WO2024077109A1 - Oligonucléotides antisens unc13a et leurs utilisations - Google Patents

Oligonucléotides antisens unc13a et leurs utilisations Download PDF

Info

Publication number
WO2024077109A1
WO2024077109A1 PCT/US2023/076023 US2023076023W WO2024077109A1 WO 2024077109 A1 WO2024077109 A1 WO 2024077109A1 US 2023076023 W US2023076023 W US 2023076023W WO 2024077109 A1 WO2024077109 A1 WO 2024077109A1
Authority
WO
WIPO (PCT)
Prior art keywords
antisense oligonucleotide
seq
set forth
sequence set
unc13a
Prior art date
Application number
PCT/US2023/076023
Other languages
English (en)
Inventor
Shila MEKHOUBAD
Eric Green
Georgiana MILLER
Ryan MORRIE
Carleton GOOLD
Original Assignee
Maze Therapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Maze Therapeutics, Inc. filed Critical Maze Therapeutics, Inc.
Publication of WO2024077109A1 publication Critical patent/WO2024077109A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • the present disclosure relates in some aspects to compositions and methods of using antisense oligonucleotides targeting the UNC13A cryptic exon locus for increasing UNC13A protein expression.
  • TDP-43 RNA-binding protein TDP-43 from the nucleus of neurons in the brain and spinal cord.
  • TARDBP RNA-binding protein that normally localizes to the nucleus. It plays a role in fundamental RNA processing activities including RNA transcription, alternative splicing, and RNA transport (1).
  • TDP-43 can bind to thousands of premessenger RNA/mRNA targets (2, 3).
  • TDP-43 Reduction in TDP-43 from an otherwise normal adult nervous system alters the splicing or expression levels of more than 1,500 RNAs, including long intron-containing transcripts (2).
  • a major splicing regulatory function of TDP-43 is to repress the inclusion of cryptic exons during splicing (4-7). Unlike normal conserved exons, these cryptic exons are lurking in introns and normally excluded from mature mRNAs. When TDP-43 is depleted from cells, these cryptic exons get spliced into messenger RNAs, often introducing frame shifts and premature termination or even nonsense-mediated decay of the mRNA. However, cryptic splicing events that are key for disease remains to be identified. Thus, the discovery of cryptic splicing targets that are regulated by TDP-43 and also play a role in the pathogenesis of TDP-43 proteinopathies as therapeutic targets is needed. Provided herein are methods and compositions that address such and other needs.
  • ASO antisense oligonucleotides
  • modified ASOs comprising one or more modified nucleotide, for example, a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • methods of using the described ASOs are also provided herein. In some aspects, provided herein is a method for increasing the expression of full-length UNC13A protein in a cell by at least 10%.
  • a method of treating clinical disease for example amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual.
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • pharmaceutical compositions and kits comprising one or more of the ASOs described herein.
  • a method of increasing expression of UNC13A protein in a cell by at least 10% comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1.
  • a method of increasing expression of UNC13A protein in a cell by at least 10% comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • a method of increasing expression of UNC13A protein in a cell by at least 10% comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.
  • the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NO: 20-355, 400-638, 810-957, or 961-1332. [0008] In some embodiments, the antisense oligonucleotide consists of 13 to 25 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • the antisense oligonucleotide consists of 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: l.
  • the antisense oligonucleotide consists of 19, 20, 21, or 22 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. In some embodiments, the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173.
  • the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935.
  • the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199.
  • the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224.
  • the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247.
  • the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.
  • the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271- 1292.
  • antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313.
  • the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945.
  • the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314-1332.
  • the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.
  • the antisense oligonucleotide of the method provided herein is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementary to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementary to the sequence set forth in SEQ ID NO:703.
  • the antisense oligonucleotide of the method provided herein is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof.
  • the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.
  • the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339.
  • the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341.
  • the antisense oligonucleotide is at least at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.
  • the cell prior to contacting the cell with the antisense oligonucleotide, expresses a low level of UNC13A. In some embodiments, comprising measuring the level of UNC13A protein in the cell. In some embodiments, UNC13A protein level is measured by western blot, imaging, ELISA, a fluorescent reporter assay, luminescence assay, or immunohistochemistry.
  • the secondary structure of an UNC13A mRNA is altered by binding of the antisense oligonucleotide to an UNC13A transcript.
  • the antisense oligonucleotide sterically blocks inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide has at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO: 1.
  • the antisense oligonucleotide of the method provided herein restores the expression of UNC13A mRNA in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide of the method provided herein reduces expression of an UNC13A cryptic exon splice variant mRNA by at least 10%. In some embodiments, the antisense oligonucleotide reduces the expression of UNC13A cryptic exon mRNA by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A cryptic exon mRNA expressed in a cell treated with shRNA, miRNA, antisense oligonucleotide targeting TARDBP.
