WO2024098361A1 - Molécule d'acide nucléique artificiel - Google Patents

Molécule d'acide nucléique artificiel Download PDF

Info

Publication number
WO2024098361A1
WO2024098361A1 PCT/CN2022/131289 CN2022131289W WO2024098361A1 WO 2024098361 A1 WO2024098361 A1 WO 2024098361A1 CN 2022131289 W CN2022131289 W CN 2022131289W WO 2024098361 A1 WO2024098361 A1 WO 2024098361A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
acid sequence
compound
mmol
lipid
Prior art date
Application number
PCT/CN2022/131289
Other languages
English (en)
Chinese (zh)
Inventor
张军
王泰云
李航文
董慧芳
Original Assignee
斯微(上海)生物科技股份有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 斯微(上海)生物科技股份有限公司 filed Critical 斯微(上海)生物科技股份有限公司
Priority to PCT/CN2022/131289 priority Critical patent/WO2024098361A1/fr
Publication of WO2024098361A1 publication Critical patent/WO2024098361A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material

Definitions

  • the present invention belongs to the field of biomedicine.
  • the present invention relates to an artificial nucleic acid molecule, which comprises an open reading frame, a 3'-untranslated region element (3'-UTR element) and/or a 5'-untranslated region element (5'-UTR element).
  • the present invention also relates to a vector comprising a 3'-UTR element and/or a 5'-UTR element, to a cell comprising the artificial nucleic acid molecule or the vector, to a lipid composition or a pharmaceutical composition comprising the artificial nucleic acid molecule or the vector, and to a kit comprising the artificial nucleic acid molecule, the vector, the lipid composition and/or the pharmaceutical composition, preferably for the field of gene therapy and/or gene vaccination.
  • stable RNA For gene therapy and gene vaccination, stable RNA is usually required.Stable RNA can make the product encoded by RNA sequence accumulate in vivo and in its storage process, preparation process and application process, stable RNA can maintain its structural and functional integrity.Therefore, it is necessary to provide stable RNA molecules for gene therapy or gene vaccination to prevent them from experiencing early degradation or decay.And as a scheme for mRNA stabilization, it has been found that naturally occurring eukaryotic mRNA molecules contain specific stabilization elements.For example, its 3'-untranslated region (3'-UTR) and/or 5'-untranslated region (5'-UTR).Both 3'-UTR and 5'-UTR are typical pre-mature (premature) mRNA elements.
  • 3'-UTR 3'-untranslated region
  • 5'-UTR 5'-untranslated region
  • An mRNA molecule carries a gene that encodes a corresponding protein. This gene has specific untranslated regions on both sides at the 5' of the AUG start codon and the 3' of the stop codon. These regions are called 5'-untranslated region and 3'-untranslated region. Usually, 3'-UTR is a part of the sequence between the protein coding region (open reading frame (ORF) or coding sequence (CDS)) and the polyadenylation sequence, which can regulate the stability, localization and expression of mRNA.
  • ORF open reading frame
  • CDS coding sequence
  • the present invention provides an artificial nucleic acid molecule comprising
  • ORF open reading frame
  • 3'-UTR element at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a nucleic acid sequence selected from the group consisting of:
  • the 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO:44, and the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence shown in SEQ ID NO:44; or (ii) wherein the 3'-UTR element comprises a nucleic acid sequence of 3'-UTR derived from transcripts of the following genes or a variant thereof: HCV, CoV2, CVB3, AES and AAT, and the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence derived from; or (iii) wherein the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:16; or the corresponding RNA sequence of the above nucleic acid sequence.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:3.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:4.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:44 and also comprises a nucleic acid sequence of SEQ ID NO:90, 91 or 93.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO: 1, 2 or 5.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the following viral genes or a variant thereof: HCV, CoV2 and CVB3; or from the nucleic acid sequence of the 3'-UTR of the transcript of the mouse gene AES or a variant thereof; or from the nucleic acid sequence of the 3'-UTR of the transcript of the human gene AAT or a variant thereof; or from the nucleic acid sequence of the 3'-UTR of the transcript of the bovine gene AES or a variant thereof, wherein the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element exhibits a length of 3-500 nucleotides, preferably 5-250 nucleotides, more preferably 90-215 nucleotides.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO: 6, 7, 8, 9 or 12.
  • the 3'-UTR element also comprises a nucleic acid sequence of SEQ ID NO:92.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:10, 14 or 15.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:12 and also comprises a nucleic acid sequence of SEQ ID NO:9 or 94.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:11 or 13.
  • the artificial nucleic acid molecule further comprises at least one 5'-untranslated region element (5'-UTR element).
  • the 5'-UTR element comprises a nucleic acid sequence of SEQ ID NO:45.
  • the artificial nucleic acid molecule further comprises a 5' cap structure, a polycytidylic acid sequence, a polyadenylic acid sequence or a histone stem-loop.
  • the artificial nucleic acid molecule further comprises a 5' cap structure, a polycytidylic acid sequence, a polyadenylic acid sequence and a histone stem-loop.
  • the ORF is codon optimized.
  • the artificial nucleic acid molecule is RNA, preferably mRNA.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 or 62.
  • the present invention also provides a vector comprising the artificial nucleic acid molecule of the present invention.
  • the present invention also provides a cell comprising the artificial nucleic acid molecule of the present invention or the vector of the present invention.
  • the present invention also provides a lipid composition, which comprises an artificial nucleic acid molecule of the present invention and a lipid that encapsulates the artificial nucleic acid molecule, wherein the lipid that encapsulates the artificial nucleic acid molecule comprises a cationic lipid, a phospholipid, a steroid and a polyethylene glycol-modified lipid; the lipid composition further comprises a cationic polymer, wherein the cationic polymer is associated with the artificial nucleic acid molecule as a complex and is co-encapsulated in the lipid to form a lipid polymer complex.
  • the cationic lipid comprises a lipid compound of formula (I), (II), (III), (IV) or a pharmaceutically acceptable salt thereof, as defined herein.
  • the cationic lipid is M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2.
  • the lipid composition comprises 10-70 mol% of a cationic lipid, 10-70 mol% of a phospholipid, 10-70 mol% of a steroid, and 0.05-20 mol% of a polyethylene glycol-modified lipid.
  • the lipid composition comprises 35-50 mol% of a cationic lipid, 10-30 mol% of a phospholipid, 24-44 mol% of a steroid, and 1-1.5 mol% of a polyethylene glycol-modified lipid.
  • the lipid composition comprises 35-50 mol% of cationic lipid, 10-30 mol% of DOPE, 24-44 mol% of cholesterol and 1-1.5 mol% of DMG-PEG.
  • the lipid composition comprises 50 mol% of cationic lipid, 10 mol% of DOPE, 38.5 mol% of cholesterol and 1.5 mol% of DMG-PEG.
  • the lipid composition comprises 40 mol% of cationic lipid, 15 mol% of DOPE, 43.5 mol% of cholesterol and 1.5 mol% of DMG-PEG.
  • the present invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention or the lipid composition of the present invention, and a pharmaceutically acceptable carrier, excipient or diluent.
  • the present invention also provides use of the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention in the preparation of a vaccine or a drug for gene therapy.
  • the present invention also provides use of the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention in the preparation of a medicament for treating or preventing a disease.
  • the present invention also provides a method for increasing the translation efficiency of an artificial nucleic acid molecule, preferably an mRNA molecule or a vector, the method comprising linking an open reading frame to a 3'-UTR element as defined in the present invention.
  • the present invention also provides a kit comprising the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention.
  • the present invention also provides a method for producing an artificial nucleic acid molecule, the method comprising:
  • Figure 1 shows a plasmid map of pUC57-Luc.
  • FIG2 shows exemplary sequences of test artificial nucleic acid molecules.
  • Figure 3 shows the effect of different 3'-UTR elements on the expression of the reporter gene luciferase.
  • the ordinate is the sequence number of the corresponding 3'-UTR elements contained in different artificial nucleic acid molecules, wherein the artificial nucleic acid molecule containing only a poly (A) sequence after the stop codon of the luciferase gene relative to the tested artificial nucleic acid molecule is the reference nucleic acid molecule (ctrl).
  • At least one or “one or more” may mean 1, 2, 3, 4, 5, 6, 7, 8 or more.
  • the expressions “comprises,” “comprising,” “containing,” and “having” are open ended, meaning the inclusion of the listed elements, steps, or components but not the exclusion of other unlisted elements, steps, or components.
  • the expression “consisting of” excludes any element, step, or component not specified.
  • the expression “consisting essentially of” means that the scope is limited to the specified elements, steps, or components, plus optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions “consisting essentially of” and “consisting of” are encompassed within the meaning of the expression “comprising.”
  • connection term "and/or” between multiple mentioned elements should be understood to include individual and combined options.
  • “and/or” includes “and” and “or”.
  • a and/or B includes A, B and A+B.
  • A, B and/or C include A, B, C and any combination thereof, such as A+B, A+C, B+C and A+B+C. More elements defined by “and/or” are understood in a similar manner and include any one of them and any combination thereof.
  • any numerical value or numerical range such as concentration or concentration range, is understood to be modified by the term "about” in any case. Therefore, numerical values generally include ⁇ 10% of the value. For example, a concentration of 1 mg/mL includes 0.9 mg/mL to 1.1 mg/mL. Similarly, a concentration range of 1% to 10% (w/v) includes 0.9% (w/v) to 11% (w/v). As used herein, the use of numerical ranges explicitly includes all possible subranges, all individual numerical values within the range, including integers and fractions within the range, unless the context clearly indicates otherwise.
  • nucleotide includes deoxyribonucleotides and ribonucleotides and their derivatives.
  • ribonucleotide is a constituent substance of ribonucleic acid (RNA), which is composed of a molecule of base, a molecule of pentose, and a molecule of phosphoric acid. It refers to a nucleotide with a hydroxyl group at the 2' position of the ⁇ -D-ribofuranosyl group.
  • Deoxyribonucleotide is a constituent substance of deoxyribonucleic acid (DNA), which is also composed of a molecule of base, a molecule of pentose, and a molecule of phosphoric acid. It refers to a nucleotide in which the hydroxyl group at the 2' position of the ⁇ -D-ribofuranosyl group is replaced by hydrogen, and is the main chemical component of chromosomes.
  • Nucleotide is usually referred to by a single letter representing the base: "A (a)” refers to deoxyadenosine or adenylic acid containing adenine, “C (c)” refers to deoxycytidine or cytidine containing cytosine, “G (g)” refers to deoxyguanosine or guanylate containing guanine, “U (u)” refers to uridine containing uracil, and “T (t)” refers to deoxythymidylate containing thymine.
  • polynucleotide and “nucleic acid” are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA).
  • Polynucleotide sequence and “nucleotide sequence” are used interchangeably to refer to the order of nucleotides in a polynucleotide.
  • DNA coding strand sense strand
  • RNA it encodes can be considered to have the same nucleotide sequence, and the deoxythymidylic acid in the DNA coding strand sequence corresponds to the uridine acid in the RNA sequence it encodes.
  • artificial nucleic acid molecule may be understood as a non-natural nucleic acid molecule. Such nucleic acid molecules may be non-natural due to their individual sequences (which do not exist naturally) and/or due to other modifications (e.g., structural modifications of naturally non-existent nucleotides). Artificial nucleic acid molecules may be DNA molecules, RNA molecules, or hybrid molecules comprising DNA and RNA portions. Typically, artificial nucleic acid molecules may be designed and/or produced by genetic engineering methods. In this case, the artificial nucleic acid molecule comprises an artificial sequence that is normally non-existent naturally, and the artificial sequence is different from the wild-type sequence by at least one nucleotide. The term "wild-type sequence" may be understood as a naturally occurring sequence.
  • RNA can be modified RNA. That is, RNA can include one or more non-naturally occurring nucleobases, nucleosides, nucleotides or linking groups. “Modified” groups can also be referred to as “altered” groups in this article. Groups can be modified or altered chemically, structurally or functionally. For example, a modified nucleobase can include one or more non-naturally occurring substitutions.
  • the term “transfection” refers to the introduction of nucleic acid molecules, such as DNA or RNA (e.g., mRNA) molecules into cells, preferably into eukaryotic cells.
