WO2024085700A1

WO2024085700A1 - Composition for ameliorating, preventing, or treating myocardial damage, containing cirsium setidens, capsella, or saururus chinensis extract

Info

Publication number: WO2024085700A1
Application number: PCT/KR2023/016305
Authority: WO
Inventors: 최효경; 박수현; 송지혜; 이장호; 황진택
Original assignee: 한국식품연구원
Priority date: 2022-10-21
Filing date: 2023-10-20
Publication date: 2024-04-25

Abstract

The present invention relates to a composition for ameliorating, preventing, or treating myocardial damage caused by cardiotoxic drugs. The composition contains at least one selected from the group consisting of a Cirsium setidens extract, a Capsella extract, and a Saurus chinensis extract as an active ingredient, and thus can ameliorate, prevent, or treat myocardial damage caused by cardiotoxic drugs. In addition, the composition has no toxicity and thus can be taken in the form of a food.

Description

Composition for improving, preventing, or treating myocardial damage containing extracts of Korean thistle, shepherd's purse, or trifolium prickly pear as active ingredients

The present invention relates to a composition that can improve, prevent, or treat myocardial damage caused by cardiotoxic drugs by containing as an active ingredient one or more selected from the group consisting of Korean thistle extract, shepherd's purse extract, and trifoliate extract.

Treatment with anticancer drugs has contributed to increasing the patient's survival rate, but side effects include memory decline, cognitive decline, and cardiotoxicity.

Specifically, anticancer drugs cause cardiotoxicity in approximately 41% of patients, leading to myocardial cell death, and a typical example is atrioventricular blockage.

Myocardium is the muscle that makes up the heart and is the main body of heart contraction, and is metabolically extremely active. In these myocardium, mitochondria exist in more than 30% of the volume of individual fibers, so reserves of high-energy phosphate are very low, so aerobic metabolism is essential.

Cardiomyocyte death proceeds as adenosine triphosphate (ATP) levels are very low and anaerobic glycolysis is virtually halted. Recently, the increase in side effects due to the administration of treatments for various diseases has become a problem, especially doxorubicin, a quinone-based anticancer drug that exhibits an inhibitory effect on signaling between cells, and sodium nitrorfuside (disodium), a vasodilator.

Drugs such as nitroferricyanide (SNP) increase intracellular reactive oxygen species and decrease mitochondrial function, leading to the death of cardiomyocytes, which can lead to decreased cardiac function and various heart diseases.

However, mammalian cardiomyocytes have limited proliferation potential and do not regenerate sufficiently when severely damaged.

Treatment methods for damaged myocardium include removal of irreversibly damaged cells through an inflammatory response after reperfusion injury, but complete healing is fundamentally difficult because regeneration of myocardial cells is difficult. Therefore, the best way is to protect heart cells against damage-causing factors and prevent heart cell loss.

Meanwhile, Korean thistle ( Cirsium setidens ) has the effect of lowering cholesterol levels, helping blood circulation and preventing vascular diseases, and it has recently been known that thistle extract is effective in neutralizing and protecting liver toxicity. There is no known effect of milk thistle on the side effects of treatment with anticancer drugs.

In addition, shepherd's purse ( Capsella ), which has a unique fragrant scent, is a representative food ingredient of spring. It is rich in vitamins A, B1, and C, and is known to boost energy and be good for fatigue recovery and spring fever. However, shepherd's purse is known to be good for the side effects of treatment with anticancer drugs. Nothing is known about its effects.

In addition, Saururus chinensis is a functional raw material for industrial health functional foods and is a traditional medicine used in the treatment of edema, jaundice, jaundice, staghorn, and carbuncle due to its moist heat, cleansing, and detoxifying effects. Recently, there has been a lot of research on Saururus chinensis. Studies have shown its antioxidant, antibacterial, and whitening effects, but there is no known effect of trifolium prickly pear on the side effects of treatment with anticancer drugs.

The purpose of the present invention is to provide a food composition that can improve or prevent myocardial damage caused by cardiotoxic drugs by containing as an active ingredient one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract.

In addition, another object of the present invention is to provide a pharmaceutical composition capable of preventing or treating myocardial damage caused by cardiotoxic drugs, containing as an active ingredient one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract. there is.

In addition, another object of the present invention is to improve or prevent myocardial damage caused by cardiotoxic drugs by containing as an active ingredient one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract. The aim is to provide a food composition for.

In addition, another object of the present invention is to provide a combination preparation for anticancer treatment containing at least one extract selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract, and an anticancer agent as active ingredients.

The food composition for improving or preventing myocardial damage of the present invention to achieve the above-described object may contain as an active ingredient one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract.

The myocardial damage may be induced by myocardial cell death by cardiotoxic drugs.

The cardiotoxic drug may be an anticancer agent that provides cancer cell damage, cancer cell growth inhibitory activity, or cancer metastasis inhibitory activity.

The anticancer agent may be one or more types selected from the group consisting of chemical anticancer agents and targeted anticancer agents.

The chemical anticancer agent is selected from the group consisting of doxorubicin, epirubicin, mitoxantrone, idarubicin, daunorubicin, and valrubicin; The targeted anticancer agents include osmertinib, erlotinib, gefitinib, crizotinib, ceritinib, alectinib, and brigatinib. , bosutinib, dasatinib, imatinib, nilotinib, ponatinib, ibrutinib, cabozantinib, lapatinib ), vandetanib, afatinib, ruxolitiib, tofacitinib, axitinib, lenvatinib, nintedanib, pa It may be selected from the group consisting of pazopanib, regorafenib, sorafenib, sunitinib, dasatinib, and axitinib.

One or more extracts selected from the group consisting of the Korean thistle extract, the shepherd's purse extract, and the Chinese herbaceous extract may each be extracted with water, lower alcohol having 1 to 4 carbon atoms, ethylene glycol, ethyl ether, or a mixed solvent thereof.

The lower alcohol having 1 to 4 carbon atoms may be 20 to 80% methanol, ethanol, butanol, or propanol.

In addition, the pharmaceutical composition for the prevention or treatment of myocardial damage of the present invention to achieve the above-mentioned other purposes may contain as an active ingredient one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Cypress extract. .

In addition, the food composition for companion animals for improving or preventing myocardial damage of the present invention to achieve the above-mentioned other object contains one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract as an active ingredient. It may contain.

In addition, the combination preparation for anti-cancer treatment for preventing cardiac toxicity caused by the anti-cancer agent of the present invention to achieve the above-mentioned other object includes at least one extract selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract, and anticancer agents as active ingredients.

The combination preparation for anticancer treatment is a mixture of one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract, and an anticancer agent; One or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract, and an anticancer agent may each be formulated and administered simultaneously or sequentially.

The composition for improving, preventing or treating myocardial damage caused by cardiotoxic drugs of the present invention is non-toxic and has an excellent effect for improving, preventing or treating myocardial damage caused by cardiotoxic drugs, making it a competitive food composition and even a health functional food. Alternatively, it can be used as a pharmaceutical composition.

Figure 1 is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with Korean thistle extract prepared according to Example 1 of the present invention and then treated with doxorubicin.

Figure 2 is a graph measuring the survival rate of MDA-MB-231 breast cancer cells when treated with Korean thistle extract prepared according to Example 1 of the present invention and then treated with doxorubicin.

Figure 3a is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with Korean thistle extract prepared according to Example 1 of the present invention and then treated with osmertinib; Figure 3b is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with Korean thistle extract prepared according to Example 1 of the present invention and then treated with erlotinib; Figure 3c is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with Korean thistle extract prepared according to Example 1 of the present invention and then treated with gefitinib.

Figure 4a is a graph measuring the survival rate of A549 lung cancer cells when treated with Korean thistle extract prepared according to Example 1 of the present invention and then treated with osmertinib; Figure 4b is a graph measuring the survival rate of A549 lung cancer cells when treated with Korean thistle extract prepared according to Example 1 of the present invention and then treated with erlotinib; Figure 4c is a graph measuring the survival rate of A549 lung cancer cells when treated with Korean thistle extract prepared according to Example 1 of the present invention and then treated with gefitinib.

Figure 5a is a graph showing oxygen consumption when treated with Korean thistle extract prepared according to Example 1 of the present invention; Figure 5b is a graph showing maximum respiration when treated with Korean thistle extract prepared according to Example 1 of the present invention; Figure 5c is a graph showing mitochondrial respiration, including adenosine triphosphate (ATP) production, when treated with Korean thistle extract prepared according to Example 1 of the present invention.

Figure 6a shows the membrane potential of mitochondria when treated with Korean thistle extract prepared according to Example 1 of the present invention and then treated with DOX; Figure 6b is a graph quantifying the TMRM expression level of Figure 6a.

Figure 7a is a Western blot showing the expression of SOD1 and SOD2 upon treatment with Korean thistle extract prepared according to Example 1 of the present invention; Figure 7b is a graph showing the activities of total SOD, SOD1, and SOD2 when treated with Korean thistle extract prepared according to Example 1 of the present invention; Figure 7c is a photograph showing the expression of mitochondrial membrane potential when treated with DOX after treatment with Korean thistle extract prepared according to Example 1 of the present invention; Figure 7d is a graph quantifying the expression level of MitoSOXTM of Figure 7c.

Figure 8a is a graph showing the schedule for recording after processing the Korean thistle extract and DOX prepared according to Example 1 of the present invention; Figure 8b is a photograph and graph showing the total active electrode when treated with Korean thistle extract prepared according to Example 1 of the present invention; Figure 8c shows the beat cycle measured when processing the Korean thistle extract prepared according to Example 1 of the present invention; Figure 8d is a graph measured as the time from the start of the depolarization spike to the peak of the repolarization wave when treated with the Korean thistle extract prepared according to Example 1 of the present invention, and a graph quantified over time; Figure 8e is a photograph showing the conduction speed upon treatment with the Korean thistle extract prepared according to Example 1 of the present invention and a graph quantifying this over time; Figure 8f is a graph showing the shrinkage upon treatment of the Korean thistle extract prepared according to Example 1 of the present invention.

Figure 9a is a graph showing the heart rate per minute of the Control group, Dox group, Korean thistle extract group, Berberine 20 group, and Berberine 40 group; Figure 9b is a graph showing the RR interval of the Control group, Dox group, Korean thistle extract group, Berberine 20 group, and Berberine 40 group; Figure 9c is a graph showing the QT interval of the Control group, Dox group, Korean thistle extract group, Berberine 20 group, and Berberine 40 group; Figure 9d is a graph showing the ST segment of the Control group, Dox group, Korean thistle extract group, Berberine 20 group, and Berberine 40 group.

Figure 10a is a graph showing CK (creatin kinase) in the Control group, Dox group, Korean thistle extract group, and Berberine 20 group; Figure 10b is a graph showing LHD (lactate dehydrogenase) of the Control group, Dox group, Korean thistle extract group, and Berberine 20 group; Figure 10c is a graph showing AST (aspartate aminotransferase) in the Control group, Dox group, Korean thistle extract group, and Berberine 20 group; Figure 10d is a graph showing ALT (alanine aminotransferase) in the Control group, Dox group, Korean thistle extract group, and Berberine 20 group.

Figure 11 is a diagram measuring the degree of fibrosis of heart tissue in the Control group, Dox group, and Korean thistle extract group.

Figure 12 is a diagram measuring the degree of cardiomyocyte apoptosis in the Control group, Dox group, and Korean thistle extract group.

Figure 13 is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with shepherd's purse extract prepared according to Example 2 of the present invention and then treated with doxorubicin.

Figure 14 is a graph measuring the survival rate of MDA-MB-231 breast cancer cells when treated with shepherd's purse extract prepared according to Example 2 of the present invention and then treated with doxorubicin.

Figure 15a is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with shepherd's purse extract prepared according to Example 2 of the present invention and then treated with osmertinib; Figure 15b is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with shepherd's purse extract prepared according to Example 2 of the present invention and then treated with erlotinib; Figure 15c is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with shepherd's purse extract prepared according to Example 2 of the present invention and then treated with gefitinib.