  • the antisense oligonucleotide decreases the expression of UNC13A cryptic exon mRNA in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313.
  • the UNC13A cryptic exon splice variant comprises the sequence set forth in SEQ ID NO:7 or SEQ ID NO:9.
  • the ratio of an UNC13A transcript not comprising the cryptic exon splice variant to an UNC13A transcript comprising the cryptic exon splice variant is at least 10:1.
  • the presence and/or amount of the cryptic exon splice variant is measured using qPCR.
  • the cell is a neuron.
  • the neuron is a motor neuron, a cortical neuron, an interneuron, or an excitatory neuron.
  • contacting the cell with the antisense oligonucleotide of the methods provide herein increases the expression of UNC13A protein to a level sufficient to improve one or more neuronal functions.
  • the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide of the methods provided herein restores the expression of UNC13A protein in a cell to at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A protein in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide of the methods provided herein increases the expression of UNC13A mRNA in a cell by at least 50%, decreases the expression of UNC13A cryptic exon mRNA in the cell by at least 25%, and increases the expression of UNC13A protein in the cell by at least 50%.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.
  • the cell of the methods provided herein is heterozygous or homozygous for a risk allele.
  • the risk allele is selected from the group consisting of rs12608932 (hg38 chr19:17.641,880 A ⁇ C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C ⁇ A ), or any combination thereof.
  • the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • the antisense oligonucleotide is provided to the cell by transfection.
  • the cell expresses a low level of TDP-43 protein.
  • the cell is a human cell or a murine cell.
  • the antisense oligonucleotide of the methods provided herein does not cause any cell morphology changes. In some embodiments, the antisense oligonucleotide does not cause neuronal toxicity. In some embodiments, the antisense oligonucleotide does not bind to a genomic sequence other than the sequence set forth in SEQ ID NO:1.
  • a method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide comprising 13 to 30 nucleotides to the individual, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1, and wherein the individual is homozygous for a reference allele, homozygous for a risk allele, heterozygous for a risk allele or comprises a mutation associated with ALS or FTD.
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A ⁇ C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 A), or any combination thereof.
  • the mutation associated with ALS or FTD is a mutation in TDP43.
  • the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • an antisense oligonucleotide that modulates UNC13A splicing, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.
  • an antisense oligonucleotide that modulates UNC13A splicing comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide comprises a sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in any one of SEQ ID NOs: 700- 703. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703.
  • the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof.
  • the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.
  • the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339.
  • the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.
  • an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide consists of 13-30 nucleotides. In some embodiments, the antisense oligonucleotide consists of 13-25 nucleotides. In some embodiments, the antisense oligonucleotide consists of 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the antisense oligonucleotide consists of 19, 20, 21, or 22 nucleotides. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • an antisense oligonucleotide consisting of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. Also provided herein is an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.
  • the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. In some embodiments, the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173.
  • the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935.
  • the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199.
  • the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224.
  • the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247.
  • the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.
  • the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271- 1292.
  • the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313.
  • the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945.
  • the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314-1332.
  • the antisense oligonucleotide consists of 25 nucleotides that are complementary
  • the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof.
  • the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.
  • the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339.
  • the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341.
  • the antisense oligonucleotide is at least at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide comprises a modification.
  • the 5’ end and/or the 3’ end of the antisense oligonucleotide comprises a modification.
  • 5’ end and the 3’ end of the antisense oligonucleotide comprise a modification, wherein 2, 3, 4, or 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide.
  • at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the nucleotides comprise a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • the modification is a 2’OMe antisense oligonucleotide.
  • composition comprising the antisense oligonucleotide of any one of embodiments disclosed herein.
  • pharmaceutical composition comprises an excipient and/or a buffer.
  • kits comprising the antisense oligonucleotide of some embodiments disclosed herein or the pharmaceutical composition some embodiments disclosed herein.
  • FIG. 1A and FIG. IB show the percent UNC13A mRNA upon treatment with ASO compared to treatment with a control ASO that does not affect UNC13A mRNA in TDP-43 knockdown iPSC-derived motor neurons.
  • UNC13A mRNA was detected using qPCR. Location of the ASO target is plotted in 5’ to 3’
  • FIG. 2A and FIG. 2B show the percent UNC13A mRNA comprising a cryptic exon (CE) upon treatment with ASO compared to treatment with a control ASO that does not affect UNC13A CE mRNA in TDP-43 knockdown iPSC-derived motor neurons.
  • UNC13A CE mRNA was detected using qPCR. Location of the ASO target is plotted in 5’ to 3’
  • FIG. 3A and FIG. 3B show the percent UNC13A mRNA, percent UNC13A mRNA comprising a cryptic exon (CE), and the expression of a control transcript STMN2 which is not targeted by the ASO in TDP-43 knockdown iPSC-derived motor neurons. Location of the ASO target is plotted in 5’ to 3’
  • FIG. 4 shows the percent UNC13A cryptic exon transcript and the percent UNC13A full length transcript for each of the ASOs tested in TDP-43 knockdown iPSC-derived motor neurons.