  • the term “transfection” includes any method known to those skilled in the art for introducing nucleic acid molecules into cells, preferably into eukaryotic cells, such as into mammalian cells. Such methods include, for example, electroporation, lipofection based on cationic lipids and/or liposomes, calcium phosphate precipitation, nanoparticle-based transfection, virus-based transfection, or transfection based on cationic polymers (e.g., DEAE-dextran or polyethyleneimine), etc.
  • the method is lipofection.
  • expression includes transcription and/or translation of a nucleotide sequence. Thus, expression may involve the production of transcripts and/or polypeptides.
  • translation efficiency refers to a nucleic acid molecule (e.g., mRNA) comprising an open reading frame (ORF). Translation efficiency is experimentally measurable. Translation efficiency is usually measured by measuring the amount of protein translated by the ORF. For experimental measurements of translation efficiency, the ORF preferably encodes a reporter protein or any other quantifiable protein. In the context of the present invention, translation efficiency is particularly useful for such nucleic acid molecules, wherein, in addition to the ORF, at least one 3'-UTR element is also included, preferably as defined herein. It should be understood that in the present invention, high translation efficiency is usually provided by a specific UTR element (specific 3'-UTR element).
  • the ORF appropriately encodes a reporter protein or any other quantifiable protein
  • the present invention is not limited to such purposes; therefore, at least one 3'-UTR element of the present invention (which provides high translation efficiency) can be included in a nucleic acid molecule containing an ORF that does not encode a reporter protein.
  • Translation efficiency is a relative term, which is obtained by determining the translation efficiency of multiple (e.g., two or more) nucleic acid molecules and comparing them, for example, by experiments to quantify the protein encoded by the ORF.
  • One of the nucleic acid molecules can be referred to as a "reference nucleic acid molecule” or “reference construct”, and the other can be referred to as a “test nucleic acid molecule” or “test construct”, and the test nucleic acid molecule can be an artificial nucleic acid molecule as described in the present invention.
  • the reference nucleic acid molecule and the test nucleic acid molecule share the same ORF (same nucleic acid sequence); and preferably, the nucleic acid sequence of the test nucleic acid molecule is the same as that of the reference nucleic acid molecule, except that the UTR element tested, i.e., the 3'-UTR element; in other words, preferably, the test nucleic acid molecule and the reference nucleic acid molecule differ from each other only in that the 3'-UTR element has a different nucleic acid sequence; making the 3'-UTR element the only structural feature that distinguishes the test nucleic acid molecule from the reference nucleic acid molecule.
  • the UTR element tested i.e., the 3'-UTR element
  • vector is a medium for introducing exogenous polynucleotides into host cells, and when the vector is transformed into an appropriate host cell, the exogenous polynucleotides are amplified or expressed.
  • the vector usually remains free, but can be designed to integrate a gene or part thereof into a chromosome of the genome.
  • the definition of vector encompasses plasmids, linearized plasmids, viral vectors, cosmids, phage vectors, phagemids, artificial chromosomes (e.g., yeast artificial chromosomes and mammalian artificial chromosomes), etc.
  • Viral vectors include, but are not limited to, retroviral vectors (including lentiviral vectors), adenoviral vectors, adeno-associated viral vectors, herpes virus vectors, poxvirus vectors, and baculovirus vectors, etc.
  • a "cell” is a cell that is used to receive, maintain, replicate and amplify a vector.
  • the cell can also be used to express a polypeptide encoded by the vector.
  • the cell can be a eukaryotic cell or a prokaryotic cell. Suitable cells include, but are not limited to, CHO cells, various COS cells, HeLa cells, HEK cells such as HEK 293 cells.
  • an "aliphatic” group is a non-aromatic group in which the carbon atoms are linked in a chain, and may be saturated or unsaturated.
  • alkyl refers to an optionally substituted straight or branched chain saturated hydrocarbon including one or more carbon atoms.
  • C 1 -C 12 alkyl or “C 1-12 alkyl” refers to an optionally substituted straight or branched chain saturated hydrocarbon including 1-12 carbon atoms.
  • alkoxy refers to an alkyl group as described herein, which is connected to the remainder of the molecule through an oxygen atom.
  • alkylene refers to a divalent group formed by the corresponding alkyl group losing one hydrogen atom.
  • alkenyl refers to an optionally substituted straight or branched hydrocarbon comprising two or more carbon atoms and at least one double bond.
  • C 2 -C 12 alkenyl or “C 2-12 alkenyl” refers to an optionally substituted straight or branched hydrocarbon comprising 2 to 12 carbon atoms and at least one carbon-carbon double bond.
  • the alkenyl group may include one, two, three, four or more carbon-carbon double bonds.
  • halogen refers to fluorine, chlorine, bromine and iodine.
  • the term "carbocycle” refers to a monocyclic or polycyclic non-aromatic system comprising one or more rings consisting of carbon atoms.
  • C 3-8 carbocycle means a carbocycle comprising 3-8 carbon atoms.
  • the carbocycle may include one or more carbon-carbon double bonds or triple bonds. Examples of carbocycles include, but are not limited to, cyclopropyl, cyclopentyl, cyclohexyl, etc.
  • when the carbocycle is saturated (i.e., without unsaturated bonds), it may also refer to the corresponding cycloalkyl.
  • the carbocycle described herein refers to unsubstituted and substituted, i.e., optionally substituted carbocycles.
  • heterocycle refers to a monocyclic or polycyclic system including one or more rings and including at least one heteroatom.
  • the heteroatom can be, for example, nitrogen, oxygen, phosphorus or sulfur atoms.
  • the heterocycle can include one or more double bonds or triple bonds and can be non-aromatic. Examples of heterocycles include, but are not limited to, imidazolidinyl, oxazolidinyl, thiazolidinyl, pyrazolidinyl, isoxazolidinyl, isothiazolidinyl, morpholinyl, pyrrolidinyl, tetrahydrofuranyl and piperidinyl.
  • the heterocycle can contain, for example, 3-10 atoms (non-hydrogen), i.e., 3-10 yuan heterocycles (e.g., 3, 4, 5, 6, 7, 8, 9 or 10 yuan), wherein one or more atoms are heteroatoms (e.g., N, O, S or P).
  • 3-10 atoms non-hydrogen
  • 3-10 yuan heterocycles e.g., 3, 4, 5, 6, 7, 8, 9 or 10 yuan
  • one or more atoms are heteroatoms (e.g., N, O, S or P).
  • heterocycle When the heterocycle is saturated (i.e., without unsaturated bonds), it can also refer to the corresponding heterocycloalkyl.
  • heterocycles described herein refer to two types of unsubstituted and substituted heterocyclic groups, i.e., optionally substituted heterocycles.
  • aryl refers to an all-carbon monocyclic or fused polycyclic aromatic ring group having a conjugated ⁇ electron system.
  • a C 6 -C 10 alkylaryl group may have 6-10 carbon atoms, such as 6, 7, 8, 9, 10 carbon atoms.
  • Examples of aryl groups include, but are not limited to, phenyl, naphthyl, and the like.
  • heteroaryl refers to a monocyclic or fused polycyclic ring system containing at least one ring atom selected from N, O, S, the remaining ring atoms being C, and having at least one aromatic ring.
  • the heteroaryl group may have 5-10 ring atoms (5-10 membered heteroaryl), including 5, 6, 7, 8, 9 or 10 members, particularly 5 or 6 membered heteroaryl groups.
  • heteroaryl groups include, but are not limited to, pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, pyrazolyl, pyridyl, pyrimidinyl, pyrazinyl, quinolyl, isoquinolyl, tetrazolyl, triazolyl, triazinyl, benzofuranyl, benzothienyl, indolyl, isoindolyl, etc.
  • the term "interrupted by one or more groups” means that the one or more groups exist on the carbon chain, and the rest of the carbon chain is connected to both ends of the one or more groups.
  • any of R 1 -R 7 may be optionally substituted.
  • halogen atoms e.g., chloro, bromo, fluoro, or iodo
  • carboxylic acids
  • the substituent itself can be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein.
  • alkyl can be further substituted with one, two, three, four, five, or six substituents as described herein.
  • the term "compound” is intended to include isotopic compounds of the depicted structure.
  • “Isotopes” refer to atoms having the same atomic number but different mass numbers due to different numbers of neutrons in the nucleus, such as deuterium isotopes.
  • isotopes of hydrogen include tritium and deuterium.
  • the compounds, salts or complexes of the present invention can be prepared in combination with solvents or water molecules to form solvates and hydrates by conventional methods.
  • optionally substituted means that the subsequently described event may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where the event or circumstance does not occur.
  • optionally substituted alkyl means that the alkyl group may or may not be substituted, and that the description includes substituted alkyl radicals and unsubstituted alkyl radicals.
  • contacting a mammalian cell with a lipid composition means that a mammalian cell and a lipid nanoparticle are physically connected.
  • the method of contacting a cell with an external entity in vivo and in vitro is well known in the biological field.
  • contacting a lipid composition with a mammalian cell in a mammal can be carried out by different routes of administration (e.g., intravenous, intramuscular, intradermal and subcutaneous) and can relate to different amounts of lipid compositions.
  • the lipid composition can contact more than one mammalian cell.
  • delivery refers to providing an entity to a target.
  • delivering an artificial nucleic acid molecule to a subject may involve administering a lipid composition comprising the artificial nucleic acid molecule to the subject.
  • lipid component is a component of a composition that includes one or more lipids.
  • the lipid component can include one or more cationic lipids, PEGylated lipids, structural lipids, or helper lipids.
  • phrases "pharmaceutically acceptable” is used herein to refer to compounds, salts, materials, compositions and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications, and are consistent with a reasonable benefit/risk ratio.
  • pharmaceutically acceptable salts refer to derivatives of the disclosed compounds in which the parent compound is altered by converting an existing acid or base moiety into its salt form (e.g., by reacting a free basic group with a suitable organic acid).
  • pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues such as amines; alkali metal or organic salts of acidic residues such as carboxylic acids; and the like.
  • Representative acid addition salts include, but are not limited to, acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate,
  • alkali metal or alkaline earth metal salts include, but are not limited to, sodium, lithium, potassium, calcium, magnesium salts, and the like; and non-toxic ammonium, quaternary ammonium and amine cations, including but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like.
  • the pharmaceutically acceptable salts of the present invention include, for example, conventional non-toxic salts of the parent compound formed from non-toxic inorganic or organic acids.
  • the pharmaceutically acceptable salts of the present invention can be synthesized from the parent compound containing a basic or acidic moiety by conventional chemical methods.
  • these salts can be prepared by reacting the free acid or base form of these compounds with a stoichiometric amount of an appropriate base or acid in water or in an organic solvent, or in a mixture of the two; non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile are generally preferred.
  • gene therapy is understood to be the treatment of a patient's body or an isolated component of a patient's body, such as an isolated tissue/cell, by a nucleic acid encoding a peptide or protein. It can typically include at least one of the following steps: a) directly administering a nucleic acid (preferably an artificial nucleic acid molecule as defined herein) to a patient by any administration route or in vitro to an isolated cell/tissue of a patient, which results in in vivo/ex vivo or in vitro transfection of the patient's cells; b) transcribing and/or translating the introduced nucleic acid molecule; and optionally c) if the nucleic acid is not directly administered to the patient, the isolated, transfected cells are administered to the patient again.
  • a nucleic acid preferably an artificial nucleic acid molecule as defined herein
  • genetic vaccination can typically be understood as vaccination by administering nucleic acid molecules encoding antigens or immunogens or fragments thereof.
  • Nucleic acid molecules can be administered to the subject's body or to isolated cells of the subject. When certain cells of the body are transfected or when isolated cells are transfected, the antigen or immunogen can be expressed by those cells and then presented to the immune system, causing an adaptive (i.e., antigen-specific) immune response.
  • genetic vaccination typically includes at least one of the following steps: a) administering a nucleic acid (preferably an artificial nucleic acid molecule as defined herein) to a subject (preferably a patient), or to isolated cells of a subject (preferably a patient), which usually results in in vivo or in vitro transfection of the subject's cells; b) transcribing and/or translating the introduced nucleic acid molecules; and optionally c) if the nucleic acid is not directly administered to the patient, the isolated, transfected cells are administered to the subject (preferably the patient).
  • a nucleic acid preferably an artificial nucleic acid molecule as defined herein
  • vaccine refers to a composition comprising an active ingredient (e.g., an artificial nucleic acid molecule of the present invention) that can induce an immune response in a vaccinated subject through vaccination.
