WO2024159266A1 - Compositions et procédés de combinaison pour le traitement de la dystrophie musculaire - Google Patents

Compositions et procédés de combinaison pour le traitement de la dystrophie musculaire Download PDF

Info

Publication number
WO2024159266A1
WO2024159266A1 PCT/AU2024/050052 AU2024050052W WO2024159266A1 WO 2024159266 A1 WO2024159266 A1 WO 2024159266A1 AU 2024050052 W AU2024050052 W AU 2024050052W WO 2024159266 A1 WO2024159266 A1 WO 2024159266A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
nucleotides
seq
positions
exon
Prior art date
Application number
PCT/AU2024/050052
Other languages
English (en)
Inventor
George Tachas
Original Assignee
Antisense Therapeutics Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2023900242A external-priority patent/AU2023900242A0/en
Application filed by Antisense Therapeutics Ltd filed Critical Antisense Therapeutics Ltd
Publication of WO2024159266A1 publication Critical patent/WO2024159266A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3233—Morpholino-type ring
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/335—Modified T or U
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • the present specification enables compositions and methods for treating muscular disorders such as muscular dystrophy.
  • Muscular Dystrophy is a group of disorders characterized by progressive weakness and wasting of specific muscle tissue (myonecrosis) and replacement of skeletal muscles with fibrous, bony or fatty tissue.
  • muscle tissue myonecrosis
  • MD Duchene muscular dystrophy
  • LGMD limb girdle muscular dystrophy
  • BMD Becker muscular dystrophy
  • CMD congenital muscular dystrophy
  • Almost all types of MD arise from single-gene mutations.
  • DMD and BMD involve a primary defect in the dystrophin gene on the X- chromosome.
  • the dystrophin protein serves to link the contractile machinery (actin filaments) of the muscle cell (sarcomeres) and the cytoskeleton with the extracellular matrix (ECM) where collagens transmit the muscle force (Grounds MD, 2008).
  • the ECM is known to play a complex role in muscle function and muscle regeneration.
  • Dystrophic myofibres are associated with necrosis, inflammation and fibrosis. The precise sequence of events leading to progressive disease as a result of dystrophin deficiency is not understood at the molecular level and it is important to find secondary causes of disease progression.
  • DMD is a devastating condition which affects mainly boys with an incidence of about 1 :3,500 live births. Boys may lose their ability to walk at an early age and become wheelchair bound typically post-pubescence, and death often from cardiopulmonary compromise frequently occurs in the 3 rd decade of life with existing treatments. BMD is similar to DMD but much milder.
  • Corticosteroids Current primary treatments with corticosteroids (CS) are aimed at reducing the severity of the disease by reducing inflammation and maintain muscle mass and function for a period of time.
  • Corticosteroids have an acute anti-inflammatory effect which can be short term and their mechanism of action is not understood in particular in modulating chronic inflammatory damage to muscle in DMD. They are less than optimal because side effects severely limit their use, and they may also cause atrophy.
  • Prednisolone at 0.75mg/kg/day and Deflazacort 0.9mg/kg/day are the standard therapies for ambulant DMD patients and delay loss of ambulation for approximately 2 to 3 years.
  • Vamorolone is an anti-inflammatory drug that binds the same receptors as the corticosteroids, with the potential to dissociate efficacy from typical steroid safety issues and has progressed through development as a monotherapy in young ambulant boys with DMD, maintaining a similar efficacy compared to prednisolone.
  • Dystrophin “restoration” drugs directed at the primary cause of the disease in DMD, are recently approved for use on top of CS in ambulant boys, conditionally approved based on their ability to generate a small percent of a “microdystrophin,” i.e., dystrophin that results from inducing skipping of mutations in any of exons 45, 51, 53, or reading through stop codons in other exons.
  • Existing dystrophin restoration drugs treatments are relevant for approximately 50% of DMD subjects with such mutations in dystrophin, andare indicated for use in young ambulant DMD boys, but unfortunately do not delay loss of ambulation beyond that achieved with the use of corticosteroids in controlled studies, with clinical studies ongoing.
  • composition includes a single composition, as well as two or more compositions; reference to “an agent” includes one agent, as well as two or more agents; reference to “the disclosure” includes single and multiple aspects of the disclosure and so forth.
  • a method for treating a muscular dystrophy in a subject in need thereof comprising administering or having administered to the subject: (i) a therapeutically effective amount of a first oligonucleotide that induces skipping of a dystrophin gene exon comprising a mutation associated with the muscular dystrophy; and (ii) a therapeutically effective amount of a second oligonucleotide that targets human CD49d and comprises the structure:
  • each of the 19 internucleotide linkages of the oligonucleotide is an 0,0- linked phosphorothioate diester; b) the nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; c) the nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides; d) the nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; and e) all cytosines are 5-methylcytosines ( Me C).
  • a method for improving muscle function or delaying decline in muscle function in a subject suffering from a muscular dystrophy comprising administering or having administered to the subject: (i) a therapeutically effective amount of a first oligonucleotide that induces skipping of a dystrophin gene exon comprising a mutation associated with the muscular dystrophy; and (ii) a therapeutically effective amount of a second oligonucleotide that targets human CD49d and comprises the structure of the oligomer referred to herein as “ATL-1102”:
  • each of the 19 internucleotide linkages of the oligonucleotide is an 0,0- linked phosphorothioate diester; b) the nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; c) the nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides; d) the nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; and e) all cytosines are 5-methylcytosines ( Me C).
  • the exon skipping is in the human dystrophin gene. In some embodiments, where the exon skipping is in the human dystrophin gene, the exon skipping is skipping of one or more of human dystrophin gene exons, 8, 43, 44, 45, 50, 51, 52, 53, or 55. In some embodiments the exon skipping in human dystrophin gene is an exon selected from the group consisting of exon 45, exon 51, and exon 53. In some embodiments, where the human dystrophin gene exon to be skipped is exon 45, exon 51, or exon 53, the first oligonucleotide comprises a nucleotide sequence selected from the group consisting of
  • CTCCAACATCAAGGAAGATGGCATTTCT SEQ ID NO:2
  • CAATGCCATCCTGGAGTTCCTG SEQ ID NO:4
  • CCTCCGGTTCTGAAGGTGTTC SEQ ID NO:5
  • the first oligonucleotide is a: phosphorodiamidate morpholino oligomer (PMO), a 2'-O-Methyl Phosphorothioate oligomer (2OMePS), a 2'-O-methoxyethyl (2'MOE) oligomer, a peptide-conjugated PMO, a polypeptide- conjugated PMO, or an antibody-conjugated PMO.
  • PMO phosphorodiamidate morpholino oligomer
  • 2OMePS 2'-O-Methyl Phosphorothioate oligomer
  • 2'MOE 2'-O-methoxyethyl
  • administering the first oligonucleotide includes administering an oligonucleotide drug selected from the group consisting of Exondys 51, Vyondis 53, Viltepso, and Amondys 45.
  • the method of treatment includes a periodic administration of the first or second oligonucleotide with a frequency of (i) one to three times per week; (ii) one to three times per two weeks; or (iii) one to four times per month.
  • the method includes a periodic administration of both the first and the second oligonucleotides.
  • both oligonucleotides are administered periodically, the frequencies of administration of the first and the second oligonucleotides are the same. In other embodiments the frequencies of administration of the first and the second oligonucleotides are different.
  • the therapeutically effective amount of (i) the first oligonucleotide is about 250 mg to about 7500 mg; and (ii) the second oligonucleotide is about is about 10 mg to about 300 mg. In some embodiments the therapeutically effective amount of
  • the first oligonucleotide is selected from the group consisting of 75 mg to 150 mg, 150 mg to 300 mg, 300 mg to 600 mg, 600 mg to 750 mg, 750 mg to 1000, 1000- 1250, and 1250-1500 mg, or 1500-2000mg; and
  • the second oligonucleotide is selected from the group consisting of 10 to 25, 25 mg to 50 mg, 50 mg to 100 mg, 100 mg to 200 mg and 150 mg to 300 mg. In some preferred embodiments the dose of the second oligonucleotide is about 25 mg to 50 mg administered once per week.
  • the first or second oligonucleotide is a sodium or potassium salt thereof.
  • first or second oligonucleotide is administered as a pharmaceutical composition pharmaceutical comprising a pharmaceutically acceptable carrier and having a pH about 7.2 to about 7.6. In some embodiments first and second oligonucleotides are co-administered as a single pharmaceutical composition.
  • the subject is suffering from a muscular dystrophy caused by a mutation in the dystrophin gene. In some embodiments the subject is suffering from Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD). In some embodiments the subject to be treated is ambulatory. In other embodiments the subject to be treated is transitioning from ambulatory to non- ambulatory, or is non-ambulatory. In some embodiments the subject to treated is a child of 4 years, or juvenile or pubescent child of 10 years or 10-18 years or older.
  • DMD Duchenne muscular dystrophy
  • BMD Becker muscular dystrophy
  • administration of the first or second oligonucleotide or both oligonucleotides is systemic administration.
  • administration of the first oligonucleotide or the second oligonucleotide is subcutaneous administration, oral administration, intravenous administration, or intramuscular administration.
  • the first and second oligonucleotides are administered by the same route of administration.
  • the first and second oligonucleotides are administered by different routes of administration.
  • the first and second oligonucleotides are administered at the same time.
  • the first and second oligonucleotides are administered at different times, e.g, an hour apart, less than a day apart, a day apart, or multiple days apart.
  • a treatment method also includes administration of a corticosteroid.
  • the corticosteroid is administered at a low dose or a low frequency of dosing.
  • any of the foregoing treatment methods also include administration of a therapeutically effective amount of glycine or dantrolene, or other enhancer of exon splicing.
  • a first oligonucleotide that induces skipping of a human dystrophin gene exon in the manufacture of a medicament for treatment of a muscular dystrophy in combination therapy with a second oligonucleotide that is an antisense oligonucleotide to human CD49d that has been administered or will be administered to a subject in need thereof, wherein the second oligonucleotide comprises the structure:
  • each of the 19 internucleotide linkages of the oligonucleotide is an 0,0- linked phosphorothioate diester; b) the nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; c) the nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides; d) the nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; and e) all cytosines are 5-methylcytosines ( Me C).
  • a first oligonucleotide that targets human CD49d in the manufacture of a medicament for treatment of a muscular dystrophy in combination therapy with a second oligonucleotide that induces skipping of a human dystrophin gene exon, wherein the second oligonucleotide has been administered or will be administered to a subject in need thereof, wherein the first oligonucleotide comprises the structure:
  • each of the 19 internucleotide linkages of the oligonucleotide is an 0,0- linked phosphorothioate diester; b) the nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; c) the nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides; d) the nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; and e) all cytosines are 5-methylcytosines ( Me C).
  • CTCCAACATCAAGGAAGATGGCATTTCT SEQ ID NO:2
  • CAATGCCATCCTGGAGTTCCTG SEQ ID NO:4
  • CCTCCGGTTCTGAAGGTGTTC SEQ ID NO:5
  • an antisense oligonucleotide to human CD49d for use in combination therapy with an oligonucleotide that induces skipping of a human dystrophin gene exon for treatment of a muscular dystrophy, wherein:
  • the first oligonucleotide comprises the structure: 5' - Me C Me UG AGT Me CTG TTT Me U Me C Me C A Me U Me U Me C Me U - 3'