  • ASO which both reduced UNC13A CE and increased UNC13A full length transcript are shown as squares.
  • FIG. 5A and FIG. 5B are maps of the UNC13A cryptic exon showing the location of active oligos shown in dark grey and inert oligos in light grey.
  • FIG. 5B shows the four identified modulatory regions.
  • FIG. 6A and FIG. 6B show the effect of ASOs on UNC13A expression in TDP43 knockdown iPSC-derived motor neurons.
  • NT non-targeting ASO
  • ASO 434 inert ASO
  • +NT non-targeting shRNA
  • +shTDP43 shRNA to TARDBP.
  • FIG. 6C shows the effect of ASOs on TARDBP expression in iPSC derived motor neurons treated with shRNA to TDP-43 compared to control cells treated with inactive ASO.
  • FIG. 6D shows the effect of ASOs on STMN2 expression iPSC derived motor neurons treated with shRNA to TDP-43 compared to control cells treated with inactive ASO.
  • NT non-targeting ASO
  • ASO 434 inert ASO
  • +NT non-targeting shRNA
  • +shTDP43 shRNA to TARDBP.
  • FIG. 7A shows the effect of ASO 422 on percent UNC13A mRNA expression in iPSC derived motor neurons with TDP-43 knock down in extended culture compared to no ASO or a control ASO that does not target UNC13A.
  • FIG. 7B shows the effect of ASO 422 on UNC13A cryptic exon (CE) in iPSC derived motor neurons with TDP-43 knock down in extended culture compared to no ASO or a control ASO that does not target UNC13A.
  • FIG. 7C shows the effect of ASO 422 on TARDBP expression in iPSC derived motor neurons with TDP-43 knock down in extended culture compared to no ASO or a control ASO that does not target UNC13A.
  • FIG. 8A shows a western blot of UNC13 protein levels in iPSC derived motor neurons with TDP-43 knock down treated with ASOs or a control ASO (432) that does not target UNC13A.
  • FIG. 8B shows the quantitation of UNC13A protein levels determined by western blot.
  • FIG. 9A and FIG. 9B show the percent UNC13A mRNA expression after treatment with varying doses of ASO (0.024-3 pM) compared with a control ASO that does not affect UNC13A mRNA expression.
  • FIG. 9D show the percent of UNC13A mRNA comprising a cryptic exon (CE) after treatment with varying doses of ASO (0.024-3 pM) compared with a control ASO that does not affect UNC13A mRNA expression.
  • FIG. 9E and FIG. 9F show TARDBP and STMN2 expression levels after treatment with varying doses of ASO. Cells were transduced with shRNA against TARDBP or control after ASO delivery. UNC13A, UNC13A CE, STMN2, and TARDBP mRNA expression levels were detected using qPCR.
  • ASO 432 inert ASO; +NT, non-targeting shRNA; +shTDP43, shRNA to TARDBP.
  • FIG. 10A shows the percent UNC13A protein expression for individual ASO treatments at varying concentrations (0.024-3 pM) in iPSC derived motor neurons with TDP-43 knock down.
  • FIG. 10B shows the percent UNC13A protein expression for all the ASO treatment conditions.
  • FIG. 10C shows the rank order of HiBiT signal (UNC13A protein expression) for 3 pM ASO treated neurons.
  • FIG. 10D shows the percent of UNC13A mRNA and UNC13A protein expression for each control and UNC13A splice correcting ASO tested.
  • FIG. 11A shows the percent UNC13A mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in iPSC derived motor neurons with TDP-43 knockdown.
  • FIG. 11B shows the percent UNC13A protein expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression.
  • FIG. 11C shows the percent of UNC13A mRNA and UNC13A protein expression for each control and UNC13A splice correcting ASO tested. Cells were transduced with shRNA against TARDBP or control after ASO delivery.
  • UNC13A, UNC13A CE, STMN2, and TARDBP mRNA expression levels were detected using qPCR.
  • FIG. 12A and FIG. 12B show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in GM25256 (GM) iPSC-derived motor neurons. Cells were transduced with shRNA against TARDBP or control after ASO delivery.
  • FIG. 13A and FIG. 13B show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in NCRM-5 (005) iPSC-derived motor neurons. Cells were transduced with shRNA against TARDBP or control after ASO delivery.
  • FIG. 14A and FIG. 14B show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in NDS00209 (4048) iPSC-derived motor neurons.
  • Cells were transduced with shRNA against TARDBP or control after ASO delivery.
  • FIG. 15A and FIG. 15B show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASO (0.024 pM or 3 pM) compared with a control ASO that does not affect UNC13A mRNA expression in NDS00235 (4157) iPSC-derived motor neurons.
  • Cells were transduced with shRNA against TARDBP or control after ASO delivery.