  • an active ingredient e.g., an artificial nucleic acid molecule of the present invention
  • the immune response induced by it can provide immune protection and is sufficient to prevent and/or alleviate at least one symptom associated with a pathogen or disease infection.
  • treat refers to partially or completely alleviating, ameliorating, improving, relieving, delaying the onset of, inhibiting the progression of, reducing the severity of, or reducing the occurrence of one or more symptoms or features of a particular infection, disease, disorder, or condition.
  • Preventing refers to guarding against underlying disease or preventing worsening of symptoms or development of disease.
  • prophylactically or therapeutically effective amount refers to an amount of an agent (e.g., nucleic acid, drug, composition, therapeutic agent, diagnostic agent, prophylactic agent, etc.) sufficient to prevent or inhibit the occurrence of a disease or symptom and/or slow down, alleviate, or delay the development or severity of a disease or symptom.
  • the prophylactically or therapeutically effective amount is affected by factors including, but not limited to, the rate and severity of development of the disease or symptom, the age, sex, weight, and physiological condition of the subject, the duration of treatment, and the specific route of administration.
  • the prophylactically or therapeutically effective amount may be administered in one or more doses.
  • the prophylactically or therapeutically effective amount may be achieved by continuous or intermittent administration.
  • an artificial nucleic acid molecule comprising
  • ORF open reading frame
  • At least one 3'-untranslated region element (3'-UTR element).
  • open reading frame is a sequence of nucleotide triplets that can be translated into a peptide or protein.
  • the open reading frame preferably contains a start codon at the end of its 5'-untranslated region element, i.e., a combination of three consecutive nucleotides (ATG) that usually encode the amino acid methionine, and an immediately adjacent region that usually presents a plurality of 3 nucleotides in length.
  • ATG consecutive nucleotides
  • the open reading frame of the present invention is preferably a nucleotide sequence, consisting of a number of nucleotides that can be divided by three, which starts with a start codon (e.g., ATG) and which preferably ends with a stop codon (e.g., TAA, TGA, or TAG).
  • the open reading frame can be isolated or it can be integrated into a longer nucleic acid sequence, such as a vector or mRNA.
  • the open reading frame can also be referred to as a "protein coding region".
  • UTRs Untranslated regions
  • Polynucleotides comprising UTRs may be administered to cells, tissues, or organisms, and one or more regulatory features may be measured using conventional methods.
  • 3'-UTR refers to a portion of an artificial nucleic acid molecule that is located 3' (i.e., "downstream") of an open reading frame and that is not translated into a protein.
  • a 3'-UTR is a portion of an mRNA between the protein coding region (open reading frame (ORF) or coding sequence (CDS)) and the polyadenylation sequence of the mRNA.
  • ORF open reading frame
  • CDS coding sequence
  • the 3'-UTR of an mRNA is not translated into an amino acid sequence.
  • 3'-UTR plays an important role in the regulation of biological complexity. It can regulate the localization expression of mRNA, regulate the translation of mRNA, and regulate protein-protein interactions (see, e.g., Mayr C. What Are 3'UTRs Doing? Cold Spring Harb Perspect Biol. 2019 Oct 1; 11(10): a034728).
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO:44, and the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence shown in SEQ ID NO:44.
  • the 3'-UTR element comprises T87C or T94C compared to SEQ ID NO:44.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:3.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:3 and also comprises the nucleic acid sequence of SEQ ID NO:92.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:4.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:44 and further comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID NO:6, 7, 9, 12, 90, 91, 92, 93, 95 and 96.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and also comprises the nucleic acid sequence of SEQ ID NO:90.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:1.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and also comprises the nucleic acid sequence of SEQ ID NO:91.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:2.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and also comprises the nucleic acid sequence of SEQ ID NO:93.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:5.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and also comprises the nucleic acid sequence of SEQ ID NO:92.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:17.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and also comprises the nucleic acid sequence of SEQ ID NO:95.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:18.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and also comprises the nucleic acid sequence of SEQ ID NO:7.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:25.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44, and also comprises the nucleic acid sequences of SEQ ID NO:96 and 92.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:26.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44, and also comprises the nucleic acid sequences of SEQ ID NO:9 and SEQ ID NO:92.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:27 or 38.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44, and also comprises the nucleic acid sequences of SEQ ID NO:12 and 92.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:29 or 40.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and also comprises the nucleic acid sequence of SEQ ID NO:9.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:37.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and also comprises the nucleic acid sequence of SEQ ID NO:12.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:39.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:44 and also comprises the nucleic acid sequence of SEQ ID NO:6.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:41.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:44 and also comprises a nucleic acid sequence of SEQ ID NO:90, 91 or 93.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO: 1, 2 or 5.
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-UTR element at least one 3'-untranslated region element (3'-UTR element), wherein the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO: 1, 2, 3, 4, 5, 17, 18, 25, 26, 27, 29, 37, 38, 39, 40 or 41.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO: 1, 2, 3, 4 or 5.
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-untranslated region element comprising a nucleic acid sequence derived from the 3'-UTR of a transcript of the following genes or a variant thereof: HCV, CoV2, DENV2, TCV, CYBA, BYDA, CVB3, AES and AAT, the variant comprising truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • nucleic acid sequence derived from the 3'-UTR of the transcript of a gene refers to a nucleic acid sequence based on the 3'-UTR sequence of the transcript of a gene or a fragment or part thereof (preferably a naturally occurring gene or a fragment or part thereof).
  • Nucleic acid sequence derived from the 3'-UTR of the transcript of a gene includes a sequence corresponding to the entire 3'-UTR sequence, i.e., the full-length 3'-UTR sequence of the transcript of the gene, and a sequence corresponding to a fragment of the 3'-UTR sequence of the transcript of the gene.
  • the fragment of the 3'-UTR of the transcript of the gene contains a continuous nucleotide corresponding to a continuous nucleotide in the full-length 3'-UTR of the transcript of the gene, which represents at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%
  • the fragment retains the regulatory function of the translation of the ORF connected to the 3'-UTR or its fragment.
  • truncated refers to a fragment or portion of a nucleic acid sequence based on a 3'-UTR sequence of a transcript of a gene.
  • the truncated 3'-UTR sequence comprises a continuous stretch of nucleotides corresponding to a continuous stretch of nucleotides in the full-length 3'-UTR of the transcript of the gene, which represents at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the full-length 3'-UTR of the transcript of the gene.
  • variant refers to a variant of a 3'-UTR of a naturally occurring gene transcript, preferably a variant of a 3'-UTR of a viral gene transcript, and more preferably a variant of a 3'-UTR of a mammalian gene transcript.
  • the variant may be a modified 3'-UTR of a gene transcript.
  • the variant of the 3'-UTR may present truncation, terminal extension, or one or more nucleotide deletions, additions and/or mutations.
  • the variant of the 3'-UTR of the gene transcript is at least 40%, preferably at least 50%, more preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% identical to the naturally occurring 3'-UTR from which the variant is derived.
  • terminally extended refers to a variant of a 3'-UTR having one or more nucleotides added to its N-terminus or C-terminus compared to the naturally occurring or modified 3'-UTR from which the variant is derived.
  • the 3'-UTR element exhibits a length of at least about 3 nucleotides, preferably at least about 5 nucleotides, more preferably at least about 10, 15, 20, 25 or 30 nucleotides, even more preferably at least about 50 nucleotides, and most preferably at least about 90 nucleotides. In a preferred embodiment, the 3'-UTR element exhibits a length of 3 to about 500 nucleotides, preferably 5 to about 250 nucleotides, and more preferably 90 to 215 nucleotides.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcripts of the following viral genes: HCV, CoV2, DENV2, TCV, CYBA, BYDA and CVB3, and is truncated.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:8, 19, 21 or 23.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the mouse gene AES and is truncated.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:9.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the human gene AAT or AES and is truncated.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:12 or 96.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the bovine gene AES and is truncated.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:98.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the following viral genes or a variant thereof: HCV, CoV2, DENV2, TCV, CYBA, BYDA and CVB3, wherein the variant comprises truncation and 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:6, 7, 20, 22, 30, 31 or 32.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the bovine gene AES or a variant thereof, wherein the variant comprises a truncation and 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:94.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the mouse gene AES or a variant thereof, wherein the variant comprises truncation and 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:97.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the mouse gene AES or a variant thereof, wherein the variant comprises truncations and terminal extensions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:9 and also comprises the nucleic acid sequence of SEQ ID NO:92 or 12.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:10, 13 or 28.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:9, and also comprises the nucleic acid sequences of SEQ ID NO:92 and 12.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:33.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the human gene AAT or a variant thereof, wherein the variant comprises truncations and terminal extensions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:12, and also comprises the nucleic acid sequence of SEQ ID NO:6, 9, 92, 94, 97 or 98.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:11, 13, 14, 28, 34, 35 or 36.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:12, and also comprises the nucleic acid sequences of SEQ ID NO:9 and 92.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:33.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the bovine gene AES or a variant thereof, wherein the variant comprises truncations and terminal extensions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:98 and also comprises the nucleic acid sequence of SEQ ID NO:12.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:35.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the bovine gene AES or a variant thereof, wherein the variant comprises truncation, terminal extension and 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:94 and also comprises the nucleic acid sequence of SEQ ID NO:12.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:11.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the following viral genes or a variant thereof: HCV, CoV2, DENV2, TCV, CYBA, BYDA and CVB3, wherein the variant comprises truncation, terminal extension and 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:6 and also comprises the nucleic acid sequence of SEQ ID NO:92.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:15.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:7 and also comprises the nucleic acid sequence of SEQ ID NO:92.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:24.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:6 and also comprises the nucleic acid sequence of SEQ ID NO:12.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:36.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the mouse gene AES or a variant thereof, wherein the variant comprises truncation, terminal extension and 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises the nucleic acid sequence of SEQ ID NO:97 and also comprises the nucleic acid sequence of SEQ ID NO:12.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:34.
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-untranslated region element comprises a nucleic acid sequence of SEQ ID NO: 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 19, 20, 21, 22, 23, 24, 28, 30, 31, 32, 33, 34, 35, 36, 94, 96, 97 or 98.