  • each of the 19 internucleotide linkages of the oligonucleotide is an 0,0- linked phosphorothioate diester; b) the nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; c) the nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides; d) the nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; and e) all cytosines are 5-methylcytosines ( Me C).
  • composition comprising:
  • the first oligonucleotide included in the above-mentioned pharmaceutical composition is a phosphorodiamidate morpholino oligomer.
  • CTCCAACATCAAGGAAGATGGCATTTCT SEQ ID NO:2
  • each of the 19 internucleotide linkages of the oligonucleotide is an 0,0- linked phosphorothioate diester; b) the nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; c) the nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides; d) the nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; and e) all cytosines are 5-methylcytosines ( Me C).
  • the first oligonucleotide is a phosphorodiamidate morpholino oligomer (PMO), a Phosphorothioate oligomer, a 2'-O-Methyl Phosphorothioate oligomer (2'OMePS), a 2'-O-methoxyethyl (2'MOE) oligomer, a 2'- O-Methyl Phosphorothioate gapmer oligomer (2'OMePS), a 2'-O-methoxyethyl (2'MOE) gapmer oligomer, a peptide-conjugated PMO, a polypeptide-conjugated PMO, or an antibody-conjugated PMO.
  • PMO phosphorodiamidate morpholino oligomer
  • PMO Phosphorothioate oligomer
  • 2'OMePS 2'-O-Methyl Phosphorothioate oligomer
  • any of the above-mentioned pharmaceutical compositions is for treatment of a muscular dystrophy selected from the group consisting of Duchenne muscular dystrophy (DMD), limb girdle muscular dystrophy (LGMD), Becker muscular dystrophy (BMD), congenital muscular dystrophy (CMD including Fukuyama Type congenital MD and congenital MD with myosin deficiency), fascio scapulohumeral, oculophayngeal, Emery-Dreifuss, and distal muscular dystrophy selected from the group consisting of Duchenne muscular dystrophy (DMD), limb girdle muscular dystrophy (LGMD), Becker muscular dystrophy (BMD), congenital muscular dystrophy (CMD including Fukuyama Type congenital MD and congenital MD with myosin deficiency), fascio scapulohumeral, oculophayngeal, Emery-Dreifuss, and distal muscular dystrophy selected from the group consisting
  • a muscular dystrophy in a subject in need thereof comprising administering or having administered to the subject:
  • TID translational readthrough-inducing drug
  • each of the 19 internucleotide linkages of the oligonucleotide is an 0,0- linked phosphorothioate diester; b) the nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; c) the nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides; d) the nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; and e) all cytosines are 5-methylcytosines ( Me C).
  • FIG. 1 Oligonucleotide combination treatment effect on the Force Frequency (FF) specific maximum force measured in extensor digitorum longus (EDL) muscle in mdx mouse model of Duchene muscular dystrophy.
  • FF Force Frequency
  • EDL extensor digitorum longus
  • a category plot showing the FF specific maximum force in EDL muscle from six experimental groups of mdx mice following six weeks of treatment as shown.
  • One way ANOVA indicates a significant increase in specific maximum force in EDL muscle from mdx mice treated with a combination of an ASO against CD49d and an oligonucleotide that induces dystrophin exon 23 skipping (“exon skip”).
  • the FF specific maximum force is the FF maximum force corrected for size/mass and cross sectional area of the EDL muscle
  • FIG. 2 Oligonucleotide combination treatment effect on EDL force loss after a first eccentric contraction.
  • a category plot showing the mdx phenotype-associated eccentric contraction (EC) force loss in EDL muscle following eccentric muscle damage after a single (first) (A) and the fifth (B) eccentric lengthening contractions of 10% from six experimental groups of mdx mice following six weeks of treatment as shown.
  • One way ANOVA indicates a significant reduction in the first and fifth EC force loss in EDL muscle from mdx mice treated with a combination of an ASO against CD49d and an exon skip oligonucleotide.
  • Figure 3 Oligonucleotide combination treatment effect on EDL force loss after a series of 10 eccentric contractions.
  • A A line plot showing serial EC force loss in EDL muscle after 1 to 10 repeated eccentric (lengthening) contractions of 10% in six experimental groups of mdx mice following six weeks of treatment as shown.
  • B A category plot indicating area under the curve % change compared to saline for each experimental group EDL force drop curve following eccentric muscle damage illustrated in (A).
  • C Area under the curve for EDL force drop across 10 ECs in each treatment group.
  • ANOVA indicates significant differences in AUC between groups as shown.
  • SEQ ID NO: 1 human CD49d antisense oligomer (nucleotide sequence of ATL1102)
  • SEQ ID NO:2 nucleotide sequence of human dystrophin exon 51 skipping oligonucleotide EXONDYS51
  • SEQ ID NO:5 nucleotide sequence of human dystrophin exon 45 skipping oligonucleotide AMONDYS 45
  • SEQ ID NO:6 nucleotide sequence of murine dystrophin exon 23 skipping oligonucleotide (PMO)
  • the term “subject” includes a human subject or individual diagnosed with a form of MD or a clinical study MD model animal.
  • DMD for example is often clinically diagnosed when infant motor milestones are delayed at 18 months.
  • Early features of muscle weakness include a wide based gait, toe walking hyperlordosis of the spine, frequent falls, hypertrophy of muscles, such as the calf, deltoid, quadriceps, tongue masseters, difficulty getting up, arm weakness.
  • Loss of ambulation typically occurs between 7 and 13 years of age in boys with DMD on standard of care corticosteroids, with corticosteroids delaying loss of ambulation 2 to 3 years, while later ambulation is characteristic of BMD. Cardiopulmonary deficits may also be apparent. Fatigue and speech development may also be delayed. However, no upper motor neurone signs or muscle fasciculation is observed.
  • Diagnosis of DMD may be confirmed by dystrophin immunofluorescence testing and/or immunoblot showing dystrophin deficiency, and a clinical picture consistent with typical DMD.
  • gene deletions test positive (missing one or more exons) of the dystrophin gene, where reading frame can be predicted as 'out-of-frame', and a clinical picture consistent with typical DMD is indicative.
  • complete dystrophin gene sequencing may show a point mutation, duplication, or other mutation resulting in a stop codon mutation that can be definitely associated with DMD.
  • a positive family history of DMD confirmed by one of the criteria listed above in a sibling or maternal uncle is also useful. Also used are assessments of DMD characteristic clinical symptoms or signs (e.g., proximal muscle weakness, Gowers' manoeuvre, elevated serum creatinine kinase level).
  • Suitable improved markers, signs and symptoms of MD or dystrophic myofibres/improved muscle function will be known to those of skill in the art.
  • Suitable tests include those for increased motor, muscle, cardiac, blood flow, lung function over time during treatment.
  • cardiac efficacy based on serum biomarker response may be determined. This may be achieved by determining the levels of one or more markers such as myostatin ratio, cardiac troponins, cardiac BNP etc. eGFR changes may also be monitored. Other cardiac functions may be assessed by telemetry or rhythm abnormalities assessed by continuous mobile telemetry monitoring.
  • Further tests include testing for muscle oxygenation parameters and mitochondrial phenotype.
  • Fibrosis and muscle fat may be assessed by MRI. Reduced muscle fat, reduced cardiac fibrosis, increased pinch strength, grip strength, suggesting an improvement in upper limb function, improved cardiac and lung function tests. Other assessments look for a slowing in the rate of decline of the above functions or motor functions or clinical assessments associated with risk of loss of ambulation.
  • Quality of life questionnaires are very useful in determining the effect of treatments.
  • Clinical outcomes may involve, for example, determining the percent change in normalized upper extremity reachable surface area, the percent change in cardiac circumferential strain by MRI, cardiac lateral and posterior wall strain is assessed.
  • Another useful test is to measure forced vital capacity, delayed loss of respiratory function, such as change in FVC 5p from baseline by spirometry measurements.
  • Motor function tests include determining the mean change in 4 standard stairs climb test before and after treatment, time to rise form floor, magnetic resonance spectroscopy mean change in fat fraction of vastus lateralis muscle at MRS, muscle testing of quadriceps, knee extensor peak torque measurement, ultrasound muscle microvascular blood supply to forearm.
  • molecular prognostic tests can include determining levels of circulating immune cells such as T cells expressing CD49d and/or a level of dystrophin protein in one more affected muscles, e.g. , by means of a microbiopsy.
  • Important clinical assessments include time to walk/run 6 or 10 meters, time to climb 4 stairs, time to descend 4 stairs, time to stand from supine position. Changes in weight, height, BMI may also be assessed.
  • biomarkers from muscle biopsy assessments Alternatively or in addition biomarkers from muscle biopsy assessments, pharmacodynamics markers measuring change in plasma biomarker panel measured by ELISA or proteomics, or change in circulating immune cell markers are assessed.
  • antisense compound or “antisense oligonucleotide” as used herein refers to an oligomeric compound that hybridizes to a nucleic acid molecule encoding the ⁇ 4 integrin chain of VLA-4 ( ⁇ 4pi) and/or ⁇ 4 ⁇ 7 integrin.
  • the ⁇ 4 integrin chain in humans is CD49d.
  • the antisense oligonucleotide may interfere with expression of CD49d, pi integrin and/or P7 integrin.
  • targets CD49d or “targeting of CD49d” as used herein refers to the use of antisense-mediated or RNA interference-mediated a decrease in the level of CD49d pre-mRNA or mRNA and consequently CD49d protein.
  • nucleic acid molecule encoding alpha4 integrin encompasses DNA encoding the ⁇ 4 integrin chain of VLA-4 or ⁇ 4 ⁇ 7 integrin, RNA (including pre- mRNA and mRNA or portions thereof) transcribed from such DNA, and further, cDNA derived from such RNA.
  • VLA-4" refers to a heterodimer of an ⁇ 4 integrin (CD49d) and a pi integrin.
  • VLA-4 is expressed at substantial levels on normal peripheral blood B and T cells, thymocytes, monocytes, and other cells, as well as on hematopoietic stem and progenitor cells.
  • VLA-4 is also expressed on mesenchymal and endothelial progenitor cells and mesenchymal stem cells and potentially endothelial stem cells.
  • Ligands for VLA-4 include vascular cell adhesion molecule-1 (VCAM-1) and CS-1, an alternately spliced domain within the Hep II region of fibronectin and osteopontin.
  • ⁇ 4 ⁇ 7 integrin refers to a heterodimer of an ⁇ 4 integrin and a P7 integrin.
  • ⁇ 4 ⁇ 7 integrin identifies a subset of memory T cells with a tropism for the intestinal tract.
  • ⁇ 4 ⁇ 7 integrin and is also expressed on a subset of mast, lymphocyte and NK progenitor cells.
  • ⁇ 4 ⁇ 7 integrin is expressed on some stem and progenitor cells.
  • Ligands for ⁇ 4 ⁇ 7 integrin include MAdCam-1 and VCAM-1.
  • exon skipping oligonucleotide “exon- skipping oligonucleotide” or “oligonucleotide that induces skipping of a dystrophin gene exon comprising a mutation associated with the muscular dystrophy” as used herein refers to an oligomeric compound that hybridizes to a dystrophin pre-mRNA to inhibit splicing/inclusion of a dystrophin gene exon (e.g., a human dystrophin gene exon) comprising a mutation associated with muscular dystrophy, e.g., a nonsense mutation.
  • a dystrophin gene exon e.g., a human dystrophin gene exon
  • TERT translational readthrough inducing drug
  • terapéuticaally effective amount refers to an amount of a referred-to therapeutic agent, as a monotherapy or in combination with another therapeutic agent, that is sufficient to alleviate one or more symptoms associated with a condition to be treated and for which treatment with the therapeutic agent is intended.
  • nucleic acids include DNA (e.g., complementary DNA (cDNA), genomic DNA (gDNA), mRNA, pre-RNA, pre-mRNA, short hairpin RNA (shRNA), short inhibitory RNA (siRNA), ribosomal RNA (rRNA), tRNA, microRNA, DNA or RNA analogues (e.g., containing base analogues, sugar analogues and/or a non-native backbone and the like), RNA/DNA hybrids and polyamide nucleic acids (PNAs), all of which can be in single- or double- stranded form.
  • the nucleic acid is isolated.
  • isolated nucleic acid means a nucleic acid that is altered or removed from the natural state through human intervention.
  • oligonucleotide broadly means a short nucleic acid molecule. Oligonucleotides readily bind, in a sequence-specific manner, to their respective complementary oligonucleotides, DNA, or RNA to form duplexes. In one embodiment, oligonucleotides are five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides or more in length.
