGACTAGCCTTA
Positive colony identifies that product size is for 190bp, and negative clone is without band.
Positive colony correct qualification is expanded and cultivates the rear pCas9/gRNA1-XBP1 of extraction plasmid, turn for follow-up cellDye.
S13.DC cell is cultivated
S131 extracts healthy volunteer's peripheral blood 50ml, anticoagulant heparin, room temperature centrifugal (700g, 20min); Draw upper strata bloodSlurry, is placed in 56 DEG C of water-baths, 30min; Then after 4 DEG C of standing 15min, centrifugal (900g, 30min), gets 4 DEG C of guarantors of autologous plasmaDeposit for subsequent use;
S132 gets above-mentioned 700g, and the centrifugal rear lower cell component of 20min, adds D-PBS to 50ml, mixes, and is slowly added to 2Room temperature centrifugal (800g, 15min) is housed in the 50ml centrifuge tube of 20ml human lymphocyte parting liquid;
S133 draws tunica albuginea confluent monolayer cells, joins in the 50ml centrifuge tube that 5mlRPMI1640 is housed;
It is 50ml to cumulative volume that S134 adds RPMI1640, and centrifugal (600g, 10min), abandons supernatant;
S135 adds 50mlRPMI1640, and centrifugal (600g, 10min), abandons supernatant;
Alys-505 nutrient solution re-suspended cell containing 10% autologous plasma for S136, is distributed in six orifice plates 5 × 106/Ml, 2ml/ hole, is placed in saturated humidity, 37 DEG C, 5.0%CO2In incubator, cultivate 2h;
S137 washs and collects not adherent cell and carries out the cultivation of T cell. Retain attached cell in six orifice plates, add and containThe Alys-505 nutrient solution of 100ng/mlGM-CSF, 10ng/mlIL-4 and 10% autologous plasma, is placed in saturated humidity, 37℃、5.0％CO2In incubator, continue to cultivate;
S138Day3: half amount is changed liquid and supplemented fresh cell factor, is placed in saturated humidity, 37 DEG C, 5.0%CO2CultivateIn case, continue to cultivate;
S139Day5: collect DC cell, counting, PBS centrifuge washing cell (1500rpm × 10min), to contain 100ng/The Alys-505 nutrient solution re-suspended cell of mlGM-CSF, 10ng/mlIL-4 and 10% autologous plasma, is inoculated in respectively 6 orifice platesIn, 1 × 106Individual cells/well, 2ml/ hole; Establish altogether three groups.
S14.DC cell XBP1 gene knockout
The grouping situation of S141DC is as follows:
(1) negative control group; (NC-DC)
(2) pCas9/gRNA1-XBP1 group; (XBP1-DC)
(3) pCas9/gRNA1-XBP1+L189 group. (XBP1/L189-DC)
S142XBP1 gene knockout
(1) DC cultivates the 6th day, prepares plasmid dilution according to the system in following table 3. Wherein, shown in the group 2 in table 3PCas9/gRNA1-XBP1 be pCas9/gRNA1-XBP1 plasmid prepared by above-described embodiment 1.
Table 3
(2) prepare transfection reagent dilution: Polyfect-V transfection reagent 4.8ul, Alys505 culture medium 145.2ul.
(3) respectively plasmid dilution 50ul and transfection reagent dilution 50ul are fully mixed to incubated at room 15min.
After (4) 72 hours, detect the expression of XBP1 gene in two groups of DC cells.
Embodiment 2
The embodiment of the present invention 2 provides a kind of DC cell XBP1 gene knockout method. The method comprises the steps:
S21. gene knockout target spot and oligonucleotide design
Directly process according to S11 in embodiment 1.
S22.pCas9/gRNA1 gene knockout carrier connects and qualification
Directly process according to step S12 in embodiment 1.
S23.DC cell is cultivated
Directly process according to step S13 in embodiment 1.
S24.DC cell XBP1 gene knockout
The grouping situation of S241DC is as follows:
(1) negative control group; (NC-DC)
(3) pCas9/gRNA1-XBP1+L189 group. (XBP1/L189-DC)
S242XBP1 gene knockout
(1) DC cultivates the 6th day, prepares plasmid dilution according to the system in following table 4. Wherein, shown in the group 3 in table 4PCas9/gRNA1-XBP1 be pCas9/gRNA1-XBP1 plasmid prepared by the present embodiment 2 step S22.