  • FIG. 16A and FIG. 16B show the cumulative UNC13A and UNC13A CE mRNA expression data from the four iPSC lines (GM, 005, 4048, and 4157).
  • FIGS. 17A-17H show the percent UNC13A mRNA expression (FIG. 17A and FIG. 17B), UNC13A CE mRNA expression (FIG. 17C and FIG. 17D), TARDBP mRNA expression (FIG. 17E and FIG. 17G), and STMN2 mRNA expression (FIG. 17F and FIG. 17H) after extended culturing and multiple doses of UNC13A splice correcting ASOs or a control nontargeting ASO (432) in GM and 005 iPSC-derived motor neurons.
  • GM and 005 cells were treated with gapmer ASOs against TARDBP or a non-targeting control gapmer prior to UNC13A splice correcting ASO dosing.
  • FIG. 18A shows the percent nuclear area of neurons treated with UNC13A splice blocking ASOs.
  • FIG. 18B shows neuronal images after control or ASO treatment.
  • FIGS. 19A-19R show the percent UNC13A and UNC13A CE mRNA expression after treatment with ASOs (3 pM) of different lengths targeting region 2 of UNC13A CE.
  • FIG. 19A 13mer
  • FIG. 19C 15mer
  • FIG. 19E 17mer
  • FIG. 19G 18mer
  • FIG. 19K 20mer
  • FIG. 19M 21mer
  • FIG. 190 22mer
  • FIG. 19Q 24mer
  • FIG. 19B shows percent of UNC13A mRNA expression.
  • FIG. 19B 13mer
  • FIG. 19D 15mer
  • FIG. 19J (19mer
  • FIG. 19L 20mer
  • FIG. 19N 21mer
  • FIG. 19P 22mer
  • FIG. 19R 24mer
  • iPSC- derived motor neurons were transduced with shRNA against TARDBP or control after ASO delivery.
  • FIGS. 20A-20R show the percent of UNC13A and UNC13A CE mRNA expression after treatment with ASOs (3 pM) of different lengths targeting region 4 of UNC13A CE.
  • FIG. 20A 13mer
  • FIG. 20C 15mer
  • FIG. 20E 17mer
  • FIG. 20G 18mer
  • FIG. 201 (19mer)
  • FIG. 20K (20mer
  • FIG. 20M 21mer
  • FIG. 200 22mer
  • FIG. 20Q 24mer
  • FIG. 20B show percent of UNC13A mRNA expression.
  • FIG. 20B 13mer
  • FIG. 20D 15mer
  • FIG. 20J (19mer
  • FIG. 20L 20mer
  • FIG. 20N 21mer
  • FIG. 20P 22mer
  • FIG. 20R 24mer
  • iPSC- derived motor neurons were transduced with shRNA against TARDBP or control after ASO delivery.
  • FIG. 21A shows the average percentage of UNC13A mRNA expression from all cells treated with child ASOs of the indicated length contained within the sequences on the left. Darker shading indicates higher UNC13A mRNA expression.
  • FIG. 21B shows the average difference in percent UNC13A mRNA expression between cells treated with the parent 24-mer ASO indicated on the left and all cells treated with a child ASO of the indicated length contained within the parent sequence. Lighter shading indicates an increase in UNC13A mRNA expression for child ASOs of that length compared to the parent 24-mer, while darker shading indicates a decrease in UNC13A mRNA expression for child ASOs of that length compared to the parent 24- mer. Cells were transduced with shRNA against TARDBP or control after ASO delivery.
  • FIGS. 22A-22B show the effect on UNC13A mRNA expression of ASOs ranging from 13 nucleotide (13-mer) to 24 nucleotide (24-mer) that tile Region 2 (FIG. 22A) and Region 4 (FIG. 22B) in cells transduced with shRNA against TARDBP after ASO delivery.
  • the top portion of the panel plots the average percentage of UNC13A expression for all ASOs overlapping each nucleotide indicated, grouped by ASO length.
  • TDP-43 depletion is associated with a number of neuronal pathologies including ALS and FTD. Depletion of TDP-43 results in incorrect splicing of UNC13A mRNA and inclusion of a cryptic exon between exon 20-21. Inclusion of the UNC13A cryptic exon results in decreased UNC13A protein and is associated with such neuronal pathologies.
  • antisense oligonucleotides that target UNCI 3 mRNA that reduce inclusion of the UNC13A cryptic exon by targeting four regions of the UNC13A mRNA transcript: the 5’ splice donor site, the 3’ splice acceptor site, and two regions located within the cryptic exon itself. The antisense oligonucleotides are able to restore UNC13A expression in neurons and increase the ratio of correctly spliced to incorrectly spliced UNC13A transcript.
  • any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer) or subranges, unless otherwise indicated.
  • Description of a range includes description of each endpoint of the range.