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-untranslated region element comprising a nucleic acid sequence derived from the 3'-UTR of a transcript of the following genes or a variant thereof: HCV, CoV2, CVB3, AES and AAT, the variant comprising truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the following viral genes or its variants: HCV, CoV2 and CVB3, wherein the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the mouse gene AES or a variant thereof, wherein the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the human gene AAT or a variant thereof, wherein the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the bovine gene AES or a variant thereof, wherein the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the nucleic acid sequence is derived from the nucleic acid sequence of the 3'-UTR of the transcript of the following viral genes or its variant: HCV, CoV2 and CVB3; or derived from the nucleic acid sequence of the 3'-UTR of the transcript of the mouse gene AES or its variant; or derived from the nucleic acid sequence of the 3'-UTR of the transcript of the human gene AAT or its variant; or derived from the nucleic acid sequence of the 3'-UTR of the transcript of the bovine gene AES or its variant, wherein the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence from which it is derived.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:6, 7, 8, 9, 10, 11, 12, 13, 14 or 15.
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-UTR element at least one 3'-untranslated region element (3'-UTR element), wherein the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO: 16, 42 or 43.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:16.
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-UTR element at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a nucleic acid sequence selected from the group consisting of:
  • the 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO:44, and the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence shown in SEQ ID NO:44; or
  • the 3'-UTR element comprises a nucleic acid sequence derived from the 3'-UTR of a transcript of the following genes or a variant thereof: HCV, CoV2, DENV2, TCV, CYBA, BYDA, CVB3, AES and AAT, wherein the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence derived therefrom; or
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:16, 42 or 43.
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-UTR element at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a nucleic acid sequence selected from the group consisting of:
  • SEQ ID NO:1 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 or 43.
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-UTR element at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a nucleic acid sequence selected from the group consisting of:
  • the 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO:44, and the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence shown in SEQ ID NO:44; or
  • the 3'-UTR element comprises a nucleic acid sequence derived from the 3'-UTR of a transcript of the following genes or a variant thereof: HCV, CoV2, CVB3, AES and AAT, wherein the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence derived therefrom; or
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-UTR element at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a nucleic acid sequence selected from the group consisting of:
  • the 3'-UTR element comprises a variant of the nucleic acid sequence shown in SEQ ID NO:44, and the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence shown in SEQ ID NO:44; or
  • the 3'-UTR element comprises a nucleic acid sequence derived from the 3'-UTR of a transcript of the following genes or a variant thereof: HCV, CoV2, CVB3, AES and AAT, wherein the variant comprises truncation, terminal extension and/or 1, 2, 3 or more mutations, additions or deletions compared to the nucleic acid sequence derived therefrom; or
  • the artificial nucleic acid molecule comprises
  • ORF open reading frame
  • 3'-UTR element at least one 3'-untranslated region element (3'-UTR element), the 3'-UTR element comprising a nucleic acid sequence selected from the group consisting of:
  • SEQ ID NO:1 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16.
  • 5'-untranslated region element refers to a portion of an artificial nucleic acid molecule that is located at the 5' end (i.e., "upstream") of an open reading frame and is not translated into a protein.
  • the 5'-UTR starts at the transcription start site and terminates at one nucleotide before the start codon of the open reading frame.
  • the 5'-UTR plays a key role in regulating gene expression.
  • Many cis-regulatory elements may be included in the DNA sequence of the 5'-UTR, which may interact with the transcription machinery to regulate the abundance of messenger RNA (mRNA).
  • the transcribed 5'-UTR is composed of a variety of RNA-based regulatory elements, including a 5' cap structure, a secondary structure, an RNA binding protein motif, an upstream open reading frame (uORF), an internal ribosome entry site, a terminal oligopyrimidine (TOP) tract, and a G-quadruplex.
  • RNA-based regulatory elements including a 5' cap structure, a secondary structure, an RNA binding protein motif, an upstream open reading frame (uORF), an internal ribosome entry site, a terminal oligopyrimidine (TOP) tract, and a G-quadruplex.
  • the artificial nucleic acid molecule further comprises at least one 5'-untranslated region element (5'-UTR element).
  • the 5'-untranslated region element comprises the nucleic acid sequence of SEQ ID NO:45.
  • poly(A) sequence or “poly(A) tail” refers to a nucleotide sequence comprising continuous or discontinuous adenylic acid.
  • the poly(A) sequence is generally located at the 3' end of the RNA, such as the 3' end (downstream) of the 3'-UTR. In some embodiments, the poly(A) sequence does not contain nucleotides other than adenylic acid at its 3' end.
  • the poly(A) sequence can be transcribed by a DNA-dependent RNA polymerase according to the coding sequence of the DNA template during the preparation of the IVT-RNA, or can be linked to the free 3' end of the IVT-RNA, such as the 3' end of the 3'-UTR, by a DNA-independent RNA polymerase (poly(A) polymerase).
  • the artificial nucleic acid molecule further comprises a poly(A) sequence.
  • polycytidylic acid sequence refers to a nucleotide sequence comprising continuous or discontinuous cytidylic acid.
  • the polycytidylic acid sequence is usually located at the 3' end of the RNA, such as the 3' end (downstream) of the 3'-UTR.
  • the polycytidylic acid sequence does not contain nucleotides other than cytidylic acid at its 3' end.
  • the artificial nucleic acid molecule further comprises a polycytidylic acid sequence.
  • the term “5' cap” generally refers to an N7-methylguanosine structure (also known as “m7G cap”, “m7Gppp-”) attached to the 5' end of the mRNA via a 5' to 5' triphosphate bond.
  • the 5' cap can be co-transcriptionally added to the RNA during in vitro transcription (e.g., using the anti-reverse cap analog "ARCA"), or can be attached to the RNA after transcription using a capping enzyme.
  • the artificial nucleic acid molecule further comprises a 5' cap structure.
  • stem loop (whether it is a histone stem loop or not) can be present in single-stranded DNA, or more commonly in RNA.
  • This structure is also called a hairpin or hairpin loop, and is generally composed of a stem and (terminal) loop in a continuous sequence, wherein the stem is formed by two adjacent completely or partially reverse complementary sequences separated by a short sequence as a spacer to a certain extent, and the short sequence as a spacer becomes the loop of the stem-loop structure.
  • These two adjacent completely or partially reverse complementary sequences can be defined as, for example, stem-loop element stem 1 and stem 2.
  • stem-loop element stem 1 and stem 2 form base pairing with each other, a double-stranded nucleic acid sequence fragment is formed, which contains an unpaired loop formed by a short sequence between the stem-loop element stem 1 and stem 2 on the continuous sequence at its end, thereby forming a stem-loop.
  • histone stem-loop is derived from a histone gene (e.g., from a gene of histone family H1, H2A, H2B, H3, H4), and comprises intramolecular base pairing of two adjacent completely or partially reverse complementary sequences, thereby forming a stem-loop.
  • the artificial nucleic acid molecule further comprises a histone stem-loop.
  • the artificial nucleic acid molecule further comprises a 5' cap structure, a polycytidylic acid sequence, a polyadenylic acid sequence or a histone stem-loop.
  • the artificial nucleic acid molecule further comprises a 5' cap structure and a poly(C) sequence.
  • the artificial nucleic acid molecule further comprises a 5' cap structure and a poly(A) sequence.
  • the artificial nucleic acid molecule further comprises a 5' cap structure, a poly(C) sequence and a histone stem-loop.
  • the artificial nucleic acid molecule further comprises a 5' cap structure, a poly(A) sequence and a histone stem-loop.
  • the artificial nucleic acid molecule further comprises a 5' cap structure, a polycytidylic acid sequence, a polyadenylic acid sequence and a histone stem-loop.
  • the artificial nucleic acid molecule comprises a poly(A) sequence
  • the poly(A) sequence comprises the nucleic acid sequence of SEQ ID NO:46.
  • the artificial nucleic acid molecules defined herein can be prepared using any method known in the art, including synthetic methods, e.g., solid phase synthesis, and in vitro methods, e.g., in vitro transcription reactions or in vivo reactions, e.g., in vivo propagation of DNA plasmids in bacteria.
  • the artificial nucleic acid molecules of the invention can be codon-optimized for the host cells used for expression.
  • the open reading frame (ORF) is codon-optimized.
  • the artificial nucleic acid molecule is RNA.
  • the artificial nucleic acid molecule is mRNA.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 or 89.
  • the 3'-UTR element comprises a nucleic acid sequence of SEQ ID NO:47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 or 62.
  • the mRNA comprises modified nucleotides, wherein the modified nucleotides are selected from one or more of the following nucleotides: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-ur ...
  • the modified nucleotides are selected from one or more of the following nucleotides: 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadeno
  • the present invention also provides an expression vector comprising the artificial nucleic acid molecule of the present invention.
  • the expression vector may further comprise additional nucleic acid sequences, such as regulatory sequences and antibiotic resistance genes.
  • the artificial nucleic acid molecule of the present invention may be present in one or more expression vectors.
  • the vector is a DNA vector.
  • the vector is a plasmid vector or a viral vector.
  • the vector is a plasmid vector, such as a pUC57 plasmid vector.
  • the carrier is a circular molecule.
  • the artificial nucleic acid molecule of the present invention is prepared as a recombinant nucleic acid.
  • Recombinant nucleic acids can be prepared using techniques well known in the art, such as chemical synthesis, DNA recombination technology (such as polymerase chain reaction (PCR) technology), etc.
  • the present invention also provides a method for producing an artificial nucleic acid molecule of the present invention, the method comprising:
  • the present invention also provides a method for increasing the translation efficiency of an artificial nucleic acid molecule, preferably an mRNA molecule or a vector, the method comprising linking an open reading frame to a 3'-UTR element as defined in the present invention.
  • the present invention also provides a cell comprising the artificial nucleic acid molecule or vector of the present invention.
  • the artificial nucleic acid molecule or vector of the present invention can be introduced into a suitable cell by various methods known in the art. Such methods include, but are not limited to, liposome transfection, electroporation, viral transduction, and calcium phosphate transfection.
  • cells are used to express the peptide or protein encoded by the ORF in the artificial nucleic acid molecule of the present invention.
  • examples of cells include, but are not limited to, prokaryotic cells (e.g., bacteria, such as Escherichia coli) and eukaryotic cells (e.g., yeast, insect cells, mammalian cells).
  • Suitable mammalian host cells include, but are not limited to, human cervical cancer cells (HeLa cells), human embryonic kidney cells (HEK cells, such as HEK 293 cells), Chinese hamster ovary (CHO) cells, and other mammalian cells.
  • the cell is a mammalian cell.
  • the cells are cells isolated from a human subject.
  • the present invention further provides a lipid composition.
  • the lipid composition is a lipid delivery carrier, and the lipid can encapsulate the artificial nucleic acid molecule of the present invention to form nanoparticles, thereby delivering it into an organism.
  • lipid refers to an organic compound comprising a hydrophobic portion and optionally also a hydrophilic portion. Lipids are generally insoluble in water but soluble in many organic solvents. Typically, amphipathic lipids comprising a hydrophobic portion and a hydrophilic portion can be organized into a lipid bilayer structure in an aqueous environment, for example, in the form of vesicles. Lipids may include, but are not limited to, fatty acids, glycerides, phospholipids, sphingolipids, glycolipids, steroids, and cholesterol esters, etc.
  • lipid nanoparticle refers to a lipid vesicle with a uniform lipid core, which is a particle formed by lipids, and the lipid components undergo intermolecular interactions to form a nanostructured entity.
  • Nucleic acids eg, mRNA
  • lipids are encapsulated in lipids.
  • Particularly preferred lipid compositions can be, for example, lipid multiplexes (LPPs) as described herein. Methods for preparing such compositions can be as described herein.