  • mutantation associated with a muscular dystrophy refers to a sequence alteration in the dystrophin gene that results in a partial or complete loss of function or a disease-associated gain of function in dystrophin.
  • the mutation in a particular exon is a nonsense mutation, which results in a premature stop codon and a truncated non-fimctional/partially functional dystrophin protein.
  • mutations are “circumvented” in the resulting splice variant transcript that yields a dystrophin that while containing a partial deletion is sufficiently functional to ameliorate the muscular dystrophy associated with the dystrophin gene mutation in question.
  • oligonucleotides of the present disclosure are inhibitory oligonucleotides.
  • the term "inhibitory oligonucleotide” refers to any oligonucleotide that reduces the production, expression or biological activity of one or more proteins.
  • an inhibitory oligonucleotide can interfere with translation of mRNA into protein in a ribosome.
  • an inhibitory oligonucleotide can be sufficiently complementary to either a gene or a mRNA encoding one or more proteins to bind to (hybridize with) a targeted gene(s) or mRNA thereby reducing expression or biological activity of the target protein.
  • an inhibitory oligonucleotide inhibits the biological activity of an intracellular nucleic acid that does not code for a protein.
  • an inhibitory oligonucleotide can inhibit the biological activity of a non-coding RNA.
  • an inhibitory oligonucleotide hybridizes with a dystrophin pre-mRNA to inducing skipping of an exon that contains a mutation associated with a muscular dystrophy. In some embodiments such an oligonucleotide hybridizes within an intronic sequence. In other embodiments the oligonucleotide hybridizes within the sequence of the exon to be “skipped’/excluded from the mRNA. In some embodiments the oligonucleotide hybridizes to a sequence that spans the intron-exon border.
  • antisense means a sequence of nucleotides complementary to and therefore capable of binding to a coding sequence, which may be either that of the strand of a DNA double helix that undergoes transcription, or that of a messenger RNA molecule.
  • Antisense DNA is the non-coding strand complementary to the coding strand in double-stranded DNA.
  • short hairpin RNA or “shRNA” refer to an RNA structure having a duplex region and a loop region.
  • small interfering RNA is a class of double-stranded or single stranded RNA molecules, about 19-25 base pairs in length.
  • a siRNA that inhibits or prevents translation to a particular protein is indicated by the protein name coupled with the term siRNA.
  • a siRNA in various embodiments is a double-stranded or single stranded nucleic acid molecule having about 19 to about 28 nucleotides (i.e. about 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides).
  • miRNA is a small non-coding RNA molecule (containing about 22 nucleotides) found in plants, animals and some viruses, that functions in RNA silencing and post-transcriptional regulation of gene expression.
  • miR The prefix “miR” is followed by a dash and a number, the latter often indicating order of naming.
  • miRNAs with nearly identical sequences except for one or two nucleotides are annotated with an additional lower case letter.
  • Numerous miRNAs are known in the art (miRBase V.21 nomenclature; see Kozomara et al. 2013; Griffiths- Jones, S. 2004). Sequences of these miRNAs are well known in the art and may be found, for example, on the world wide web at mirbase dot org.
  • inhibitory oligonucleotides mimic the activity of one or more miRNA.
  • miRNA mimic refers to small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA mimics can be obtained from various suppliers such as Sigma Aldrich and Thermo Fisher Scientific.
  • “inhibitory oligonucleotides” inhibit the activity of one or more miRNA.
  • miRNA species are suitable for this purpose. Examples include, without limitation, antagomirs, interfering RNA, ribozymes, miRNA sponges and miR- masks.
  • antisense oligonucleotides that bind to a target miRNA and inhibit miRNA function by preventing binding of the miRNA to its cognate gene target.
  • Antagomirs can include any base modification known in the art. In an example, the above referenced miRNA species are about 10 to 50 nucleotides in length.
  • antagomirs can have antisense portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.
  • the miRNA species are chimeric oligonucleotides that contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.
  • beneficial properties such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target
  • nucleic acids encompassed by the present disclosure are synthetic.
  • synthetic nucleic acid means that the nucleic acid does not have a chemical structure or sequence of a naturally occurring nucleic acid.
  • Synthetic nucleotides include an engineered nucleic acid molecule.
  • the nucleic acid structure can also be modified into a locked nucleic acid (LNA) with a methylene bridge between the 2' Oxygen and the 4' carbon to lock the ribose in the 3'-endo (North) conformation in the A- type conformation of nucleic acids (Lennox et al 2011; Bader et al 2011). In the context of miRNAs, this modification can significantly increase both target specificity and hybridization properties of the molecule.
  • LNA locked nucleic acid
  • this modification can significantly increase both target specificity and hybridization properties of the molecule.
  • Nucleic acids for use in the methods disclosed herein can be designed using routine methods as required.
  • target segments of 5, 6, 7, 8, 9, 10 or more nucleotides in length comprising a stretch of at least five (5) consecutive nucleotides within the seed sequence, or immediately adjacent thereto, are considered to be suitable for targeting a gene.
  • Exemplary target segments can include sequences that comprise at least the 5 consecutive nucleotides from the 5 '-terminus of one of the seed sequence (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately upstream of the 5'- terminus of the seed sequence and continuing until the nucleic acid contains about 5 to about 30 nucleotides).
  • target segments are represented by RNA sequences that comprise at least the 5 consecutive nucleotides from the 3 '-terminus of one of the seed sequence (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately downstream of the 3 '-terminus of the target segment and continuing until the nucleic acid contains about 5 to about 30 nucleotides).
  • seed sequence is used in the context of the present disclosure to refer to a 6- 8 nucleotide (nt) long substring within the first 8 nt at the 5 -end of the miRNA (i.e., seed sequence) that is an important determinant of target specificity.
  • inhibitory nucleic acid compounds are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity (i.e., do not substantially bind to other non-target nucleic acid sequences), to give the desired effect.
  • Oligonucleotides compounds including antisense oligonucleotides targeting CD49d (AKA: «4 integrin; VLA-4 «4) and exon skipping oligonucleotides to induce dystrophin gene exon skipping
  • the methods of the present disclosure rely on the use of an antisense oligonucleotide to CD49d in combination with the use of oligonucleotide to induce skipping of a dystrophin gene exon (“exon skipping oligonucleotide”) comprising a mutation associated with a muscular dystrophy (e.g., a nonsense mutation associated with Duchenne muscular dystrophy).
  • exon skipping oligonucleotide comprising a mutation associated with a muscular dystrophy (e.g., a nonsense mutation associated with Duchenne muscular dystrophy).
  • the CD49d antisense oligonucleotides disclosed herein are targeted to nucleic acids encoding the ⁇ 4 integrin chain of VLA-4 ( ⁇ 4pi) or ⁇ 4 ⁇ 7 integrin.
  • dystrophin exon skipping oligonucleotide compounds disclosed herein are targeted to dystrophin pre-mRNA transcripts and hybridize to exonic, intronic, or intron-exon spanning sequence to promote skipping/exclusion of the mutation-bearing exon in the mature dystrophin mRNA transcript.
  • Hybridization of an antisense oligonucleotide or an exon skipping oligonucleotide with its target nucleic acid inhibits the function of the target nucleic acid.
  • Antisense inhibition is typically based upon hydrogen bonding-based hybridization of the antisense oligonucleotide to the target nucleic acid such that the target nucleic acid is cleaved, degraded, or otherwise rendered inoperable.
  • hybridization with the target pre-mRNA can interfere with splicesome function to result in exclusion of the targeted exon. While not wishing to be bound by theory, this interference could be by direct steric hindrance or indirectly by affecting the secondary structure of the pre-mRNA resulting in reduced splicing/inclusion of the targeted exon in the mature transcript (mRNA).
  • Hybridization as used herein means pairing of complementary bases of the oligonucleotide and target nucleic acid.
  • Base pairing typically involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases).
  • Guanine (G) and cytosine (C) are examples of complementary nucleobases which pair through the formation of 3 hydrogen bonds.
  • Adenine (A) and thymine (T) are examples of complementary nucleobases which pair through the formation of 2 hydrogen bonds. Hybridization can occur under varying circumstances.
  • nucleoside is a base-sugar combination.
  • the base portion of the nucleoside is normally a heterocyclic base.
  • the two most common classes of such heterocyclic bases are the purines and the pyrimidines.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofiiranosyl sugar, the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
  • Specifically hybridizable and “complementary” are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the antisense oligonucleotide and target nucleic acid. It is understood that the antisense oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable.
  • An antisense or oligonucleotide compound is specifically hybridizable when binding to the target nucleic acid interferes with the normal function of the target molecule to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense or oligonucleotide compound to non-target sequences under conditions in which specific binding is desired, for example, under physiological conditions in the case of therapeutic treatment.
  • the antisense or oligonucleotide compound may hybridize over one or more segments, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure).
  • the oligonucleotide compound comprises at least 70% sequence complementarity to a target region within the target nucleic acid, e.g., 75%, 80%, 85%, 90%, 92%, 95%, 98%, 99%, or another percent complementarity from at least 70% to 100% complementarity to the target sequence.
  • an oligonucleotide in which 18 of 20 nucleobases are complementary to a target region within the target nucleic acid, and would therefore specifically hybridize would represent 90% complementarity.
  • the remaining non- complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other, or to complementary nucleobases.
  • an antisense oligonucleotide which is 18 nucleobases in length having 4 non-complementary nucleobases which are flanked by 2 regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus, fall within the scope of the present disclosure.
  • Percent complementarity of an antisense oligonucleotide with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., 1990; Zhang and Madden, 1997).
  • the present disclosure provides antisense oligonucleotides for inhibiting expression of CD49d/ ⁇ 4 integrin, and/or VLA-4 and/or ⁇ 4 ⁇ 7 integrin.
  • antisense oligonucleotides are targeted to nucleic acids encoding the ⁇ 4 integrin chain of VLA-4 or ⁇ 4 ⁇ 7 integrin.
  • the present disclosure also provides exon skipping oligonucleotides to induce skipping of a dystrophin gene exon comprising a mutation associated with muscular dystrophy.
  • inhibitors as used herein means any measurable decrease (e.g., 10%, 20%, 50%, 90%, or 100%) in VLA-4 or ⁇ 4 ⁇ 7integrin expression.
  • oligonucleotide refers to an oligomer or polymer of RNA or DNA or mimetics, chimeras, analogs and homologs thereof. This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages, as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for the target nucleic acid and increased stability in the presence of nucleases.
  • the oligonucleotides may contain chiral (asymmetric) centers or the molecule as a whole may be chiral.
  • the individual stereoisomers (enantiomers and diastereoisomers) and mixtures of these are within the scope of the present disclosure.
  • phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound.
  • the respective ends of this linear polymeric compound can be further joined to form a circular compound; however, linear compounds are generally preferred.
  • linear compounds may have internal nucleobase complementarity and may therefore fold in a manner so as to produce a fully or partially double-stranded compound.
