WO2024101710A1 - 다중에피토프 펩타이드를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물 - Google Patents
다중에피토프 펩타이드를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물 Download PDFInfo
- Publication number
- WO2024101710A1 WO2024101710A1 PCT/KR2023/016335 KR2023016335W WO2024101710A1 WO 2024101710 A1 WO2024101710 A1 WO 2024101710A1 KR 2023016335 W KR2023016335 W KR 2023016335W WO 2024101710 A1 WO2024101710 A1 WO 2024101710A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- peptide
- amino acid
- acid sequence
- represented
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/08—Peptides having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/445—Non condensed piperidines, e.g. piperocaine
- A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
- A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/10—Peptides having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70539—MHC-molecules, e.g. HLA-molecules
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2818—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- This invention was made under the project number HCRI20005 and project number HCRI20005 under the support of the Biomedical Research Institute of Chonnam National University Hospital, Hwasun.
- the research management agency for the project is the Biomedical Research Institute of Chonnam National University Hospital, Hwasun, and the research project name is "In-Hospital Academic Research Project.”
- the name of the research project is "Design and synthesis of brain tumor antigen multipeptide and formulation and characterization of peptide cancer vaccine", the project carrying out organization is Chonnam National University Industry-Academic Cooperation Foundation, and the research period is 2020.01.01 ⁇ 2021.12.31.
- the present invention relates to a pharmaceutical composition for preventing or treating glioma containing a multiple epitope peptide. More specifically, the MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 It relates to a technology for using a multi-epitope peptide including the MHCI peptide and the MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3 for the purpose of preventing, improving, or treating glioma.
- Epitope refers to an 'antigen recognition site' in the structure of an antigen that can directly bind to an antibody, B cell receptor, or T cell receptor. It is also called an antigenic determinant. Typically, this includes 1 to 6 monosaccharides or 5 to 8 amino acid residues present on the antigen surface. Multi-epitope vaccines can provide immunity against various viral antigens by incorporating multiple epitopes into one vaccine.
- Glioma is a tumor that originates from glial cells inside the brain and spinal cord. Glial cells nourish and protect nerve cells and provide structural support. Most gliomas grow by infiltrating surrounding normal tissues, grow rapidly, and are difficult to completely remove through surgery. Despite active treatment such as surgery, radiation therapy, and chemotherapy, most cases recur within a short period of time and the number of deaths and new diagnoses is similar to the number of deaths each year due to the poor prognosis. More than half of the cases are malignant, and benign differentiated gliomas also tend to become malignant over time.
- Glioma accounts for 12.7% of all primary brain tumors, of which glioblastoma (GBM) accounts for approximately 5%.
- GBM glioblastoma
- glioblastoma is histologically the most malignant tumor with nuclear atypia, mitotic figures, proliferation of vascular endothelial cells, and necrosis observed.
- TAAs tumor-associated antigens
- TSAs neoantigens
- the present inventor confirmed the remarkable glioma treatment effect of the multi-epitope peptide and completed the present invention.
- the object of the present invention is a multi-epitope peptide comprising an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and an MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3;
- a pharmaceutical composition for preventing or treating glioma comprising an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and an MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3;
- Another object of the present invention is a multi-epitope peptide comprising an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and an MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3; lenalidomide; and anti-PD1 antibody; to provide a pharmaceutical composition comprising a.
- Another object of the present invention is to provide a nucleic acid encoding an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, a nucleic acid encoding an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and an MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3.
- the goal is to provide a multi-epitope peptide gene containing coding nucleic acid.
- the present invention relates to a pharmaceutical composition for preventing or treating glioma containing a multi-epitope peptide, and more specifically, to a MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and It relates to a technology for using a multi-epitope peptide including MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3 for the purpose of preventing, improving, or treating glioma.
- One aspect of the present invention includes a multi-epitope peptide comprising an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and an MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3. It relates to a pharmaceutical composition for preventing or treating glioma.
- the MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1 the MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and the MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3 are linked through a linker. It may have happened.
- the linker is 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 2 to 10, 2 to 9, It may be 2 to 8 amino acids, 2 to 7 amino acids, 2 to 6 amino acids, or 2 to 5 amino acids, for example, 2 amino acids.
- the linker is glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, methionine, aspartic acid, asparagine, glutamic acid, glutamine, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan and proline. It may be one or more types selected from the group consisting of, for example, glycine.
- the multi-epitope peptide is an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and an MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3 using a linker. It may be a dimeric fusion peptide in which each of the two molecules of the peptide bound through it forms a disulfide bond.
- the multi-epitope peptide may have the structure of structural formula 1 below.
- the pharmaceutical composition may additionally include lenalidomide and an anti-PD1 antibody.
- a pharmaceutical composition may refer to a composition incorporated into a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carriers include carriers, excipients and diluents commonly used in the pharmaceutical field, such as lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, From the group consisting of acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. There may be one or more types selected, but it is not limited thereto.
- the pharmaceutical composition is formulated in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions according to conventional methods.
- oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions according to conventional methods.
- diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
- the pharmaceutical composition can be administered by intramuscular injection or subcutaneous injection.
- Another aspect of the present invention includes a nucleic acid encoding an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, a nucleic acid encoding an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and an MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3. It relates to a multi-epitope peptide gene containing coding nucleic acid.
- the multi-epitope peptide gene includes an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and an MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3. It may be used to prepare a pharmaceutical composition for preventing or treating glioma, including a multi-epitope peptide.
- the nucleic acid may be in the form of a recombinant vector or expression vector.
- the nucleic acid encoding the MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1 is a nucleic acid represented by the nucleotide sequence of SEQ ID NO: 4, and the nucleic acid encoding the MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2
- the nucleic acid encoding the nucleotide sequence of SEQ ID NO: 5, and the nucleic acid encoding the MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3 may be the nucleic acid represented by the nucleotide sequence of SEQ ID NO: 6.
- the present invention relates to a pharmaceutical composition for preventing or treating glioma containing a multi-epitope peptide, and more specifically, to a MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and It relates to a technology for using a multi-epitope peptide including MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3 for the purpose of preventing, improving, or treating glioma.
- Figure 1a shows the structure of a multi-epitope peptide according to an embodiment of the present invention.
- Figure 1b shows an administration schedule of an immune-boosting composition according to an embodiment of the present invention.
- Figures 1c to 1e show Kaplan-Meier survival curves according to administration of the immune enhancing composition according to an example and comparative example of the present invention.
- Figures 1F to 1H show mouse tumor sizes before and after treatment according to administration of an immune enhancing composition according to an example and comparative example of the present invention.
- Figures 2a to 2o show the expression of immune cells in the spleen, lymph nodes, and tumors following administration of an immune-enhancing composition according to an example and comparative example of the present invention.
- Figures 3a to 3j show the expression of PD1 and PDL1 on immune cells and tumors according to administration of the immune enhancing composition according to an example and comparative example of the present invention.
- 4A to 4M show the production of pro-inflammatory and anti-inflammatory cytokines from restimulated spleen cells, restimulated lymph nodes, and single tumor cells following administration of an immune enhancing composition according to an example and comparative example of the present invention. It indicates the level.
- Figures 5A to 5B show the levels of IFN- ⁇ secreted from restimulated spleen cells and lymph nodes when co-cultured with target cancer cells according to administration of an immune-enhancing composition according to an example and comparative example of the present invention.
- Figures 5c to 5d show the specific killing effect of restimulated spleen cells and lymph nodes on target cancer cells according to administration of the immune enhancing composition according to an example and comparative example of the present invention.
- Figure 6 shows the viability of GL261 cell line according to lenalidomide treatment.
- the present invention provides a glioma comprising a multi-epitope peptide comprising an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and an MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3. It relates to a pharmaceutical composition for prevention or treatment.
- mice Six- to eight-week-old female C57BL/6 mice (H-2b, I-Ab) were purchased from Orient Bio (Iksan, Korea). Mice were raised under specific-pathogen-free (SPF) conditions. All animal care, experiments, and euthanasia were performed after receiving approval from the Animal Research Committee of Chonnam National University.
- SPF specific-pathogen-free
- GL261 H-2b and I-Ab, Dr. Maciej S. Lesniak, Northwestern University
- YAC-1 mouse lymphoma cell line
- DL261 cells were maintained in Dulbecco's Modified Eagle Medium (DMEM) and YAC-1 cells were maintained in Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S). It was grown in 5% CO 2 at 37°C.
- DMEM Dulbecco's Modified Eagle Medium
- FBS fetal bovine serum
- P/S penicillin-streptomycin
- Mouse BIRC5 peptide having the amino acid sequence of SEQ ID NO: 1 H-2b-restricted BIRC5 97-104: TVSEFLKL
- mouse EphA2 peptide H-2b-restricted EphA2 682-689: VVSKYKPM
- All single peptides consisting of a pan HLA-DR binding epitope I-Ab-restricted PADRE, ak-Cha-VAAWTLKAAAa-ZC
- All single peptides consisting of a pan HLA-DR binding epitope I-Ab-restricted PADRE, ak-Cha-VAAWTLKAAAa-ZC
- the long multi-epitope peptide was synthesized in the laboratory of Professor Cheol-won Lee of the Department of Chemistry at Chonnam National University.
- a long multi-epitope peptide was prepared by integrating two single peptides (BIRC5 97-104 and EphA2 682-689) with a pan HLA-DR binding epitope (PADRE).