  • LPPs are particles with a core-shell structure, wherein nucleic acids are contained in multiplexes, and the multiplexes themselves are encapsulated in biocompatible lipid bilayer shells to form lipid nanoparticles of the present invention.
  • the lipid composition of the present invention is a lipid multiplex (LPP).
  • the lipid composition of the present invention is a lipid multiplex (LPP) comprising an artificial nucleic acid molecule.
  • the lipid encapsulating the artificial nucleic acid molecule of the present invention is selected from one or more of the following lipids: cationic lipids, phospholipids, steroids and/or polyethylene glycol-modified lipids.
  • the cationic lipid is an ionizable cationic lipid.
  • the lipid composition of the present invention comprises the artificial nucleic acid molecule of the present invention and a lipid encapsulating the artificial nucleic acid molecule.
  • the lipid encapsulating the artificial nucleic acid molecule comprises a cationic lipid, a phospholipid, a steroid and a polyethylene glycol-modified lipid.
  • the lipid composition comprises a cationic lipid, wherein the cationic lipid comprises DOTMA, DOTAP, DDAB, DOSPA, DODAC, DODAP, DC-Chol, DMRIE, DMOBA, DLinDMA, DLenDMA, CLinDMA, DMORIE, DLDMA, DMDMA, DOGS, N4-cholesteryl-spermine, DLin-KC2-DMA, DLin-MC3-DMA, a compound of formula (I), (II), (III) or (IV) as described herein, or a combination thereof.
  • the cationic lipid comprises M5, MC3, ALC-0315, SM-102.
  • the cationic lipid comprises SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2.
  • the cationic lipid comprises M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2.
  • the lipid composition comprises a phospholipid and/or a steroid.
  • the lipid composition comprises a phospholipid as described herein, wherein the phospholipid comprises 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diondecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn- Glycerol-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphocho
  • the lipid composition comprises a steroid as described herein, wherein the steroid comprises cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, ⁇ -tocopherol and derivatives thereof.
  • the lipid composition comprises a phospholipid as described herein and a steroid.
  • the lipid composition comprises DOPE.
  • the lipid composition comprises DSPC.
  • the lipid composition comprises cholesterol.
  • the lipid composition comprises DOPE and cholesterol.
  • the lipid composition comprises DSPC and cholesterol.
  • the lipid composition comprises cationic lipids M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, phospholipids DOPE and cholesterol.
  • the lipid composition comprises cationic lipids M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, phospholipids DSPC and cholesterol.
  • the lipids encapsulating the artificial nucleic acid molecules of the present invention further comprise polyethylene glycol-modified lipids.
  • the polyethylene glycol-modified lipids comprise DMG-PEG (e.g., DMG-PEG 2000), DOG-PEG, and DSPE-PEG or a combination thereof.
  • the polyethylene glycol-modified lipid is DSPE-PEG.
  • the polyethylene glycol-modified lipid is DMG-PEG (e.g., DMG-PEG 2000).
  • the lipid composition comprises a cationic lipid, DOPE, cholesterol, and DSPE-PEG.
  • the lipid composition comprises a cationic lipid, DSPC, cholesterol, and DSPE-PEG.
  • the lipid composition comprises a cationic lipid, DSPC, cholesterol, and DMG-PEG.
  • the lipid composition comprises a cationic lipid, DOPE, cholesterol and DMG-PEG.
  • the lipid composition comprises the cationic lipids M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, DOPE, cholesterol and DMG-PEG.
  • the lipid composition of the present invention further comprises a cationic polymer, which is associated with the artificial nucleic acid molecule as a complex and is co-encapsulated in the lipid.
  • the cationic polymer comprises poly-L-lysine, protamine, polyethyleneimine (PEI), or a combination thereof. In one embodiment, the cationic polymer is protamine. In one embodiment, the cationic polymer is polyethyleneimine.
  • the amount of lipid in the lipid composition is calculated as a mole percent (mol %), which is determined based on the total moles of lipid in the composition.
  • the amount of cationic lipid in the lipid composition is about 10-about 70 mol%. In some embodiments, the amount of cationic lipid in the lipid composition is about 20-about 60 mol%, about 30-about 50 mol%, about 35-about 50 mol%, about 35-about 45 mol%, about 38-about 45 mol%, about 40-about 45 mol%, about 40-about 50 mol%, or about 45-about 50 mol%.
  • the amount of phospholipids in the lipid composition is about 10-about 70 mol%. In one embodiment, the amount of phospholipids in the lipid composition is about 20-about 60 mol%, about 30-about 50 mol%, about 10-about 30 mol%, about 10-about 20 mol%, or about 10-about 15 mol%.
  • the amount of cholesterol in the lipid composition is about 10-about 70 mol%. In one embodiment, the amount of cholesterol in the lipid composition is about 20-about 60 mol%, about 24-44 mol%, about 30-about 50 mol%, about 35-about 40 mol%, about 35-about 45 mol%, about 40-about 45 mol%, or about 45-about 50 mol%.
  • the amount of polyethylene glycol-modified lipids in the lipid composition is about 0.05-about 20 mol%. In one embodiment, the amount of polyethylene glycol-modified lipids in the lipid composition is about 0.5-about 15 mol%, about 1-about 10 mol%, about 5-about 15 mol%, about 1-about 5 mol%, about 1-about 1.5 mol%, about 1.5-about 3 mol%, or about 2-5 mol%.
  • the lipid composition comprises 10-70 mol % of cationic lipids, 10-70 mol % of phospholipids, 10-70 mol % of steroids and 0.05-20 mol % of polyethylene glycol-modified lipids. In a preferred embodiment, the lipid composition comprises 35-50 mol % of cationic lipids, 10-30 mol % of phospholipids, 24-44 mol % of steroids and 1-1.5 mol % of polyethylene glycol-modified lipids.
  • LPP comprises an artificial nucleic acid molecule of the present invention and a lipid encapsulating the artificial nucleic acid molecule, wherein the lipid encapsulating the artificial nucleic acid molecule comprises a cationic lipid, a phospholipid, a steroid and a polyethylene glycol-modified lipid; the LPP further comprises a cationic polymer, wherein the cationic polymer is associated with the artificial nucleic acid molecule as a complex.
  • the lipid composition of the present invention comprises an artificial nucleic acid molecule of the present invention and a lipid encapsulating the artificial nucleic acid molecule, wherein the lipid encapsulating the artificial nucleic acid molecule comprises a cationic lipid, a phospholipid, a steroid and a polyethylene glycol-modified lipid; the lipid composition further comprises a cationic polymer, wherein the cationic polymer is associated with the artificial nucleic acid molecule as a complex, and is co-encapsulated in the lipid to form a lipid polymer complex.
  • the lipid composition comprises 2.5-20 mol% of a polyethylene glycol-modified lipid, based on the total amount of all lipids in the lipid composition.
  • the phospholipid is selected from 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoylphosphatidylcholine (DSPC) or a combination thereof.
  • DOPE 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine
  • DSPC distearoylphosphatidylcholine
  • the steroid is cholesterol.
  • the cationic polymer is protamine.
  • the polyethylene glycol-modified lipid is selected from 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (DSPE-PEG) or a combination thereof.
  • the cationic lipid is selected from M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2.
  • the lipid encapsulation complex comprises 50 mol% of M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, 10 mol% of DOPE, 38.5 mol% of cholesterol and 1.5 mol% of DMG-PEG.
  • the lipid encapsulation complex comprises 40 mol% of M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2, 15 mol% of DOPE, 43.5 mol% of cholesterol and 1.5 mol% of DMG-PEG.
  • Cationic lipids are lipids that can have a net positive charge at a given pH. Lipids with a net positive charge can associate with nucleic acids through electrostatic interactions.
  • cationic lipids include, but are not limited to, 1,2-di-O-octadecenyl-3-trimethylammonium-propane (DOTMA), 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), didecyldimethylammonium bromide (DDAB), 2,3-dioleoyloxy-N-[2(spermaminecarboxamide)ethyl]-N,N-dimethyl-l-propylamine trifluoroacetate (2,3-dioleoyloxy-N-[2(spermaminecarboxamide)ethyl]-N,N-dimethyl-l-propylamine trifluoroacetate (2,3-dioleoyloxy-N-[2(spermaminecarboxamide)ethyl]-N,N-dimethyl-l-propylamine trifluoroacetate (2,3-dioleoyloxy-N-
  • DOSPA dioctadecyldimethyl ammonium chloride
  • DODAC 1,2-dioleoyl-3-dimethylammonium-propane
  • DODAP 3-(N—(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol, DC-Chol), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium (DMRIE), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), enyloxy-N,N-dimethyla
  • the cationic lipid is preferably an ionizable cationic lipid.
  • An ionizable cationic lipid has a net positive charge at, for example, acidic pH, but is neutral at higher pH (eg, physiological pH).
  • ionizable cationic lipids include, but are not limited to, dioctadecylamidoglycyl spermine (DOGS), N4-cholesteryl-spermine, 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA), compounds of formula (I), (II), (III) or (IV) as described herein, or combinations thereof.
  • DOGS dioctadecylamidoglycyl spermine
  • N4-cholesteryl-spermine 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane
  • DLin-KC2-DMA 2,2-dilino
  • the cationic lipid comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof:
  • R1 and R2 are each independently selected from a bond, a C1 - C12 alkyl group, and a C2 - C12 alkenyl group;
  • R3 and R4 are each independently selected from C1 - C12 alkyl, C2 - C12 alkenyl, C6 - C10 aryl and 5-10 membered heteroaryl; and R3 and R4 are each independently optionally substituted by t R6 , t being an integer selected from 1-5;
  • R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl
  • M1 and M2 are each independently selected from a bond, H, -O-, -S-, -C(O)-, -OC(O)-, -C(O)O-, -OC(O)O-, -SC(S)-, -C(S)S-, a 3-10 membered heterocycle, -NR7- , or
  • R 5 one of M 1 and M 2 , together with the nitrogen atom to which they are attached, form a 3-10 membered heterocyclic ring, and the corresponding R 1 /R 3 or
  • R 2 /R 4 is absent, the heterocyclic ring is optionally substituted by R 7 ;
  • R 5 is selected from C 3-8 carbocycle, -C 1-12 alkylene-Q
  • n are each independently an integer selected from 0-12;
  • the alkyl, alkenyl and alkylene groups are each optionally and independently interrupted by one or more groups selected from: -O-, -S-, -NR 7 -, -C(O)-, -OC(O)-, -C(O)O-, -SC(S)-, -C(S)S-, C 3-8 carbocycle, and the alkyl, alkenyl and alkylene groups are each optionally substituted by one or more R 7 ;
  • R1 and R2 are each independently selected from C1 - C12 alkyl and C2 - C12 alkenyl, such as C1 - C12 alkyl.
  • one of R1 and R2 is a bond and the other is independently selected from C1 - C12 alkyl and C2 - C12 alkenyl, such as C1 - C12 alkyl.
  • R3 and R4 are each independently selected from C1 - C12 alkyl, C2 - C12 alkenyl, C6 - C10 aryl and 5-10 membered heteroaryl. In another embodiment, R3 and R4 are each independently selected from C1 - C12 alkyl and C2 - C12 alkenyl.
  • R 3 and R 4 may each independently be optionally substituted by t R 6 , t being 1, 2, 3, 4, or 5.
  • R 6 is each independently selected from C 1 -C 12 alkyl.
  • At least one of R 3 and R 4 is C 6 -C 10 aryl or 5-10 membered heteroaryl, for example C 6 -C 10 aryl.
  • R 5 is selected from C 3-8 carbocycle, -C 1-12 alkylene-Q.
  • Q may be selected from H, -OR 7 , -SR 7 , -OC(O)R 7 , -C(O)OR 7 , -N(R 7 )C(O)R 7 , -N(R 7 )S(O) 2 R 7 , -N(R 7 )C(S)R 7 , -N(R 7 ) 2 , cyano, C 3-8 carbocycle, 3-10 membered heterocycle, C 6 -C 10 aryl.
  • the above groups may each be optionally substituted with one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, hydroxy, oxo ( ⁇ O), where appropriate.
  • R 5 is selected from C 3-8 carbocycle, -C 1-12 alkylene-Q
  • Q is selected from H, -OR 7 , -SR 7 , -OC(O)R 7 , -C(O)OR 7 , -N(R 7 )C(O)R 7 , -N(R 7 )S(O) 2 R 7 , -N(R 7 )C(S)R 7 , -N(R 7 ) 2 , cyano, C 3-8 carbocycle, 3-10 membered heterocycle, C 6 -C 10 aryl.
  • the above groups may each be optionally substituted with one or more C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, hydroxy, oxo ( ⁇ O), where appropriate.
  • R7 can be each independently selected from H, C1 - C12 alkyl, C2- C12 alkenyl, C1 - C12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C6 - C10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, C3-8 carbocycle, preferably selected from H, C1 - C12 alkyl, C2- C12 alkenyl, C1 - C12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C6 - C10 aryl and 5-10 membered heteroaryl.
  • each group described above such as C 3-8 carbocycle, -C 1-12 alkylene-Q, includes -OR 7 , -SR 7 , -OC(O)R 7 , -C(O)OR 7 , -N(R 7 )C(O)R 7 , -N(R 7 )S(O) 2 R 7 , -N(R 7 )C(S)R 7 , -N(R 7 ) 2 , C 3-8 carbocycle, 3-10 membered heterocycle, C 6 -C 10 aryl, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, C The 3-8
  • the alkyl, alkenyl and alkylene groups (e.g., those mentioned in R 1 -R 7 ) in the compounds of formula (I) may each be optionally and independently interrupted by one or more groups selected from: -O-, -S-, -NR 7 -, -C(O)-, -OC(O)-, -C(O)O-, -SC(S)-, -C(S)S-, C 3-8 carbocycle, and the alkyl, alkenyl and alkylene groups may each be optionally substituted by one or more R 7.
  • the chains (straight or branched) of the alkyl, alkenyl and alkylene groups may each optionally contain one or more groups selected from: -O-, -S-, -NR 7 -, -C(O)-, -OC(O)-, -C(O)O-, -SC(S)-, -C(S)S-, C 3-8 carbocycle.
  • R7 is each independently selected from H, C1 - C12 alkyl, C2- C12 alkenyl, C1 - C12 alkoxy, carboxylic acid , sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C6 - C10 aryl, 5-10 membered heteroaryl, 3-10 membered heterocycle, halogen, C3-8 carbocycle; preferably, R7 is independently selected from H, C1 - C12 alkyl, C2 - C12 alkenyl, C1 - C12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C6 - C10 aryl and 5-10 membered heteroaryl.