  • the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
  • the normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
  • Antisense and exon skipping oligonucleotides used for the methods and compositions disclosed herein include oligonucleotides having modified backbones or non-natural internucleoside linkages. Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • Modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2
  • Oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'- most internucleotide linkage, that is, a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
  • Various salts, mixed salts and free acid forms are also included.
  • Modified oligonucleotide backbones that do not include a phosphorus atom therein include, for example, backbones formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
  • riboacetyl backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
  • Oligonucleotides disclosed herein include oligonucleotide mimetics where both the sugar and the internucleoside linkage (i.e. the backbone), of the nucleotide units are replaced with novel groups.
  • the nucleobase units are maintained for hybridization with the target nucleic acid.
  • PNA peptide nucleic acid
  • the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular, an aminoethylglycine backbone.
  • the nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, US 5,539,082, US 5,714,331, and US 5,719,262. Further teaching of PNA compounds can be found in Nielsen et al., 1991.
  • the antisense oligonucleotides of the present disclosure also include oligonucleotides with phosphorothioate backbones and oligonucleotides with heteroatom backbones, for example, -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- [known as a methylene (methylimino) or MMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)- CH2- and -O-N(CH3)-CH2-CH2- [wherein the native phosphodiester backbone is represented as -0-P-0-CH2-] of US 5,489,677, and the amide backbones of US 5,602,240.
  • oligonucleotide compounds of the present disclosure also include oligonucleotides having morpholino backbone structures of US 5,034,506.
  • the oligonucleotides disclosed herein are oligonucleotides having one or more substituted sugar moieties.
  • Examples include oligonucleotides comprising one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O- alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Cl to CIO alkyl or C2 to CIO alkenyl and alkynyl.
  • the oligonucleotide comprises one of the following at the 2' position: O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10.
  • modified oligonucleotides include oligonucleotides comprising one of the following at the 2' position: Cl to CIO lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • the modification includes 2'-methoxyethoxy (2'-O- CH2CH2OCH3 (also known as 2'-O-(2-methoxy ethyl) or 2'-M0E) (Martin et al., 1995), that is, an alkoxyalkoxy group.
  • the modification includes 2'-dimethylaminooxyethoxy, that is, a O(CH2)2ON(CH3)2 group (also known as 2'-DMA0E), or 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O- dimethyl-amino-ethoxy-ethyl or 2'-DMAE0E), that is, 2'-O-CH2-O-CH2-N(CH3)2.
  • 2'-dimethylaminooxyethoxy that is, a O(CH2)2ON(CH3)2 group (also known as 2'-DMA0E)
  • 2'-dimethylaminoethoxyethoxy also known in the art as 2'-O- dimethyl-amino-ethoxy-ethyl or 2'-DMAE0E
  • the 2'-modification may be in the arabino (up) position or ribo (down) position.
  • a 2'-arabino modification is 2'-F.
  • Oligonucleotides may also have sugar mimetics, such as cyclobutyl moieties in place of the pentofiiranosyl sugar.
  • Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, US 4,981,957, US 5,118,800, US 5,319,080, US 5,359,044, US 5,393,878, US 5,446,137, US 5,466,786, US 5,514,785, US 5,519,134, US 5,567,811, US 5,576,427, US 5,591,722, US 5,597,909, US 5,610,300, US 5,627,053, US 5,639,873, US 5,646,265, US 5,658,873, US 5,670,633, US 5,792,747, and US 5,700,920.
  • a further modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety.
  • LNAs Locked Nucleic Acids
  • the linkage is a methylene (- CH2-)n group bridging the 2' oxygen atom and the 4' carbon atom, wherein n is 1 or 2.
  • LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226.
  • Oligonucleotides of the present disclosure include oligonucleotides having nucleobase modifications or substitutions.
  • "unmodified" or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2- thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-CC-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted aden
  • nucleobases include tricyclic pyrimidines, such as phenoxazine cytidine(lH-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H- pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one), G-clamps such as, for example, a substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4- b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido [3 ',2' : 4, 5 ]pyrrolo [2,3 -d]pyrimi
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in US 3,687,808, those disclosed in J.I. Kroschwitz (editor), The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, John Wiley and Sons (1990), those disclosed by Englisch et al. (1991), and those disclosed by Y.S. Sanghvi, Chapter 15: Antisense Research and Applications, pages 289-302, S.T. Crooke, B. Lebleu (editors), CRC Press, 1993.
  • nucleobases are particularly useful for increasing the binding affinity of the oligonucleotide.
  • These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5- propynyluracil and 5-propynylcytosine.
  • 5 -methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C.
  • these nucleobase substitutions are combined with 2'-O-methoxyethyl sugar modifications.
  • Antisense oligonucleotides of the present disclosure may be conjugated to one or more moieties or groups which enhance the activity, cellular distribution or cellular uptake of the antisense oligonucleotide.
  • moieties or groups may be covalently bound to functional groups such as primary or secondary hydroxyl groups.
  • moieties or groups include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
  • Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins and dyes.
  • Moieties or groups that enhance the pharmacodynamic properties include those that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid.
  • Moieties or groups that enhance the pharmacokinetic properties include those that improve uptake, distribution, metabolism or excretion of the compounds of the present disclosure. Representative moieties or groups are disclosed in PCT/US92/09196 and US 6,287,860. Moieties or groups include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, for example, hexyl -S-tritylthiol, a thiocholesterol, an aliphatic chain, for example, dodecandiol or undecyl residues, a phospholipid, for example, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O- hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an oct
  • the conjugate moiety is a peptide (e.g., a cell-penetrating peptide), a polypeptide, or an antibody (e.g., an antibody directed to a receptor that facilitates transport of the conjugated oligonucleotide into a particular tissue or cell type).
  • a peptide e.g., a cell-penetrating peptide
  • a polypeptide e.g., an antibody directed to a receptor that facilitates transport of the conjugated oligonucleotide into a particular tissue or cell type.
  • Oligonucleotides of the disclosure include chimeric oligonucleotides.
  • "Chimeric oligonucleotides” contain two or more chemically distinct regions, each made up of at least one monomer unit, that is, a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, increased stability and/or increased binding affinity for the target nucleic acid.
  • RNAse H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNA duplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of oligonucleotide-mediated inhibition of gene expression.
  • the cleavage of RNA:RNA hybrids can, in like fashion, be accomplished through the actions of endoribonucleases, such as RNAseL which cleaves both cellular and viral RNA. Cleavage of the RNA target can be routinely detected by gel electrophoresis and if necessary, associated nucleic acid hybridization techniques known in the art.
  • Chimeric antisense oligonucleotides of the disclosure may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, and/or oligonucleotide mimetics. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, US 5,013,830, US 5,149,797, US 5,220,007, US 5,256,775, US 5,366,878, US 5,403,711, US 5,491,133, US 5,565,350, US 5,623,065, US 5,652,355, US 5,652,356, and US 5,700,922.
  • Illustrative antisense platforms known in the art include without limitation, morpholino, Igen oligos, 2 nd gen oligo’s, gapmer, siRNA, LNA, BNA, or oligo mimetics like Peptide Nucleic acids.
  • Oligonucleotides may be naked or formulated in liposomes. Oligonucleotides may be linked to a delivery means to cells or not. Oligonucleotides may use an endosome release agent or not.
  • the antisense oligonucleotide is a second generation phosphorothioate backbone 2'-MOE-modified chimeric oligonucleotide gapmer designed to hybridize to the 3 '-untranslated region of VLA-4 mRNA.
  • the oligonucleotide selectively inhibits VLA-4 expression in both primary human cells and in several human cell lines by hybridizing to RNA encoding CD49, which is the ⁇ 4 integrin subunit of VLA-4 and ⁇ 4 ⁇ 7 integrin.
  • the oligonucleotide is the 19-sodium salt of a 3'— >5' phosphorothioate oligonucleotide 20mer also referred as a 3-9-8 MOE gapmer having a molecular weight of 7230 Daltons, in which the nucleotides at positions 1 to 3 from the 5' end are 2'-O-(2-methoxyethyl) (2'MOE) modified ribonucleosides (2'-O-(2- methoxyethyl ribose); the nucleotides at positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides of which all cytosines are 5 -methyl cytosines; the nucleotides at positions 13 to 20 from the 5' end are 2'-O-(2-methoxyethyl) modified ribonucleosides.
  • sequence of the oligonucleotide is (SEQ ID NO:1 - “ATL1102”):
  • the empirical formula of the oligonucleotide is:
  • Antisense oligonucleotide ATL1102 has previously been shown to be effective in central nervous system disorder, MS and at significantly higher doses than proposed herein (Limmroth et al).
  • the ability of antisense oligonucleotide to CD49d alpha chain of VLA-4 to selectively inhibit VLA-4 in immune cells prevents significant safety events such as PML which have characterised administration of antibodies and small molecule inhibitors of VLA-4 which are pan VLA-4 inhibitors affecting all cells which express VLA-4.
  • all uracils are 5 -methyluracils (MeU).
  • the oligonucleotide is synthesized using 2-methoxy ethyl modified thymidines not 5- methyluracils.
  • all pyrimidines are C5 methylated (i.e., U, T, C are C5 methylated).
  • sequence of the oligonucleotide may be named by accepted oligonucleotide nomenclature, showing each 0-0 linked phosphorothioate internucleotide linkage:
  • the oligonucleotide may be synthesized by a multi-step process that may be divided into two distinct operations: solid-phase synthesis and downstream processing.
  • solid-phase synthesis the nucleotide sequence of the oligonucleotide is assembled through a computer-controlled solid-phase synthesizer.
  • downstream processing includes deprotection steps, preparative reversed-phase chromatographic purification, isolation and drying to yield the oligonucleotide drug substance.
  • the chemical synthesis of the oligonucelotide utilizes phosphoramidite coupling chemistry followed by oxidative sulfurization and involves sequential coupling of activated monomers to an elongating oligomer, the 3 '-terminus of which is covalently attached to the solid support.
  • Each cycle of the solid-phase synthesis commences with removal of the acid-labile 5'- 0-4, 4'-dimethoxytrityl (DMT) protecting group of the 5' terminal nucleoside of the support bound oligonucleotide. This is accomplished by treatment with an acid solution (for example dichloroacetic acid (DCA) in toluene). Following detritylation, excess reagent is removed from the support by washing with acetonitrile in preparation for the next reaction.
  • DMT 4'-dimethoxytrityl
  • Chain elongation is achieved by reaction of the 5'-hydroxyl group of the support -bound oligonucleotide with a solution of the phosphoramidite corresponding to that particular base position (e.g., for base2: MOE-MeC amidite) in the presence of an activator (e.g., IH-tetrazole).
  • an activator e.g., IH-tetrazole
  • excess reagent is removed from the support by washing with acetonitrile in preparation for the next reaction.
  • the newly formed phosphite triester linkage is converted to the corresponding [O, O, O)-trialkyl phosphorothioate triester by treatment with a solution of a sulfur transfer reagent (e.g., phenylacetyl disulfide). Following sulfurization, excess reagent is removed from the support by washing with acetonitrile in preparation for the next reaction.
  • a sulfur transfer reagent e.g., phenylacetyl disulfide
  • a "capping reagent” e.g., acetic anhydride and N- methylimidazole/acetonitrile/pyridine