Figure 16a is a graph measuring the survival rate of A549 lung cancer cells when treated with shepherd's purse extract prepared according to Example 2 of the present invention and then treated with osmertinib; Figure 16b is a graph measuring the survival rate of A549 lung cancer cells when treated with shepherd's purse extract prepared according to Example 2 of the present invention and then treated with erlotinib; Figure 16c is a graph measuring the survival rate of A549 lung cancer cells when treated with shepherd's purse extract prepared according to Example 2 of the present invention and then treated with gefitinib.

Figure 17a is a graph showing oxygen consumption when treated with shepherd's purse extract prepared according to Example 2 of the present invention; Figure 17b is a graph showing basal respiration upon treatment with shepherd's purse extract prepared according to Example 2 of the present invention; Figure 17c is a graph showing maximum respiration when treated with shepherd's purse extract prepared according to Example 2 of the present invention; Figure 17d is a graph showing mitochondrial respiration including adenosine triphosphate (ATP) production when treated with shepherd's purse extract prepared according to Example 2 of the present invention.

Figure 18a shows the membrane potential of mitochondria when treated with shepherd's purse extract prepared according to Example 2 of the present invention and then treated with DOX; Figure 18b is a graph quantifying the expression level of Figure 18a.

Figure 19a is a Western blot showing the expression of SOD1 and SOD2 upon treatment with shepherd's purse extract prepared according to Example 2 of the present invention; Figure 19b is a graph showing the activities of Ho-1, SOD1, and SOD2 when treated with shepherd's purse extract prepared according to Example 2 of the present invention; Figure 19c is a photograph showing the expression of mitochondrial membrane potential upon treatment with DOX after treatment with the shepherd's purse extract prepared according to Example 2 of the present invention; Figure 19d is a graph quantifying the expression level of MitoSOXTM of Figure 19c.

Figure 20a is a graph showing the schedule for recording after processing the shepherd's purse extract and DOX prepared according to Example 2 of the present invention; Figure 20b is a graph measured as the time from the start of the depolarization spike to the peak of the repolarization wave when treated with the shepherd's purse extract prepared according to Example 2 of the present invention, and a graph quantified over time; Figure 20c is a graph showing the conduction velocity upon treatment with the shepherd's purse extract prepared according to Example 2 of the present invention; Figure 20d is a graph showing the total spike amplitude upon treatment with the shepherd's purse extract prepared according to Example 2 of the present invention; Figure 20e shows the beat cycle measured when processing the shepherd's purse extract prepared according to Example 2 of the present invention.

Figure 21a is a graph showing heart beats per minute in the Control group, Dox group, shepherd's purse extract group, Berberine 20 group, and Berberine 4 group; Figure 21b is a graph showing the RR interval of the Control group, Dox group, shepherd's purse extract group, Berberine 20 group, and Berberine 40 group; Figure 21c is a graph showing the QT interval of the Control group, Dox group, shepherd's purse extract group, Berberine 20 group, and Berberine 40 group; Figure 21d is a graph showing the ST segment of the Control group, Dox group, shepherd's purse extract group, Berberine 20 group, and Berberine 40 group.

Figure 22a is a graph showing CK (creatin kinase) in the Control group, Dox group, shepherd's purse extract group, and Berberine 20 group; Figure 22b is a graph showing LHD (lactate dehydrogenase) in the Control group, Dox group, shepherd's purse extract group, and Berberine 20 group; Figure 22c is a graph showing AST (aspartate aminotransferase) in the Control group, Dox group, shepherd's purse extract group, and Berberine 20 group; Figure 22d is a graph showing ALT (alanine aminotransferase) in the Control group, Dox group, shepherd's purse extract group, and Berberine 20 group.

Figure 23 is a diagram measuring the degree of fibrosis of heart tissue in the Control group, Dox group, and shepherd's purse extract group.

Figure 24 is a diagram measuring the degree of cardiomyocyte apoptosis in the Control group, Dox group, and shepherd's purse extract group.

Figure 25 is a graph measuring the survival rate of H9C2 myocardial cells when treated with doxorubicin after treatment with the Trifolium prickly pear extract prepared according to Example 3 of the present invention.

Figure 26 is a graph measuring the survival rate of MDA-MB-231 breast cancer cells when treated with doxorubicin after treatment with the Triacium chinensis extract prepared according to Example 3 of the present invention.

Figure 27a is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with osmertinib after treatment with the Triacium chinensis extract prepared according to Example 3 of the present invention; Figure 27b is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with erlotinib after treatment with the Triacium chinensis extract prepared according to Example 3 of the present invention; Figure 27c is a graph measuring the survival rate of H9C2 cardiomyocytes when treated with gefitinib after treatment with the extract of Trifolium prickly pear prepared according to Example 3 of the present invention.

Figure 28a is a graph measuring the survival rate of A549 lung cancer cells when treated with osmertinib after treatment with the Trifolia extract prepared according to Example 3 of the present invention; Figure 28b is a graph measuring the survival rate of A549 lung cancer cells when treated with erlotinib after treatment with the extract of Trifolium vulgaris prepared according to Example 3 of the present invention; Figure 28c is a graph measuring the survival rate of A549 lung cancer cells when treated with gefitinib after treatment with the P. chinensis extract prepared according to Example 3 of the present invention.

Figure 29a is a graph showing the heart beats per minute of the Control group, Dox group, Triacium vulgaris extract group, Berberine 20 group, and Berberine 40 group; Figure 29b is a graph showing the RR interval of the Control group, Dox group, Triacium chinensis extract group, Berberine 20 group, and Berberine 40 group; Figure 29c is a graph showing the QT interval of the Control group, Dox group, Trifolium prickly pear extract group, Berberine 20 group, and Berberine 40 group; Figure 29d is a graph showing the ST segment of the Control group, Dox group, Trillium chinensis extract group, Berberine 20 group, and Berberine 40 group.

Figure 30a is a graph showing CK (creatin kinase) in the Control group, Dox group, P. ginseng extract group, and Berberine 20 group; Figure 30b is a graph showing the LHD (lactate dehydrogenase) of the Control group, Dox group, Triacium chinensis extract group, and Berberine 20 group; Figure 30c is a graph showing AST (aspartate aminotransferase) in the Control group, Dox group, P. ginseng extract group, and Berberine 20 group; Figure 30d is a graph showing ALT (alanine aminotransferase) in the Control group, Dox group, Triacium chinensis extract group, and Berberine 20 group.

Figure 31 is a diagram measuring the degree of fibrosis of heart tissue in the Control group, Dox group, and P. ginseng extract group.

Figure 32 is a diagram measuring the degree of myocardial cell apoptosis in the Control group, Dox group, and P. ginseng extract group.

The present invention relates to a composition that can improve, prevent, or treat myocardial damage caused by cardiotoxic drugs by containing as an active ingredient one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract.

The myocardial damage is induced by cardiomyocyte cell death by a cardiotoxic drug, and the cardiotoxic drug may be an anticancer agent that provides cancer cell damage, cancer cell growth inhibitory activity, or cancer metastasis inhibitory activity.

The anticancer agent may be one or more types selected from the group consisting of chemical anticancer agents and targeted anticancer agents. The chemical anticancer drugs cause cardiotoxicity by producing free radicals and induce cardiomyocyte cell death, specifically doxorubicin, epirubicin, mitoxantrone, and idarubicin. It may be selected from the group consisting of idarubicin, daunorubicin, and valrubicin. In addition, the targeted anticancer agent performs anticancer activity through a mechanism of inhibiting tyrosine kinase, which is involved in tumor neovascularization and tumor cell proliferation mechanisms. Tyrosine kinase, which is involved in the survival of cardiomyocytes, is Since myocardial toxicity and myocardial cell death are induced due to inhibition of kinase, specifically osmertinib, erlotinib, gefitinib, crizotinib, and ceritinib. ), alectinib, brigatinib, bosutinib, dasatinib, imatinib, nilotinib, ponatinib, ibrutinib (ibrutinib), cabozantinib, lapatinib, vandetanib, afatinib, ruxolitiib, tofacitinib, axitinib, lenvatinib, nintedanib, pazopanib, regorafenib, sorafenib, sunitinib, dasatinib, and Exiti It may be selected from the group consisting of axitinib.

Hereinafter, the present invention will be described in detail.

The composition capable of improving, preventing, or treating myocardial damage of the present invention contains as an active ingredient one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and cypress extract.

The Korean thistle ( Cirsium setidens ) is a perennial herb of the Asteraceae family of the order Campanula. The height of the stem is 1 m, the roots are straight, the stem has many branches, the leaves are alternate, the central part has a petiole, and a spiral, oval lanceolate. Brother, the end is sharp.

In addition, Capsella is used as a medicinal herb for hemostasis and postpartum hemorrhage, and is known to be good for the liver and eyes. In addition, the leaves contain a large amount of beta-carotene, and the roots contain choline, which has a spicy aroma, which helps prevent liver diseases such as cirrhosis and hepatitis. It not only helps improve rough skin and prevent acne, but also helps with menstrual irregularities. It is effective in alleviating various gynecological diseases, including.

In addition, the whole plant of Saururus chinensis is used as an antidote or to treat beriberi, and is used as a diuretic in Japan. Additionally, in oriental medicine, the entire plant is dried and used when the body is swollen and urinating is difficult, and it is also prescribed for beriberi, jaundice, and hepatitis.

The Korean thistle, shepherd's purse or trifoliate are mixed with the extraction solvent at a weight ratio of 1:5 to 25, preferably 1:8 to 15, and incubated at 80 to 110°C for 5 to 15 hours, preferably 7 to 10 hours. After extraction, the extract is prepared by concentration under reduced pressure at 50 to 60°C. If the weight ratio of the Korean thistle, shepherd's purse, or shepherd's purse and the extraction solvent is outside the above range, a small amount of the active ingredients of the Korean thistle, herb's purse, or shepherd's purse may be extracted in the extract.

If the extraction temperature is below the above lower limit, a small amount of the active ingredients of Korean thistle, shepherd's purse, or Japanese herb may be extracted, and if the extraction temperature is above the above upper limit, toxic substances may be generated.

The extraction solvent for extracting each of the above extracts is water, lower alcohol having 1 to 4 carbon atoms, ethylene glycol, ethyl ether, or a mixed solvent thereof. The lower alcohol may include 20 to 80% methanol, ethanol, butanol, or propanol.

The extraction solvent is not particularly limited, but hot water extracts extracted with water are preferred for improving, preventing, or treating myocardial damage caused by cardiotoxic drugs.

One or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract of the present invention can be used not only as a composition for improving, preventing, or treating myocardial damage caused by cardiotoxic drugs, but also as a combination preparation.

The combination preparation for anticancer treatment of the present invention is for the prevention of cardiac toxicity caused by anticancer drugs, and may contain one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Cypress extract, and an anticancer agent as active ingredients. there is.

The combination preparation for anticancer treatment is a mixture of one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract, and an anticancer agent; One or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract and an anticancer agent may each be formulated and administered simultaneously or sequentially.

The anticancer agent is not particularly limited as long as it provides activity to inhibit cancer cell migration or cancer metastasis, but is preferably composed of doxorubicin, osmertinib, erlotinib, and gefitinib. One or more types selected from the group may be mentioned.

The term 'extract' used in this specification when referring to Korean thistle, shepherd's purse, or Japanese herbaceous herb includes not only the crude extract obtained by treatment with an extraction solvent, but also processed products of the Korean thistle extract, herby's purse extract, or herbaceous herb's extract. For example, one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract may be prepared in powder form by additional processes such as reduced pressure distillation and freeze-drying or spray drying.

In addition, the one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Shenzhen chinensis extract of the present invention are, in a broad sense, a mixture of Korean thistle, shepherd's purse, or shepherd's purse that is formulated to be administered to animals. It is also meant to include processed products, such as powders of Korean thistle, shepherd's purse, or shepherd's purse. Although experiments were conducted with Korean thistle, shepherd's purse, or Japanese herbaceous herb in the present invention, those skilled in the art would be able to predict that the desired effect can be achieved even in the form of a processed product of Korean thistle, herby's purse, or Japanese herbaceous herb.