- Binding scores of BIRC5 and EphA2 peptides were predicted from SYFPEITHI: http://www.syfpeithi.de. All peptides were dissolved in dimethyl sulfoxide (DMSO) and diluted with phosphate-buffered saline (PBS).
- Mouse anti-PD1 (clone RMP1-14) used for in vivo blocking was purchased from BioXcell (West Riverside, NH, USA).
- the amino acid sequence used is shown in Table 1, and the base sequence of the nucleic acid encoding the peptide represented by the amino acid sequence in Table 1 is shown in Table 2.
- sequence number designation Sequence (5'->3') 4 BIRC5-d accgtgagcgaatttctgaaactg 5 EphA2-d gtggtgagcaaatataaaccgatg 6 PADRE-d gcgaaatttgtggcggcgtggaccctgaaagcggcggcg
- GL261 Cultured in Dulbecco's Modified Eagle Medium (DMEM) medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S). Afterwards, cells were stained with 3-(4,5-Dimathylthiazol-2-yl)-2,5-diphenyltertazolium bromide (MTT; Sigma, USA) every 24 hours of culture for up to 5 days. For staining, plates were washed with PBS and MTT (0.5 mg/mL) was added to each well. The MTT solution was removed from each well after 4 hours of incubation. MTT formazan was dissolved in Isopropanol (Merck, Germany) and the optical density was read at 570 nm.
- DMEM Dulbecco's Modified Eagle Medium
- FBS fetal bovine serum
- P/S penicillin-streptomycin
- mice 1 ⁇ 10 5 GL261 cells in 5 ⁇ L PBS were stereotactically injected into the right striatum at a rate of 1 ⁇ L/min.
- the injection site was measured with the following coordinates: 1 mm posterior, 2 mm lateral to bregma, and 4 mm deep from the cortical surface. Mice were randomly assigned to treatment arms.
- mice were divided into six treatment groups: 1) No treatment; 2) Long multi-epitope peptide composition (Long pep); 3) Long multi-epitope peptide composition + lenalidomide (Long pep + Lena); 4) Lenalidomide + anti-PD1 antibody (Lena + anti-PD1); 5) Long multi-epitope peptide composition + lenalidomide + anti-PD1 antibody (Long pep + Lena + anti-PD1); 6) Cocktail multi-epitope peptide composition + lenalidomide + anti-PD1 antibody (Cocktail pep + Lena + anti-PD1).
- the long multi-epitope peptide composition includes MHCI peptide (BIRC5) represented by the amino acid sequence of SEQ ID NO: 1, MHCI peptide (EphA2) represented by the amino acid sequence of SEQ ID NO: 2, and MHCII peptide (PADRE) represented by the amino acid sequence of SEQ ID NO: 3. refers to a peptide composition in a bound state, and the cocktail multi-epitope peptide composition includes MHCI peptide (BIRC5) represented by the amino acid sequence of SEQ ID NO: 1, MHCI peptide (EphA2) represented by the amino acid sequence of SEQ ID NO: 2, and SEQ ID NO: 3. It refers to a peptide composition in which the MHCII peptide (PADRE) represented by the amino acid sequence is not bound.
- MHCII peptide PADRE
- mice On days 1 and 6 after injection, mice were injected intraperitoneally with lenalidomide (0.5 mg/injection). Thereafter, long multiepitope peptides or cocktail multiepitope peptides (300 ⁇ g/injection) were administered intramuscularly on days 2, 7, and 12. Mice were also administered intraperitoneal injections of the in vivo MAb anti-mouse PD1 (200 ⁇ g/injection) every 3 days (days 5, 8, 11, and 14). Overall survival was quantified. Mice were euthanized on day 20 to assess tumor size and immunological parameters in the spleen and tumor.
- Splenocytes, lymph nodes, and single tumor cells were directly isolated from the spleens, lymph nodes, and tumors of mice not treated with the composition and mice treated with the composition.
- splenocyte isolation spleens were collected and washed with RPMI medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S). The spleen was then gently pressed through a 100 ⁇ m cell strainer (Falcon, USA) while continuously adding medium using a 1 mL syringe plunger. After filtration through a 40 ⁇ m cell strainer (Falcon, USA), cells were collected and washed with medium.
- FBS fetal bovine serum
- P/S penicillin-streptomycin
- tumors and lymph nodes were collected and washed with RPMI medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S). Afterwards, the tumor was chopped into 3-4 mm pieces with a sterile scalpel. Tumor pieces or lymph nodes were incubated with collagenase type IV (0.25%; Gibco, USA) at 37°C, 5% CO 2 for 2 hours. Samples were observed and suspended at 15-minute intervals. Cells were filtered through 100 ⁇ m and 40 ⁇ m cell strainers (Falcon, USA) and single tumor cells or lymph nodes were collected. Red blood cells were removed from all samples using red blood cell lysate (Multenyi Biotech, Bergisch Gladbach, Germany).
- FBS fetal bovine serum
- P/S penicillin-streptomycin
- splenocytes, lymph nodes, and tumor single cells were stained to identify immune cells.
- cells were stained with CD45, CD3, CD4, CD8, CD44, CD62L, CD69, CD49b, CD279 (PD1), and CD274 (PDL1) for 30 min at 4°C.
- intracellular staining cells were stained with.
- Surface markers such as CD45, CD3, CD4, CD8 or CD25 were obtained by washing cells for 30 min at 4 °C and permeabilizing them with FACSTM Permeabilizing Solution 2 (BD Biosciences) for 30 min at 20-22 °C. After washing twice with permeabilization buffer, cells were stained with Foxp3 or IFN- ⁇ for 30 min at 4°C.
- protein transport inhibitor containing Brefeldin A (BD Golgi Plug TM ) containing 1 ⁇ l/1 x 10 6 cells/well was added to the wells 5 hours before intracellular staining.
- Information on all antibodies used is listed in Table 3. All samples were acquired on a BD FAC Canto II (Becton Dickinson, Mountain View, CA, USA). All data were analyzed using FlowJo v10 software (TreeStar, San Carlos, CA, USA).
- Splenocytes and lymph nodes were then restimulated according to the protocol. After the last immunization, splenocytes and lymph nodes isolated from mice not treated with the composition and mice treated with the composition were cultured in a 24 - well plate (1 /mL) for 4 hours. in RPMI-1640 (Gibco-BRL) prepared in 10% FBS with 1% P/S supplement and recombinant mouse (rm) IL-2 (20 ng/mL) (R&D Systems). Anti-PD1 (10 ⁇ g/mL) was added during restimulation. After restimulation, supernatant and cells were collected to confirm immune cell function.
- RPMI-1640 Gibco-BRL
- rm recombinant mouse
- IL-2 20 ng/mL
- Single tumor cells from the tumor were cultured in 24 well plates (1 x 10 6 cells/well) at 37°C, 5% CO 2 , and supernatants were collected for measurement of pro-inflammatory and anti-inflammatory cytokines by ELISA.
- the IFN- ⁇ secreting splenocytes and lymph nodes were examined for target cancer cells in the restimulated splenocytes and restimulated lymph nodes using the IFN- ⁇ ELISPOT assay kit (BD Biosciences). Capture-purified anti-mouse IFN- ⁇ antibody was coated on a 96-well PVDF membrane ELISPOT plate (Millipore, USA) overnight at 4°C, and then RPMI medium supplemented with 10% FBS was added to saturate the treated antibody.
- Restimulated splenocytes and restimulated lymph nodes from immunized mice were co-cultured with target cells (GL261 and YAC-1 cell lines; 2 ⁇ 10 4 cells/well) at a ratio of 1:10 (target:effector).
- the co-cultured cells were incubated in 10% FBS-RPMI medium at 37°C in 5% CO 2 for 24 hours.
- the plates were then incubated with biotinylated detection anti-mouse IFN- ⁇ antibody for 2 hours and with streptavidin-HRP for 1 hour. After washing, the spots were revealed using the AEC substrate reagent set (BD Bioscience) and measured with an automated CTL Immunospot Analyzer (Cellular Technology Ltd., USA).
- CytoTox 96 non-radioactive cytotoxicity assay (CytoTox 96, Promega, USA) was performed to analyze the killing effect of restimulated splenocyte effector cells and restimulated lymph nodes on target cancer cells according to the manufacturer's instructions.
- GL261 and YAC-1 cell lines (2 x 10 4 cells/well) were used as target cells.
- Restimulated splenocytes and restimulated lymph nodes were co-cultured with target cells at a ratio of 1:10 (target:effector) in 96-well uncoated plates (Costar, USA) for 5 h at 37 °C and 5% CO2. . Then, the supernatant was collected for determination of lactate dehydrogenase concentration.
- the levels of pro-inflammatory and anti-inflammatory cytokines released from serum, culture medium of restimulated splenocytes, restimulated lymph nodes, and single tumor cells from mice not treated with the composition and mice treated with the composition were measured using the OptEIA ELISA set. (BD Bioscience). Manufacturer's instructions.
- serum was used to analyze pro-inflammatory (IFN- ⁇ ).
- Culture media of restimulated splenocytes and restimulated lymph nodes were estimated for changes in pro-inflammatory (IL-12p70 and IFN- ⁇ ) and anti-inflammatory cytokines (IL-10), and culture media of single tumor cells. were collected and quantified of pro-inflammatory (IFN- ⁇ ) and anti-inflammatory transforming growth factor-beta (TGF- ⁇ ) and IL-10 cytokines.