Table 4
(2) prepare transfection reagent dilution: Polyfect-V transfection reagent 4.8ul, Alys505 culture medium 145.2ul.
(3) respectively plasmid dilution 50ul and transfection reagent dilution 50ul are fully mixed to incubated at room 15min.
(4) transfection liquid is added in the DC cell that is cultured to the 6th day, in XBP1/L189-DC group, add in addition 1uML189。
After (5) 72 hours, detect the expression of XBP1 gene in two groups of DC cells.
The detection of XBP1 gene expression dose in DC cell
DC after transfection by organizing 1 in above-described embodiment 1,2, in group 2 and group 3 carries out respectively XBP1 gene expression doseDetect, concrete grammar is as follows:
(1) RNA extracts
Collect respectively 1 × 106Three groups of DC cells after individual plasmid transfection, utilize RNA to extract kit (AurumTotalRNAMiniKit, BioRad, Cat.No.732-6820) extract intracellular total RNA.
(2) qRT-PCR detects XBP1-mRNA level
Utilize one-step method qRT-PCR kit (iScriptTMOne-StepRT-PCRKitWithGreen, Bio-Rad, Cat.No.170-8892) the total RNA extracting is carried out to the detection of XBP1 gene expression dose.
Reaction system is as shown in table 5 below:
Table 5
Reaction condition is as shown in table 6 below:
Table 6
(3) XBP1 gene knockout result
In three groups of DC cells the expression of XBP1 gene as shown in Figure 3, using XBP1 expression in NC-DC as 100%,The relative expression quantity of pCas9/gRNA1-XBP1 plasmid transfection group XBP1-DC is that 18.59%, pCas9/gRNA1-XBP1 plasmid turnsThe relative expression quantity of dye+L189 drug-treated group XBP1/L189-DC is 0.89%. Simple pCas9/gRNA1-XBP1 plasmid turnsDye and probably can knock out the XBP1 gene that exceedes 80% in DC cell. And after adding L189 to process, pCas9/gRNA1-XBP1 plasmidKnock out the efficiency of XBP1 gene the chances are 20.9 times of XBP1-DC group that do not add L189. Therefore, L189 can improve greatlyCRISPR/Cas9 system knocks out the efficiency of XBP1 gene.
Embodiment 3
The T cell anti-tumor experiment that DC excites
S31DC-T cell is cultivated
(1) will in step S13 in embodiment 1, cultivate not attached cell before DC cell with containing 0.5% autologous plasmaIt is 1 × 106/ml that Alys-505 nutrient solution is adjusted cell density, proceed in six orifice plates, and 2ml/ hole, 1000U/ is added in simultaneously every holeThe IFN-γ of ml, is placed in saturated humidity, 37 DEG C, 5.0%CO2In incubator, cultivate.
(2), after 24h, every hole adds respectively 50ng/mlCD3 monoclonal antibody, 1000U/mlIL-2, and 1000U/mlIL-1 α, putsIn saturated humidity, 37 DEG C, 5.0%CO2In incubator, continue to cultivate.
(3) within every 3 days, adjusting cell density is 1 × 106/ml, adds containing 1000U/mlIL-2 and 0.5% autologous plasmaAlys-505 nutrient solution.
Within (4) the 9th days, by three kinds of DC cells, (NC-DC, XBP1-DC (transfection DC in embodiment 2), XBP1/L189-DC (implementTransfection DC in example 3)) mix with the ratio of 1:10 with T cell respectively, with containing 0.5% autologous plasma, 1000U/mlIL-2,The Alys-505 nutrient solution of 100ng/mlGM-CSF continues to be cultured to the 14th day, obtains three kinds of ripe DC-T cells.
S32DC-T cell anti-tumor experiment
(1) using three kinds of DC-T cells (NC-DC-T, XBP1-DC-T, XBP1/L189-DC-T) as effector cell, CFSEThe retinoblastoma RB of mark is as target cell, than melange effect cell and target cell, mixed gently according to the effect target of 20:1Even.