Meanwhile, in this specification, the term 'containing as an active ingredient' means containing a sufficient amount to achieve the efficacy or activity of one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract. As an example, one or more extracts selected from the group consisting of the Korean thistle extract, shepherd's purse extract, and P. chinensis extract are used at a concentration of 10 to 1,500 ㎍/㎖, preferably 100 to 1,000 ㎍/㎖. Since one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Trifolium herbacea extract are natural products and do not have side effects on the human body even when administered in excessive amounts, they can be used in the group consisting of Korean thistle extract, herbaceous extract, and Trifolium herbacea extract included in the composition of the present invention. The upper quantitative limit of one or more selected extracts can be selected within an appropriate range by a person skilled in the art.

The pharmaceutical composition of the present invention can be prepared using pharmaceutically suitable and physiologically acceptable auxiliaries in addition to the above active ingredients, and the auxiliaries include excipients, disintegrants, sweeteners, binders, coating agents, swelling agents, lubricants, Lubricants or flavoring agents can be used.

For administration, the pharmaceutical composition may be preferably formulated as a pharmaceutical composition containing one or more pharmaceutically acceptable carriers in addition to the active ingredients described above.

The pharmaceutical composition may be in the form of granules, powders, tablets, coated tablets, capsules, suppositories, solutions, syrups, juices, suspensions, emulsions, drops, or injectable solutions. For example, for formulation in the form of tablets or capsules, the active ingredient may be combined with an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, etc. Additionally, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included in the mixture. Suitable binders include, but are not limited to, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tracacance or sodium oleate, sodium stearate, magnesium stearate, sodium Includes benzoate, sodium acetate, sodium chloride, etc. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum, etc.

Acceptable pharmaceutical carriers for compositions formulated as liquid solutions include those that are sterile and biocompatible, such as saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these ingredients can be mixed and used, and other common additives such as antioxidants, buffers, and bacteriostatic agents can be added as needed. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added to formulate injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets.

Furthermore, it can be preferably formulated according to each disease or ingredient using a method disclosed by Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA, as an appropriate method in the field.

The pharmaceutical composition of the present invention can be administered orally or parenterally, and in case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, etc., and is preferably administered orally. .

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. Usually, a skilled physician can easily determine and prescribe an effective dosage for the desired treatment or prevention. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.001-10 g/kg.

The pharmaceutical composition of the present invention can be prepared in unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient, or can be prepared by placing it in a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, or capsule, and may additionally contain a dispersant or stabilizer.

In addition, the present invention provides a food composition for improving, preventing, or treating myocardial damage caused by cardiotoxic drugs, containing as an active ingredient one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract.

The food composition according to the present invention can be formulated in the same way as the pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, alcoholic beverages, confectionery, diet bars, dairy products, meat, chocolate, pizza, ramen, other noodles, gum, ice cream, vitamin complexes, and health supplements. etc.

The food composition of the present invention may include, as an active ingredient, one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract, as well as ingredients commonly added during food production, for example, proteins , carbohydrates, fats, nutrients, seasonings and flavoring agents. Examples of the above-mentioned carbohydrates include monosaccharides such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, oligosaccharides, etc.; and polysaccharides, such as common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As flavoring agents, natural flavoring agents (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is manufactured as a drink or beverage, in addition to the Korean thistle extract of the present invention, citric acid, high fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, and various plant extracts may be additionally included. .

The present invention provides a health functional food comprising a food composition for the improvement, prevention or treatment of myocardial damage containing as an active ingredient one or more extracts selected from the group consisting of the Korean thistle extract, shepherd's purse extract and Triacium chinensis extract. Health functional food refers to one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and trifoliate extract, added to food materials such as beverages, teas, spices, gum, and confectionery, or manufactured by encapsulation, powder, suspension, etc. It is a food, which means that when consumed, it brings about a specific health effect. However, unlike general drugs, it has the advantage of not having any side effects that may occur when taking the drug for a long time because it is made from food. The health functional food of the present invention obtained in this way is very useful because it can be consumed on a daily basis. In such health functional foods, the amount of one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and cypress extract cannot be uniformly specified as it varies depending on the type of health functional food being targeted, but the original taste of the food It can be added within a range that does not damage it, and is usually in the range of 0.01 to 50% by weight, preferably 0.1 to 20% by weight, relative to the target food. In addition, in the case of health functional foods in the form of pills, granules, tablets, or capsules, it is usually added in the range of 0.1 to 100% by weight, preferably 0.5 to 80% by weight. In one embodiment, the health functional food of the present invention may be in the form of a pill, tablet, capsule, or beverage.

In addition, the present invention provides the use of one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Cypress extract for the production of medicines or foods for improving, preventing, or treating myocardial damage. As described above, one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract can be used to improve, prevent, or treat myocardial damage.

In addition, the present invention provides a method for improving, preventing or treating myocardial damage, comprising administering to a mammal an effective amount of one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract and P. chinensis extract.

As used herein, the term “mammal” refers to a mammal, preferably a human, that is the subject of treatment, observation or experiment.

As used herein, the term “effective amount” means the amount of an active ingredient or pharmaceutical composition that is believed by a researcher, veterinarian, physician, or other clinician to induce a biological or medical response in a tissue system, animal, or human, which means that It includes amounts that induce relief of symptoms of a disease or disorder. The effective amount and frequency of administration of the active ingredient of the present invention may vary depending on the desired effect. Therefore, the optimal dosage to be administered can be easily determined by a person skilled in the art, and can be determined based on the type of disease, the severity of the disease, the content of the active ingredient and other ingredients contained in the composition, the type of dosage form, and the patient's age, weight, and general health. It can be adjusted according to various factors, including condition, gender and diet, administration time, administration route and secretion rate of the composition, treatment period, and concurrently used drugs. In the prevention, treatment or improvement method of the present invention, the composition containing the Korean thistle extract as an active ingredient may be administered orally, rectally, intravenously, intraarterially, intraperitoneally, intramuscularly, intrasternally, transdermally, It can be administered in the conventional manner via topical, intraocular or intradermal routes.

The present invention can provide a feed composition for preventing or improving myocardial damage, which contains as an active ingredient one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract.

The 'feed composition' includes, as active ingredients, one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Triacium chinensis extract, as well as food raw materials and foods that can be used as foods described in the Food Standards and Specifications ('Food Code') Food additives listed in the Additive Code can be used, and even if they are not food raw materials or food additives that can be used as food, they are raw materials that fall within the scope of sweet feed in Annex Table 1 of the ‘Standards and Specifications for Feed, etc.’ and the scope of supplementary feed in Annex Table 2. Applicable raw materials can be used.

The ‘feed composition’ may be an extractant among supplementary feeds in accordance with ‘Standards and specifications for feed, etc.’, or may be a compound feed containing the above supplementary feed.

When preparing a feed composition using one or more extracts selected from the group consisting of the Korean thistle extract, shepherd's purse extract, and Trifolium herbacea extract as an active ingredient, one or more extracts selected from the group consisting of the Korean thistle extract, herbaceous extract, and Trifolium herbacea extract may prevent myocardial damage There is no need to specifically limit the content as long as it prevents or improves, for example, 0.1 to 99% by weight, 0.5 to 95% by weight, 1 to 90% by weight, 2 to 80% by weight, 3 to 70% by weight, 4 to 4% by weight. It may be included at 60% by weight, 5 to 50% by weight.

In the above feed composition, one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract, which are active ingredients, vary depending on the condition, body weight, presence, degree, and period of disease of the ingesting animal, but may be appropriately determined by a person skilled in the art. can be selected. For example, based on the daily dosage, it may be 1 to 5,000 mg, preferably 5 to 2,000 mg, more preferably 10 to 1,000 mg, even more preferably 20 to 800 mg, and most preferably 50 to 500 mg. There is no need to specifically limit the number of administrations, but a person skilled in the art can adjust it within the range of three times a day to once a week. In the case of long-term intake for health and hygiene purposes or health control, it may be below the above range.

Hereinafter, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are merely illustrative of the present invention, and it is clear to those skilled in the art that various changes and modifications are possible within the scope and spirit of the present invention. It is natural that such variations and modifications fall within the scope of the attached patent claims.

[고려엉겅퀴][Korean thistle]

실시예 1. Example 1.

The aerial parts of Korean thistle and 80% ethanol aqueous solution were mixed at a weight ratio of 1:10 and extracted under reflux at 80°C for 8 hours to obtain a Korean thistle extract.

<시험예 Ⅰ> <Test Example Ⅰ> In vitroIn vitro

Prepared in Examples After filtering the extract, the filtrate was concentrated under reduced pressure below 60°C and used.

시험예 1. H9C2 심근세포 생존율 측정_독소루비신(doxorubicin)Test Example 1. Measurement of H9C2 cardiomyocyte survival rate_doxorubicin

To measure the cell viability of H9C2 cardiomyocytes (ATCC, Manassas, VA, USA), ¹ 24 hours later (Day 1), the extract samples were diluted in medium to concentrations of 12.5, 25, 50, 100, 200, 400, 800, and 1600 ug/mL, and then treated with 100 uL each of the cells. 24 hours later (Day 2), except for the negative control group (Cont.), cells were treated with 100 uL of Doxorubicin HCl (Apexbio, Houston, TX, USA) at a concentration of 2 uM. After 48 hours (Day 4), to measure cell viability, 10 uL of WST-1 solution (Roche, Pleasanton, CA, USA) was added to the medium and incubated at 37°C for 2 hours. Afterwards, optical density (OD) values were measured at 450 nm and 650 nm (Reference) using a SpectraMax 190 Absorbance Microplate Reader (Molecular Devices, San Jose, CA, USA). Cell viabilit was calculated as OD ₄₅₀ - OD ₆₅₀ , and the negative control group was normalized to 100% and the 0.1% Triton X-100 treated group was normalized to 0%. Data were expressed as mean ± standard deviation from three independent experiments, and significance between groups was calculated using students' t-test (GraphPad). ****, p < 0.001 (vs. Dox group)

As shown in Figure 1, compared to the negative control group not treated with Doxorubicin, the Dox group treated with Doxorubicin (group treated only with Doxorubicin) had a decrease in cells of about 30%, while the Korean thistle extract prepared according to Example 1 It was confirmed that H9c2 cells pretreated with were protected from the toxicity of doxorubicin and showed a relatively high cell survival rate.

In particular, H9c2 cells pretreated with Korean thistle extract at a concentration of 400 to 800 ug/ml showed a cell viability similar to that of cells not treated with doxorubicin (negative control), and cells pretreated with Korean thistle extract at a concentration of 1600 ug/ml showed a cell viability similar to that of cells not treated with doxorubicin (negative control). It was confirmed that H9c2 cells showed better cell survival than cells not treated with Doxorubicin (negative control).

These results mean that pretreatment with Korean thistle extract protects cardiomyocyte H9c2 from the toxicity of doxorubicin, an anticancer drug.

시험예 2. MDA-MB-231 유방암 세포 생존율 측정_독소루비신(doxorubicin)Test Example 2. MDA-MB-231 Breast cancer cell survival rate measurement_doxorubicin

Cell survival rate was measured in the same manner as Test Example 1, using MDA-MB-231 breast cancer cells (ATCC, Manassas, VA, USA) instead of H9C2 cardiomyocytes. ###, p < 0.001 (vs. negative control); ***, p < 0.001 (vs. Dox group)

As shown in Figure 2, compared to the negative control group not treated with Doxorubicin, the survival rate of MDA-MB-231 cells, which are triple negative breast cancer cells, was reduced to about 45% in the Dox group treated with Doxorubicin, according to Example 1 It was confirmed that MDA-MB-231 cells pretreated with the prepared Korean thistle extract also showed a cell survival rate similar to that of the Dox group.

These results mean that Korean thistle extract does not inhibit the cancer cell killing effect of doxorubicin, an anticancer drug.

시험예 3. H9C2 심근세포 생존율 측정_오시머티닙(osmertinib), 엘로티닙(erlotinib) 및 게피티니브(gefitinib)Test Example 3. Measurement of H9C2 cardiomyocyte survival rate_osmertinib, erlotinib, and gefitinib

In order to confirm the cell survival rate of cardiomyocytes from the toxicity of anticancer drugs other than doxorubicin, the protective effect of Korean thistle extract on cardiomyocyte cells was measured against representative anticancer drugs of the TKI (Tyrosine kinase inhibitor) class, which are well known to cause cardiomyocyte toxicity.