- a long multi-epitope peptide was synthesized according to the structure in Figure 1a.
- the treatment schedule is shown in Figure 1B.
- Control group (24.1 days ⁇ 1 day), long multi-epitope peptide treatment group (26.9 days ⁇ 4.1 days), long multi-epitope peptide + lenalidomide treatment group (24.2 days ⁇ 1.2 days), lenalidomide + anti-PD1
- the treatment group 28.4 days ⁇ 5.8 days
- the cocktail multiepitope peptide + lenalidomide + anti-PD1 treatment group (35.1 days ⁇ 8.4 days). That is, it was confirmed that the long multi-epitope peptide + lenalidomide + anti-PD1 treatment group showed the longest survival period compared to other treatment groups.
- the long multi-epitope peptide + lenalidomide + anti-PD1 treatment group and the cocktail multi-epitope peptide + lenalidomide + anti-PD1 treatment group enhanced activated CD8 + T cells and CD4 + T cells, whereas the tumor In , only the long multi-epitope peptide + lenalidomide + anti-PD1 treatment group increased activated CD8+ T cells.
- CD8+CD44+ T cells there was a significant difference in the percentages of CD8+CD44+ T cells and CD4+CD44+ T cells between the long multiepitope peptide + lenalidomide + anti-PD1 treatment group and the cocktail multiepitope peptide + lenalidomide + anti-PD1 treatment group. It was observed that there was no
- Memory effector CD8+ and CD4+ T cells were measured and shown in Figures 2F to 2K. Expression of CD62L+ did not differ in activated CD8+ or CD4+ T cells. There was no difference in the percentage of CD62L ⁇ cells in total CD8+CD44+ or CD4+CD44+ T cells in the spleen, lymph nodes, and tumors. However, memory effector CD8+ and CD4+ T cells were enhanced along with enhancement of activated effector CD8+ and CD4+ T cells.
- CD8+CD44+CD62L- T cells and CD4+CD44+CD62L- T cells between the long multi-epitope peptide + lenalidomide + anti-PD1 treatment group and the cocktail multi-epitope peptide + lenalidomide + anti-PD1 treatment group. No significant difference in the percentage of cells was observed.
- the cocktail multi-epitope peptide + lenalidomide + anti-PD1 treatment group also improved the expression of PDL1 in the tumor.
- the levels of IFN- ⁇ in restimulated splenocytes, restimulated lymph nodes, tumors, and serum were measured and shown in Figures 4c to 4f.
- serum there was no significant difference in the level of IFN- ⁇ between each treatment group.
- IL-10 levels were measured in restimulated splenocytes, restimulated lymph nodes, and tumors and are shown in Figures 4G-4I.
- IL was significantly improved in the long multiepitope peptide + lenalidomide + anti-PD1 treatment group or the cocktail multiepitope peptide + lenalidomide + anti-PD1 treatment group compared to the control group.
- CTL and NK cell function in restimulated splenocytes and lymph nodes.
- the present invention relates to a pharmaceutical composition for preventing or treating glioma containing a multi-epitope peptide, and more specifically, to a MHCI peptide represented by the amino acid sequence of SEQ ID NO: 1, an MHCI peptide represented by the amino acid sequence of SEQ ID NO: 2, and It relates to a technology for using a multi-epitope peptide including MHCII peptide represented by the amino acid sequence of SEQ ID NO: 3 for the purpose of preventing, improving, or treating glioma.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Toxicology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
본 발명은 다중에피토프 펩타이드를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물에 관한 것으로서, 더욱 상세하게는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드를 이용하여 신경교종의 예방, 개선 또는 치료 용도로 사용하는 기술에 관한 것이다.
Description
본 발명은 화순전남대학교병원 의생명연구원의 지원 하에서 과제고유번호 HCRI20005, 과제번호 HCRI20005에 의해 이루어진 것으로서, 상기 과제의 연구관리전문기관은 화순전남대학교병원 의생명연구원, 연구사업명은 "원내학술연구과제", 연구과제명은 "뇌종양항원 멀티펩티드 설계 및 합성과 펩티드 암백신의 제형화 및 특성분석", 과제수행기관은 전남대학교 산학협력단, 연구기간은 2020.01.01 ~ 2021.12.31이다.
본 발명은 다중에피토프 펩타이드 (Multiple epitope peptide)를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물에 관한 것으로서, 더욱 상세하게는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드를 이용하여 신경교종의 예방, 개선 또는 치료 용도로 사용하는 기술에 관한 것이다.
에피토프 (epitope)는 항원 (antigen)의 구조에서 항체 (antibody), B 림프구 수용체 (B cell receptor), 또는, T 림프구 수용체 (T cell receptor)와 직접적으로 결합할 수 있는 '항원인식부위'를 의미하며, 항원결정부위 (antigenic determinant)라고도 부른다. 일반적으로 항원 표면에 존재하는 1~6개의 단당류 (monosaccharides) 또는 5~8개의 아미노산 잔기가 이에 해당한다. 다중에피토프 백신은 여러 개의 에피토프를 하나의 백신으로 넣어 다양한 바이러스 항원에 대한 면역력을 제공할 수 있다.
신경교종 (glioma)은 뇌와 척수의 내부에 있는 신경교세포에서 기원하는 종양이다. 신경교세포는 신경세포에 영양을 공급하고 보호하며, 구조적으로 지지작용을 한다. 신경교종의 대부분은 주위 정상 조직에 침투하여 자라고, 빠른 성장을 보이며, 수술로 완전 제거가 어렵다. 수술, 방사선치료, 항암화학요법 등 적극적인 치료에도 불구하고 대부분의 경우 단시간 내에 재발하며 예후가 나쁜 종양으로 매년 사망하는 수와 새로 진단되는 수가 비슷하다. 반 이상이 악성이며 양성인 분화형 신경교종도 시간이 지나면 악성화되는 경향이 있다.
신경교종은 전체 원발성 뇌종양의 12.7%를 차지하며 이 중 교모세포종 (glioblastoma; GBM)이 약 5%를 차지한다. 교모세포종은 뇌의 교세포에서 발생한 종양 중 조직학적으로 핵의 비정형성, 유사분열상, 혈관내피세포의 증식, 괴사가 관찰되는 악성도가 가장 높은 종양이다.
한편, 면역 체계가 종양을 조절하는 역할을 보여주고 면역 요법이 암 치료에 혁명을 일으켰음에도 불구하고 대부분의 임상 환경, 특히 신경교종에서 그 효능은 여전히 제한적이다. 종양 관련 항원 (TAA) 또는 신생항원 (TSA)의 수많은 펩타이드가 GBM에서 종양 특이적 T세포 반응을 증가시키는 것으로 확인되었지만, 치료 효과는 GBM 환자의 생존에 영향을 미치기에 충분하지 않다. 게다가, 개별 CD8+ T세포 에피토프만을 사용하는 백신 처리 전략은 유의미한 임상 반응을 일으키지 않는다.
따라서 CD4+ 및 CD8+ T세포를 모두 자극하여 신경교종의 치료 효과를 증대할 수 있는 새로운 치료제의 개발이 요구되는 실정이다.
이에 본 발명자는 다중에피토프 펩타이드의 현저한 신경교종 치료 효과를 확인하고 본 발명을 완성하게 되었다.
본 발명의 목적은 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드;를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드; 레날리도마이드; 및 항-PD1 항체;를 포함하는 약제학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 코딩하는 핵산을 포함하는 다중에피토프 펩타이드 유전자를 제공하는 것이다.
본 발명은 다중에피토프 펩타이드를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물에 관한 것으로서, 더욱 상세하게는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드를 이용하여 신경교종의 예방, 개선 또는 치료 용도로 사용하는 기술에 관한 것이다.
이하 본 발명을 더욱 자세히 설명하고자 한다.
본 발명의 일 양태는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드;를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물에 관한 것이다.
본 발명의 일 구체예에서, 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 상기 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 상기 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드는 링커를 통해 결합된 것일 수 있다.
본 발명의 일 구체예에서, 링커는 1 내지 10개, 1 내지 9개, 1 내지 8개, 1 내지 7개, 1 내지 6개, 1 내지 5개, 2 내지 10개, 2 내지 9개, 2 내지 8개, 2 내지 7개, 2 내지 6개, 또는 2 내지 5개, 예를 들어, 2개의 아미노산인 것일 수 있다.
본 발명의 일 구체예에서, 링커는 글라이신, 알라닌, 발린, 류신, 이소류신, 트레오닌, 세린, 시스테인, 메티오닌, 아스파르트산, 아스파라긴, 글루탐산, 글루타민, 리신, 아르기닌, 히스티딘, 페닐알라닌, 티로신, 트립토판 및 프롤린으로 이루어진 군에서 선택된 1종 이상, 예를 들어, 글라이신인 것일 수 있다.
본 발명의 일 구체예에서, 다중에피토프 펩타이드는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드가 링커를 통해 결합된 펩타이드 각 두 분자가 이황화 결합을 형성하고 있는 이량체 융합 펩타이드인 것일 수 있다.
본 발명의 일 구체예에서, 다중에피토프 펩타이드는 하기 구조식 1의 구조를 갖는 것일 수 있다.
[구조식 1]
본 발명의 일 구체예에서, 약제학적 조성물은 레날리도마이드 및 항-PD1 항체를 추가적으로 포함하는 것일 수 있다.