  • DMT-off shortmers are separated from the desired product by reversed phase HPLC purification. After the capping reaction, excess reagent is removed from the support by washing with acetonitrile in preparation of the next reaction.
  • cyanoethyl groups protecting the (O, O, O)-trialkyl phosphorothioate triester intemucleotide linkages are removed by treatment with a solution of triethylamine (TEA) in acetonitrile.
  • TAA triethylamine
  • Deprotection of the exocyclic amino groups and cleavage of the crude product from the support is achieved by incubation with aqueous ammonium hydroxide (reaction f).
  • Purification of the crude, 5'-O-DMT-protected product is accomplished by reversed phase HPLC.
  • the reversed phase HPLC step removes DMT-off failure sequences.
  • the elution profile is monitored by UV absorption spectroscopy. Fractions containing DMT-on oligonucleotide product are collected and analyzed.
  • Reversed phase HPLC fractions containing 5'-O-DMT-protected oligonucleotide are pooled and transferred to a precipitation tank.
  • the products obtained from the purification of several syntheses are combined at this stage of the process.
  • Purified DMT-on oligonucleotide is treated with acid (e.g., acetic acid) to remove the DMT group attached to the 5' terminus. After acid exposure for the prescribed time and neutralization, the oligonucleotide drug substance is isolated and dried.
  • acid e.g., acetic acid
  • the solution is neutralized by addition of aqueous sodium hydroxide and the oligonucleotide drug substance is precipitated from solution by adding ethanol.
  • the precipitated material is allowed to settle at the bottom of the reaction vessel and the ethanolic supernatant decanted.
  • the precipitated material is redissolved in purified water and the solution pH adjusted to between pH 7.2 and 7.3.
  • the precipitation step is repeated.
  • the precipitated material is dissolved in water and the solution filtered through a 0.45 micron filter and transferred into disposable polypropylene trays that are then loaded into a lyophilizer.
  • the solution is cooled to - 50°C. Primary drying is carried out at 25°C for 37 hours. The temperature is increased to 30°C and a secondary drying step performed for 5.5 hours.
  • the drug substance is transferred to high density polyethylene bottles and stored at -200°C.
  • dystrophin gene exon skipping oligonucleotides directed to inducing skipping of a human dystrophin gene exon comprising a mutation associated with a muscular dystrophy.
  • a number of oligonucleotide sequences for inducing human dystrophin gene exon skipping are known in the art. For example:
  • CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO:2) used to induce skipping of exon 51 during splicing of the human dystrophin pre-mRNA splicing and is the active ingredient in EXONDYS 51 (Eteplirsen);
  • GTTGCCTCCGGTTCTGAAGGTGTTC used to induce skipping of exon 53 during splicing of the human dystrophin pre-mRNA splicing and is the active ingredient VYONDYS 53 (Golodirsen);
  • CAATGCCATCCTGGAGTTCCTG (SEQ ID NO:4) is also used to induce skipping of human dystrophin exon 53 and is the active ingredient in Viltepso (Viltolarsen);
  • CCTCCGGTTCTGAAGGTGTTC (SEQ ID NO:5) used to induce skipping of exon 45 during splicing of the human dystrophin pre-mRNA splicing and is the active ingredient in AMONDYS 45 (Casimersen).
  • an exon skipping oligonucleotide is administered to induce skipping of mouse dystrophin gene exon 23.
  • the sequence of the oligonucleotide used in the mdx model as described in Example 1 herein is:
  • Targeting an oligonucleotide to a particular nucleic acid can be a multistep process. The process usually begins with the identification of a target nucleic acid whose function is to be modulated.
  • the target nucleic acid encodes CD49d (the alpha4 integrin chain of VLA-4) or ⁇ 4 ⁇ 7 integrin.
  • the target nucleic acid is a dystrophin pre-mRNA (see NCBI Gen ID: 1756).
  • the targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the interaction to occur such that the desired effect, for example, inhibition of expression or exclusion of an exon, will result.
  • region as used herein is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic. Within regions of the target nucleic acids are segments. “Segments” are defined as smaller or subportions of regions within a target nucleic acid. "Sites" as used herein, means positions within the target nucleic acid.
  • the translation initiation codon is typically 5'-AUG (in transcribed mRNA molecules; 5'-ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon", the “start codon” or the “AUG start codon”.
  • a minority of genes have a translation initiation codon having the RNA sequence 5'-GUG, 5 -UUG, or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG have been shown to function in vivo.
  • translation initiation codon and “start codon” can encompass many codon sequences even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
  • start codon and “translation initiation codon” as used herein refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding, for example, ⁇ 4 integrin chain of VLA-4 or ⁇ 4 ⁇ 7 integrin, regardless of the sequence(s) of such codons.
  • a “translation termination codon” also referred to a “stop codon” may have one of three RNA sequences: 5'-UAA, 5'-UAG and 5'-UGA (5'-TAA, 5'-TAG and 5'-TGA, respectively in the corresponding DNA molecule).
  • the terms "translation termination codon” and “stop codon” as used herein refer to the codon or codons that are used in vivo to terminate translation of an mRNA transcribed from a gene encoding the ⁇ 4 integrin chain of VLA-4 or ⁇ 4 ⁇ 7 integrin, regardless of the sequence(s) of such codons.
  • start codon region and “translation initiation codon region” refer to a portion of the mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from the translation initiation codon.
  • stop codon region and “translation termination codon region” refer to a portion of the mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from the translation termination codon. Consequently, the "start codon region” or “translation initiation codon region” and the “stop codon region” or “translation termination codon region” are all regions which may be targeted effectively with the antisense oligonucleotides of the present disclosure.
  • ORF open reading frame
  • coding region which is known in the art to refer to the region between the translation initiation codon and the translation termination codon, is also a region which may be targeted effectively.
  • the intragenic region encompassing the translation initiation or termination codon of the ORF of a gene is targeted.
  • target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of the mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of the mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3'UTR), known in the art to refer to the portion of the mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of the mRNA (or corresponding nucleotides on the gene).
  • 5'UTR 5' untranslated region
  • 3'UTR 3' untranslated region
  • the 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage.
  • the 5' cap region of an mRNA is considered to include the 5' cap structure itself, as well as the first 50 nucleotides adjacent to the cap site. In one embodiment, the 5' cap region is targeted.
  • mRNA transcripts Although some eukaryotic mRNA transcripts are directly translated, many contain one or more regions, known as "introns,” which are excised from a transcript before it is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. mRNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts". In some embodiments, introns, or splice sites, that is, intron-exon junctions or exon-intron junctions, or aberrant fusion junctions due to rearrangements or deletions are targeted. Alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants”.
  • Pre-mRNA variants are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence. Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller "mRNA variants". Consequently, mRNA variants are processed pre- mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as "alternative splice variants". If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
  • Variants can be produced through the use of alternative signals to start or stop transcription, that is through use of an alternative start codon or stop codon.
  • Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as "alternative start variants" of that pre-mRNA or mRNA.
  • Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre-mRNA or mRNA.
  • One specific type of alternative stop variant is the "polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the "polyA stop signals" by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites.
  • the pre-mRNA or mRNA variants are targeted.
  • target segment The location on the target nucleic acid to which the antisense oligonucleotide hybridizes is referred to as the "target segment".
  • target segment is defined as at least an 8-nucleobase portion of a target region to which an antisense oligonucleotide is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.
  • antisense oligonucleotides are chosen which are sufficiently complementary to a target segment, that is, antisense oligonucleotides that hybridize sufficiently well and with sufficient specificity, to give the desired effect.
  • the target segment may also be combined with its respective complementary antisense oligonucleotide to form stabilized double- stranded (duplexed) oligonucleotides.
  • double stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation, as well as RNA processing via an antisense mechanism.
  • the double-stranded moieties may be subject to chemical modifications (Fire et al., 1998; Timmons and Fire, 1998; Timmons et al., 2001; Tabara et al., 1998; Montgomery et al., 1998; Tuschl et al., 1999; Elbashir et al., 2001a; Elbashir et al., 2001b).
  • double-stranded moieties have been shown to inhibit the target by the classical hybridization of antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., 2002).
  • Oligonucleotides of the disclosure may be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, resulting in, for example, liposomes, receptor -targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
  • Oligonucleotides of the disclosure may be administered in a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier refers to molecular entities that do not produce an allergic, toxic or otherwise adverse reaction when administered to a subject, particularly a mammal, and more particularly a human.
  • the pharmaceutically acceptable carrier may be solid or liquid.
  • compositions include, but are not limited to, diluents, solvents, surfactants, excipients, suspending agents, buffering agents, lubricating agents, adjuvants, vehicles, emulsifiers, absorbants, dispersion media, coatings, stabilizers, protective colloids, adhesives, thickeners, thixotropic agents, penetration agents, sequestering agents, isotonic and absorption delaying agents that do not affect the activity of the active agents of the disclosure.
  • the pharmaceutical carrier is water for injection (WFI) and the pharmaceutical composition is adjusted to pH 7.4, 7.2-7.6.
  • WFI water for injection
  • the salt is a sodium or potassium salt.
  • the oligonucleotides may contain chiral (asymmetric) centers or the molecule as a whole may be chiral.
  • the individual stereoisomers (enantiomers and diastereoisomers) and mixtures of these are within the scope of the present disclosure.
  • Oligonucleotides of the disclosure may be pharmaceutically acceptable salts, esters, or salts of the esters, or any other compounds which, upon administration are capable of providing (directly or indirectly) the biologically active metabolite.
  • pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the antisense oligonucleotides that retain the desired biological activities of the parent compounds and do not impart undesired toxicological effects upon administration. Examples of pharmaceutically acceptable salts and their uses are further described in US 6,287,860.
  • Oligonucleotides of the disclosure may be prodrugs or pharmaceutically acceptable salts of the prodrugs, or other bioequivalents.
  • the term "prodrugs” as used herein refers to therapeutic agents that are prepared in an inactive form that is converted to an active form (i.e.., drug) upon administration by the action of endogenous enzymes or other chemicals and/or conditions.
  • prodrug forms of the oligonucleotides of the disclosure are prepared as SATE [(S acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510, WO 94/26764 and US 5,770,713.
  • a prodrug may, for example, be converted within the body, e.g., by hydrolysis in the blood, into its active form that has medical effects.
  • Pharmaceutical acceptable prodrugs are described in T. Higuchi and V. Stella, Prodrugs as Novel Delivery Systems, Vol. 14 of the A. C. S. Symposium Series (1976); "Design of Prodrugs” ed. H. Bundgaard, Elsevier, 1985; and in Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987, which are incorporated herein by reference.