To measure the cell viability of H9C2 cardiomyocytes (ATCC, Manassas, VA, USA), ¹ 24 hours later (Day 1), the extract sample was diluted in medium at concentrations of 50, 100, and 200 ug/mL and then treated with 100 uL of each cell. 24 hours later (Day 2), except for the negative control group, cells were treated with 100 uL of Osimertinib, Erlotinib, and Gefitinib at concentrations of 10, 40, and 30 uM, respectively. After 48 hours (Day 4), to measure cell viability, 10 uL of WST-1 solution (Roche, Pleasanton, CA, USA) was added to the medium and incubated at 37°C for 2 hours. Afterwards, optical density (OD) values were measured at 450 nm and 650 nm (Reference) using a SpectraMax 190 Absorbance Microplate Reader (Molecular Devices, San Jose, CA, USA). Cell viability was calculated as OD ₄₅₀ - OD ₆₅₀ , and the negative control group was normalized to 100% and the 0.1% Triton X-100 treated group was normalized to 0%. Data were expressed as mean ± standard deviation from three independent experiments, and significance between groups was calculated using students' t-test (GraphPad). ###, p < 0.0001 (vs. negative control); ***, p < 0.001 (vs. Dox group); ****, p < 0.0001 (vs. Dox group)

As shown in Figures 3A to 3C, when treated with Osmertinib, the cell survival rate was about 70%, when treated with Erlotinib, the cell survival rate was about 50%, and when treated with Gefitinib, the cell survival rate was about 65%.

On the other hand, it was confirmed that H9c2 cells pretreated with the Korean thistle extract prepared according to Example 1 showed a relatively high cell survival rate compared to the group treated with each anticancer agent alone.

These results mean that pretreatment with Korean thistle extract protects cardiomyocyte H9c2 not only from doxorubicin but also from other anticancer drugs.

시험예 4. A549 폐암 세포 생존율 측정_오시머티닙(osmertinib), 엘로티닙(erlotinib) 및 게피티니브(gefitinib) Test Example 4. Measurement of A549 lung cancer cell viability_osmertinib, erlotinib, and gefitinib

Three types of TKIs anticancer drugs, consisting of osmertinib, erlotinib, and gefitinib, are mainly applied clinically for the treatment of non-small cell lung cancer. Therefore, an experiment was conducted to determine whether Korean thistle extract inhibits the non-small cell lung cancer cell killing effect of three types of TKIs anticancer drugs.

To measure the cell survival rate of A549 lung cancer cells (ATCC, Manassas, VA, USA, mainly applied with the above anticancer drugs), a non-small cell lung cancer cell line, ³ . 24 hours later (Day 1), the extract sample was diluted in medium at concentrations of 50, 100, and 200 ug/mL and then treated with 100 uL of each cell. 24 hours later (Day 2), except for the negative control group, cells were treated with 100 uL of Osimertinib, Erlotinib, and Gefitinib at concentrations of 10, 40, and 30 uM, respectively. 72 hours later (Day 5), to measure cell viability, 10 uL of WST-1 solution (Roche, Pleasanton, CA, USA) was added to the medium and incubated at 37°C for 2 hours. Afterwards, optical density (OD) values were measured at 450 nm and 650 nm (Reference) using a SpectraMax 190 Absorbance Microplate Reader (Molecular Devices, San Jose, CA, USA). Cell viabilit was calculated as OD ₄₅₀ - OD ₆₅₀ , and the negative control group was normalized to 100% and the 0.1% Triton X-100 treated group was normalized to 0%. Data were expressed as mean ± standard deviation from three independent experiments, and significance between groups was calculated using students' t-test (GraphPad). ####, p < 0.0001 (vs. negative control)

As shown in Figures 4a to 4c, the survival rate of A549 lung cancer cells in the osmertinib group, erlotinib group, and gefitinib group treated with each of the three types of anticancer drugs compared to the negative control group that was not treated with each of the three types of anticancer drugs. It decreased to about 18%, about 42%, and about 63%, and the survival rates of A549 lung cancer cells pretreated with the Korean thistle extract prepared according to Example 1 were osmertinib group, erlotinib group, and gefitinib treated with only the three anticancer drugs. It was confirmed that it was similar to the group.

These results mean that Korean thistle extract does not inhibit the non-small cell lung cancer cell killing effect of the anticancer drugs osmertinib, erlotinib, and gefitinib.

시험예 5. 산소 소비량Test Example 5. Oxygen consumption

Real-time oxygen consumption (OCR) was measured using an extracellular flux analyzer (Seahorse XFe96 analyzer, Agilent Technologies, Palo Alto, CA, USA). Before measurement, 1X10 ⁴ cells were inoculated into an XF cell culture microplate at an appropriate concentration to reach about 90% confluence. Plates were incubated for 1 hour at 37°C in a CO ₂ -free incubator, and then cells were subjected to the Mito Stress test using unbuffered basal medium (Agilent Technologies) according to the manufacturer's instructions. Cellular oxygen consumption was measured under basal conditions (before addition) and after addition of oligomycin (1.5 μM), FCCP (1.0 μM), and antimycin A and rotenone (1.0 μM). OCR was monitored using an extracellular flux analyzer with three cycles of mixing (150 s), waiting (120 s), and measuring (210 s), which were repeated after each injection. Mitochondrial respiration, including maximal respiration and adenosine triphosphate (ATP) production, was calculated using the following equation:

[Equation 1]

Maximal respiration = OCR after FCCP treatment - non-mitochondrial OCR

[Equation 2]

ATP production = baseline OCR - OCR after oligomycin treatment

Figure 5a is a graph showing oxygen consumption when treated with Korean thistle extract prepared according to Example 1 of the present invention; Figure 5b is a graph showing maximum respiration when treated with Korean thistle extract prepared according to Example 1 of the present invention; Figure 5c is a graph showing mitochondrial respiration including adenosine triphosphate (ATP) production when treated with Korean thistle extract prepared according to Example 1 of the present invention.

As shown in Figures 5A to 5C, real-time oxygen consumption (OCR) of mitochondria increased compared to H9c2 cells treated only with DOX upon pretreatment with Korean thistle extract (100 ug/ml), and maximum respiratory rate and ATP production also increased. It was confirmed that pretreatment with Korean thistle extract increased compared to H9c2 cells treated only with DOX.

시험예 6. 미토콘드리아 막 전위 측정Test Example 6. Measurement of mitochondrial membrane potential

H9c2 1x10 ⁴ cells seeded in an 8-well plate were pretreated with Korean thistle extract for 24 hours and treated with 2 uM DOX for 48 hours. After 72 hours, the cell growth medium was removed and the cells were exposed to 100 nM of tetramethylrhodamine, methyl ester (TMRM) for 30 minutes to observe mitochondrial membrane potential. It is a cell-permeable dye that accumulates in active mitochondria where the membrane potential is intact. Hoechst 33422 was used for nuclear staining (5 ug/mL), and after staining, cells were washed three times with pre-warmed HBSS buffer. Images were taken with a 20X objective (Nikon ECLIPSE 80i) and analyzed using NIS-Elements version 5.21 (Nikon).

As shown in Figures 6a and 6b, it was confirmed that the mitochondrial membrane potential of living cells was significantly protected in a concentration-dependent manner when treated with Korean thistle extract.

시험예 7. SOD 발현 및 활성 측정 Test Example 7. Measurement of SOD expression and activity

7-1. For Western blot analysis, the total protein of the lysate was adjusted to 15 μg and separated on SDS-PAGE, and the separated proteins were transferred to a PVDF (polyvinylidene difluoride) membrane and blocked with EveryBlot Blocking Buffer. After washing with TBST, the membrane was incubated with primary antibody overnight at 4°C.

7-2. SOD activity was measured using the EZ-SOD assay kit (Dogenbio Co., Korea), and 20 μL of the diluted sample was added to each sample well and the well of untreated group 2, and to the wells of untreated group 1 and untreated group 3. 20 μL of ddH2O was added to each. 200 μL of WST working solution was added to each well, and 20 μL of dilution buffer was added to each well of untreated group 2 and untreated group 3. After adding 20 μL of enzyme working solution to the untreated group 1 and sample wells, the plate was incubated at 37°C for 20 minutes. Absorbance was measured at 450 nm and the results were repeated three times under the same conditions.

[Equation 3]

SOD activity (%) = (OD untreated group 1 - OD untreated group 3) - (OD sample - OD untreated group 2) / (OD untreated group 1 - OD untreated group 3)

7-3. H9c2 1x10 ⁴ cells seeded in an 8-well plate were pretreated with Korean thistle extract for 24 hours and treated with 2uM DOX for 48 hours, and the cell growth medium was removed after 72 hours. To observe mitochondrial membrane potential, cells were exposed to 5 uM of MitoSOXTM (TMRM), a mitochondrial peroxide indicator, for 10 minutes. The MitoTracker was used for mitochondrial staining (100 nM, 45 minutes). After staining, cells were washed three times with pre-warmed HBSS buffer, and images were taken with a 20X objective (Nikon ECLIPSE 80i) and analyzed using NIS-Elements version 5.21 (Nikon).

As shown in Figures 7a and 7b, when treated with Korean thistle extract, protein expression of superoxide dismutase SOD1 and SOD2, which are antioxidant enzymes; It was confirmed that the enzymatic activities of total SOD, SOD1, and SOD2 increased.

Additionally, as shown in Figures 7c to 7d, intracellular and mitochondrial oxidative stress was confirmed to be significantly reduced in H9c2 cells treated with Korean thistle extract.

시험예 8. 전기생리학적 특징 측정Test Example 8. Measurement of electrophysiological characteristics

A MEA data acquisition system (Maestro Edge, Axion BioSystems, Germany) was used to measure cardiac function using human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CM). The MEA plate included a titanium nitride electrode matrix with interelectrode electrodes, and the MEA plate was sterilized with 70% ethanol solution and coated with Matrigel (354277, Corning). Beating cardiomyocytes were plated in CM medium in the center of MEA plates for at least 3 days, and on the day of the experiment, recordings were performed for 5 min at baseline and 10 min after doxorubicin (DOX) application. Field potential signals were analyzed for beat period average, beat irregularity, FP duration, and spike amplitude, with FP duration normalized to beat rate using the Fridericia formula [modified FPD (FPDc)].

Data were analyzed with Cardiac Analysis Tool v.3.2.2 (Axion BioSystems).

Figure 8a was performed over two time points: a 7-day baseline (BL) and a post-DOX treatment period (DOX Tx.) (12 and 24 hours), and Figure 8b shows reflected external field potentials of electrically active cells. The total active electrodes were measured, Figure 8c measured the beat period and beat period irregularity, Figure 8d measured FPD (Field Potential Duration) as the time from the start of the depolarization spike to the peak of the repolarization wave, and the FPD was measured by Fredericia. Rate correction (FPDc) was performed using the formula: FPDc = FPD/RR1/3, where RR = interspike/inter-bit spacing. The FPD describes the cardiac action potential, which is closely related to the QT interval of the electrocardiogram (ECG). Figures 8e and 8f show conduction velocity, contractility, an electrophysiological property that describes the speed and direction of electrical propagation through the heart (a key parameter that describes the biomechanical properties of the heart).

As shown in Figures 8a to 8f, when treated with DOX, cells showed a decrease in total active electrodes, but when treated with Korean thistle extract, cells showed a higher level of active electrodes compared to cells treated only with DOX. (Figure 8b). Additionally, cells treated with Korean thistle extract showed improvement in both faster beat duration and higher beat period irregularity values (Figure 8c).

The QT interval is the most commonly assessed parameter in studies of DOX-induced cardiotoxicity in clinical reports, in vivo and in vitro. In the MEA analysis, Field Potential Duration (FPD) recording data confirmed that R/G and T peaks were clearly displayed along with high signals. In the gutta cluster, DOX extended the FPDc of hiPSC-CM, but pretreatment with 200 μg/ml Korean thistle extract reduced the FPDc by 80% (Figure 8d). Signal propagation was evaluated by evaluating the electric field potential signals from all electrodes, and it was confirmed that the conduction speed slowed down during DOX treatment and increased when treated with Korean thistle extract (Figure 8e). Through additional MEA analysis, it was observed that contractility (pulsation amplitude) was reduced by about 60% due to DOX, but when treated with Korean thistle extract, the reduction rate was reduced to 20%, confirming low toxicity (Figure 8f).