본 발명에 있어서, 약제학적 조성물은 약학적으로 허용될 수 있는 담체에 혼입시킨 형태의 조성물을 의미할 수 있다.
본 발명에 있어서, 약학적으로 허용될 수 있는 담체는 제약 분야에서 통상적으로 사용되는 담체, 부형제 및 희석제를 포함하며, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤 라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로스, 메틸 셀룰로스, 폴리비닐피롤리돈, 물, 메틸히드록시벤조 에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유로 이루어진 군에서 선택되는 1종 이상인 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 약제학적 조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀전, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 또는 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 제제화할 경우에는 통상 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다.
본 발명에 있어서, 약제학적 조성물은 근육 주사 또는 피하 주사에 의해 투여될 수 있다.
본 발명의 다른 양태는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 코딩하는 핵산을 포함하는 다중에피토프 펩타이드 유전자에 관한 것이다.
본 발명의 일 구체예에서, 다중에피토프 펩타이드 유전자는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드;를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물을 제조하기 위해 사용되는 것일 수 있다.
본 발명의 일 구체예에서, 핵산은 재조합 벡터 또는 발현 벡터 형태인 것일 수 있다.
본 발명의 일 구체예에서, 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산은 서열번호 4의 염기서열로 표시되는 핵산, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산은 서열번호 5의 염기서열로 표시되는 핵산, 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 코딩하는 핵산은 서열번호 6의 염기서열로 표시되는 핵산인 것일 수 있다.
본 발명은 다중에피토프 펩타이드를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물에 관한 것으로서, 더욱 상세하게는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드를 이용하여 신경교종의 예방, 개선 또는 치료 용도로 사용하는 기술에 관한 것이다.
도 1a는 본 발명의 일 실시예에 따른 다중에피토프 펩타이드의 구조를 나타낸 것이다.
도 1b는 본 발명의 일 실시예에 따른 면역증강 조성물의 투여 스케쥴을 나타낸 것이다.
도 1c 내지 1e는 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른 Kaplan-Meier 생존 곡선을 나타낸 것이다.
도 1f 내지 1h는 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른 치료 전후의 마우스 종양 크기를 나타낸 것이다.
[규칙 제91조에 의한 정정 20.10.2023]
도 2a 내지 2o는 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른 비장, 림프절 및 종양에서의 면역세포의 발현을 나타낸 것이다.
도 2a 내지 2o는 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른 비장, 림프절 및 종양에서의 면역세포의 발현을 나타낸 것이다.
[규칙 제91조에 의한 정정 20.10.2023]
도 3a 내지 3j는 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른 면역세포 및 종양에 대한 PD1 및 PDL1의 발현을 나타낸 것이다.
도 3a 내지 3j는 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른 면역세포 및 종양에 대한 PD1 및 PDL1의 발현을 나타낸 것이다.
[규칙 제91조에 의한 정정 20.10.2023]
도 4a 내지 4m은 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른 재자극된 비장세포, 재자극된 림프절 및 단일 종양 세포로부터의 전-염증성 및 항-염증성 사이토카인의 생성 수준을 나타낸 것이다.
도 4a 내지 4m은 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른 재자극된 비장세포, 재자극된 림프절 및 단일 종양 세포로부터의 전-염증성 및 항-염증성 사이토카인의 생성 수준을 나타낸 것이다.
도 5a 내지 5b는 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른, 표적 암세포와 공동 배양될 때 재자극된 비장세포 및 림프절에서 분비되는 IFN- γ의 수준을 나타낸 것이다.
도 5c 내지 5d는 본 발명의 일 실시예 및 비교예에 따른 면역증강 조성물의 투여에 따른, 표적 암세포에 대한 재자극된 비장세포 및 림프절의 특이적 사멸 효과를 나타낸 것이다.
도 6은 레날리도마이드 처리에 따른 GL261 세포주의 생존력을 나타낸 것이다.
본 발명은 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드;를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물에 관한 것이다.
이하, 본 발명을 하기의 실시예에 의하여 더욱 상세히 설명한다. 그러나 이들 실시예는 본 발명을 예시하기 위한 것일 뿐이며, 본 발명의 범위가 이들 실시예에 의하여 한정되는 것은 아니다.
실시예 1: 재료 및 방법
1-1. 동물 및 세포주
6-8주령 암컷 C57BL/6 마우스 (H-2b, I-Ab)는 Orient Bio (한국 익산)에서 구입했다. 마우스는 SPF (specific-pathogen-free) 조건에서 키웠다. 모든 동물 관리, 실험 및 안락사는 전남대학교 동물연구위원회의 승인을 받은 후 수행되었다.
마우스 교모세포종 세포주 (GL261: H-2b 및 I-Ab, Dr. Maciej S. Lesniak, Northwestern University) 및 마우스 림프종 세포주 (YAC-1, Rockville, MD, USA)를 세포 배양에 사용하였다. GL261 세포는 DMEM (Dulbecco's Modified Eagle Medium)에서 유지되었고 YAC-1 세포는 10% 소태아혈청 (FBS) 및 1% 페니실린-스트렙토마이신 (P/S)이 보충된 Roswell Park Memorial Institute (RPMI) 1640 배지에서 37 ℃의 5% CO2에서성장되었다.
1-2. 다중에피토프 펩타이드의 합성
서열번호 1의 아미노산 서열을 갖는 마우스 BIRC5 펩타이드 (H-2b-restricted BIRC5 97-104: TVSEFLKL), 서열번호 2의 아미노산 서열을 갖는 마우스 EphA2 펩타이드 (H-2b-restricted EphA2 682-689: VVSKYKPM) 및 서열번호 3의 아미노산 서열을 갖는 pan HLA-DR 결합 에피토프 (I-Ab-restricted PADRE, ak-Cha-VAAWTLKAAa-ZC)로 구성된 모든 단일 펩타이드들은 Peptron Company (대전, 한국)에서 역상 고성능 액체 크로마토그래피 (HPLC)로 순도 95% 이상으로 상업적으로 합성되었다.
긴 다중에피토프 펩타이드는 전남대학교 화학과 이철원 교수의 연구실에서 합성되었다. 긴 다중에피토프 펩타이드는 2개의 단일 펩타이드 (BIRC5 97-104 및 EphA2 682-689)를 팬 HLA-DR 결합 에피토프 (PADRE)와 통합하여 제조되었다. BIRC5 및 EphA2 펩타이드의 결합 점수는 SYFPEITHI: http:/www.syfpeithi.de 에서 예측되었다. 모든 펩타이드를 디메틸 설폭사이드 (DMSO)에 용해시키고 인산완충식염수 (PBS)로 희석하였다. 생체 내 차단에 사용되는 마우스 항 PD1 (클론 RMP1-14) 은 BioXcell (West Lebanon, NH, USA)에서 구입했다.
사용된 아미노산 서열은 표 1과 같으며, 표 1의 아미노산 서열로 표시되는 펩타이드를 코딩하는 핵산의 염기서열은 표 2와 같다.
| 서열 번호 | 명칭 | 서열 (N->C) |
| 1 | BIRC5 | TVSEFLKL |
| 2 | EphA2 | VVSKYKPM |
| 3 | PADRE | AKFVAAWTLKAAA |
| 서열 번호 | 명칭 | 서열 (5'->3') |
| 4 | BIRC5-d | accgtgagcgaatttctgaaactg |
| 5 | EphA2-d | gtggtgagcaaatataaaccgatg |
| 6 | PADRE-d | gcgaaatttgtggcggcgtggaccctgaaagcggcggcg |
1-3. 3-(4,5-디메틸티아졸-2-일)-2,5-디페닐테트라졸륨 브로마이드 (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) 세포 생존력 분석
GL261 세포주의 증식에 대한 레날리도마이드의 효과는 MTT 분석에 의해 측정되었다. 간단히 말해서, 레날리도마이드를 다양한 용량 (2.5, 5, 10, 20 μg/mL)에 따라 처리한 GL261 (5 x 103 cells/well)을 96웰 플레이트에 파종하고 37 ℃, 5% CO2에서 10% 태아 소 혈청 (FBS) 및 1% 페니실린-스트렙토마이신 (P/S)으로 보충된 Dulbecco's Modified Eagle Medium (DMEM) 배지로 배양했다. 그 후, 세포를 3-(4,5-Dimathylthiazol-2-yl)-2,5-diphenyltertazolium bromide (MTT; Sigma, USA)로 5일까지 배양 24시간마다 염색하였다. 염색을 위해 플레이트를 PBS로 세척하고 MTT (0.5 mg/mL)를 각 웰에 첨가했다. MTT 용액은 4시간 인큐베이션 후 각 웰에서 제거되었다. MTT formazan은 Isopropanol (Merck, Germany)에 용해되었고 광학 밀도는 570 nm에서 판독되었다.
1-4. 두개 내 신경교종 마우스 모델 및 치료 일정
마우스 두개 내 모델을 확립하기 위해 5 μL PBS의 1 × 105 GL261 세포를 1 μL/min의 속도로 오른쪽 선조체에 정위 주입했다. 주사 부위는 후방 1 mm, 브레그마에서 측면 2 mm, 피질 표면에서 깊이 4 mm의 좌표로 측정되었다. 마우스를 치료 암에 무작위로 할당했다.