  • nucleic acid or “nucleic acid molecule” or “polynucleotide” refers to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotide, molecules generated, for example, by the polymerase chain reaction (PCR) or by in vitro translation, and molecules generated by any of ligation, scission, endonuclease action, exonuclease action or mechanical action (e.g., shearing).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • oligonucleotide molecules generated, for example, by the polymerase chain reaction (PCR) or by in vitro translation
  • PCR polymerase chain reaction
  • Nucleic acids may be composed of a plurality of monomers that are naturally occurring nucleotides (such as deoxy ribonucleotides and ribonucleotides), analogs of naturally occurring nucleotides (e.g., a-enantiomeric forms of naturally-occurring nucleotides), or a combination of both.
  • Modified nucleotides can have modifications in or replacement of sugar moieties, or pyrimidine or purine base moieties (e.g., morpholino nucleotides).
  • Nucleic acid monomers of the polynucleotides can be linked by phosphodiester bonds or analogs of such linkages.
  • Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, or the like.
  • Nucleic acid molecules can be either single stranded or double stranded.
  • protein or “polypeptide” as used herein refers to a compound made up of amino acid residues that are covalently linked by peptide bonds.
  • the term “protein” may be synonymous with the term “polypeptide” or may refer, in addition, to a complex of two or more polypeptides.
  • a polypeptide may be a fragment.
  • a “fragment” means a polypeptide that is lacking one or more amino acids that are found in a reference sequence.
  • a fragment can comprise a binding domain, antigen, or epitope found in a reference sequence.
  • a fragment of a reference 5 polypeptide can have at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of amino acids of the amino acid sequence of the reference sequence.
  • isolated means that a material, complex, compound, or molecule is removed from its original environment (e.g., the natural environment if it is naturally occurring).
  • a naturally occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the co existing materials in the natural system, is isolated.
  • Such nucleic acid could be part of a vector and/or such nucleic acid or polypeptide could be part of a composition (e.g., a cell lysate), and still be isolated in that such vector or composition is not part of the natural environment for the nucleic acid or polypeptide.
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region "leader and trailer” as well as intervening sequences (introns), if present, between individual coding segments (exons).
  • recombinant or “genetically engineered” refers to a cell, microorganism, nucleic acid molecule, polypeptide or vector that has been genetically modified by human intervention.
  • a recombinant polynucleotide is modified by human or machine introduction of an exogenous or heterologous nucleic acid molecule, or refers to a cell or microorganism that has been altered by human or machine intervention such that expression of an endogenous nucleic acid molecule or gene is controlled, deregulated or constitutive.
  • Human generated genetic alterations may include, for example, modifications that introduce nucleic acid molecules (which may include an expression control element, such as a promoter) that encode one or more proteins or enzymes, or other nucleic acid molecule additions, deletions, substitutions, or other functional disruption of or addition to a cell's genetic material or encoded products.
  • exemplary human or machine introduced modifications include those in coding regions or functional fragments thereof of heterologous or homologous polypeptides from a reference or parent molecule.
  • a “wild-type” gene or gene product is that which is most frequently observed in a population and is thus arbitrarily designed the “normal” or “reference” or “wildtype” form of the gene.
  • mutation refers to a change in the sequence of a nucleic acid molecule or polypeptide molecule as compared to a reference or wild-type nucleic acid molecule or polypeptide molecule, respectively.
  • a mutation can result in several different types of change in sequence, including substitution, insertion or deletion of nucleotide(s) or amino acid(s).
  • a “conservative substitution” refers to amino acid substitutions that do not significantly affect or alter binding characteristics of a particular protein. Generally, conservative substitutions are ones in which a substituted amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Conservative substitutions include a substitution found in one of the following groups: Group 1 : Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T); Group 2: Aspartic acid (Asp or D), Glutamic acid (Glu or Z); Group 3: Asparagine (Asn or N), Glutamine (Gin or Q); Group 4: Arginine (Arg or R), Lysine (Lys or K), Histidine (His or H); Group 5: Isoleucine (He or I), Leucine (Leu or L), Methionine (Met or M), Valine (Vai or V); and Group 6: Phenylalanine (Phe or F), Tyrosine (Tyr or Y), Tryptophan (Trp or W).
  • Group 1 Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T);
  • Group 2 Aspartic acid
  • amino acids can be grouped into conservative substitution groups by similar function, chemical structure, or composition (e.g., acidic, basic, aliphatic, aromatic, or sulfur-containing).
  • an aliphatic grouping may include, for purposes of substitution, Gly, Ala, Vai, Leu, and He.
  • Other conservative substitutions groups include: sulfur- containing: Met and Cysteine (Cys or C); acidic: Asp, Glu, Asn, and Gin; small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gin; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, He, Vai, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Additional information can be found in Creighton (1984) Proteins, W.H. Freeman and Company.
  • expression refers to the process by which a polypeptide is produced based on the encoding sequence of a nucleic acid molecule, such as a gene.