These results confirmed that Korean thistle extract alleviated some of the cardiac electrophysiology occurring in doxorubicin-induced cardiac toxicity.

<시험예 Ⅱ> <Test Example Ⅱ> In vivoIn vivo

동물실험animal testing

C57BL/6 mice (6 weeks old, Korea, male) weighing 18 to 22 g were used in the experiment. They were raised in acrylic cages (45 And constant temperature (20-24 ℃) and humidity (45-65%) were maintained. We monitored them for a week to help them adapt to the changed environment, maintained their sleep cycle, and checked for abnormal behavior.

The animal protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of the Korea Food Research Institute, and only healthy animals with consistent body weight changes were selected and classified by random placement method.

To create a mouse model of myocardial toxicity caused by an anticancer drug (Doxorubicin), doxorubicin was administered intraperitoneally (IP; intraperitoneal) to mice once a week for 4 weeks (4 times in total) until the total cumulative drug dose reached 20 mg/kg. ) was used in the experiment 1 week after injection (5 weeks from the first dose of Doxorubicin). Negative control group (Control) administered 200 uL of 0.9% saline, Dox group administered 200 uL Dox solution at 5 mg/kg a total of 4 times, and 400 mg/kg daily from the first day of Doxorubicin administration to two days before dissection. Divided into the Korean thistle extract group, which was administered the extract orally, the Berberine 20 group, which was orally administered 20 mg/kg berberine chloride daily from the first day of doxorubicin administration to two days before dissection, and the Berberine 40 group, which was orally administered 40 mg/kg berberine chloride daily. 4 animals were used in each experimental group.

The day before the dissection, the electrocardiogram was measured using an electrocardiogram device (Heart Monitoring ECGenie, Mouse Specifics Inc.). After the dissection, heart tissue was collected, fixed in 4% formaldehyde solution, and tissue analysis was performed (n=4). Data are expressed as mean ± standard error from four mice, and significance between groups was calculated using students' t-test (GraphPad). #, p < 0.05 (vs. Cont. group); ###, p < 0.001 (vs. Cont. group); *, p < 0.05 (vs. Dox group); **, p < 0.01 (vs. Dox group); ***, p < 0.001 (vs. Dox group)

시험예 9. 항암제로 인한 심근독성 마우스 모델의 분당 심장박동수, 신전도 측정 Test Example 9. Measurement of heart rate per minute and extensibility in mouse model of myocardial toxicity caused by anticancer drugs

As shown in Figures 9a to 9d, the heart rate per minute of the Control group is about 760 beats, while the heart rate per minute of the Dox group is lowered to about 670 beats, and the group administered the Korean thistle extract of Example 1 It was confirmed that the heart rate was about 760 beats, similar to the berberine 40 group.

A decrease in heart rate is accompanied by delays in the RR interval, QT interval, and ST segment on the electrocardiogram. The results of Figures 9b to 9d also confirmed that the three factors increased in the Dox group were restored to a similar level as the Control group, Berberine 20 group, and Berberine 40 group by administration of Korean thistle extract.

These results mean that abnormal cardiac function caused by doxorubicin can be alleviated by administration of Korean thistle extract.

시험예 10. 항암제로 인한 심근독성 마우스 모델의 심근독성 관련 혈액지표 및 간독성 지표 평가Test Example 10. Evaluation of blood indicators and hepatotoxicity indicators related to myocardial toxicity in mouse model of myocardial toxicity caused by anticancer drugs

Blood was obtained through orbital blood collection before dissection, and serum was used for analysis. The myocardial toxicity indicators, such as creatin kinase (CK) and LHD (lactate dehydrogenase), and the liver damage indicators, such as AST (aspartate aminotransferase, GOT) and ALT (alanine aminotransferase, GPT), were measured.

As shown in Figures 10a to 10d, the increased serum CK and LDH due to cardiac tissue damage caused by the toxicity of doxorubicin decreased to the levels of the Control group and the Berberine 20 group in the group administered the Korean thistle extract of Example 1. confirmed.

시험예 11. 항암제로 인한 심근독성 마우스 모델의 심근조직 섬유화 측정Test Example 11. Measurement of myocardial tissue fibrosis in mouse model of myocardial toxicity caused by anticancer drugs

After dissection, heart tissue was collected, fixed in 4% formaldehyde solution, and the degree of fibrosis of the heart tissue was confirmed through Massion's Trichrome staining. Fibrotic myocardial cells are stained blue, and it is known that cumulative use of the anticancer drug doxorubicin causes death and fibrosis of myocardial cells, ultimately making normal cardiac function impossible.

As shown in Figure 11, fibrosis occurred in the cardiomyocytes of the Dox group administered with doxorubicin, and no traces of fibrosis were found in the cardiomyocytes of the Korean thistle extract group administered with doxorubicin and the Korean thistle extract of Example 1. Confirmed.

These results mean that administration of Korean thistle extract can prevent, treat, or inhibit fibrosis of cardiomyocytes caused by doxorubicin.

시험예 12. 항암제로 인한 심근독성 마우스 모델의 심근세포 사멸 측정Test Example 12. Measurement of cardiomyocyte cell death in mouse model of myocardial toxicity caused by anticancer drugs

After dissection, heart tissue was collected, fixed in 4% formaldehyde solution, and the degree of death of myocardial cells was confirmed through TUNEL staining. The nuclei of cardiomyocytes killed by the anticancer drug doxorubicin are stained brown, and the nuclei of normal cardiomyocytes are stained blue. Cumulative use of the anticancer drug doxorubicin induces the death of cardiomyocytes.

As shown in Figure 12, it was confirmed that death of cardiomyocytes occurred in the Dox group administered with doxorubicin, and in the Korean thistle extract group administered with doxorubicin and the Korean thistle extract of Example 1, no traces of death of cardiomyocytes were found. It was confirmed that it was not.

These results mean that administration of Korean thistle extract can prevent, treat, or inhibit the death of cardiomyocytes caused by doxorubicin.

<시험예 Ⅲ><Test Example Ⅲ>

시험예 13. 고려엉겅퀴 추출물의 성분 분석Test Example 13. Component analysis of Korean thistle extract

To investigate the metabolite profile of the Korean thistle extract prepared according to Example 1 of the present invention, 20 micrograms of CBW was injected into an ultra-performance lipid chromatography (UPLC) system and then subjected to triple quadrupole mass spectrometry (TQ/MS). Analysis was performed and full ion chromatograms were acquired over 24 minutes.

물질matter	함량 (μg/g)Content (μg/g)
Chlorogenic acidChlorogenic acid	3125.463125.46
Quercetin 3-o-glucoside (isoquercitrin)Quercetin 3-o-glucoside (isoquercitrin)	187.92187.92
Kaempferol 3-O-B -rutinoside (Nicotiflorin)Kaempferol 3-O-B -rutinoside (Nicotiflorin)	339.29339.29
CirsimarinCirsimarin	1.781.78
CirsimaritinCirsimaritin	0.150.15
AcacetinAcacetin	63.6263.62
PectolinarigeninPectolinarigenin	49.1049.10

As shown in Table 1 above, the Korean thistle extract prepared according to Example 1 of the present invention had the highest chlorogenic acid content of 3125.46 μg/g, and kaempferol 3-O-beta- rutinoside, Nicotiflorin) was confirmed to be the second most abundant substance.

[냉이][Shepherd's purse]

실시예 2. Example 2.

A shepherd's purse extract was obtained by mixing shepherd's purse and water at a weight ratio of 1:10 and performing reflux extraction at 80°C for 8 hours.

<시험예 Ⅳ> <Test Example Ⅳ> In vitroIn vitro

시험예 14. H9C2 심근세포 생존율 측정_독소루비신(doxorubicin)Test Example 14. Measurement of H9C2 cardiomyocyte survival rate_doxorubicin

To measure the cell viability of H9C2 cardiomyocytes (ATCC, Manassas, VA, USA), ¹ 24 hours later (Day 1), the extract sample was diluted in medium to a concentration of 100 or 200 ug/mL and then treated with 100 uL of each cell. 24 hours later (Day 2), except for the negative control (Cont.), cells were treated with 100 uL of Doxorubicin HCl (Apexbio, Houston, TX, USA) at a concentration of 2 uM. After 48 hours (Day 4), to measure cell viability, 10 uL of WST-1 solution (Roche, Pleasanton, CA, USA) was added to the medium and incubated at 37°C for 2 hours. Afterwards, optical density (OD) values were measured at 450 nm and 650 nm (Reference) using a SpectraMax 190 Absorbance Microplate Reader (Molecular Devices, San Jose, CA, USA). Cell viabilit was calculated as OD ₄₅₀ - OD ₆₅₀ , and the negative control group was normalized to 100% and the 0.1% Triton X-100 treated group was normalized to 0%. Data were expressed as mean ± standard deviation from three independent experiments, and significance between groups was calculated using students' t-test (GraphPad). ###, p < 0.001 (vs. negative control); ***, p < 0.001 (vs. Dox group)

As shown in Figure 13, compared to the negative control group not treated with Doxorubicin, the Dox group treated with Doxorubicin (group treated only with Doxorubicin) had a decrease in cells of about 36%, while the shepherd's purse extract prepared according to Example 2 It was confirmed that pretreated H9c2 cells were protected from the toxicity of doxorubicin and showed a relatively high cell survival rate.

In particular, it was confirmed that H9c2 cells pretreated with shepherd's purse extract at a concentration of 200 ug/ml showed a similar level of cell viability as cells not treated with doxorubicin (negative control).

These results mean that pretreatment with shepherd's purse extract protects cardiomyocyte H9c2 from the toxicity of doxorubicin, an anticancer drug.

시험예 15. MDA-MB-231 유방암 세포 생존율 측정_독소루비신(doxorubicin)Test Example 15. MDA-MB-231 Breast cancer cell survival rate measurement_doxorubicin

Cell viability was measured in the same manner as in Test Example 1 using MDA-MB-231 breast cancer cells (ATCC, Manassas, VA, USA) instead of H9C2 cardiomyocytes, and the sample concentrations were 12.5, 25, 50, 100, and 200. , 400, 800, and 1600 ug/mL. ####, p < 0.0001 (vs. negative control); ***, p < 0.001 (vs. Dox group); ****, p < 0.0001 (vs. Dox group)

As shown in Figure 14, compared to the negative control group not treated with Doxorubicin, the survival rate of MDA-MB-231 cells, which are triple negative breast cancer cells, was reduced by about 33% in the Dox group treated with Doxorubicin, prepared according to Example 2 It was confirmed that MDA-MB-231 cells pretreated with 12.5-25 ug/mL of shepherd's purse extract also showed a cell survival rate similar to that of the Dox group.

However, it was confirmed that MDA-MB-231 cells pretreated with 50-1600 ug/mL of shepherd's purse extract prepared according to Example 2 showed low cell viability in a concentration-dependent manner.

These results mean that 12.5-25 ug/mL of shepherd's purse extract does not inhibit the cancer cell killing effect of doxorubicin, an anticancer drug, and that 50-1600 ug/mL of shepherd's purse extract does not inhibit the cancer cell killing effect of doxorubicin, an anticancer drug. This means further improving the effect.

시험예 16. H9C2 심근세포 생존율 측정_오시머티닙(osmertinib), 엘로티닙(erlotinib) 및 게피티니브(gefitinib)Test Example 16. Measurement of H9C2 cardiomyocyte survival rate_osmertinib, erlotinib, and gefitinib

In order to determine the cell survival rate of cardiomyocytes from the toxicity of anticancer drugs other than doxorubicin, the protective effect of shepherd's purse extract on myocardial cells was measured against representative anticancer drugs of the TKI (Tyrosine kinase inhibitor) class, which are well known to cause cardiomyocyte toxicity.