  • Those skilled in the art of organic chemistry will appreciate that many organic compounds can form complexes with solvents in which they are reacted or from which they are precipitated or crystallized. These complexes are known as "solvates”. For example, a complex with water is known as a "hydrate”.
  • the term "combination" in the context of the administration of a therapy refers to the use of more than one therapy or therapeutic agent.
  • the use of the term “in combination” does not restrict the order in which the therapies or therapeutic agents are administered to a subject.
  • a therapy or therapeutic agent can be administered prior to, concomitantly with, or subsequent to the administration of a second therapy or therapeutic agent to a subject.
  • combination therapy methods for treating a muscular dystrophy in a subject in need thereof by administering or having administered:
  • the dystrophin gene is a human dystrophin gene and the CD49d is a human CD49d (mRNA to be targeted).
  • the dystrophin gene is a non-human primate, mouse, rat, or canine ortholog of the human dystrophin gene and CD49d is a non-human primate, mouse, rat, or canine ortholog of the human CD49 mRNA being targeted.
  • a method for treating a muscular dystrophy in a human subject in need thereof includes administering or having administered to the human subject:
  • a therapeutically effective amount of a second oligonucleotide an oligonucleotide that targets human CD49d and comprises the structure:
  • each of the 19 internucleotide linkages of the oligonucleotide is an 0,0- linked phosphorothioate diester; b) the nucleotides at the positions 1 to 3 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; c) the nucleotides at the positions 4 to 12 from the 5' end are 2'- deoxyribonucleosides; d) the nucleotides at the positions 13 to 20 from the 5' end are 2'-O-(2- methoxyethyl) modified ribonucleosides; and e) all cytosines are 5-methylcytosines ( Me C).
  • the above treatment methods are used for improving muscle function or delaying decline in muscle function in a subject suffering from a muscular dystrophy.
  • an improvement in muscle function can be assessed by any of a number of art- recognized tests or endpoints (e.g., loss of force over a series of eccentric contractions).
  • an improvement in muscle function is at least about 1% to about 80%, e.g., 3%, 5%, 7%, 8%, 10%, 12%, 15%, 20%, 22%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or another level of improvement in muscle function from at least 1% to about 80% improvement.
  • the level of at least partially functional dystrophin protein or mRNA encoding the at least partially functionally dystrophin protein is increased by at least 1% to about 80% higher relative to the level in the absence of the treatment methods disclosed herein, e.g., 3%, 5%, 7%, 8%, 10%, 12%, 15%, 20%, 22%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, or another increase in level from at least about 1% to about 80% higher relative to the level in the absence of the treatment.
  • exon skipping is to induce exon skipping of one or more of human dystrophin gene exons 8, 43, 44, 45, 50, 51, 52, 53, or 55. In some preferred embodiments, exon skipping is in human dystrophin gene exon 45, exon 51, or exon 53.
  • the nucleotide sequence of an exon skipping oligonucleotide to be administered comprises or consists of SEQ ID NO:2
  • the nucleotide sequence of an exon skipping oligonucleotide to be administered comprises or consists of SEQ ID NO:3 or SEQ ID NO:4.
  • the nucleotide sequence of an exon skipping oligonucleotide to be administered comprises or consists of SEQ ID NO:5
  • the exon skipping oligonucleotide to be used in the treatment methods disclosed herein is a: phosphorodiamidate morpholino oligomer (PMO), a 2’-O-Methyl Phosphorothioate oligomer (2OMePS), a 2’-O-methoxyethyl (2’MOE) oligomer, a peptide-conjugated PMO, a polypeptide-conjugated PMO, or an antibody-conjugated PMO.
  • PMO phosphorodiamidate morpholino oligomer
  • 2OMePS 2’-O-Methyl Phosphorothioate oligomer
  • 2’MOE 2’-O-methoxyethyl
  • the exon skipping oligonucleotide is an antibody-conjugated PMO
  • the antibody is an antibody (e.g., an Fab fragment) against the transferrin receptor, which can promote tissue-selective delivery of the conjugated oligonucleotide into muscle.
  • the method comprises administering the exon skipping oligonucleotide as the pharmaceutical composition Exondys 51.
  • the method comprises administering the exon skipping oligonucleotide as the pharmaceutical composition Vyondis 53 or Viltepso, respectively.
  • the method comprises administering the exon skipping oligonucleotide as the pharmaceutical composition Amondys 45.
  • an antisense oligonucleotide against CD49d is used in combination with a small molecule stop codon read through drug, which rather than promoting exclusion of an exon comprising a premature stop codon (i.e.., a nonsense mutation), permits ribosomal read -through past the stop codon to continue translation of a functional dystrophin protein.
  • a translational readthrough inducing drug is Ataluren (Translarna - CAS No. 775304-57-9), which has the following formula:
  • a suitable dose of Ataluren in combination therapy with the CD49d antisense oligonucleotide described herein is about 15 mg/kg to about 50 mg/kg for each dosing day, e.g., 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, or another dose from about 15 mg/kg to about 50 mg/kg per dosing day.
  • Ataluren is administered orally every day in three doses.
  • a treatment method disclosed herein includes periodic administration of the first oligonucleotide (dystrophin exon skipping) or the second oligonucleotide (antisense to CD49d).
  • the frequency of the periodic administration is: (i) one to four times per week; (ii) one to three times per two weeks; or (iii) one to three times per month.
  • the frequency of administration is once per week.
  • both the first and the second are administered periodically.
  • the frequency of administration of the first and second oligonucleotides are the same. In other embodiments the frequency of administration of the first and second oligonucleotides are different.
  • first and second oligonucleotides are administered at the same time. In other embodiments the first and second oligonucleotides are administered at less than a day apart, one day apart, or multiple days apart. In other embodiments the frequencies of administration of the first and the second oligonucleotides are as per standard treatment or lower frequency. Standard treatment refers to currently approved dosing regimes for the intended form of muscular dystrophy.
  • the first or second oligonucleotide is administered as a pharmaceutical composition comprising a pharmaceutically acceptable carrier (e.g., a physiological buffer) and having a pH of about 7.2 to about 7.6.
  • a pharmaceutically acceptable carrier e.g., a physiological buffer
  • the first and second oligonucleotides are co-administered as a single pharmaceutical composition.
  • the oligonucleotide compositions of the disclosure are administered systemically.
  • systemic administration is a route of administration that is either enteral or parenteral.
  • enteral refers to a form of administration that involves any part of the gastrointestinal tract and includes oral administration of, for example, an oligonucleotide in tablet, capsule or drop form; gastric feeding tube, duodenal feeding tube, or gastrostomy; and rectal administration of, for example, a CD49d antisense oligonucleotide in suppository or enema form.
  • parenteral includes administration by injection or infusion. Examples include, intravenous (into a vein), intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), subcutaneous (under the skin), intrathecal (into the spinal canal), intraperitoneal (infusion or injection into the peritoneum), transdermal (diffusion through the intact skin), transmucosal (diffusion through a mucous membrane), or inhalational.
  • the exon skipping oligonucleotide, antisense oligonucleotide, or both are administered as single dose. In other embodiments they are administered periodically, for example, with a frequency of daily, once every two days, three, four, five, six seven, eight, nine, ten, eleven, twelve, thirteen or fourteen days, once weekly, twice weekly, three times weekly, or every two weeks, or every three weeks.
  • a therapeutically effective amount of the first oligonucleotide is about 250 mg to about 7,500 mg, e.g., 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 1000 mg, 2000 mg, 2,500 mg, 3,000 mg, 4,000 mg, 5,000 mg, 6,000 mg, 7,000 mg, 7,200 mg, or another therapeutically effective amount of the first oligonucleotide from about 250 mg to about 7,500 mg.
  • a therapeutically effective amount of the second oligonucleotide is about 5 mg to about 500 mg, e.g, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 100 mg, 120 mg, 150 mg, 160 mg, 180 mg, 200 mg, 230 mg, 250 mg, 275 mg, 300 mg, 320 mg, 350 mg, 400 mg, 450 mg, or another therapeutically effective amount of the second oligonucleotide from about 5 mg to about 500 mg.
  • the therapeutically effective amount of the first oligonucleotide is: 750 mg to 1,500 mg, 1,500 mg to 3,000 mg, 3,000 mg to 6,000 mg, and 6,000 mg to 7,500 mg; and
  • the therapeutically effective amount of the second oligonucleotide is: 10 mg to 25, 25 mg to 50 mg, 50 mg to 100 mg, 100 mg to 200 mg and 150 mg to 300 mg.
  • the first oligonucleotide is dosed (IV) at about about 30 mg/kg to about 80 mg/kg once per week.
  • a low dose of antisense oligonucleotide, exon skipping oligonucleotide, or each is administered for 3 to 6 months, such as about 25-50 mg/week for at least three to six months and then up to 12 months and chronically. In some embodiments a dose of each oligonucleotide is administered once per week.
  • dosing of each oligonucleotide is adjusted so as to provide within a treated subject a Cmax of each administered oligonucleotide in the plasma of the subject of about 3,000 ng/mL to about 11,000 ng/mL, e.g., 3,500 ng/mL, 4,000 ng/mL, 4,500 ng/mL, 5,000 ng/mL, 5,500 ng/mL, 6,000 ng/mL, 6,500 ng/mL, 7,000 ng/mL, 7,500 ng/mL, ng/mL, 8,000 ng/mL, 8,500 ng/mL, 9,000 ng/mL, 9,500 ng/mL, or another plasma Cmax of each administered oligonucleotide of about 3,000 ng/mL to about 11,000 ng/mL.
  • the administration is effective to provide a Cmin or Ctrough of each oligonucleotide in the plasma of the human subject of at least
  • 2.5 ng/mL to about 45ng/mL e.g., 3.0 ng/mL, 3.5 ng/mL, 4.0 ng/mL, 5 ng/mL,
  • ng/mL 7.5 ng/mL, 10 ng/mL, 15 ng/mL, 20 ng/mL, 25 ng/mL, 30 ng/mL, 35 ng/mL, 40 ng/mL, or another plasma Cmin or Ctrough from at least 2.5 ng/ml to about 45 ng/ml.
  • the dose of the exon skipping oligonucleotide is higher than that of the antisense oligonucleotide on a molar basis.
  • the molar ratio of administered exon skipping oligonucleotide to antisense oligonucleotide is about 1.2 to about 5.0, e.g., 1.5, 1.7, 2.0, 2.3, 2.5, 3.0, 3.5, 3.7, 4.0, 4.5, or another molar ratio of administered exon skipping oligonucleotide to antisense oligonucleotide from about 1.2 to about 5.0.
  • the dose of the antisense oligonucleotide is higher than that of the exon skipping oligonucleotide on a molar basis.
  • the molar ratio of administered antisense oligonucleotide to exon skipping oligonucleotide is about 1.2 to about 5.0, e.g., 1.5, 1.7, 2.0, 2.3, 2.5, 3.0, 3.5, 3.7, 4.0, 4.5, or another molar ratio of administered antisense oligonucleotide to exon skipping oligonucleotide from about 1.2 to about 5.0.
  • the dose of exon skipping oligonucleotide and antisense oligonucleotide are approximately equal on a molar basis.
  • a therapeutic effect such as a delay in disease progression is observable within about three months after administration of the first doses of each oligonucleotide.
  • the term "therapeutically effective amount" as used herein refers to a dose of exon skipping oligonucleotide and antisense oligonucleotide sufficient, in combination therapy, to improve one or more markers (e.g., dystrophin mRNA and/or protein levels), signs or symptoms of muscular dystrophy (e.g., loss of normalized muscle force, increased muscle fatigue, efc.) or to delay progression of muscular dystrophy in a treated subject relative to expected disease progression in an untreated subject.
  • markers e.g., dystrophin mRNA and/or protein levels
  • signs or symptoms of muscular dystrophy e.g., loss of normalized muscle force, increased muscle fatigue, efc.
  • CD49d and/or dystrophin protein levels are determined in relevant tissues, e.g., blood, skeletal muscle, or lung in the case of CD49d, and skeletal muscle (e.g., by microbiopsy) in the case of dystrophin.
  • the first or second oligonucleotide are administered as a sodium or potassium salt thereof.
  • muscular dystrophy to be treated examples include, but are not limited to, Duchenne muscular dystrophy (DMD), limb girdle muscular dystrophy (LGMD), Becker muscular dystrophy (BMD), congenital muscular dystrophy (CMD including Fukuyama Type congenital MD and congenital MD with myosin deficiency), fascio scapulohumeral, oculophayngeal, Emery-Dreifuss, and distal muscular dystrophy.