치료를 위해 마우스는 다음 6가지 치료 그룹으로 나누었다. 1) 무처리 (No treatment); 2) 긴 다중에피토프 펩타이드 조성물 (Long pep); 3) 긴 다중에피토프 펩타이드 조성물 + 레날리도마이드 (Long pep + Lena); 4) 레날리도마이드 + 항-PD1 항체 (Lena + anti-PD1); 5) 긴 다중에피토프 펩타이드 조성물 + 레날리도마이드 + 항-PD1 항체 (Long pep + Lena + anti-PD1); 6) 칵테일 다중에피토프 펩타이드 조성물 + 레날리도마이드 + 항-PD1 항체 (Cocktail pep + Lena + anti-PD1).
긴 다중에피토프 펩타이드 조성물은 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드 (BIRC5), 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 (EphA2) 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드 (PADRE)가 결합된 상태의 펩타이드 조성물을 의미하며, 칵테일 다중에피토프 펩타이드 조성물은 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드 (BIRC5), 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 (EphA2) 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드 (PADRE)가 결합되지 않은 상태의 펩타이드 조성물을 의미한다.
주사 후 1일 및 6일에, 마우스에 레날리도마이드(0.5 mg/주사)를 복강내 주사하였다. 그 후, 긴 다중에피토프 펩타이드 또는 칵테일 다중에피토프 펩타이드 (300 ㎍/주사)를 2일, 7일 및 12일에 근육내 투여하였다. 또한 마우스에 생체내 MAb 항-마우스 PD1 (200 ㎍/주사)의 복강내 주사를 3일마다(5, 8, 11, 14일) 투여하였다. 전반적으로 생존이 정량화되었다. 비장 및 종양에서 종양 크기 및 면역학적 매개변수를 평가하기 위해 20일째에 마우스를 안락사시켰다.
1-5. 비장세포, 림프절 및 단일 종양 세포 분리
비장세포, 림프절 및 단일 종양 세포는 조성물을 처리하지 않은 마우스 및 조성물을 처리한 마우스의 비장, 림프절 및 종양으로부터 직접 분리하였다. 비장세포 분리를 위해 비장을 수집하고 10% 소태아혈청 (FBS) 및 1% 페니실린-스트렙토마이신 (P/S)이 보충된 RPMI 배지로 세척했다. 그런 다음 1mL 주사기 플런저를 사용하여 지속적으로 배지를 추가하면서 100μm 세포 여과기 (Falcon, USA)를 통해 비장을 부드럽게 눌렀다. 40μm 셀 스트레이너 (Falcon, USA) 로 여과한 후 세포를 수집하고 배지로 세척하였다. 단일 종양 세포 및 림프절 분리를 위해 종양 및 림프절을 수집하고 10% 소 태아 혈청 (FBS) 및 1% 페니실린-스트렙토마이신 (P/S)이 보충된 RPMI 배지로 세척했다. 그 후, 종양을 멸균 메스로 3-4mm 조각으로 잘게 썬다. 종양 조각 또는 림프절을 콜라게나제 유형 IV (0.25%; Gibco, USA)와 함께 37 ℃, 5% CO2에서 2시간 동안 인큐베이션하였다. 샘플을 관찰하고 15분 간격으로 현탁했다. 세포를 100 μm 및 40 μm 세포 여과기 (Falcon, USA)로 여과하고 단일 종양 세포 또는 림프절을 수집하였다. 적혈구 용해액 (Multenyi Biotech, Bergisch Gladbach, Germany)을 사용하여 모든 샘플에서 적혈구를 제거했다.
1-6. 유세포 분석
생체 외 실험을 위해 비장세포, 림프절 및 종양 단일 세포를 염색하여 면역 세포를 확인했다. 세포 표면 염색을 위해, 세포를 4 ℃에서 30분 동안 CD45, CD3, CD4, CD8, CD44, CD62L, CD69, CD49b, CD279 (PD1), CD274 (PDL1)로 염색하였다. 세포내 염색을 위해, 세포를 다음으로 염색하였다. CD45, CD3, CD4, CD8 또는 CD25와 같은 표면 마커는 4 ℃에서 30분 동안 세포를 세척하고 FACS ™ Permeabilizing Solution 2 (BD Biosciences)로 20-22 ℃에서 30분 동안 투과했다. 세척 후 투과 완충액으로 2회, 세포를 4 ℃에서 30분 동안 Foxp3 또는 IFN-γ로 염색하였다. IFN-γ 염색을 위해, 1 ㎕/ 1 x 106 세포/웰 을 포함하는 Brefeldin A (BD Golgi Plug TM )를 함유하는 단백질 수송 억제제 세포내 염색을 위해 5시간 전에 웰을 첨가하였다. 사용된 모든 항체에 대한 정보는 표 3에 나열되어 있다. 모든 샘플은 BD FAC Canto II (Becton Dickinson, Mountain View, CA, USA)에서 획득했다. 모든 데이터는 FlowJo v10 소프트웨어 (TreeStar, San Carlos, CA, USA)를 사용하여 분석되었다.
| Name | Catalog# | Clone | Company |
| LIVE/DEADTM Fixable Dead Cell Stain Kits | L34966 | - | Invitrogen |
| Pacific BlueTM anti-mouse CD45 Antibody | 103126 | 30-F11 | BioLegend |
| PE/Cyanine7 anti-mouse CD3 Antibody | 100220 | 17A2 | BioLegend |
| PE Rat Anti-Mouse CD4 | 557308 | GK1.5 | BD PharmingenTM |
| PE Rat Anti-Mouse CD8a | 553033 | 53-6.7 | BD PharmingenTM |
| PE Rat Anti-Mouse CD49b | 553858 | DX5 | BD PharmingenTM |
| FITC Hamster Anti-Mouse CD69 | 553236 | H1.2F3 | BD PharmingenTM |
| APC Monoclonal Antibody CD44 | 17-0441-82 | IM7 | Invitrogen |
| Alexa Fluor® 647 anti-Mouse Foxp3 | 560401 | MF23 | BD PharmingenTM |
| FITC Monoclonal Antibody CD279 (PD1) | 11-9985-82 | J43 | Invitrogen |
| FITC Rat anti-Mouse CD25 | 558689 | 3C7 | BD PharmingenTM |
| FITC Rat Anti-Mouse CD62L | 553150 | MEL-14 | BD PharmingenTM |
| APC/Cyyanine7 anti-mouse IFNγ | 505850 | XMG1.2 | BioLegend |
| PE Rat Anti-Mouse CD274 | 558091 | MIH5 | BD PharmingenTM |
1-7. 혈청 수집, 비장세포 및 림프절 재자극 및 단일 종양 세포 생체 외 배양
마우스를 마취시킨 후 개흉술을 통해 천천히 심장에서 혈액을 빼냈다. 혈청을 채취하기 위해 항응고 처리 없이 상온에서 1시간 동안 보관한 후 냉장 원심분리기를 이용하여 2000 rpm으로 10분간 원심분리하여 혈전을 제거하였다. 생성된 상층액은 혈청으로 지정되어 분석을 위해 -80 ℃에서 수집 및 보관되었다.
그 다음 프로토콜에 따라 비장세포 및 림프절을 재자극했다. 마지막 면역 후 조성물을 처리하지 않은 마우스와 조성물을 처리한 마우스에서 분리한 비장세포와 림프절을 24웰 플레이트 (1 x 106 cells/well)에서 배양하고 칵테일 다중에피토프 펩타이드 또는 긴 다중에피토프 펩타이드 (30 μg/mL)로 4시간 동안 재자극했다. 1% P/S 보충제 및 재조합 마우스 (rm) IL-2 (20ng/mL) (R&D Systems)가 포함된 10% FBS에서 제조된 RPMI-1640 (Gibco-BRL)에서 일. 재자극 동안 항-PD1 (10μg/mL)을 추가했다. 재자극 후 상층액과 세포를 채취하여 면역세포 기능을 확인하였다.
종양의 단일 종양 세포를 24개의 웰 플레이트 (1 x 10 6 세포/웰)에서 37 ℃, 5% CO2, ELISA에 의한 전-염증성 및 항-염증성 사이토카인 측정을 위해 상청액을 수집하였다.
1-8. IFN-γ 방출 Enzyme-Linked ImmunoSpot (ELISPOT) 분석
IFN-γ ELISPOT assay kit (BD Biosciences)를 이용하여 재자극된 비장세포 및 재자극된 림프절의 표적 암세포에 대한 IFN-γ 분비 비장세포 및 림프절을 조사하였다. 96 웰 PVDF 멤브레인 ELISPOT 플레이트 (Millipore, USA)에 포획 정제된 항-마우스 IFN-γ 항체를 4 ℃에서 밤새 코팅한 후, 10% FBS가 보충된 RPMI 배지를 첨가하여 처리된 항체를 포화시켰다. 면역화된 마우스로부터의 재자극된 비장세포 및 재자극된 림프절을 1:10 (표적:이펙터)의 비율로 표적 세포 (GL261 및 YAC-1 세포주; 2×10 4 세포/웰)와 공동 배양하였다. 공동 배양된 세포를 10% FBS-RPMI 배지에서 5% CO2에서 37 ℃에서 24시간 동안 인큐베이션하였다. 그런 다음, 플레이트를 비오틴화 검출 항-마우스 IFN-γ 항체와 함께 2시간 동안, 스트렙타비딘-HRP와 함께 1시간 동안 인큐베이션하였다. 세척 후 AEC 기질 시약 세트 (BD Bioscience)를 사용하여 스팟을 드러내고 자동 CTL Immunospot Analyzer (Cellular Technology Ltd., USA)로 측정하였다.