To measure the cell viability of H9C2 cardiomyocytes (ATCC, Manassas, VA, USA), ¹ 24 hours later (Day 1), the extract sample was diluted in medium at concentrations of 50, 100, and 200 ug/mL and then treated with 100 uL of each cell. 24 hours later (Day 2), except for the negative control group, cells were treated with 100 uL of Osimertinib, Erlotinib, and Gefitinib at concentrations of 10, 40, and 30 uM, respectively. After 48 hours (Day 4), to measure cell viability, 10 uL of WST-1 solution (Roche, Pleasanton, CA, USA) was added to the medium and incubated at 37°C for 2 hours. Afterwards, optical density (OD) values were measured at 450 nm and 650 nm (Reference) using a SpectraMax 190 Absorbance Microplate Reader (Molecular Devices, San Jose, CA, USA). Cell viability was calculated as OD ₄₅₀ - OD ₆₅₀ , and the negative control group was normalized to 100% and the 0.1% Triton X-100 treated group was normalized to 0%. Data were expressed as mean ± standard deviation from three independent experiments, and significance between groups was calculated using students' t-test (GraphPad). ####, p < 0.0001 (vs. negative control); *, p < 0.05 (vs. Dox group); **, p < 0.01 (vs. Dox group); ***, p < 0.001 (vs. Dox group); ****, p < 0.0001 (vs. Dox group)

As shown in Figures 15A to 15C, when treated with Osmertinib, the cell survival rate was about 68%, when treated with Erlotinib, the cell survival rate was about 65%, and when treated with Gefitinib, the cell survival rate was about 75%.

On the other hand, it was confirmed that H9c2 cells pretreated with the shepherd's purse extract prepared according to Example 2 showed a relatively high cell survival rate compared to the group treated with each anticancer agent alone.

These results indicate that pretreatment with shepherd's purse extract protects cardiomyocyte H9c2 not only from doxorubicin but also from other anticancer drugs.

시험예 17. A549 폐암 세포 생존율 측정_오시머티닙(osmertinib), 엘로티닙(erlotinib) 및 게피티니브(gefitinib) Test Example 17. Measurement of A549 lung cancer cell viability_osmertinib, erlotinib, and gefitinib

Three types of TKIs anticancer drugs, consisting of osmertinib, erlotinib, and gefitinib, are mainly applied clinically for the treatment of non-small cell lung cancer. Therefore, an experiment was conducted to determine whether shepherd's purse extract inhibits the non-small cell lung cancer cell killing effect of three types of TKIs anticancer drugs.

As shown in Figures 16a to 16c, the survival rate of A549 lung cancer cells in the osmertinib group, erlotinib group, and gefitinib group treated with each of the three types of anticancer drugs compared to the negative control group that was not treated with each of the three types of TKIs anticancer drugs. It decreased to about 18%, about 60%, and about 58%, and the survival rate of A549 lung cancer cells pretreated with the shepherd's purse extract prepared according to Example 2 was that of the osmertinib group, erlotinib group, and gefitinib group treated with only the above three anticancer drugs. It was confirmed that it was similar to .

These results mean that shepherd's purse extract does not inhibit the non-small cell lung cancer cell killing effect of the anticancer drugs osmertinib, erlotinib, and gefitinib.

시험예 18. 산소 소비량Test Example 18. Oxygen consumption

Real-time oxygen consumption (OCR) was measured using an extracellular flux analyzer (Seahorse XFe96 analyzer, Agilent Technologies, Palo Alto, CA, USA). Before measurement, H9c2 1X10 ⁴ cells were inoculated into XF cell culture microplates at an appropriate concentration to reach about 90% confluence. Plates were incubated for 1 hour at 37°C in a CO ₂ -free incubator, and then cells were subjected to the Mito Stress test using unbuffered basal medium (Agilent Technologies) according to the manufacturer's instructions. Cellular oxygen consumption was measured under basal conditions (before addition) and after addition of oligomycin (1.5 μM), FCCP (1.0 μM), and antimycin A and rotenone (1.0 μM). OCR was monitored using an extracellular flux analyzer with three cycles of mixing (150 s), waiting (120 s), and measurement (210 s), which were repeated after each injection. Mitochondrial respiration, including maximal respiration and adenosine triphosphate (ATP) production, was calculated using the equation above.

As shown in Figures 17a to 17d, the real-time oxygen consumption rate (OCR, Figure 17a) of the isolated mitochondria was measured by the basal respiration rate (Figure 17b), maximum respiration rate (Figure 17c) and ATP production (Figure 17b) upon treatment with shepherd's purse extract. 17d) was confirmed to alleviate the decline. On the other hand, the lowest level was confirmed in H9c2 cells treated with DOX.

시험예 19. 미토콘드리아 막 전위 측정Test Example 19. Measurement of mitochondrial membrane potential

H9c2 1x10 ⁴ cells seeded in an 8-well plate were pretreated with shepherd's purse extract for 24 hours and treated with 2 uM DOX for 48 hours. After 72 hours, the cell growth medium was removed and the cells were exposed to 100 nM of tetramethylrhodamine, methyl ester (TMRM) for 30 minutes to observe mitochondrial membrane potential. It is a cell-permeable dye that accumulates in active mitochondria where the membrane potential is intact. Hoechst 33422 was used for nuclear staining (5 ug/mL), and after staining, cells were washed three times with pre-warmed HBSS buffer. Images were taken with a 20X objective (Nikon ECLIPSE 80i) and analyzed using NIS-Elements version 5.21 (Nikon).

As shown in Figures 18A and 18B, it was confirmed that the mitochondrial membrane potential of living cells was significantly protected in a concentration-dependent manner when treated with the shepherd's purse extract.

시험예 20. SOD 발현 및 활성 측정 Test Example 20. Measurement of SOD expression and activity

20-1. For Western blot analysis, the total protein of the lysate was adjusted to 15 μg and separated on SDS-PAGE, and the separated proteins were transferred to a PVDF (polyvinylidene difluoride) membrane and blocked with EveryBlot Blocking Buffer. After washing with TBST, the membrane was incubated with primary antibody overnight at 4°C.

20-2. For mRNA measurement, total RNA was extracted from cells using RNAiso Plus (Takara, Kusatsu, Shiga, Japan). Reverse transcription was performed using a cDNA synthesis kit (Toyobo, Osaka, Japan) according to the manufacturer's instructions, and genes were purified using a CFX Connect Real-Time PCR detection system (Bio-Rad) with SYBR Green PCR Master Mix (Roche, Mannheim, Germany). , Hercules, CA, USA). Primers used are listed in Table 1 below, and bands were quantified in relation to Gapdh expression.

GeneGene		Sequence (5’-3’)Sequence (5’-3’)	UsageUsage
GapdhGapdh	ForwardForward	AGACAGCCGCATCTTCTTGTAGACAGCCGCATCTTCTTGT	qPCRqPCR
GapdhGapdh	ReverseReverse	CTTGCCGTGGGTAGAGTCATCTTGCCGTGGGTAGAGTCAT
Sod1Sod1	ForwardForward	TGTGTCCATTGAAGATCGTGTGTGTGTCCATTGAAGATCGTGTG
Sod1Sod1	ReverseReverse	CTTCCAGCATTTCCAGTCTTTGCTTCCAGCATTTCCAGTCTTTG
Sod2Sod2	ForwardForward	GGACAAACCTGAGCCCTAAGGGACAAACCTGAGCCCTAAG
Sod2Sod2	ReverseReverse	CAAAAGACCCAAAGTCACGCCAAAAGACCCAAAGTCACGC
Ho-1Ho-1	ForwardForward	GTCCCAGGATTTGTCCGAGGGTCCCAGGATTTGTCCGAGG
Ho-1Ho-1	ReverseReverse	GGTACAAGGAGGCCATCACCGGTACAAGGAGGCCATCACC

20-3. H9c2 1x10 ⁴ cells seeded in an 8-well plate were pretreated with shepherd's purse extract for 24 hours and treated with 2uM DOX for 48 hours, and the cell growth medium was removed after 72 hours. To observe mitochondrial membrane potential, cells were exposed to 5 uM of MitoSOXTM (TMRM), a mitochondrial peroxide indicator, for 10 minutes. The MitoTracker was used for mitochondrial staining (100 nM, 45 minutes). After staining, cells were washed three times with pre-warmed HBSS buffer, and images were taken with a 20X objective (Nikon ECLIPSE 80i) and analyzed using NIS-Elements version 5.21 (Nikon).

As shown in Figures 19a and 19b, it was confirmed that treatment with shepherd's purse extract increased the mRNA and protein expression of superoxide dismutase SOD 1, SOD2, and Haem Oxygenase-1 (Ho-1), which are antioxidant enzymes.

Additionally, as shown in Figures 19c to 19d, intracellular and mitochondrial oxidative stress was confirmed to be significantly reduced in a concentration-dependent manner in H9c2 cells treated with shepherd's purse extract.

시험예 21. 전기생리학적 특징 측정Test Example 21. Measurement of electrophysiological characteristics

Data were analyzed with Cardiac Analysis Tool v.3.2.2 (Axion BioSystems).

The above Figure 20A was performed over two time points: a 7-day baseline (BL) and a post-DOX treatment period (DOX Tx.) (12 and 24 hours), and Figure 20B shows the graph from the start of the depolarization spike to the peak of the repolarization wave. Field Potential Duration (FPD) was measured in time and the FPD was rate corrected (FPDc) using Fredericia's formula (FPDc = FPD/RR1/3, where RR = interspike/interbeat spacing). The FPD describes the cardiac action potential, which is closely related to the QT interval of the electrocardiogram (ECG). Figure 20c shows conduction velocity, an important electrophysiological characteristic that describes the speed and direction of electrical propagation through the heart, and Figure 20d shows spike amplitude, which is the absolute amplitude of depolarizing spikes (positive and negative), measured and expressed as total spike amplitude. , Figure 20e measures the beat period and beat period irregularity.

As shown in Figures 20A-20E, the QT interval is the most commonly assessed parameter in clinical reports, in vivo and in vitro, in studies of DOX-induced cardiotoxicity. Field potential duration (FPD) data from MEA analysis clearly showed visible R/Q and T peaks with high signal-to-baseline ratio in cells treated with shepherd's purse extract before DOX exposure. As expected, DOX induced an increase in the QT interval over time, but treatment with shepherd's purse extract prevented this increase in a concentration-dependent manner (FIG. 20b). After DOX treatment, hiPSC-CMs showed slow conduction velocity and low spike amplitude, which were confirmed to be restored in a concentration-dependent manner by shepherd's purse extract (Figures 20c and 20d, respectively). Beat cycle and beat cycle irregularity values were also improved in hiPSC-CM(E) when treated with shepherd's purse extract.

These results confirmed that shepherd's purse extract alleviates cardiac dysfunction resulting from doxorubicin-induced cardiotoxicity.

<시험예 Ⅴ> <Test Example Ⅴ> In vivoIn vivo

동물실험animal testing

To create a mouse model of myocardial toxicity caused by an anticancer drug (Doxorubicin), doxorubicin was administered intraperitoneally (IP; intraperitoneal) to mice once a week for 4 weeks (4 times in total) until the total cumulative drug dose reached 20 mg/kg. ) was used in the experiment 1 week after injection (5 weeks from the first dose of Doxorubicin). Negative control group (Control) administered 200 uL of 0.9% saline, Dox group administered 200 uL Dox solution at 5 mg/kg a total of 4 times, and 400 mg/kg daily from the first day of Doxorubicin administration to two days before dissection. The group was divided into the shepherd's purse extract group, which was administered the extract orally, the Berberine 20 group, which was orally administered 20 mg/kg Berberine chloride daily from the first day of doxorubicin administration to two days before dissection, and the Berberine 40 group, which was orally administered 40 mg/kg Berberine chloride daily. Four animals were used in each experimental group.

시험예 22. 항암제로 인한 심근독성 마우스 모델의 분당 심장박동수, 신전도 측정 Test Example 22. Measurement of heart rate per minute and extensibility in mouse model of myocardial toxicity caused by anticancer drugs

Figure 21a is a graph showing heart beats per minute in the Control group, Dox group, shepherd's purse extract group, Berberine 20 group, and Berberine 40 group; Figure 21b is a graph showing the RR interval of the Control group, Dox group, shepherd's purse extract group, Berberine 20 group, and Berberine 40 group; Figure 21c is a graph showing the QT interval of the Control group, Dox group, shepherd's purse extract group, Berberine 20 group, and Berberine 40 group; Figure 21d is a graph showing the ST segment of the Control group, Dox group, shepherd's purse extract group, Berberine 20 group, and Berberine 40 group.