  • the process may include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post-translational modification, or any combination thereof.
  • Sequence identity refers to the percentage of nucleotides (amino acid residues) in one sequence that are identical with the nucleotides (amino acid residues) in another reference polynucleotide (polypeptide) sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • the percentage sequence identity values can be generated using the NCBI BLAST2.0 software as defined by Altschul et al. (1997) "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402, with the parameters set to default values.
  • UNC13A refers to a presynaptic protein found in central and neuromuscular synapses that regulates the release of neurotransmitters, peptides, and hormones.
  • UNC13A reference or wild type mRNA transcript contains 44 exons encoding a 1,703 amino acid protein.
  • NCBI Reference Sequence: NP_001073890.2 (SEQ ID NO: 11) is an example of a wild type or reference UNC13A protein.
  • NCBI Reference Sequence NM_001080421.3 (SEQ ID NO:1) is an example of a wild-type or reference UNC13A mRNA transcript.
  • UNC13A includes all forms of UNC13A including wild type, splice isoforms, variants, mutants, native conformation, misfolded, and post- translationally modified. In embodiments, UNC13A does not include UNC13A cryptic exon splice variant.
  • pre-processed mRNA or “pre-mRNA” or “precursor mRNA” refers to a primary transcript synthesized from transcription of a DNA template and that has not undergone processing, e.g., splicing, addition of 5’ cap, and addition of a 3’ poly A tail, in order to become a mature mRNA.
  • the mature mRNA is capable of being translated into protein by the ribosome.
  • the term “cryptic exon” or “pseudoexon” refers to an exon that is absent or not detectably used in wild-type pre-mRNA but are selected in a variant isoform, Cryptic exons may arise as a result of mutations that create new splice sites or remove the existing binding sites for splicing repressors. Cryptic exons can also emerge from transposable elements (e.g., Alu elements).
  • UNC13A cryptic exon splice variant refers to a mRNA, or protein encoded by said mRNA, that comprises a cryptic exon between exon 20 and exon 21.
  • the cryptic exon is obtained from intron 20-21 of the UNC13A gene.
  • the cryptic exon has the nucleotide sequence of SEQ ID NO:5 or SEQ ID NO:6.
  • the UNC13A cryptic exon splice variant may have the nucleotide sequence of SEQ ID NO:7, encoding a protein sequence of SEQ ID NO:8, or the nucleotide sequence of SEQ ID NO:9, encoding a protein sequence of SEQ ID NO: 10.
  • transactivation response element DNA-binding protein 43 or “TAR-DNA binding protein-43” or “TDP-43” refers to a protein of typically 414 amino acid residues encoded by TARDBP, as well as the mRNA transcript for TARDBP. In certain instances mRNA encoded by the TARDBP gene is referred to herein as TDP-43. In embodiments, wild type TDP-43 amino acid sequence is provided by Uniprot Accession number Q13148 (SEQ ID NO:378).
  • TDP-43 includes all forms of TDP-43 including wild type, splice isoforms, variants, mutants, native conformation, misfolded, and post- translationally modified (e.g., ubiquitinated, phosphorylated, acetylated, sumoylated, or cleaved into C-terminal fragments) proteins.
  • post- translationally modified e.g., ubiquitinated, phosphorylated, acetylated, sumoylated, or cleaved into C-terminal fragments
  • TAR-DNA binding protein-43 proteinopathy or “TDP-43 proteinopathy” refers to a neurodegenerative disease that is characterized by the deposition of TDP-43 positive protein inclusions in the brain and/or spinal cord of subjects.
  • Cytoplasmic inclusions of hyperphosphorylated, ubiquitinated, cleaved form of TDP-43 are a pathological feature of diseases including but not limited to amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial onset sensory and motor neuronopathy (FOSMN), hippocampal sclerosis (HS), limbic-predominant age-related TDP-43 encephalopathy (LATE), cerebral age-related TDP-43 with sclerosis (CARTS), Guam Parkinson-dementia complex (G-PDC), Guan ALS (G- ALS), Multisystem proteinopathy (MSP), Perry disease, Alzheimer's disease (AD), and chronic traumatic encephalopathy (CTE).
  • ALS amyotrophic lateral sclerosis
  • FTLD primary lateral sclerosis
  • PMA progressive muscular atrophy
  • FOS progressive muscular atrophy
  • FOS progressive muscular atrophy
  • complementarity refers to polynucleotides (i.e., a sequence of nucleotides) related by the base-pairing rules. For example, the sequence “A-G-T,” is complementary to the sequence “T-C-A.” Complementarity may be “partial,” in which only some of the nucleic acids’ bases are matched according to the base pairing rules, or there may be “complete” or “total” complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.