1-9. LDH 방출 세포독성 분석
제조업체의 지침에 따라 재자극된 비장세포 이펙터 세포와 재자극된 림프절이 표적 암세포에 미치는 사멸 효과를 분석하기 위해 CytoTox 96 비방사성 세포독성 분석 (CytoTox 96, Promega, USA)을 수행했다. GL261 및 YAC-1 세포주 (2 x 10 4 cells/well)를 표적 세포로 사용하였다. 재자극된 비장세포와 재자극된 림프절 을 37 ℃ 및 5% CO2에서 5시간 동안 96웰 코팅되지 않은 플레이트 (Costar, USA)에서 1:10 (표적:이펙터)의 비율로 표적 세포와 공동 배양했다. 그런 다음, 젖산 탈수소효소 농도 측정을 위해 상등액을 수집했다. 특이적 용해의 평균 백분율은 다음과 같이 계산되었다: % 세포독성 = [(실험 - 이펙터 자발적 - 표적 자발적) / (목표 최대 - 표적 자발적)] × 100
1-10. 효소 결합 면역흡착제 (ELISA) 분석
혈청, 재자극된 비장세포의 배양 배지, 재자극된 림프절 및 조성물 처리를 하지 않은 마우스 및 조성물을 처리한 마우스의 단일 종양 세포에서 방출된 전-염증 및 항-염증 사이토카인의 수준을 OptEIA ELISA 세트 (BD Bioscience)에 따라 추정했다. 제조업체의 지침. 특히, 혈청을 사용하여 전-염증성 (IFN-γ)을 분석하였다. 재자극된 비장세포 및 재자극된 림프절의 배양 배지는 전-염증성(IL-12p70 및 IFN-γ) 및 항-염증성 사이토카인 (IL-10)의 변화에 대해 추정되었으며, 단일 종양 세포의 배양 배지를 수거하여 전-염증성(IFN-γ) 및 항-염증성 변형 성장 인자-베타(TGF-β) 및 IL-10 사이토카인의 정량화를 수행했다.
1-11. 통계 분석
모든 통계 분석은 Windows용 SPSS 23.0 (SPSS Inc., Chicago, IL, USA)을 사용하여 수행되었다. 이원 및 일원 분산 분석 (ANOVA)은 여러 그룹에 걸쳐 수행되었다. 생존 데이터에 대해 로그 순위 검정을 수행했으며 p<0.05가 통계적으로 유의한 것으로 간주되었다.
실시예 2: 결과
2-1. GBM 마우스 모델에 대한 레날리도마이드 및 항-PD1과 결합된 긴 다중에피토프 펩타이드 조성물의 치료 효과
긴 다중에피토프 펩타이드는 도 1a의 구조에 따라 합성되었다. 치료 스케쥴은 도 1b에 나타냈다. 도 1c 내지 1e에 도시된 바와 같이, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 대조군 (24.1일±1일)에 비해 연장된 생존 (52.8일±10.4일)을 나타냈다 (p=0.046). 대조군 (24.1일±1일), 긴 다중에피토프 펩타이드 처리군 (26.9일±4.1일), 긴 다중에피토프 펩타이드 + 레날리도마이드 처리군 (24.2일±1.2일), 레날리도마이드 + 항-PD1 처리군 (28.4일±5.8일), 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 (35.1일±8.4일) 간에 유의미한 차이가 관찰되지 않았다. 즉, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 다른 처리군들에 비해 가장 긴 생존일을 나타냄을 확인하였다.
이러한 경향은 도 1f 및 1g에서 MRI로 확인된 처리 전후의 마우스 종양 크기와 유사하다. 도 1f 및 1g에 도시된 바와 같이, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 대조군에 비해 종양 성장을 지연시켰다 (p=0.037). 그러나, 대조군, 긴 다중에피토프 펩타이드 처리군, 긴 다중에피토프 펩타이드 + 레날리도마이드 처리군, 레날리도마이드 + 항-PD1 처리군, 및 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 간에는 유의미한 차이가 관찰되지 않았다. 즉, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 다른 처리군들에 비해 가장 높은 종양 억제 효과를 보임을 확인하였다.
긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군의 면역 기능 관련 치료 효과를 강조하기 위해, 레날리도마이드 + 항-PD1 처리군, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군, 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군의 면역 반응을 추가 연구에서 비교하였다.
2-2. 비장, 림프절 및 종양의 면역 세포 분포
[규칙 제91조에 의한 정정 20.10.2023]
레날리도마이드 + 항-PD1 처리군, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군, 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 간의 비장, 림프절 및 종양에서의 면역 세포 분포의 차이를 도 2a 내지 2o에 나타냈다. 비장 및 림프절에서는 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 및 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군이 활성화된 CD8+ T세포 및 CD4+ T세포를 강화한 반면, 종양에서는 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군만이 활성화된 CD8+ T세포를 증가시켰다.
레날리도마이드 + 항-PD1 처리군, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군, 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 간의 비장, 림프절 및 종양에서의 면역 세포 분포의 차이를 도 2a 내지 2o에 나타냈다. 비장 및 림프절에서는 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 및 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군이 활성화된 CD8+ T세포 및 CD4+ T세포를 강화한 반면, 종양에서는 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군만이 활성화된 CD8+ T세포를 증가시켰다.
CD8+CD44+ T세포 백분율의 경우 비장, 림프절 및 종양 모두에서 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군이 대조군에 비해 유의한 차이가 있는 향상을 나타낸 반면 (각각 p=0.027, p=0.000 및 p=0.032), CD4+CD44+ T세포 백분율의 경우 비장 및 림프절에서만 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군이 대조군에 비해 유의한 차이가 있는 향상을 나타냈다 (각각 p=0.005 및 p=0.001). 또한, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군과 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 간에는 CD8+CD44+ T세포 및 CD4+CD44+ T세포 백분율의 유의한 차이가 없음이 관찰되었다.
[규칙 제91조에 의한 정정 20.10.2023]
메모리 이펙터 CD8+ 및 CD4+ T세포들을 측정하여 도 2f 내지 2k에 나타냈다. CD62L+의 발현은 활성화된 CD8+ 또는 CD4+ T세포에서 차이가 없었다. 비장, 림프절 및 종양의 전체 CD8+CD44+ 또는 CD4+CD44+ T세포에서 CD62L- 세포의 백분율에는 차이가 없었다. 그러나, 메모리 이펙터 CD8+ 및 CD4+ T세포는 활성화된 이펙터 CD8+ 및 CD4+ T세포의 향상에 따라 향상되었다. 특히, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 비장, 림프절 및 종양에서 대조군에 비해 CD8+CD44+CD62L- 세포의 백분율을 증가시켰고 (각각 p=0.039, p=0.01 및 p=0.006), 비장 및 림프절에서 대조군에 비해 CD4+CD44+CD62L- 세포의 백분율을 증가시켰다 (p=0.01 및 p=0.027). 또한, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군과 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 간에는 CD8+CD44+CD62L- T세포 및 CD4+CD44+CD62L- T세포의 백분율에 유의한 차이가 없음이 관찰되었다.
메모리 이펙터 CD8+ 및 CD4+ T세포들을 측정하여 도 2f 내지 2k에 나타냈다. CD62L+의 발현은 활성화된 CD8+ 또는 CD4+ T세포에서 차이가 없었다. 비장, 림프절 및 종양의 전체 CD8+CD44+ 또는 CD4+CD44+ T세포에서 CD62L- 세포의 백분율에는 차이가 없었다. 그러나, 메모리 이펙터 CD8+ 및 CD4+ T세포는 활성화된 이펙터 CD8+ 및 CD4+ T세포의 향상에 따라 향상되었다. 특히, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 비장, 림프절 및 종양에서 대조군에 비해 CD8+CD44+CD62L- 세포의 백분율을 증가시켰고 (각각 p=0.039, p=0.01 및 p=0.006), 비장 및 림프절에서 대조군에 비해 CD4+CD44+CD62L- 세포의 백분율을 증가시켰다 (p=0.01 및 p=0.027). 또한, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군과 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 간에는 CD8+CD44+CD62L- T세포 및 CD4+CD44+CD62L- T세포의 백분율에 유의한 차이가 없음이 관찰되었다.
[규칙 제91조에 의한 정정 20.10.2023]
NK 세포 및 조절 T세포(Treg)의 백분율을 측정하여 도 2l 내지 2o에 나타냈다. NK 세포의 경우, 긴 멀티펩타이드 + 레날리도마이드 + 항-PD1 처리군만이 림프절에서 대조군에 비해 증가된 백분율을 나타냈다 (p=0.018). 조절 T세포(Treg)의 경우, 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 비장 및 종양에서 대조군에 비해 증가된 백분율을 나타냈지만 (각각 p=0.022 및 p=0.036), 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 비장에서만 대조군에 비해 증가된 백분율을 나타냈다 (p=0.015).
NK 세포 및 조절 T세포(Treg)의 백분율을 측정하여 도 2l 내지 2o에 나타냈다. NK 세포의 경우, 긴 멀티펩타이드 + 레날리도마이드 + 항-PD1 처리군만이 림프절에서 대조군에 비해 증가된 백분율을 나타냈다 (p=0.018). 조절 T세포(Treg)의 경우, 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 비장 및 종양에서 대조군에 비해 증가된 백분율을 나타냈지만 (각각 p=0.022 및 p=0.036), 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 비장에서만 대조군에 비해 증가된 백분율을 나타냈다 (p=0.015).