As shown in FIGS. 21A to 21D, the heart rate per minute of the Control group is about 760, while the heart rate of the Dox group is lowered to about 670, and the group administered the shepherd's purse extract of Example 1 is about 760 beats per minute. It was confirmed that the heart rate was 730 beats, similar to the berberine 20 group.

A decrease in heart rate is accompanied by delays in the RR interval, QT interval, and ST segment on the electrocardiogram. The results of Figures 21b to 21d also confirmed that the three factors increased in the Dox group were restored to levels similar to those in the Control group, Berberine 20 group, and Berberine 40 group with the administration of shepherd's purse extract.

These results mean that abnormal cardiac function caused by doxorubicin can be alleviated by administration of shepherd's purse extract.

시험예 23. 항암제로 인한 심근독성 마우스 모델의 심근독성 관련 혈액지표 및 간독성 지표 평가Test Example 23. Evaluation of blood indicators and hepatotoxicity indicators related to myocardial toxicity in mouse model of myocardial toxicity caused by anticancer drugs

As shown in Figures 22a to 22d, the increased serum CK and LDH due to damage to heart tissue due to the toxicity of doxorubicin decreased to the level of the Control group and the Berberine 20 group in the group administered the shepherd's purse extract of Example 2. Confirmed.

In addition, it was confirmed that the group administered the shepherd's purse extract of Example 2 did not show statistical significance compared to the control group and the Berberine 20 group in serum AST, an indicator of liver damage.

시험예 24. 항암제로 인한 심근독성 마우스 모델의 심근조직 섬유화 측정Test Example 24. Measurement of myocardial tissue fibrosis in mouse model of myocardial toxicity caused by anticancer drugs

As shown in Figure 23, fibrosis occurred in the cardiomyocytes of the Dox group administered with doxorubicin, and it was confirmed that no traces of fibrosis were found in the cardiomyocytes of the shepherd's purse extract group administered with doxorubicin and the shepherd's purse extract of Example 2. .

These results mean that administration of shepherd's purse extract can prevent, treat, or inhibit fibrosis of myocardial cells caused by doxorubicin.

시험예 25. 항암제로 인한 심근독성 마우스 모델의 심근세포 사멸 측정Test Example 25. Measurement of myocardial cell death in mouse model of myocardial toxicity caused by anticancer drugs

As shown in Figure 24, it was confirmed that death of cardiomyocytes occurred in the Dox group administered with doxorubicin, and no traces of death of cardiomyocytes were found in the shepherd's purse extract group administered with doxorubicin and the shepherd's purse extract of Example 2. Confirmed.

These results mean that administration of shepherd's purse extract can prevent, treat, or inhibit the death of cardiomyocytes caused by doxorubicin.

<시험예 Ⅵ><Test example Ⅵ>

시험예 26. 냉이 추출물의 성분 분석Test Example 26. Component analysis of shepherd's purse extract

To investigate the metabolite profile of the shepherd's purse extract prepared according to Example 1 of the present invention, 20 micrograms of CBW was injected into an ultra-performance lipid chromatography (UPLC) system and then analyzed by triple quadrupole mass spectrometry (TQ/MS). was performed and the entire ion chromatogram was acquired over 24 minutes.

물질matter	함량 (μg/g)Content (μg/g)
Apigenin-6,8-di-C-glucoside (vicenin-2)Apigenin-6,8-di-C-glucoside (vicenin-2)	30.9230.92
IsoorientinIsoorientin	4.264.26
Quercetin 3-o-glucoside (isoquercitrin)Quercetin 3-o-glucoside (isoquercitrin)	131.22131.22
Luteolin-7-O-glucosideLuteolin-7-O-glucoside	133.41133.41
Isorhamnetin-3-rutinoside (Narcissoside)Isorhamnetin-3-rutinoside (Narcissoside)	5.815.81
Quercetin 3-O-(6''-acetyl-glucoside)Quercetin 3-O-(6''-acetyl-glucoside)	4.374.37
Chrysoeriol-7-O-glucoside (Thermopsoside)Chrysoeriol-7-O-glucoside (Thermopsoside)	18.9318.93

As shown in Table 3 above, the shepherd's purse extract prepared according to Example 1 of the present invention was confirmed to have the highest content of cynaroside (Luteolin-7-O-glucoside) at 133.41 μg/g, and isoquercetin (Quercetin). 3-o-glucoside) was confirmed to be the second most abundant substance.

[삼백초][300 seconds]

실시예 3. Example 3.

The aerial parts of Trifolium vulgaris and water were mixed at a weight ratio of 1:10, and extracted under reflux at 80°C for 8 hours to obtain a Trifolium vulgaris extract.

<시험예 Ⅶ> <Test Example VII> In vitroIn vitro

시험예 27. H9C2 심근세포 생존율 측정_독소루비신(doxorubicin)Test Example 27. Measurement of H9C2 cardiomyocyte survival rate_doxorubicin

To measure the cell viability of H9C2 cardiomyocytes (ATCC, Manassas, VA, USA), ¹ 24 hours later (Day 1), the extract samples were diluted in medium to concentrations of 50, 100, 200, and 400 ug/mL and then treated with 100 uL of each cell. 24 hours later (Day 2), except for the negative control group (Cont.), cells were treated with 100 uL of Doxorubicin HCl (Apexbio, Houston, TX, USA) at a concentration of 2 uM. 48 hours later (Day 4), to measure cell viability, 10 uL of WST-1 solution (Roche, Pleasanton, CA, USA) was added to the medium and incubated at 37°C for 2 hours. Afterwards, optical density (OD) values were measured at 450 nm and 650 nm (Reference) using a SpectraMax 190 Absorbance Microplate Reader (Molecular Devices, San Jose, CA, USA). Cell viabilit was calculated as OD ₄₅₀ - OD ₆₅₀ , and the negative control group was normalized to 100% and the 0.1% Triton X-100 treated group was normalized to 0%. Data were expressed as mean ± standard deviation from three independent experiments, and significance between groups was calculated using students' t-test (GraphPad). ###, p < 0.001 (vs. negative control); *, p < 0.05 (vs. Dox group); ***, p < 0.001 (vs. Dox group)

As shown in Figure 25, compared to the negative control group not treated with Doxorubicin, the Dox group treated with Doxorubicin (group treated only with Doxorubicin) had a decrease in cells of about 40%, while the cells of the Dox group treated with Doxorubicin (group treated only with Doxorubicin) were reduced by about 40%, while the cells of the Dox group treated with Doxorubicin (group treated only with Doxorubicin) were reduced by about 40%. It was confirmed that pretreated H9c2 cells were protected from the toxicity of doxorubicin and showed a relatively high cell survival rate.

In particular, it was confirmed that H9c2 cells pretreated with a concentration of 400 ug/ml of Chrysanthemum sinensis extract showed a similar level of cell viability as cells not treated with doxorubicin (negative control).

These results mean that pretreatment with Trifolia extract protects cardiomyocyte H9c2 from the toxicity of doxorubicin, an anticancer drug.

시험예 28. MDA-MB-231 유방암 세포 생존율 측정_독소루비신(doxorubicin)Test Example 28. MDA-MB-231 Measurement of breast cancer cell survival rate_doxorubicin

Cell survival rate was measured in the same manner as Test Example 1, using MDA-MB-231 breast cancer cells (ATCC, Manassas, VA, USA) instead of H9C2 cardiomyocytes. ###, p < 0.001 (vs. negative control)

As shown in Figure 26, compared to the negative control group not treated with Doxorubicin, the survival rate of MDA-MB-231 cells, which are triple negative breast cancer cells, was reduced by about 40% in the Dox group treated with Doxorubicin, prepared according to Example 3 It was confirmed that MDA-MB-231 cells pretreated with P. ginseng extract also showed a cell survival rate similar to that of the Dox group.

These results mean that the Trifolia extract does not inhibit the cancer cell killing effect of the anticancer drug doxorubicin.

시험예 29. H9C2 심근세포 생존율 측정_오시머티닙(osmertinib), 엘로티닙(erlotinib) 및 게피티니브(gefitinib)Test Example 29. Measurement of H9C2 cardiomyocyte survival rate_osmertinib, erlotinib, and gefitinib

In order to determine the cell survival rate of cardiomyocytes from the toxicity of anticancer drugs other than doxorubicin, we measured the cardiomyocyte cell protection effect of Triacium chinensis extract against representative anticancer drugs of the TKI (Tyrosine kinase inhibitor) class, which are well known to cause cardiomyocyte toxicity.

As shown in Figures 27a to 27c, it was confirmed that when treated with Osmertinib, the cell survival rate was about 40%, when treated with Erlotinib, the cell survival rate was about 30%, and when treated with Gefitinib, the cell survival rate was about 80%.

On the other hand, it was confirmed that the H9c2 cells pretreated with the Triacium vulgaris extract prepared according to Example 3 showed a relatively high cell survival rate compared to the group treated with each anticancer agent alone.

However, when H9c2 cells pretreated with a 200 ug/ml concentration of P. chinensis extract were treated with Osmertinib, the cell survival rate was confirmed to be similar to that of the group treated only with Osmertinib.

These results indicate that pretreatment with P. chinensis extract protects cardiomyocyte H9c2 not only from doxorubicin but also from other anticancer drugs.

시험예 30. A549 폐암 세포 생존율 측정_오시머티닙(osmertinib), 엘로티닙(erlotinib) 및 게피티니브(gefitinib) Test Example 30. Measurement of A549 lung cancer cell viability_osmertinib, erlotinib, and gefitinib

Three types of TKIs anticancer drugs, consisting of osmertinib, erlotinib, and gefitinib, are mainly applied clinically for the treatment of non-small cell lung cancer. Therefore, an experiment was conducted to determine whether the extract of P. ginseng inhibits the non-small cell lung cancer cell killing effect of three types of TKIs anticancer drugs.

Figure 28a is a graph measuring the survival rate of A549 lung cancer cells when treated with osmertinib after treatment with the Trifolia extract prepared according to Example 3 of the present invention; Figure 28b is a graph measuring the survival rate of A549 lung cancer cells when treated with erlotinib after treatment with the extract of Trifolium vulgaris prepared according to Example 3 of the present invention; Figure 28c is a graph measuring the survival rate of A549 lung cancer cells when treated with gefitinib after treatment with the Trifolia extract prepared according to Example 3 of the present invention.

As shown in Figures 28a to 28c, the survival rate of A549 lung cancer cells in the osmertinib group, erlotinib group, and gefitinib group treated with each of the three types of anticancer drugs compared to the negative control group that was not treated with each of the three types of TKIs anticancer drugs. It decreased to about 30%, about 60%, and about 68%, and the survival rate of the A549 lung cancer cells pretreated with the extract of P. ginseng prepared according to Example 3 was that of the osmertinib group, erlotinib group, and gefitinib group treated with only the above three anticancer drugs. It was confirmed that it was similar to .

These results mean that the Trifolia extract does not inhibit the non-small cell lung cancer cell killing effect of the anticancer drugs osmertinib, erlotinib, and gefitinib.

<시험예 Ⅷ> <Test Example VIII> In vivoIn vivo

동물실험animal testing

To create a mouse model of myocardial toxicity caused by an anticancer drug (Doxorubicin), doxorubicin was administered intraperitoneally (IP; intraperitoneal) to mice once a week for 4 weeks (4 times in total) until the total cumulative drug dose reached 20 mg/kg. ) was used in the experiment 1 week after injection (5 weeks from the first dose of Doxorubicin). Negative control group (Control) administered 200 uL of 0.9% saline, Dox group administered 200 uL Dox solution at 5 mg/kg a total of 4 times, and 400 mg/kg daily from the first day of Doxorubicin administration to two days before dissection. They were divided into three groups: the Trifolia extract group, which was administered the extract orally, the Berberine 20 group, which was orally administered 20 mg/kg berberine chloride daily from the first day of doxorubicin administration to two days before dissection, and the Berberine 40 group, which was orally administered 40 mg/kg berberine chloride daily. Four animals were used in each experimental group.