  • DMD Duchenne muscular dystrophy
  • LGMD limb girdle muscular dystrophy
  • BMD Becker muscular dystrophy
  • CMD congenital muscular dystrophy
  • fascio scapulohumeral oculophayngeal
  • Emery-Dreifuss and distal muscular dystrophy.
  • the muscular dystrophy to be treated is DMD.
  • the subject to be treated is ambulatory.
  • the subject to be treated due to the progression of the muscular dystrophy, the subject
  • first oligonucleotide or second oligonucleotide are to be administered systemically.
  • administration of the first oligonucleotide or second oligonucleotide (or both) is: subcutaneous administration, oral administration, intravenous administration, or intramuscular administration.
  • a treatment disclosed herein also includes administering glycine or dantrolene. While not wishing to be bound by theory, it is believe that glycine enhances proliferation of muscle satellite cells (stem cells), which consequently enhances uptake of the administered oligonucleotides. Dantrolene decreases muscle spasticity by reducing excitation-contraction coupling.
  • any of the combination treatments disclosed herein can also include or be supplement with conventional therapies (including palliative treatments) for a muscular dystrophy as described below.
  • Corticosteroid therapy is the mainstay of DMD treatment in ambulatory patients.
  • Corticosteroid refers to any one of several synthetic or naturally occurring substances with the general chemical structure of steroids that mimic or augment the effects of the naturally occurring corticosteroids.
  • Examples of synthetic corticosteroids include prednisone, prednisolone (including prednisone a precursor to prednisolone, methylprednisolone), dexamethasone triamcinolone, budesonide, and betamethasone.
  • the treatment of the present invention for a muscular dystrophy in a human subject comprises administering to the subject an effective amount of a dystrophin gene exon skipping oligonucleotide and an antisense oligonucleotide to CD49d (alpha chain of VLA-4), and further comprising administering to the subject an effective amount of a corticosteroid.
  • the corticosteroid is prednisone (or a prednisone equivalent), deflazacort (a derivative or prednisolone).
  • Other corticosteroids are known in the art as mentioned above.
  • Combined administration herein includes co-administration, using separate formulations (or a single pharmaceutical formulation), and consecutive administration in either order, wherein generally there is a time period while both (or all) active agents simultaneously exert their biological activities.
  • Corticosteroid treatment at standard doses is used in DMD patients while they are ambulatory as it has been shown to have some effect in maintaining ambulation in some patients.
  • Prolonged treatment at standard doses (0.75 mg/kg/day prednisone or 0.9 mg/kg/day deflazacort) however can result in muscle atrophy and/or has other side effects.
  • combination antisense treatment to CD49d and dystrophin exon skipping oligonucleotide treatment in conjunction with corticosteroid treatment, including reduced levels of corticosteroid treatment, in non-ambulatory subjects will reduce or delay loss of muscle function.
  • subjects initially treated with corticosteroids delay administration of corticosteroids approximately 24 hours prior to administration of the antisense oligonucleotide and exon skipping oligonucleotides described herein. This allows samples collected to be assessed for the effects of the antisense oligonucleotide in combination with the exon skipping oligonucleotide independently of the effects of a corticosteroid, as the corticosteroid would not be present in significant levels in the blood stream at 24 hours without further administration of a corticosteroid.
  • the mutation in the mdx mouse is a nonsense point mutation (C-to-T transition) in exon 23 that aborts full- length dystrophin expression.
  • the PMO used to skip exon 23 has the nucleotide sequence corresponding to SEQ ID NO: 6.
  • the antisense oligonucleotide against mouse CD49d RNA is a gapmer having the nucleotide sequence corresponding to SEQ ID NO:7 (ISIS 348574):
  • the scrambled mismatch negative control gapmer oligonucleotide is SEQ ID NO:8 (ISIS 358342) and has an 8 base mismatch compared to SEQ ID NO:7.
  • the extensor digitorum longus (EDL) muscle was then subjected to a number of ex vivo assays to assess force frequency (FF) characteristics including FF maximum force, FF specific maximum force (i.e., the FF maximum force corrected for size, mass, and cross sectional area of the EDL muscle) and the loss of force following a series of 1 to 10 eccentric contractions induced muscle damage by the stretching of the muscle by 10% (or equivalent eccentric muscle force remaining following induced damage to the EDL). Differences between groups were assessed for significance by one way ANOVA.
  • the EDL is a muscle in the front of the lower leg and functions to extend the 4 four toes, and is 1 of 4 muscles which function to invert the foot at the ankle, another being the tibialis anterior (TA).
  • a and 3B indicated the combination of ASO to CD49d and exon skip oligonucleotide (Group 6) (AUC -620) was statistically superior to the scrambled oligonucleotide control group (AUC -540), and the exon skip alone (AUC -560) (indicating an improvement compared to exon skip treatment) and saline control (AUC -510).
  • the Group 6 combination treatment was not statistically different compared to the ASO to CD49d (monotherapy AUC -580).
  • the ASO to CD49d monotherapy was statistically improved compared to saline (AUC -510) and the MM control (AUC -540), and the exon skip monotherapy group 3 (AUC -560) was improved vs the saline control (-510).
  • ATL1102 is administered to ambulant boys 10 years or older with DMD already on treatment with either Exondys 51, Vyondis 53, Viltepso or Amondys 45 or Ataluren.
  • ATL1102 is administered 25 to 50 mg sc once weekly.
  • Boys with DMD 10 years of age can weigh approx, between 20-50 kg so these ATL1102 doses correspond to 0.5mg/kg to 2.5 mg/kg in these boys.
  • Boys with DMD 12 yrs of age can weigh approx, between 25-75kg, so these ATL1102 doses correspond to 0.67mg/kg to 1 mg/kg.
  • ATL1102 is administered weekly at 25 to 50 mg to young ambulant paediatric boys 7-9 years old with DMD on treatment with Exondys 51, Vyondis 53, Viltepso or Amondys 45 or Ataluren.
  • Boys with DMD 7 years of age can weigh approx, between 20-30kg so these ATL1102 doses correspond to 0.83mg/kg to 2.5 mg/kg in these boys and boys with DMD 9 yrs of age can weigh approx, between 20-45kg, so these ATL1102 doses correspond to 0.56mg/kg to 2.5 mg/kg.
  • ATL1102 is administered weekly at 10, 25 mg to young ambulant paediatric boys 4-6 years old with DMD on treatment with Exondys 51, Vyondis 53, Viltepso or Amondys 45 or Ataluren.
  • Boys with DMD 4 years of age can weigh approx, between 10-20kg so these ATL1102 doses correspond to 0.5mg/kg to 2.5 mg/kg in these boys and boys with DMD 6 yrs of age can weigh approx., between 15-25kg, so these ATL1102 doses correspond to 0.67mg/kg to 1 mg/kg.
  • ATL1102 can be dosed for 12 up to 24 weeks in combination and if safe in combination extended to 48 weeks in combination.
  • ATL1102 may be given the day before the iv infusion of the exon skipping drug, though different regimens are also viable. Though drugs may not interact as they are not similarly charged, it may be worth avoiding Cmax concentration of the morpholino, and the ATL1102 as would be known in the art based on pharmacokinetics of each drug and chemistry.
  • the ATL1102 may also be similarly given ahead of the first daily dose, second or third daily dose of Ataluren or after Ataluren dosing.
  • the patient studies may be studies assessing just the use of ATL1102 with eterplirsen, or one or more of the other exon splicing drugs.
  • the effects of the administered oligonucleotide ATL1102 can be assessed for motor/muscle function and inflammatory and fibrosis markers or for muscle degeneration-regeneration markers. Effects may be detected in situ with MRI, or samples such as in plasma, urine, or muscle biopsy with a muscle biopsy preferably also used to measure dystrophin levels in the combination compared to exon skipping drug or to corticosteroid used alone.
  • Ambulant paediatric boys may be good walkers or poor walkers. Maintenance or reducing the loss of walking capacity may be assessed by the methods known to those skilled in the art.
  • This data may be compared to baseline data and/or historical data collected from the same boys earlier and/or from historical data in a matched group of subjects. More preferably effects are compared to a standard of care CS control subject group or standard of care CS together with Exondys 51, Vyondis 53, Viltepso or Amondys 45 or Ataluren.
  • Inspiratory and expiratory pressures, peak cough flow, FVC may also be assessed to evaluate change in respiratory performance.
  • Percent change in normalized upper extremity reachable surface area, percent change in Performance of the Upper Limb Assessment score PUL2.0, percent change in Person-Reported Outcome Measure Upper Limb (PROM-UL) functional capacity score may be used to assess muscle function. Also for effects on heart function. Quality of life questionnaires are also useful in determining the effect of treatments.
  • Corticosteroid dosed daily, or less frequently may be administered at 0.75mg/kg/day and Deflazacort 0.9 mg/kg/day as standard therapies for ambulant DMD patients, at two thirds standard doses, half the dose, or a third the dose.
  • Exondys 51, Vyondis 53, Viltepso or Amondys 45 or Ataluren may be dosed half or a third or a quarter less frequently i.e once every fortnight to three or four weeks with the morpholino drug, and once or twice daily for Ataluren.
  • Patient studies can be conducted with either one of the Exon splicing drugs chosen based on the subjects mutation, or more based on the subjects mutation.
  • non-ambulant 14 DMD patients 12 to 18 years of age receive ATL1102 at a starting dose of 25 or 50mg per week for 24 weeks in combination with Exondys 51, Vyondis 53, Viltepso or Amondys 45 or Ataluren and another 14 DMD boys continue of corticosteroid.
  • assessments are at baseline, and every two weeks for safety, including injection sites reactions, platelet changes, liver enzyme GGT -bilirubin, CRP and albumin, A/G ratio changes.
  • the number of circulating lymphocytes, CD4+ and CD8+ T cells, and CD49d T cells and the number of NK and CD49d+ NK cells determined 3 days post ATL1102 treatment, with samples taken ahead of the daily dose of CS, and compared to baseline blood sample also taken ahead of the daily dose of CS and exon skipping drug or read through drug.
  • Clinical assessments are measures of upper limb function PUL2.0, and grip and pinch strength, and functional capacity, quality of life, and respiratory markers and MRI assessment of muscle fibrosis, fat inflammation-oedema and atrophy and pharmacokinetics.
  • Exploratory outcome measures include serum / plasma biomarker sVCAM-1, LTBP4, Thrombospondin- 1, as those are related to effects of ATL1102 and muscle inflammation muscle fibrosis, muscle apoptosis/degeneration, and muscle regeneration.
  • the 14 non-ambulant DMD patients 10 to 18 years can continue to dose 25 mg or 50mg once weekly for a further 24 weeks in combination and boys on control treatments placed on the combinations and monitored for benefits of longer dosing .
  • Efficacy endpoints for clinical assessments are upper limb function as measured by by PUL-2 (performance of upper limb module for DMD 2.0) and upper limb strength as measured by myoset (myogrip, myopinch), or functional capacity, quality of life, and respiratory markers, and cardiac markers, and MRI assessment of muscle fibrosis, fat inflammation-oedema and atrophy and pharmacokinetics.
  • Serum / plasma biomarker response such as those related to muscle inflammation, muscle fibrosis, muscle apoptosis/degeneration, and muscle regeneration and mononuclear cell assessed. Studies reported previously using ATL1102 or the exon skipping drugs, or ataluren may be used to determine the most appropriate endpoints.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Neurology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des compositions et des procédés de combinaison pour le traitement d'une dystrophie musculaire (par exemple, la dystrophie musculaire de Duchenne) qui utilisent un oligomère pour induire le saut d'un exon de dystrophine en combinaison avec un oligomère antisens à CD49d.
PCT/AU2024/050052 2023-02-01 2024-01-30 Compositions et procédés de combinaison pour le traitement de la dystrophie musculaire WO2024159266A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2023900242 2023-02-01
AU2023900242A AU2023900242A0 (en) 2023-02-01 Combination compositions and methods for treatment of Muscular Dystrophy