  • some embodiments can include one or more but preferably 6, 5, 4, 3, 2, or 1 mismatches with respect to the target nucleic acid (e.g., RNA). Variations at any location within the oligomer are included. In certain embodiments, variations in sequence near the termini of an oligomer are generally preferable to variations in the interior, and if present are typically within about 6, 5, 4, 3, 2, or 1 nucleotides of the 5’ and/or 3’ terminus.
  • target nucleic acid e.g., RNA
  • antisense oligomer or “antisense compound” or “antisense oligonucleotide” or “oligonucleotide” are used interchangeably and refer to a short, singlestranded polynucleotide (e.g., 10-50 subunits) made up of DNA, RNA or both, that hybridizes to a target sequence in a nucleic acid (typically an RNA) by Watson-Crick base pairing, to form a nucleic acid: oligomer heteroduplex within the target sequence.
  • a nucleic acid typically an RNA
  • An antisense oligonucleotide may comprise unmodified nucleotides or may contain modified nucleotides, non natural nucleotides, or analog nucleotides, such as morpholino, phosphorothioate, peptide nucleic acid, LNA, 2'-O-Me RNA, 2'F-RNA, 2'-O-MOE-RNA, 2'F-ANA, or any combination thereof.
  • Such an antisense oligomer can be designed to block or inhibit translation of mRNA or to inhibit natural pre-mRNA splice processing, or induce degradation of targeted mRNAs, and may be said to be “directed to” or “targeted against” a target sequence with which it hybridizes.
  • the target sequence is a region surrounding or including an AUG start codon of an mRNA, a 3’ or 5’ splice site of a pre processed mRNA, or a branch point.
  • the target sequence may be within an exon or within an intron or a combination thereof.
  • the target sequence for a splice site may include an mRNA sequence having its 5’ end at 1 to about 25 base pairs downstream of a normal splice acceptor junction in a preprocessed mRNA.
  • An exemplary target sequence for a splice site is any region of a preprocessed mRNA that includes a splice site or is contained entirely within an exon coding sequence or spans a splice acceptor or donor site.
  • An oligomer is more generally said to be “targeted against” a biologically relevant target such as, in the present disclosure, a human UNC13A gene pre-mRNA encoding the UNC13A protein, when it is targeted against the nucleic acid of the target in the manner described above.
  • Exemplary targeting sequences include those listed in Tables 2-5.
  • oligonucleotide analog refers to an oligonucleotide having (i) a modified backbone structure, e.g., a backbone other than the standard phosphodiester linkage found in natural oligo- and polynucleotides, and (ii) optionally, modified sugar moieties, e.g., morpholino moieties rather than ribose or deoxyribose moieties.
  • Oligonucleotide analogs support bases capable of hydrogen bonding by Watson-Crick base pairing to standard polynucleotide bases, where the analog backbone presents the bases in a manner to permit such hydrogen bonding in a sequence-specific fashion between the oligonucleotide analog molecule and bases in a standard polynucleotide (e.g., single-stranded RNA or single-stranded DNA).
  • a standard polynucleotide e.g., single-stranded RNA or single-stranded DNA.
  • Exemplary analogs are those having a substantially uncharged, phosphorus containing backbone.
  • a "modified nucleotide” is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide).
  • an antisense oligonucleotide (ASO) contains one or more modified nucleotides. In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the nucleotides are modified.
  • Modified nucleotides include, but are not limited to, deoxynucleotides, nucleotide mimics, abasic nucleotides (represented herein as x or ab), 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides (represented herein as invdn, invn, invn, invx), nonnatural basecomprising nucleotides, bridged nucleotides, peptide nucleic acids, 2', 3 'seco nucleotide mimics (unlocked nucleobase analogues, represented herein as nuna or nuna), locked nucleotides (represented herein as nlna or nlna), 3'-o-methoxy (2' intemucleotide linked) nucleotides (represented herein as 3'-omen), 2'-f-arabino nucleotides (represented herein as nfana or nfana), morph
  • 2'-modified nucleotides include, but are not limited to, 2'omethyl nucleotides (represented herein as a lower case letter 'n 1 in a nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented herein as nf, also represented herein as 2'-fluoro nucleotide), 2'-deoxy nucleotides (represented herein as dn), 2'-methoxyethyl (2'-o-2-methoxylethyl) nucleotides (represented herein as nm or 2'-moe), 2'- amino nucleotides, and 2'-alkyl nucleotides.
  • 2'omethyl nucleotides represented herein as a lower case letter 'n 1 in a nucleotide sequence
  • 2'-deoxy-2'-fluoro nucleotides represented herein as nf, also represented herein as 2'-fluoro nucleot
  • a “subunit” of an oligonucleotide refers to one nucleotide (or nucleotide analog) unit comprising a purine or pyrimidine base pairing moiety.
  • the term may refer to the nucleotide unit with or without the attached intersubunit linkage, although, when referring to a “charged subunit”, the charge typically resides within the intersubunit linkage (e.g., a phosphate or phosphorothioate linkage or a cationic linkage).