2-3. 면역 세포 및 종양에 대한 PD1 및 PDL1의 발현
비장, 림프절 및 종양에서의 활성화된 CD8+ T세포, CD4+ T세포 및 Treg에서 PD1의 발현을 측정하여 도 3a 내지 3h에 나타냈다. 도 3a 내지 3h에 도시된 바와 같이, 종양에서, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 주로 활성화된 CD8+ T세포에서 PD1 발현을 향상시킨 반면, 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 Treg에서 PD1 발현을 향상시켰다.
[규칙 제91조에 의한 정정 20.10.2023]
또한, 도 3i 및 3j에 도시된 바와 같이, 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 종양에서 PDL1의 발현 역시 향상시켰다.
또한, 도 3i 및 3j에 도시된 바와 같이, 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 종양에서 PDL1의 발현 역시 향상시켰다.
비장과 림프절에서 CD8+CD44+PD1+ 세포의 백분율은 처리군 간에 차이가 없었지만, 종양에서 CD8+CD44+PD1+ 세포의 백분율은 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군이 대조군에 비해 유의한 차이가 있는 향상을 나타냈다 (p=0.014). 또한, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 및 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 림프절 및 종양보다는 비장에서 향상된 CD4+CD44+PD1+ 세포 백분율을 나타냈다. 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 비장, 림프절 및 종양에서의 Tregs에서 대조군에 비해 유의하게 향상된 PD1 발현을 나타냈고 (각각 p=0.002, p=0.000 및 p=0.014), 레날리도마이드 + 항-PD1 처리군은 림프절 및 종양에서의 Tregs에서 대조군에 비해 유의하게 향상된 PD1+ 세포 백분율을 나타냈만 (p=0.000 및 p=0.000), 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 림프절에서의 Treg에서만 대조군에 비해 유의하게 향상된 PD1+ 세포 백분율을 나타냈다 (p=0.000). 더욱이, CD45- 세포에서 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 대조군에 비해 유의하게 향상된 PDL1+ 의 발현을 나타냈다 (p=0.049). 다만, CD45+ 세포에서의 PDL1+ 발현은 각 처리군 간의 유의미한 차이가 관찰되지 않았다.
2-4. 재자극된 비장세포, 재자극된 림프절 및 단일 종양 세포로부터의 전-염증성 및 항-염증성 사이토카인 생성
[규칙 제91조에 의한 정정 20.10.2023]
전-염증성 사이토카인에 대한 IL-12p70 및 IFN-γ의 수준 및 항-염증성 사이토카인에 대한 IL-10 및 TGF-β의 수준을 측정하여 도 4a 내지 4j에 나타냈다.
전-염증성 사이토카인에 대한 IL-12p70 및 IFN-γ의 수준 및 항-염증성 사이토카인에 대한 IL-10 및 TGF-β의 수준을 측정하여 도 4a 내지 4j에 나타냈다.
먼저, 재자극된 비장세포 및 림프절의 상청액에서 IL-12p70의 수준을 측정하여 도 4a 및 4b에 나타냈다. 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군만이 재자극된 비장 세포 및 림프절 둘 다에서 대조군에 비해 IL-12p70의 수준이 강화되었다 (각각 p=0.023 및 p=0.026).
또한, 재자극된 비장세포, 재자극된 림프절, 종양 및 혈청의 IFN-γ 수준을 측정하여 도 4c 내지 4f에 나타냈다. 일반적으로 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 (p=0.002, p=0.000 및 p=0.000) 또는 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 (p=0.015, p=0.000 및 p=0.000)은 재자극된 비장세포, 재자극된 림프절 및 종양에서 대조군에 비해 IFN-γ 수준이 향상된 것으로 나타났다. 혈청의 경우에는 각 처리군 사이에 IFN-γ 수준에 유의한 차이가 없었다.
긴 다중에피토프 펩타이드 + 레날리도마이드 및 항PD1 처리군 또는 칵테일 다중에피토프 펩타이드 + 레날리도마이드 및 항PD1 처리군 간의 차이도 비교되었다. 재자극된 비장세포에서는 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군이 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군에 비해 유의하게 향상된 IL-12p70 수준을 나타냈지만 (p=0.024), 재자극된 림프절에서는 양자 간 유의미한 차이가 관찰되지 않았다. 또한, 재자극된 비장세포에서의 IFN-γ 수준에 있어서는 양자 간 유의미한 차이가 관찰되지 않았으나, 재자극된 림프절 및 종양에서의 IFN-γ 수준에 있어서는 양자 간 유의한 차이가 측정되었다 (각각 p=0.025 및 p=0.029).
[규칙 제91조에 의한 정정 20.10.2023]
또한, 재자극된 비장세포, 재자극된 림프절 및 종양에서 IL-10 수준을 측정하여 도 4g 내지 4i에 나타냈다. 재자극된 비장 세포 및 재자극된 림프절에서는 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 또는 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군이 대조군에 비해 유의하게 향상된 IL-10 수준을 나타냈지만 (각각 p=0.000 및 p=0.000 또는 p=0.000 및 p =0.000), 종양에서는 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 또는 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군의 경우 대조군에 비해 유의하게 감소된 IL-10 수준을 나타냈다 (각각 p=0.008 및 p=0.018). 또한, 도 4j에 도시된 바와 같이, 종양에서의 TGF-β 수준은 각 처리군 간에 유의미한 차이가 관찰되지 않았다.
또한, 재자극된 비장세포, 재자극된 림프절 및 종양에서 IL-10 수준을 측정하여 도 4g 내지 4i에 나타냈다. 재자극된 비장 세포 및 재자극된 림프절에서는 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 또는 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군이 대조군에 비해 유의하게 향상된 IL-10 수준을 나타냈지만 (각각 p=0.000 및 p=0.000 또는 p=0.000 및 p =0.000), 종양에서는 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 또는 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군의 경우 대조군에 비해 유의하게 감소된 IL-10 수준을 나타냈다 (각각 p=0.008 및 p=0.018). 또한, 도 4j에 도시된 바와 같이, 종양에서의 TGF-β 수준은 각 처리군 간에 유의미한 차이가 관찰되지 않았다.
[규칙 제91조에 의한 정정 20.10.2023]
재자극된 비장세포에서 CD8+IFN-γ+ 및 CD4+IFN-γ+ T세포의 백분율을 측정하여 도 4k 내지 4m에 나타냈다. 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 재자극된 비장세포에서 CD8+IFN-γ+ T세포만을 강화한 반면 (p=0.000), 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 재자극된 비장세포에서 CD8+IFN-γ+ 및 CD4+IFN-γ+ T세포 모두를 강화했다 (p=0.000 및 p=0.04).
재자극된 비장세포에서 CD8+IFN-γ+ 및 CD4+IFN-γ+ T세포의 백분율을 측정하여 도 4k 내지 4m에 나타냈다. 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 재자극된 비장세포에서 CD8+IFN-γ+ T세포만을 강화한 반면 (p=0.000), 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군은 재자극된 비장세포에서 CD8+IFN-γ+ 및 CD4+IFN-γ+ T세포 모두를 강화했다 (p=0.000 및 p=0.04).
2-5. 재자극된 비장세포 및 림프절의 CTL 및 NK 세포 기능
조성물을 처리하지 않은 마우스와 조성물을 처리한 마우스의 재자극된 비장세포의 CTL 및 NK 세포 매개 면역 반응을 도 5a 내지 5d에 나타냈다. 표적 암세포와 공배양 후 재자극된 비장세포에 의한 IFN-γ 분비를 GL261 세포에 대한 병용 치료의 항종양 효과에 대해 조사하였다. IFN-γ ELISPOT 분석을 위해 비처리 및 처리된 마우스로부터 재자극된 비장세포를 준비하였다. GL261 및 YAC-1 세포를 각각 CTL 및 NK 세포 활성을 조사하기 위한 표적 암세포로 사용하였다.
도 5a 및 5b에 도시된 바와 같이, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 (p=0.000 및 p=0.000) 또는 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 (p=0.000 및 p=0.000)은 재자극된 비장 세포 및 림프절 둘 다에서 대조군에 비해 GL261 세포에 대한 IFN-γ-분비 비장 세포를 향상시켰다.
또한, GL261 표적 암세포에 대한 재자극된 비장세포 및 재자극된 림프절의 특이적 사멸 효과를 확인하여 도 5c 및 5d에 나타냈다. 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리 마우스 (p=0.000 및 p=0.000) 또는 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리 마우스 (p=0.009 및 p=0.04)는 대조군에 비해 재자극된 비장세포 및 림프절에서의 특이적 용해 백분율이 향상되었음을 확인하였다. 비장세포 또는 림프절에서의 IFN-γ-분비 및 특이적 용해 백분율에서 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군과 칵테일 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 간에 유의미한 차이는 관찰되지 않았다. 또한, 긴 다중에피토프 펩타이드 + 레날리도마이드 + 항-PD1 처리군 및 칵테일 다중에피토프 펩타이 + 레날리도마이드 + 항-PD1 처리군은 대조군에 비해 림프절에서 YAC-1 세포에 대한 IFN-γ-분비를 강화했다 (각각 p=0.000 및 p=0.000). 다만, 재자극된 비장세포 및 림프절에서 YAC-1 세포의 특이적 용해 백분율은 양자 간 유의미한 차이가 관찰되지 않았다.