(2)5％CO2, 37 DEG C of incubators are hatched 24h, after reaction finishes, add 1 μ g/mlPI dye liquor, mix, and room temperature is kept awayLight is hatched after 15min, utilizes flow cytometer to detect the percentage of CFSE+PI+ cell (dead RB cell). Experimental result(Fig. 4) show, compared with control group, in DC cell XBP1 gene to knock out efficiency higher, the DC-T cell of its induction is swollen to RBThe killing-efficiency of oncocyte is higher, inspires stronger antineoplastic immune effect.
The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all in essence of the present inventionAny amendment of doing within god and principle, be equal to replacement and improvement etc., within protection scope of the present invention all should be included in.
Claims (8)
1. an efficient DC cell XBP1 gene knockout method, comprises the steps:
Carry out CRISPR target sequences Design taking endoplasmic reticulum pressure experience factor XBP1 as target gene, and according to described CRISPR targetTo sequences Design forward oligonucleotide sequence and reverse oligonucleotide sequence;
Described forward oligonucleotide sequence and reverse oligonucleotide sequence are carried out to annealing reaction processing formation double chain oligonucleotide;
Enzyme is cut pCas9/gRNA1 carrier and is obtained linearized vector;
Described double chain oligonucleotide and described linearized vector are carried out to coupled reaction processing in coupled reaction system, the company of acquisitionThe thing of practicing midwifery;
By described connection product transformed competence colibacillus cell, and after being expanded to cultivation, the cell after being converted carries out plasmid extractionProcess, obtain pCas9/gRNA1-XBP1 plasmid;
Described pCas9/gRNA1-XBP1 plasmid is carried out to transfection to DC cell and cultivate processing.
2. DC cell XBP1 gene knockout method according to claim 1, is characterized in that: described transfection cultivation is processedIn transfection cultivating system, also add L189.
3. DC cell XBP1 gene knockout method according to claim 2, is characterized in that: described L189 is in described transfectionConcentration in cultivating system is 0.1 μ M-10 μ M.
4. according to the DC cell XBP1 gene knockout method described in claim 2 or 3, it is characterized in that: described pCas9/The concentration of gRNA1-XBP1 plasmid is 10-20 μ g/ml; The concentration of described DC cell is 2 × 105Individual/ml-2 × 106Individual/ml.
5. according to the arbitrary described DC cell XBP1 gene knockout method of claim 1-3, it is characterized in that: described CRISPR targetBe CCGCGCCGAACCCGGCCGA to sequence.
6. DC cell XBP1 gene knockout method according to claim 5, is characterized in that: described forward oligonucleotides orderClassify as:
5’-GAAACACCGCCGCGCCGAACCCGGCCGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT-3’；
Described reverse oligonucleotide sequence is:
5’-AACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTCGGCCGGGTTCGGCGCGGCGGTGTTTC-3’。
7. according to claim 1-3,6 arbitrary described DC cell XBP1 gene knockout methods, it is characterized in that: described annealing is anti-Annealing reaction system in should processing comprise described forward oligonucleotide sequence, described reverse oligonucleotide sequence, NaCl andTris-Cl reagent, and the program of described annealing reaction is: 90 DEG C of 4min, 70 DEG C of 10min, 55 DEG C of 10min, 40 DEG C of 10min, 25℃10min。
8. according to claim 1-3,6 arbitrary described DC cell XBP1 gene knockout methods, it is characterized in that: described connection is anti-The system of answering comprise described double chain oligonucleotide, described linearized vector, T4DNA ligase, EcoRV, ligase Buffer,PEG4000 reagent, and described reaction condition is: 22 DEG C of 30min, 37 DEG C of 15min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510814335.1A CN105602987A (en) | 2015-11-23 | 2015-11-23 | High-efficiency knockout method for XBP1 gene in DC cell |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510814335.1A CN105602987A (en) | 2015-11-23 | 2015-11-23 | High-efficiency knockout method for XBP1 gene in DC cell |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105602987A true CN105602987A (en) | 2016-05-25 |
Family
ID=55983330