  • n and n can each independently be an integer selected from 0 to 12, for example, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. When 0 is taken, it means that the corresponding group does not exist.
  • M 1 or M 2 is a bond, the corresponding m or n is not 0, and the carbon chain before M 1 or M 2 is connected to the corresponding R 1 or R 2 .
  • m or n is 0, the corresponding M1 or M2 is not a bond, and the N atom is directly connected to M1 or M2 .
  • M1 or M2 is a bond, the corresponding m or n is 0, and the N atom is directly connected to the corresponding R1 or R2 .
  • M1 and M2 are each independently selected from -C(O)-, -OC(O)-, -C(O)O- and -OC(O)O-. In another embodiment, M1 and M2 are each independently selected from -NR7- , and R7 is as described above.
  • R 5 and one of M 1 and M 2 together with the attached N atom form a 3-10 membered heterocyclic ring, and the corresponding R 1 /R 3 or R 2 /R 4 are absent, and the heterocyclic ring is optionally substituted with R 7 , and R 7 is as described above.
  • R 5 is selected from -C 1-12 alkylene-Q
  • Q is selected from H, -OR 7 , -OC(O)R 7 , -C(O)OR 7 , -N(R 7 )C(O)R 7 , -N(R 7 ) 2 , cyano, and R 7 is as described above.
  • R 1 and R 2 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl;
  • R 3 and R 4 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl; and R 3 and R 4 are each independently optionally substituted by t R 6 , t being an integer selected from 1-5; and R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl.
  • M1 and M2 are each independently selected from -OC(O)-, -C(O)O-, -OC(O)O-, -SC(S)- and -C(S)S-;
  • R 5 is selected from -C 1 -12 alkylene-Q
  • Q is selected from -OR 7 and -SR 7
  • R 7 is independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl and 5-10 membered heteroaryl;
  • n are each independently an integer selected from 1-12.
  • the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof:
  • the cationic lipid comprises M5 or SM-102.
  • the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof:
  • the cationic lipid comprises MC3.
  • the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof:
  • the cationic lipid comprises ALC-0315.
  • the cationic lipid comprises a compound of formula (I) or a pharmaceutically acceptable salt thereof:
  • R1 and R2 are each independently selected from C1 - C12 alkyl and C2 - C12 alkenyl;
  • R 3 and R 4 are each independently selected from C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 6 -C 10 aryl and 5-10 membered heteroaryl;
  • R 3 and R 4 are C 6 -C 10 aryl or 5-10 membered heteroaryl, and R 3 and R 4 are each independently optionally substituted by t R 6 , t being an integer selected from 1-5; R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl;
  • M1 and M2 are each independently selected from -OC(O)-, -C(O)O-, -OC(O)O-, -SC(S)- and -C(S)S-;
  • R 5 is selected from -C 1-12 alkylene-Q
  • Q is selected from -OR 7 and -SR 7
  • R 7 is independently selected from H, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 1 -C 12 alkoxy, carboxylic acid, sulfinic acid, sulfonic acid, sulfonyl, nitro, cyano, amino, carbamoyl, sulfonamide, C 6 -C 10 aryl and 5-10 membered heteroaryl;
  • n are each independently an integer selected from 1-12.
  • R 2 is selected from C 1 -C 12 alkyl. In another embodiment, R 2 is selected from C 1 -C 6 alkyl.
  • one of R 3 and R 4 is C 6 -C 10 aryl or 5-10 membered heteroaryl, and the other is C 1 -C 12 alkyl or C 2 -C 12 alkenyl.
  • R3 and R4 are each independently selected from C1 - C12 alkyl and phenyl, provided that at least one of R3 and R4 is phenyl. In another embodiment, one of R3 and R4 is phenyl and the other is C1 - C12 alkyl.
  • R3 and R4 are each independently substituted by t R6 , t being an integer selected from 1-5; for example 1, 2, 3, 4 or 5.
  • t is an integer from 1-3, for example 1, 2 or 3, in particular 1 or 2.
  • each R 6 is independently selected from C 1 -C 12 alkyl, such as C 1 -C 10 alkyl.
  • t is 1 and R 6 is substituted on the phenyl ring at the meta or para position relative to R 1 or R 2 .
  • t is 2 and R 6 is substituted on the phenyl ring at the meta and para positions relative to R 1 or R 2 .
  • R 4 is substituted at the 1st position or the last position of R 2.
  • the 1st position refers to the position of the C atom in R 2 that is directly connected to M 2.
  • the last position refers to the position of the C atom in R 2 that is farthest from M 2.
  • R 4 is selected from C 1 -C 12 alkyl, and R 3 is phenyl.
  • R 3 is substituted at the 1st position or the last position of R 1.
  • the 1st position refers to the position of the C atom in R 1 that is directly connected to M 1.
  • the last position refers to the position of the C atom in R 1 that is farthest from M 1.
  • R 3 is selected from C 1 -C 12 alkyl, and R 4 is phenyl.
  • M1 and M2 are each independently selected from -OC(O)-, -C(O)O- and -OC(O)O-.
  • R 5 is selected from -C 1-5 alkylene-Q, such as C 1 , C 2 , C 3 , C 4 or C 5 alkylene-Q. In an exemplary embodiment, R 5 is selected from -C 1-3 alkylene-Q, such as C 1 , C 2 or C 3 alkylene-Q.
  • Q is selected from -OH and -SH, in particular -OH.
  • m and n are each independently an integer selected from 2-9, such as 2, 3, 4, 5, 6, 7, 8 or 9.
  • m and n are each independently an integer selected from 2-7, such as 2, 3, 4, 5, 6 or 7, more preferably, m and n are each independently an integer selected from 5-7, such as 5, 6 or 7.
  • the compound of formula (I) includes a compound represented by formula (II):
  • R 1 is selected from C 1 -C 6 alkyl
  • R 2 is selected from C 1 -C 10 alkyl
  • R 4 is selected from C 1 -C 10 alkyl
  • M1 and M2 are each independently selected from -OC(O)-, -C(O)O- and -OC(O)O-;
  • R 5 is selected from -C 1-5 alkylene-Q
  • Q is selected from -OR 7 and -SR 7
  • R 7 is independently selected from H, C 1 -C 12 alkyl and C 2 -C 12 alkenyl
  • R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl, in particular C 1 -C 12 alkyl;
  • n and n are each independently an integer selected from 2-9, such as 2, 3, 4, 5, 6, 7, 8 or 9;
  • t is an integer selected from 1-3.
  • R 5 is selected from -C 1-3 alkylene-Q
  • Q is selected from -OH and -SH, especially -OH.
  • n and n are each independently an integer selected from 2-7, such as 2, 3, 4, 5, 6 or 7.
  • t is 1 or 2.
  • R 4 is substituted at the 1st position or the last position of R 2.
  • the 1st position refers to the position of the C atom in R 2 that is directly connected to M 2.
  • the last position refers to the position of the C atom in R 2 that is farthest from M 2 .
  • t is 1 and R 6 is substituted on the phenyl ring at the meta or para position relative to R 1 .
  • t is 2 and R 6 is substituted on the phenyl ring at the meta and para positions relative to R 1 .
  • the compound of formula (I) includes a compound represented by formula (III):
  • R 1 is selected from C 1 -C 6 alkyl
  • R 2 is selected from C 1 -C 10 alkyl
  • R 4 is selected from C 1 -C 10 alkyl
  • R 5 is selected from -C 1-3 alkylene-Q, Q is selected from -OH and -SH, especially -OH;
  • t 1 or 2;
  • R 6 is selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl, in particular C 1 -C 12 alkyl;
  • n and n are each independently an integer selected from 2-7, for example 2, 3, 4, 5, 6 or 7.
  • R 4 is substituted at the 1st or last position of R 2.
  • the 1st position refers to the position of R 2 that is The last position refers to the position of the C atom in R 2 that is directly connected to the The position of the C atom that is farthest from the part.
  • t is 1 and R 6 is substituted on the phenyl ring at the meta or para position relative to R 1 .
  • t is 2 and R 6 is substituted on the phenyl ring at the meta and para positions relative to R 1 .
  • the compound of formula (I) includes a compound of formula (IV):
  • R 1 is selected from C 1 -C 6 alkyl
  • R 2 is selected from C 1 -C 10 alkyl
  • R 4 is selected from C 1 -C 10 alkyl
  • t 1 or 2;
  • R 6 are each independently selected from C 1 -C 12 alkyl and C 2 -C 12 alkenyl, in particular C 1 -C 12 alkyl;
  • n and n are each independently an integer selected from 2-7, for example 2, 3, 4, 5, 6 or 7.
  • R 4 is substituted at the 1st or last position of R 2.
  • the 1st position refers to the position of R 2 that is The last position refers to the position of the C atom in R 2 that is directly connected to the The position of the C atom that is farthest from the others.
  • t is 1 and R 6 is substituted on the phenyl ring at the meta or para position relative to R 1 .
  • t is 2 and R 6 is substituted on the phenyl ring at the meta and para positions relative to R 1 .
  • the substituents (eg, R 1 -R 7 ) in the lipid compounds of the present invention do not include alkenyl groups.
  • the cationic lipid comprises a lipid compound having the structure shown below or a pharmaceutically acceptable salt thereof:
  • the cationic lipid comprises the following lipid compound: SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2.
  • the cationic lipid comprises the following lipid compound: M5, MC3, ALC-0315, SM-102, SW-II-115, SW-II-121, SW-II-122, SW-II-134-3, SW-II-138-2, SW-II-139-2 or SW-II-140-2.
  • the lipid composition of the present invention contains phospholipids, which can assist the cell penetration of the lipid composition.
  • phospholipids include, but are not limited to, 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diondecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPPC).
  • DLPC 1,2-dilinoleoyl-sn-glycero-3-phosphocholine
  • 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diacetonic acid-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphocholine ethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3
  • the lipid composition of the present invention comprises a steroid, which can serve as a structural component of the lipid composition.
  • steroids examples include, but are not limited to, cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, alpha-tocopherol, and derivatives thereof.
  • polyethylene glycol-modified lipid or "PEG-modified lipid” or “PEG lipid” refers to a molecule comprising a polyethylene glycol portion and a lipid portion, which is a lipid modified with polyethylene glycol.
  • the PEG lipid can be selected from the non-limiting group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (PEG-CER), PEG-modified dialkylamine, PEG-modified diacylglycerol (PEG-DEG), PEG-modified dialkylglycerol, or a combination thereof.
  • examples of polyethylene glycol-modified lipids include, but are not limited to, 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG), 1,2-Dioleoyl-rac-glycerol, methoxypolyethylene Glycol (DOGPEG), and 1,2-Distearoyl-sn-glycero-3-phosphoethanolamine-Poly(ethylene glycol) (DSPE-PEG).
  • DMG-PEG 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol
  • DOGPEG methoxypolyethylene Glycol
  • DSPE-PEG 1,2-Distearoyl-sn-glycero-3-phosphoethanolamine-Poly(ethylene glycol)
  • the polyethylene glycol-modified lipid is DMG-PEG, such as DMG-PEG 2000.
  • DMG-PEG 2000 has the following structure:
  • n 44.
  • cationic polymer refers to any ionic polymer that can carry a net positive charge at a specified pH, thereby electrostatically binding to nucleic acids.
  • examples of cationic polymers include, but are not limited to, poly-L-lysine, protamine, polyethyleneimine (PEI), or a combination thereof.
  • the polyethyleneimine can be linear or branched polyethyleneimine.
  • protamine refers to a low molecular weight basic protein rich in arginine, which exists in sperm cells of various animals (especially fish) and binds to DNA instead of histones.
  • the cationic polymer is protamine (eg, protamine sulfate).
  • the present invention also provides a pharmaceutical composition
  • a pharmaceutical composition comprising the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention or the lipid composition of the present invention, and a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include, but are not limited to, diluents, binders and adhesives, lubricants, disintegrants, preservatives, vehicles, dispersants, glidants, sweeteners, coatings, excipients, preservatives, antioxidants (such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, ⁇ -tocopherol, citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc.), solubilizers, gelling agents, softeners, solvents (e.g., water, alcohol, acetic acid and syrup), buffers (e.g., phosphate buffers, histidine buffers and acetate
  • compositions provided herein can be in a variety of dosage forms, including but not limited to solid, semisolid, liquid, powder or lyophilized forms.
  • dosage forms comprising artificial nucleic acid molecules, vectors, cells or lipid compositions
  • preferred dosage forms can generally be, for example, injection solutions and lyophilized powders.
  • compositions provided herein can be administered to a subject by any method known in the art, such as by systemic or topical administration.
  • the route of administration includes, but is not limited to, parenteral (e.g., intravenous, intraperitoneal, intradermal, intramuscular, subcutaneous or intracavitary), topical (e.g., intratumoral), epidural or mucosal (e.g., intranasal, oral, vaginal, rectal, sublingual or topical).
  • parenteral e.g., intravenous, intraperitoneal, intradermal, intramuscular, subcutaneous or intracavitary
  • topical e.g., intratumoral
  • epidural or mucosal e.g., intranasal, oral, vaginal, rectal, sublingual or topical
  • the pharmaceutical composition is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).
  • the present invention relates to use of the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention in the preparation of a vaccine or a medicament for gene therapy.
  • the present invention relates to use of the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention in the preparation of a medicament for treating or preventing a disease.
  • the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention can be used to treat a disease, a disorder or a condition.