시험예 31. 항암제로 인한 심근독성 마우스 모델의 분당 심장박동수, 신전도 측정 Test Example 31. Measurement of heart rate per minute and extensibility in mouse model of myocardial toxicity caused by anticancer drugs

Figure 29a is a graph showing the heart beats per minute of the Control group, Dox group, Triacium vulgaris extract group, Berberine 20 group, and Berberine 40 group; Figure 29b is a graph showing the RR interval of the Control group, Dox group, Triacium chinensis extract group, Berberine 20 group, and Berberine 40 group; Figure 29c is a graph showing the QT intervals of the Control group, Dox group, P. ginseng extract group, Berberine 20 group, and Berberine 40 group; Figure 29d is a graph showing the ST segment of the Control group, Dox group, Trillium chinensis extract group, Berberine 20 group, and Berberine 40 group.

As shown in Figures 29a to 29d, the heart rate per minute of the Control group is about 760 beats, while the heart rate per minute of the Dox group is lowered to about 670 beats, and the group administered the P. ginseng extract of Example 3 is about 760 beats per minute. It was confirmed that the heart rate was 740 beats, similar to the berberine 20 group.

A decrease in heart rate is accompanied by delays in the RR interval, QT interval, and ST segment on the electrocardiogram. The results of Figures 29b to 29d also confirmed that the three factors increased in the Dox group were restored to a level similar to that of the Control group, Berberine 20 group, and Berberine 40 group with the administration of P. ginseng extract.

These results mean that the abnormal cardiac function caused by doxorubicin can be alleviated by the administration of P. chinensis extract.

시험예 32. 항암제로 인한 심근독성 마우스 모델의 심근독성 관련 혈액지표 및 간독성 지표 평가Test Example 32. Evaluation of blood indicators and hepatotoxicity indicators related to myocardial toxicity in mouse model of myocardial toxicity caused by anticancer drugs

Blood was obtained through orbital blood collection before dissection, and serum was used for analysis. CK (creatin kinase) and LHD (lactate dehydrogenase), indicators of myocardial toxicity, and aspartate aminotransferase (GOT) and ALT (alanine aminotransferase, GPT), indicators of liver damage, were measured.

Figure 30a is a graph showing CK (creatin kinase) in the Control group, Dox group, P. ginseng extract group, and Berberine 20 group; Figure 30b is a graph showing the LHD (lactate dehydrogenase) of the Control group, Dox group, Trillium chinensis extract group, and Berberine 20 group; Figure 30c is a graph showing AST (aspartate aminotransferase) in the Control group, Dox group, P. ginseng extract group, and Berberine 20 group; Figure 30d is a graph showing ALT (alanine aminotransferase) in the Control group, Dox group, Triacium chinensis extract group, and Berberine 20 group.

As shown in Figures 30a to 30d, serum CK and LDH, which increased due to damage to heart tissue due to the toxicity of doxorubicin, decreased to the level of the Control group and the Berberine 20 group in the group administered the P. chinensis extract of Example 3. Confirmed.

In addition, it was confirmed that the group administered the P. ginseng extract of Example 3 did not show statistical significance compared to the Control group and the Berberine 20 group in serum AST, an indicator of liver damage.

시험예 33. 항암제로 인한 심근독성 마우스 모델의 심근조직 섬유화 측정Test Example 33. Measurement of myocardial tissue fibrosis in mouse model of myocardial toxicity caused by anticancer drugs

As shown in Figure 31, fibrosis occurred in the cardiomyocytes of the Dox group administered with doxorubicin, and it was confirmed that no traces of fibrosis were found in the myocardial cells of the Chrysanthemum sinensis extract group administered with doxorubicin and the Chrysanthemum sinensis extract of Example 3. .

These results mean that administration of P. chinensis extract can prevent, treat, or inhibit fibrosis of myocardial cells caused by doxorubicin.

시험예 34. 항암제로 인한 심근독성 마우스 모델의 심근세포 사멸 측정Test Example 34. Measurement of myocardial cell death in mouse model of myocardial toxicity caused by anticancer drugs

As shown in Figure 32, it was confirmed that death of cardiomyocytes occurred in the Dox group administered with doxorubicin, and no traces of death of cardiomyocytes were found in the group administered with Doxorubicin and the Chrysanthemum sinensis extract of Example 3. Confirmed.

These results mean that administration of P. ginseng extract can prevent, treat, or inhibit the death of cardiomyocytes caused by doxorubicin.

Below, a formulation example of a composition containing the powder of the present invention is described, but the present invention is not intended to be limited, but merely explained in detail.

Formulation Example 1. Preparation of powder

500 mg of extract powder obtained in Example 1, Example 2 or Example 3

100 mg lactose

Talc 10 mg

The above ingredients are mixed and filled into an airtight bubble to prepare a powder.

Formulation Example 2. Preparation of tablets

300 mg of extract powder obtained in Example 1, Example 2 or Example 3

Corn starch 100 mg

100 mg lactose

Magnesium stearate 2 mg

After mixing the above ingredients, tablets are manufactured by compressing them according to a typical tablet manufacturing method.

Formulation Example 3. Preparation of capsules

Extract powder obtained in Example 1, Example 2 or Example 3

200mg

3 mg crystalline cellulose

Lactose 14.8 mg

Magnesium stearate 0.2 mg

Capsules are prepared by mixing the above ingredients and filling them into gelatin capsules according to a typical capsule manufacturing method.

Formulation Example 4. Preparation of injections

Extract powder obtained in Example 1, Example 2 or Example 3

600mg

Mannitol 180 mg

Sterile distilled water for injection 2974 mg

Na ₂ HPO _4, 12H ₂ O 26 mg

It is prepared with the above ingredients per ampoule according to the usual manufacturing method for injections.

Formulation Example 5. Preparation of liquid formulation

4 g of extract powder obtained in Example 1, Example 2 or Example 3

10 g isomerized sugar

5 g mannitol

Proper amount of purified water

According to the usual liquid preparation method, add and dissolve each ingredient in purified water, add an appropriate amount of lemon flavor, mix the above ingredients, add purified water, adjust the total to 100g by adding purified water, and then fill in a brown bottle and sterilize. to produce a liquid.

Formulation Example 6. Preparation of granules

Extract powder obtained in Example 1, Example 2 or Example 3

1,000 mg

Vitamin mixture dosage

Vitamin A acetate 70 μg

Vitamin E 1.0 mg

Vitamin B1 0.13 mg

Vitamin B2 0.15 mg

Vitamin B6 0.5 mg

Vitamin B12 0.2 ㎍

Vitamin C 10 mg

Biotin 10 μg

Nicotinamide 1.7 mg

Folic acid 50 μg

Calcium pantothenate 0.5 mg

Mineral mixture appropriate amount

Ferrous sulfate 1.75 mg

Zinc oxide 0.82 mg

Magnesium carbonate 25.3 mg

Monobasic Potassium Phosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 90 mg

Calcium carbonate 100 mg

Magnesium chloride 24.8 mg

The composition ratio of the above vitamin and mineral mixture is a mixture of ingredients relatively suitable for granules in a preferred embodiment, but the mixing ratio may be modified arbitrarily. After mixing the above ingredients according to a normal granule manufacturing method, the granules are formed. It can be prepared and used to manufacture a health functional food composition according to a conventional method.

Formulation Example 7. Preparation of functional beverage

Extract powder obtained in Example 1, Example 2 or Example 3

1,000 mg

1,000 mg citric acid

100 g oligosaccharides

2 g plum concentrate

1 g taurine

Add purified water to make a total of 900 mL.

After mixing the above ingredients according to a typical health drink manufacturing method, stirring and heating at 85°C for about 1 hour, the resulting solution was filtered, placed in a sterilized 2 L container, sealed, sterilized, stored in the refrigerator, and then refrigerated. Used for manufacturing the functional beverage composition of the invention.

The composition ratio is a preferred embodiment of mixing ingredients that are relatively suitable for beverages of preference, but the mixing ratio may be arbitrarily modified according to regional and ethnic preferences such as demand class, demand country, and intended use.

The composition for improving, preventing or treating myocardial damage caused by cardiotoxic drugs of the present invention can be used as a food composition, and further as a health functional food or pharmaceutical composition.

Claims

A food composition for improving or preventing myocardial damage, comprising as an active ingredient one or more extracts selected from the group consisting of Cirsium setidens extract, Capsella extract, and Saururus chinensis extract.
The food composition for improving or preventing myocardial damage according to claim 1, wherein the myocardial damage is induced by cardiomyocyte cell death caused by a cardiotoxic drug.
The food composition for improving or preventing myocardial damage according to claim 2, wherein the cardiotoxic drug is an anticancer agent that provides cancer cell damage, cancer cell growth inhibitory activity, or cancer metastasis inhibitory activity.
The food composition for improving or preventing myocardial damage according to claim 3, wherein the anticancer agent is at least one selected from the group consisting of chemical anticancer agents and targeted anticancer agents.
The method of claim 4, wherein the chemical anticancer agent consists of doxorubicin, epirubicin, mitoxantrone, idarubicin, daunorubicin, and valrubicin. selected from the group; The targeted anticancer agents include osmertinib, erlotinib, gefitinib, crizotinib, ceritinib, alectinib, and brigatinib. , bosutinib, dasatinib, imatinib, nilotinib, ponatinib, ibrutinib, cabozantinib, lapatinib ), vandetanib, afatinib, ruxolitiib, tofacitinib, axitinib, lenvatinib, nintedanib, pa Characterized in that it is selected from the group consisting of pazopanib, regorafenib, sorafenib, sunitinib, dasatinib, and axitinib. Food composition for improving or preventing myocardial damage.
The method of claim 1, wherein the one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract are each extracted with water, lower alcohol having 1 to 4 carbon atoms, ethylene glycol, ethyl ether, or a mixed solvent thereof. A food composition for improving or preventing myocardial damage, characterized in that:
The food composition for improving or preventing myocardial damage according to claim 6, wherein the lower alcohol having 1 to 4 carbon atoms is 20 to 80% methanol, ethanol, butanol, or propanol.
A pharmaceutical composition for preventing or treating myocardial damage, comprising as an active ingredient one or more extracts selected from the group consisting of Cirsium setidens extract, Capsella extract, and Saururus chinensis extract.
The pharmaceutical composition for preventing or treating myocardial damage according to claim 8, wherein the myocardial damage is induced by cardiomyocyte cell death caused by a cardiotoxic drug.
The pharmaceutical composition for preventing or treating myocardial damage according to claim 9, wherein the cardiotoxic drug is an anticancer agent that provides cancer cell damage, cancer cell growth inhibitory activity, or cancer metastasis inhibitory activity.
The pharmaceutical composition for preventing or treating myocardial damage according to claim 10, wherein the anticancer agent is at least one selected from the group consisting of chemical anticancer agents and targeted anticancer agents.
The method of claim 11, wherein the chemical anticancer agent is a group consisting of doxorubicin, epirubicin, mitoxantrone, idarubicin, daunorubicin, and valrubicin. is selected from; The targeted anticancer agents include osmertinib, erlotinib, gefitinib, crizotinib, ceritinib, alectinib, and brigatinib. , bosutinib, dasatinib, imatinib, nilotinib, ponatinib, ibrutinib, cabozantinib, lapatinib ), vandetanib, afatinib, ruxolitiib, tofacitinib, axitinib, lenvatinib, nintedanib, pa Characterized in that it is selected from the group consisting of pazopanib, regorafenib, sorafenib, sunitinib, dasatinib, and axitinib. Pharmaceutical composition for preventing or treating myocardial damage.
Anticancer for the prevention of cardiac toxicity caused by anticancer drugs containing at least one extract selected from the group consisting of Korean thistle ( Cirsium setidens ) extract, shepherd's purse ( Capsella ) extract, and Saururus chinensis extract, and an anticancer agent as an active ingredient. Combination drug for treatment.
The method of claim 13, wherein the combination preparation for anticancer treatment is a mixture of at least one extract selected from the group consisting of Korean thistle extract, shepherd's purse extract, and Sambaek extract, and an anticancer agent; A combination preparation for anti-cancer treatment, characterized in that one or more extracts selected from the group consisting of Korean thistle extract, shepherd's purse extract, and P. chinensis extract, and an anti-cancer agent are each formulated and administered simultaneously or sequentially.