Publications (1)

Publication Number Publication Date
WO2024159266A1 true WO2024159266A1 (fr) 2024-08-08

Family

ID=92145532

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2024/050052 WO2024159266A1 (fr) 2023-02-01 2024-01-30 Compositions et procédés de combinaison pour le traitement de la dystrophie musculaire

Country Status (1)

Country Link
WO (1) WO2024159266A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020223762A1 (fr) * 2019-05-06 2020-11-12 Antisense Therapeutics Ltd Méthodes de traitement de la dystrophie musculaire à l'aide d'oligonucléotides inhibiteurs dirigés contre le cd49d

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020223762A1 (fr) * 2019-05-06 2020-11-12 Antisense Therapeutics Ltd Méthodes de traitement de la dystrophie musculaire à l'aide d'oligonucléotides inhibiteurs dirigés contre le cd49d

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ŁOBODA AGNIESZKA, DULAK JÓZEF: "Muscle and cardiac therapeutic strategies for Duchenne muscular dystrophy: past, present, and future", PHARMACOLOGICAL REPORTS, POLSKA AKADEMIA NAUK, INSTYTUT FARMAKOLOGII, KRAKOW, PL, vol. 72, no. 5, 1 October 2020 (2020-10-01), PL , pages 1227 - 1263, XP093199066, ISSN: 1734-1140, DOI: 10.1007/s43440-020-00134-x *
TOMINARI TSUKASA, AOKI YOSHITSUGU: "Clinical development of novel therapies for Duchenne muscular dystrophy—Current and future", NEUROLOGY AND CLINICAL NEUROSCIENCE, vol. 11, no. 3, 1 May 2023 (2023-05-01), pages 111 - 118, XP093199062, ISSN: 2049-4173, DOI: 10.1111/ncn3.12691 *

Similar Documents

Publication Publication Date Title
JP2022103192A (ja) タウ発現を調節するための組成物
AU2020260492A1 (en) Improved compositions for treating muscular dystrophy
US8637484B2 (en) Modulation of growth hormone receptor expression and insulin-like growth factor expression
JP2020511943A (ja) 筋ジストロフィーに対するエクソンスキッピングオリゴマーコンジュゲート
CN111108201A (zh) 结合至人类肌养蛋白前体mRNA的外显子51的反义寡核苷酸
EP3687547A1 (fr) Polythérapies pour traiter une dystrophie musculaire
JP2019525918A (ja) Ｓｍｎ２の調節のための化合物及び方法
NZ554277A (en) Antisense modulation of integrin alpha 4 expression
US20210145852A1 (en) Combination Therapies for Treating Muscular Dystrophy
EP3955966A1 (fr) Compositions pour le traitement de la dystrophie musculaire
CA3101228A1 (fr) Conjugues oligomeres a saut d'exon pour dystrophie musculaire
WO2019067979A1 (fr) Polythérapies pour traiter une dystrophie musculaire
AU2018421460B2 (en) Therapeutic uses and methods
JP2009516710A (ja) ｅＩＦ４Ｅ−ＢＰ２の発現のモジュレート
JP2019527549A (ja) 転写プロセシングの調節のための化合物及び方法
EP3684933A2 (fr) Oligonucléotides thiomorpholino pour le traitement de la dystrophie musculaire
CA2918787A1 (fr) Polytherapie
US20220296631A1 (en) Methods for treating muscular dystrophy using inhibitory oligonucleotides to cd49d
WO2024159266A1 (fr) Compositions et procédés de combinaison pour le traitement de la dystrophie musculaire
US20040162249A1 (en) Treatment and prevention of hyperproliferative conditions in humans and antisense oligonucleotides inhibition of human replication-initiation proteins

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24749422

Country of ref document: EP

Kind code of ref document: A1