  • the artificial nucleic acid molecule of the present invention, the vector of the present invention, the cell of the present invention, the lipid composition of the present invention or the pharmaceutical composition of the present invention can be used to treat a disease, a disorder or a condition characterized by loss or abnormal protein or polypeptide activity.
  • an artificial nucleic acid molecule, a vector, a cell, a lipid composition or a pharmaceutical composition comprising an mRNA encoding a loss or abnormal polypeptide can be administered or delivered to a cell.
  • the mRNA is subsequently translated to produce the polypeptide, thereby reducing or eliminating the problems caused by the absence or abnormal activity of the polypeptide. Since translation can occur rapidly, these methods and artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions are used to treat acute diseases, disorders or conditions such as sepsis, apoplexy and myocardial infarction.
  • Diseases, disorders or conditions characterized by malfunction or abnormal protein or polypeptide activity to which the artificial nucleic acid molecules, vectors, cells, lipid compositions or pharmaceutical compositions of the present invention can be administered include, but are not limited to, rare diseases, infectious diseases (in the form of vaccines and therapeutic agents), cancers and proliferative diseases, genetic diseases (e.g., cystic fibrosis), autoimmune diseases, neurodegenerative diseases, cardiovascular and renal vascular diseases, and metabolic diseases.
  • rare diseases e.g., cystic fibrosis
  • genetic diseases e.g., cystic fibrosis
  • autoimmune diseases e.g., cystic fibrosis
  • malfunctioning proteins are missense mutation variants of the cystic fibrosis transmembrane conductance regulatory protein (CFTR) gene, which produce malfunctioning protein variants of the CFTR protein, thereby causing cystic fibrosis.
  • the present invention provides a method for treating such diseases, disorders or conditions of a subject by administering an artificial nucleic acid molecule, vector, cell, lipid composition or pharmaceutical composition of the present invention, wherein the RNA may be an mRNA encoding a polypeptide that antagonizes or otherwise overcomes the abnormal protein activity present in the subject's cells.
  • the artificial nucleic acid molecule, vector, cell, lipid composition or pharmaceutical composition of the present invention can be administered to a subject using any reasonable amount and any administration route that is effective for the prevention, treatment, diagnosis of a disease, disorder or condition or for any other purpose.
  • the specific amount administered to a given subject may vary depending on the species, age and general condition of the subject; the purpose of administration; the specific composition; the mode of administration, etc.
  • the artificial nucleic acid molecule, vector, cell, lipid composition or pharmaceutical composition of the present invention can be administered to a subject by any method known to those skilled in the art, such as parenteral, oral, transmucosal, transdermal, intramuscular, intravenous, intradermal, subcutaneous or intraperitoneal.
  • the present invention also provides a kit comprising an artificial nucleic acid molecule, a vector, a cell, a lipid composition or a pharmaceutical composition of the present invention, and instructions for use.
  • the kit may also comprise a suitable container.
  • the kit also comprises a device for administration.
  • the kit generally includes a label indicating the intended use and/or method of use of the contents of the kit.
  • label includes any written or recorded material provided on or with the kit or otherwise provided with the kit.
  • the artificial nucleic acid molecule, vector, cell, lipid composition or pharmaceutical composition of the present invention can exhibit excellent effects, such as but not limited to: 1) improving the translation efficiency of the contained mRNA; and/or 2) the contained mRNA has high stability.
  • the cationic lipid according to formula (I) is synthesized by Silicomai or prepared by reference, such as CN110520409A, WO2018081480A1 or US11,246,933B1; phospholipid (DOPE) is purchased from CordenPharma; cholesterol is purchased from Sigma-Aldrich; mPEG2000-DMG (i.e., DMG-PEG 2000) is purchased from Avanti Polar Lipids, Inc.; PBS is purchased from Invitrogen; protamine sulfate is purchased from Beijing Silian Pharmaceutical Co., Ltd.; mPEG2000-DSPE is purchased from Lipooid GmbH; DSPC is purchased from Avanti Polar Lipids, Inc.
  • DOPE phospholipid
  • DMG-PEG 2000 is purchased from Avanti Polar Lipids, Inc.
  • PBS is purchased from Invitrogen
  • protamine sulfate is purchased from Beijing Silian Pharmaceutical Co., Ltd.
  • mPEG2000-DSPE is purchased from Lipooi
  • LAH Lithium Aluminum Hydride
  • reaction mixture was diluted with DCM (20 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure.
  • the residue was purified by silica gel column chromatography, eluted with petroleum ether: ethyl acetate (1: 0-20: 1) to give compound 3 (4.365 g, 28%) as a colorless oil.
  • reaction mixture was diluted with DCM (50 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure.
  • the residue was purified by silica gel column chromatography, eluted with petroleum ether:ethyl acetate (1:0-10:1) to give compound 3 (0.5 g, 45%) as a colorless oil.
  • a mixed solution containing compound 1 (1.22 g, 5.0 mmol, 1.0 eq.), compound 2 (1.30 mg, 10.0 mmol, 2.0 eq.), Pd(PPh 3 ) 4 (289 mg, 0.25 mmol, 0.05 eq.) and K 2 CO 3 (1.38 g, 10.0 mmol, 2.0 eq.) in toluene (10 ml) and H 2 O (1 ml) was stirred at 110° C. under N 2 protection for 1 hour. TLC (petroleum ether:ethyl acetate 19:1) showed that compound 1 was consumed and a new spot was observed.
  • reaction mixture was diluted with DCM (50 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure.
  • the residue was purified by silica gel column chromatography, eluted with petroleum ether:ethyl acetate (1:0-10:1) to give compound 3 (0.78 g, 62%) as a colorless oil.
  • reaction mixture was diluted with DCM (20 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure.
  • the residue was purified by silica gel column chromatography, eluted with petroleum ether: ethyl acetate (1: 0-10: 1) to give compound 3 (1.2 g, 66.9%) as a yellow oil.
  • reaction mixture was quenched with H 2 O (80 mL) and extracted with ethyl acetate (60 mL ⁇ 3), and the organic layer was dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure.
  • the residue was purified by silica gel column chromatography, eluted with petroleum ether/ethyl acetate (1/0-10/1) to obtain yellow oily compound 3 (800 mg, 78%).
  • reaction mixture was diluted with DCM (20 mL) and washed with H 2 O (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure.
  • the residue was purified by silica gel column chromatography, eluted with petroleum ether/ethyl acetate (1/0-10/1) to obtain yellow oily compound 3 (1.2 g, 66.9%).
  • reaction mixture was extracted with ethyl acetate (20 mL) and washed with water (40 mL ⁇ 3), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure.
  • the residue was purified by silica gel column chromatography, eluted with petroleum ether/ethyl acetate (1/0-20/1) to give a colorless oily compound 3 (4.365 g, 28%).
  • reaction mixture was washed with H 2 O (90 mL) and extracted with EA (110 mL) three times, and the organic phase was washed twice with brine (40 mL), dried over anhydrous Na 2 SO 4 , filtered and concentrated under reduced pressure.
  • the residue was purified by silica gel column chromatography eluting with PE/EA (1/0-30/1) to give compound 3 (1.98 g, 45.5%) as a yellow oil.
  • the residue was purified by silica gel column chromatography eluting with PE/EA (1/0-7/1) to give compound 11 (210 mg, 50.5%) as a yellow oil.
  • reaction mixture was extracted with ethyl acetate (200 mL) and washed with water (200 mL ⁇ 3), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure.
  • the residue was purified by silica gel column chromatography, eluted with petroleum ether/ethyl acetate (1/0-20/1) to give a colorless oily compound 3 (7.391 g, 37%).
  • the reaction was directly dried under reduced pressure, and the residue was purified by silica gel column, eluted with DCM/MeOH (1/0-10:1, v/v) to obtain the target product (100 mg, 51%, SW-II-138-2) as a colorless oil.
  • the plasmid containing different 3'-UTR elements is as follows: different 3'-UTR elements (sequences are shown in SEQ ID NO: 1-43) are cloned into the middle region between the downstream stop codon and the poly (A) sequence of the reporter gene firefly luciferase (Firefly Luciferase) by genetic means of homologous recombination, that is, the 3'-UTR region shown in Figure 1, and the rest are the same.
  • a plasmid containing only the poly (A) sequence after the downstream stop codon of firefly luciferase and not containing the tested 3'-UTR element is used as a reference construct.
  • Figure 2 is an exemplary artificial nucleic acid molecule to be tested (SEQ ID NO: 99, wherein the exemplary 3'-UTR element is SEQ ID NO: 1), and the underlined part is the tested 3'-UTR element. Except for the underlined elements, all elements of the sequence shown in Figure 2 are the same as the reference artificial nucleic acid molecule (SEQ ID NO: 100). Therefore, SEQ ID NO:99 differs from SEQ ID NO:100 only in the different 3'-UTR elements tested before the poly(A) sequence.
  • the internal reference plasmid is: the reporter gene firefly luciferase (Firefly Luciferase) is replaced with the renilla luciferase gene (renilla luciferase, Rluc), and the other sequences of the plasmid are the same.
  • Plasmids containing different 3'-UTR elements and internal control plasmids were fully synthesized by Shanghai Sangon Biotechnology Co., Ltd.
  • a DNA template was obtained by PCR amplification using a pair of primers (upstream universal primer: 5’TTGGACCCTCGTACAGAAGCTAATACG 3’; and downstream specific complementary long primer carrying poly(T)) and a high-fidelity DNA polymerase-based PCR amplification kit (Novagen Biotech, Inc.).
  • RNA polymerase was used for co-transcription capping reaction, and RNA was transcribed in vitro to produce Cap1 mRNA.
  • 1-Methyl-pseudouridine-triphosphate was added in the in vitro transcription instead of uridine triphosphate (UTP), so the modification ratio of 1-methyl-pseudouridine in the in vitro transcribed Cap1 mRNA was 100%.
  • DNaseI Thermo Fisher Scientific Inc.
  • Dynabeads Myone was used to purify the mRNA.
  • the purified mRNA was dissolved in 1 mM sodium citrate buffer (pH 6.5+/-0.1), sterile filtered, and frozen at -80°C until use.
  • HEK-293 cells in good growth state were inoculated into 96-well cell culture plates at a density of 3.5 ⁇ 10 4 cells/well, and then placed in a 37°C cell culture incubator for 18-24 hours.
  • Lipofectamine Messenger MAX reagent Thermo Fisher
  • the mRNA of the plasmid containing the reporter gene firefly luciferase and the mRNA of the internal reference control plasmid containing the reporter gene sea cucumber luciferase in Example 3 were transfected into HEK293 cells in a 96-well plate at a mRNA mass ratio of 2:1 per well (a total of 100 ng mRNA), and three replicate wells were set for each sample.
  • the cell plate after mRNA transfection was placed in a 37°C, 5% CO 2 cell culture incubator for 24 hours.
  • the transfected cell samples were tested using the dual luciferase reporter gene detection kit (Novozyme, DL101-01). First, pre-treatment was performed, and the cell lysate was added to the 96-well cell plate at 100 ⁇ L/well. Then, 14 ⁇ L of the lysed cell supernatant was carefully aspirated and transferred to a 96-well all-black ELISA plate, and 70 ⁇ L of firefly luciferase substrate equilibrated to room temperature was added to the ELISA plate, and the plate was quickly mixed and immediately used with an ELISA reader (BioTek).
  • ELISA reader BioTek
  • the relative light unit (RLU) value of firefly luciferase was detected at a wavelength of 560 nm; after the detection was completed, 70 ⁇ L of freshly prepared Renilla luciferase substrate working solution was added to the above reaction solution, and the relative light unit (RLU) value of Renilla luciferase was detected at a wavelength of 480 nm using an ELISA reader (BioTek) immediately after rapid mixing.
  • the actual report for each well is the ratio (Fluc/Rluc) of firefly luciferase RLU (Fluc) to Renilla luciferase RLU (Rluc) in each well.
  • the Fluc/Rluc of the artificial nucleic acid molecule containing only the poly(A) sequence is used as the reference nucleic acid molecule, and the Fluc/Rluc ratio of the artificial nucleic acid molecule containing the different 3'-UTR elements tested relative to the reference is the final relative expression amount.
  • the effects of different 3'-UTR elements on reporter gene expression were analyzed based on the results of three independent repeated experiments, statistical histograms were drawn, and statistical analysis was performed.
  • the experimental results are shown in Figure 3 and Table 2.
  • the translation efficiency of most artificial nucleic acid molecules containing the tested 3'-UTR elements is higher than that of the reference nucleic acid molecules.
  • the relative expression of artificial nucleic acid molecules containing 3'-UTR elements numbered U3006, U3008, U3009, U3010, U3011, U3016, U3020, U3030, U3051, U3053, U3055, U3056, U3057, U3058, U3060 and U3067 is greater than 1.9, and has a higher translation efficiency.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Cell Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Dermatology (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente demande concerne le domaine technique des produits biopharmaceutiques. La présente invention concerne plus particulièrement une molécule d'acide nucléique artificiel comprenant au moins un cadre de lecture ouvert et au moins un élément de la région non traduite en 3', et la molécule d'acide nucléique artificiel présente une efficacité de traduction élevée.
PCT/CN2022/131289 2022-11-11 2022-11-11 Molécule d'acide nucléique artificiel WO2024098361A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/CN2022/131289 WO2024098361A1 (fr) 2022-11-11 2022-11-11 Molécule d'acide nucléique artificiel