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510814335.1A Pending CN105602987A (en) | 2015-11-23 | 2015-11-23 | High-efficiency knockout method for XBP1 gene in DC cell |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105602987A (en) |
Cited By (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| CN106755091A (en) * | 2016-11-28 | 2017-05-31 | 中国人民解放军第三军医大学第附属医院 | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
-
2015
- 2015-11-23 CN CN201510814335.1A patent/CN105602987A/en active Pending
Non-Patent Citations (6)
| Title |
|---|
| JUAN R. CUBILLOS-RUIZ等: "ER Stress Sensor XBP1 Controls Anti-tumor Immunity by Disrupting Dendritic Cell Homeostasis", 《CELL.》 * |
| XI CHEN等: "Rational Design of Human DNA Ligase Inhibitors that Target Cellular DNA Replication and Repair", 《CANCER RES.》 * |
| 卢利莎等: "利用CRISPR/Cas9技术构建敲除MEIS2基因的HEK293T人胚肾细胞系", 《中国细胞生物学学报》 * |
| 孔丽娅等: "真核细胞DNA双链断裂修复通路的选择和调节", 《癌变，畸变，突变》 * |
| 李蔚蔚等: "非同源末端连接修复相关因子对DNA 损伤修复调控及肿瘤治疗作用的研究进展", 《中国药理学与毒理学杂志》 * |
| 璩良等: "CRISPR/Cas9 系统的分子机制及其在人类疾病基因治疗中的应用", 《遗传》 * |
Cited By (43)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9999671B2 (en) | 2013-09-06 | 2018-06-19 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US9737604B2 (en) | 2013-09-06 | 2017-08-22 | President And Fellows Of Harvard College | Use of cationic lipids to deliver CAS9 |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10077453B2 (en) | 2014-07-30 | 2018-09-18 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10167457B2 (en) | 2015-10-23 | 2019-01-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| CN106755091A (en) * | 2016-11-28 | 2017-05-31 | 中国人民解放军第三军医大学第附属医院 | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105602987A (en) | High-efficiency knockout method for XBP1 gene in DC cell | |
| CN106566838B (en) | A kind of miR-126 full-length gene knockout kit and its application based on CRISPR-Cas9 technology | |
| JP2017513477A5 (en) | ||
| CN106399377A (en) | Method for screening drug target genes based on CRISPR/Cas9 high-throughput technology | |
| CN107893076A (en) | CRISPR Cas9 targeting knock outs human breast cancer cell RASSF2 genes and its specific sgRNA | |
| CN107893074A (en) | A kind of gRNA, expression vector, knockout system, kit for being used to knock out CXCR4 genes | |
| Jiang et al. | Small indels induced by CRISPR/Cas9 in the 5′ region of microRNA lead to its depletion and Drosha processing retardance | |
| CN105518138A (en) | Method knocking out pig GFRA1 genes with CRISPR-Cas9 specificity and sgRNA for specificity targeting GFRA1 genes | |
| Lee et al. | CRISPR diagnosis and therapeutics with single base pair precision | |
| CN111849979B (en) | sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line | |
| WO2023142594A1 (en) | Accurate pam-limitation-free adenine base editor and use thereof | |
| CN108220338A (en) | A kind of construction method of the IPEC-J2 cells of APN gene knockouts | |
| Wu et al. | A simple approach to mediate genome editing in the filamentous fungus Trichoderma reesei by CRISPR/Cas9-coupled in vivo gRNA transcription | |
| Ventura et al. | Modeling cancer in the CRISPR era | |
| Guan et al. | Application of CRISPR-Cas system in gene therapy: pre-clinical progress in animal model | |
| Huang et al. | Current advancement in the application of prime editing | |
| CN105132424A (en) | MicroRNA inhibitor, microRNA inhibitor expression vector, building method of microRNA inhibitor expression vector and application of microRNA inhibitor expression vector | |
| Rosenlund et al. | CRISPR/Cas9 to silence long non-coding RNAs | |
| CN108949832A (en) | A kind of targeting vector and its application for knock-out pig GHR gene | |
| CN108148866A (en) | A kind of HCBP6 Knockout cells system and its construction method | |
| Usher et al. | Optimizing CRISPR/Cas9 editing of repetitive single nucleotide variants | |
| CN109897825A (en) | It is a kind of to be simple and efficient the cell system for generating hepatitis type B virus recombination cccDNA | |
| CN109957570A (en) | The gRNA sequence and its application of targeting editor's bcr-abl fusion | |
| Zhang et al. | Application progress of CRISPR/Cas9 genome-editing technology in edible fungi | |
| Ran | CRISPR-Cas: Development and applications for mammalian genome editing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160525 |
|
| RJ01 | Rejection of invention patent application after publication |