본 발명은 다중에피토프 펩타이드를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물에 관한 것으로서, 더욱 상세하게는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드를 이용하여 신경교종의 예방, 개선 또는 치료 용도로 사용하는 기술에 관한 것이다.
Claims (10)
- 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 포함하는 다중에피토프 펩타이드;를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물.
- 제1항에 있어서, 상기 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 상기 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 상기 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드는 링커를 통해 결합된 것을 특징으로 하는, 약제학적 조성물.
- 제2항에 있어서, 상기 링커는 글라이신, 알라닌, 발린, 류신, 이소류신, 트레오닌, 세린, 시스테인, 메티오닌, 아스파르트산, 아스파라긴, 글루탐산, 글루타민, 리신, 아르기닌, 히스티딘, 페닐알라닌, 티로신, 트립토판 및 프롤린으로 이루어진 군에서 선택된 1종 이상인 것을 특징으로 하는, 약제학적 조성물.
- 제1항에 있어서, 다중에피토프 펩타이드는 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드가 링커를 통해 결합된 펩타이드 각 두 분자가 이황화 결합을 형성하고 있는 이량체 융합 펩타이드인 것을 특징으로 하는, 약제학적 조성물.
- 제1항에 있어서, 상기 약제학적 조성물은 레날리도마이드 및 항-PD1 항체를 추가적으로 포함하는 것인, 약제학적 조성물.
- 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산, 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산 및 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 코딩하는 핵산을 포함하는 다중에피토프 펩타이드 유전자.
- 제7항에 있어서, 상기 다중에피토프 펩타이드 유전자는 제1항의 약제학적 조성물을 제조하기 위해 사용되는 것인, 다중에피토프 펩타이드 유전자.
- 제7항에 있어서, 상기 핵산은 재조합 벡터 또는 발현 벡터 형태인 것을 특징으로 하는, 다중에피토프 펩타이드 유전자.
- 제7항에 있어서, 상기 서열번호 1의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산은 서열번호 4의 염기서열로 표시되는 핵산, 상기 서열번호 2의 아미노산 서열로 표시되는 MHCI 펩타이드를 코딩하는 핵산은 서열번호 5의 염기서열로 표시되는 핵산, 및 상기 서열번호 3의 아미노산 서열로 표시되는 MHCII 펩타이드를 코딩하는 핵산은 서열번호 6의 염기서열로 표시되는 핵산인 것을 특징으로 하는, 다중에피토프 펩타이드 유전자.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2022-0149781 | 2022-11-10 | ||
| KR1020220149781A KR102913951B1 (ko) | 2022-11-10 | 2022-11-10 | 다중에피토프 펩타이드를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2024101710A1 true WO2024101710A1 (ko) | 2024-05-16 |
Family
ID=91032737
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2023/016335 Ceased WO2024101710A1 (ko) | 2022-11-10 | 2023-10-20 | 다중에피토프 펩타이드를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR102913951B1 (ko) |
| WO (1) | WO2024101710A1 (ko) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120086299A (ko) * | 2009-10-02 | 2012-08-02 | 사노피 | EphA2 수용체에 특이적으로 결합하는 항체 |
| KR20130098308A (ko) * | 2010-08-23 | 2013-09-04 | 셀렉타 바이오사이언시즈, 인크. | 항원에 대한 면역 반응을 유도하기 위한 표적화 다중 에피토프 투여형 |
| KR101774929B1 (ko) * | 2012-05-23 | 2017-09-19 | 떼라벡띠스 | Mhc 클래스 i 프로모터를 포함하는 렌티바이러스 벡터들 |
-
2022
- 2022-11-10 KR KR1020220149781A patent/KR102913951B1/ko active Active
-
2023
- 2023-10-20 WO PCT/KR2023/016335 patent/WO2024101710A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120086299A (ko) * | 2009-10-02 | 2012-08-02 | 사노피 | EphA2 수용체에 특이적으로 결합하는 항체 |
| KR20130098308A (ko) * | 2010-08-23 | 2013-09-04 | 셀렉타 바이오사이언시즈, 인크. | 항원에 대한 면역 반응을 유도하기 위한 표적화 다중 에피토프 투여형 |
| KR101774929B1 (ko) * | 2012-05-23 | 2017-09-19 | 떼라벡띠스 | Mhc 클래스 i 프로모터를 포함하는 렌티바이러스 벡터들 |
Non-Patent Citations (2)
| Title |
|---|
| ALEXANDER J., ET AL.: "DEVELOPMENT OF HIGH POTENCY UNIVERSAL DR-RESTRICTED HELPER EPITOPES BY MODIFICATION OF HIGH AFFINITY DR-BLOCKING PEPTIDES.", IMMUNITY, CELL PRESS, AMSTERDAM, NL, vol. 01., no. 09., 1 December 1994 (1994-12-01), AMSTERDAM, NL , pages 751 - 761., XP000673954, ISSN: 1074-7613, DOI: 10.1016/S1074-7613(94)80017-0 * |
| TRAN THI-ANH-THUY, KIM YOUNG-HEE; KIM GA-EUN; JUNG SHIN; KIM IN-YOUNG; MOON KYUNG-SUB; KIM YOUNG-JIN; LEE TAE-KYU; YUN HYOSUK; LEE: "The long multi-epitope peptide vaccine combined with adjuvants improved the therapeutic effects in a glioblastoma mouse model", FRONTIERS IN IMMUNOLOGY, FRONTIERS MEDIA, LAUSANNE, CH, vol. 13, 9 November 2022 (2022-11-09), Lausanne, CH , XP093170418, ISSN: 1664-3224, DOI: 10.3389/fimmu.2022.1007285 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR102913951B1 (ko) | 2026-01-20 |
| KR20240073177A (ko) | 2024-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2019203497A1 (ko) | 고갈성 항 cd4 단일클론항체를 포함하는 항암 t 세포치료제 보조용 조성물 및 이의 용도 | |
| ES2285157T3 (es) | Induccion de inmunidad antitumoral ctl a traves del desencadenamiento en vivo de 4-1 bb y/o cd 40. | |
| WO2019182422A1 (ko) | 신규 유전자 변형 자연살해 세포주 및 그의 용도 | |
| CA2282300A1 (en) | Recombinant pox virus for immunization against muc1 tumor-associated antigen | |
| WO2015137724A1 (ko) | 자가암항원 특이적 cd8+ t 세포의 분리 및 증식방법 | |
| WO2017069512A1 (ko) | 바이러스 항원 특이적인 t 세포의 유도 및 증식 방법 | |
| US12083111B2 (en) | Use of hexokinase 2/mitochondria-detaching compounds for activating immune responses | |
| WO2017039313A1 (ko) | IL-12 및 shVEGF 동시발현 아데노바이러스를 포함하는 항종양 면역성 증진 조성물 | |
| WO2023048530A1 (ko) | 종양 연관 항원으로부터 유래된 펩타이드 및 리포펩타이드와 면역활성물질로 구성되는 아쥬번트를 포함하는 항암 백신 조성물 및 이의 용도 | |
| Mikysková et al. | Treatment of minimal residual disease after surgery or chemotherapy in mice carrying HPV16-associated tumours: Cytokine and gene therapy with IL-2 and GM-CSF | |
| WO2019198995A1 (ko) | 엑소좀 기반의 면역세포의 교차분화 방법 | |
| CN108472345B (zh) | 包含c-c基序趋化因子22(ccl22)或其片段的疫苗组合物 | |
| WO2019103436A9 (ko) | Nk 세포 배양용 조성물 및 이를 이용하여 nk 세포를 배양하는 방법 | |
| WO2024101710A1 (ko) | 다중에피토프 펩타이드를 포함하는 신경교종 예방 또는 치료용 약제학적 조성물 | |
| WO2015167243A1 (ko) | 면역질환 치료효과를 갖는 신규한 화합물 및 이의 용도 | |
| WO2024058609A1 (ko) | 자연 살해 t 세포의 리간드와 항원을 적재한 말초혈액단핵세포를 포함하는 백신 | |
| WO2024205045A1 (ko) | Her2 백신, 및 면역관문 억제제의 조합 요법 | |
| Pancre et al. | Induction of Cytotoxic T‐Cell Activity by the Protective Antigen of Schistosoma mansoni Sm28GST or its Derived C‐Terminal Lipopeptide | |
| WO2023090956A1 (ko) | 신규 항암 백신 조성물 및 그를 이용한 백신화 방법 | |
| Behboudi et al. | Dendritic cells infected by recombinant modified vaccinia virus Ankara retain immunogenicity in vivo despite in vitro dysfunction | |
| WO2022108306A1 (ko) | 인터류킨-33을 처리하여 면역원성이 향상된 cd103+ fcgr3+ 수지상세포의 제조방법 및 상기 수지상세포를 포함하는 면역항암치료용 약학적 조성물 | |
| WO2023090774A1 (ko) | 종양 침윤 림프구의 개선된 제조방법 | |
| US8105601B2 (en) | Compositions and methods for modulating an immune response | |
| WO2022250416A1 (ko) | 리포펩타이드와 폴리(i:c) 아쥬번트를 이용하는 면역항암치료제 조성물 | |
| Yamasaki et al. | Establishment of experimental malignant glioma-specific cytotoxic T lymphocyte clone by T cell growth factor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23888973 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 23888973 Country of ref document: EP Kind code of ref document: A1 |