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2022/131289 WO2024098361A1 (fr) 2022-11-11 2022-11-11 Molécule d'acide nucléique artificiel

Publications (1)

Publication Number Publication Date
WO2024098361A1 true WO2024098361A1 (fr) 2024-05-16

Family

ID=91031780

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/131289 WO2024098361A1 (fr) 2022-11-11 2022-11-11 Molécule d'acide nucléique artificiel

Country Status (1)

Country Link
WO (1) WO2024098361A1 (fr)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017036580A1 (fr) * 2015-08-28 2017-03-09 Curevac Ag Molécules d'acide nucléique artificielles
CN107124889A (zh) * 2014-12-30 2017-09-01 库瑞瓦格股份公司 人工核酸分子
US20190167811A1 (en) * 2016-04-13 2019-06-06 Modernatx, Inc. Lipid compositions and their uses for intratumoral polynucleotide delivery
CN110520409A (zh) * 2017-03-15 2019-11-29 摩登纳特斯有限公司 用于细胞内递送治疗剂的化合物和组合物
CN113186203A (zh) * 2020-02-13 2021-07-30 斯微(上海)生物科技有限公司 治疗或者预防冠状病毒病的疫苗试剂
CN113372432A (zh) * 2021-06-15 2021-09-10 深圳市臻质医疗科技有限公司 一种基于化学修饰mRNA编码蛋白因子诱导和/或增强软骨损伤修复的方法

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107124889A (zh) * 2014-12-30 2017-09-01 库瑞瓦格股份公司 人工核酸分子
WO2017036580A1 (fr) * 2015-08-28 2017-03-09 Curevac Ag Molécules d'acide nucléique artificielles
US20190167811A1 (en) * 2016-04-13 2019-06-06 Modernatx, Inc. Lipid compositions and their uses for intratumoral polynucleotide delivery
CN110520409A (zh) * 2017-03-15 2019-11-29 摩登纳特斯有限公司 用于细胞内递送治疗剂的化合物和组合物
CN113186203A (zh) * 2020-02-13 2021-07-30 斯微(上海)生物科技有限公司 治疗或者预防冠状病毒病的疫苗试剂
CN113372432A (zh) * 2021-06-15 2021-09-10 深圳市臻质医疗科技有限公司 一种基于化学修饰mRNA编码蛋白因子诱导和/或增强软骨损伤修复的方法

Similar Documents

Publication Publication Date Title
JP6718547B2 (ja) 核酸の送達のための生分解性脂質
CN114728886B (zh) 用于细胞内递送治疗剂的含碳酸酯的脂质化合物和组合物
AU2020200489B2 (en) Stereochemically enriched compositions for delivery of nucleic acids
TWI805577B (zh) 靶向組合物
KR102096796B1 (ko) 메신저 rna의 전달을 위한 지질 제형
JP2022501360A (ja) 治療薬の細胞内送達のための化合物及び組成物
CN114206827A (zh) 脂质纳米颗粒组合物
JP2019508371A (ja) 薬剤の細胞内送達のための化合物および組成物
CN114391008B (zh) 脂质化合物和脂质纳米颗粒组合物
CN112384523A (zh) 核糖阳离子脂质
EP3801627A1 (fr) Lipides cationiques de phosphoesters
TW201718017A (zh) 用於細胞內遞送治療劑之化合物及組合物
WO2020257611A1 (fr) Lipides cationiques comprenant une fraction hydroxy
TW201408625A (zh) 陽離子性脂質
CN114929282A (zh) 脱唾液酸糖蛋白受体介导的治疗活性缀合物的递送
CN115515927A (zh) 一种脂质
CN112805292A (zh) 一种改性核苷及其合成方法
CN116323627A (zh) 脂质化合物和脂质纳米颗粒组合物
TW201619137A (zh) 陽離子性脂質
WO2024098361A1 (fr) Molécule d'acide nucléique artificiel
WO2024098360A1 (fr) Molécule d'acide nucléique artificiel
WO2023116804A1 (fr) Composé lipidique et composition de nanoparticules lipidiques
KR20240013087A (ko) 지질 화합물 및 지질 나노입자 조성물
WO2024032613A1 (fr) Composition lipidique
WO2024094211A1 (fr) Composition lipidique