  • the purine or pyrimidine base pairing moiety also referred to herein simply as a “nucleobases,” “base,” or “bases,” may be adenine, cytosine, guanine, uracil, thymine or inosine.
  • bases such as pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimell5thoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5 -methylcytidine), 5 -alkyluridines (e.g., ribothymidine), 5- halouridine (e.g., 5 -bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g.
  • modified bases in this aspect is meant nucleotide bases other than adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), as illustrated above; such bases can be used at any position in the antisense molecule.
  • Ts and Us are interchangeable. For instance, with other antisense chemistries such as 2’-O-methyl antisense oligonucleotides that are more RNA-like, the T bases may be shown as U.
  • targeting sequence is the sequence in the oligomer or oligomer analog that is complementary (meaning, in addition, substantially complementary) to the “target sequence” in the RNA genome.
  • the entire sequence, or only a portion, of the antisense oligomer may be complementary to the target sequence.
  • about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 may be targeting sequences that are complementary to the target region.
  • the targeting sequence is formed of contiguous bases in the oligomer, but may alternatively be formed of noncontiguous sequences that when placed together, e.g., from opposite ends of the oligomer, constitute sequence that spans the target sequence.
  • a “targeting sequence” may have “near” or “substantial” complementarity to the target sequence and still function for the purpose of the present disclosure, that is, still be “complementary.”
  • the oligomer analog compounds employed in the present disclosure have at most one mismatch with the target sequence out of 10 nucleotides, and preferably at most one mismatch out of 20.
  • the antisense oligomers employed have at least 90% sequence identity, and preferably at least 95% sequence identity, with the exemplary targeting sequences as designated herein.
  • amino acid subunit or “amino acid residue” can refer to an a-amino acid residue ( CO CHR-NH-) or a [ ⁇ - or other amino acid residue (e.g., -CO-(CH2)nCHR-NH-), where R is a side chain (which may include hydrogen) and n is 1 to 7, preferably 1 to 4.
  • Naturally occurring amino acid refers to an amino acid present in proteins found in nature, such as the 20 (L)-amino acids utilized during protein biosynthesis as well as others such as 4-hydroxyproline, hydroxy lysine, desmosine, isodesmosine, homocysteine, citrulline and ornithine.
  • non-natural amino acids refers to those amino acids not present in proteins found in nature, examples include beta-alanine ([3- Ala), 6- aminohexanoic acid (Ahx) and 6 aminopentanoic acid.
  • non-natural amino acids include, without limitation, (D)-amino acids, norleucine, norvaline, p- fluorophenylalanine, ethionine and the like, which are known to a person skilled in the art.
  • target sequence refers to a portion of the target RNA against which the oligonucleotide or antisense agent is directed, that is, the sequence to which the oligonucleotide will hybridize by Watson-Crick base pairing of a complementary sequence.
  • the target sequence may be a contiguous region of a pre-mRNA that includes both intron and exon target sequence.
  • the target sequence will consist exclusively of either intron or exon sequences.
  • Target and targeting sequences are described as “complementary” to one another when hybridization occurs in an antiparallel configuration.
  • a targeting sequence may have “near” or “substantial” complementarity to the target sequence and still function for the purpose of the present disclosure, that is, it may still be functionally “complementary.”
  • an oligonucleotide may have at most one mismatch with the target sequence out of 10 nucleotides, and preferably at most one mismatch out of 20.
  • an oligonucleotide may have at least 90% sequence identity, and preferably at least 95% sequence identity, with the exemplary antisense targeting sequences described herein.
  • An oligonucleotide “specifically hybridizes” to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions, with a Tm substantially greater than 45°C, preferably at least 50°C, and typically 60°C-80°C or higher. Such hybridization preferably corresponds to stringent hybridization conditions. At a given ionic strength and pH, the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide. Again, such hybridization may occur with “near” or “substantial” complementarity of the antisense oligomer to the target sequence, as well as with exact complementarity.
  • a “nuclease-resistant” oligomeric molecule refers to one whose backbone is substantially resistant to nuclease cleavage, in non-hybridized or hybridized form; by common extracellular and intracellular nucleases in the body; that is, the oligomer shows little or no nuclease cleavage under normal nuclease conditions in the body to which the oligomer is exposed.
  • an “effective amount” or “therapeutically effective amount” refers to an amount of therapeutic agent, such as an UNC13A cryptic splice variant inhibitor, administered to a mammalian subject, either as a single dose or as part of a series of doses, which is effective to produce a desired therapeutic effect. For an antisense oligonucleotide, this effect is typically brought about by inhibiting translation or natural splice-processing of a selected target sequence.
  • An “effective amount,” targeted against UNC13A cryptic exon splice variant mRNA also relates to an amount effective to modulate expression of UNC13A cryptic exon splice variant protein.
  • inhibitor refers to an alteration, interference, reduction, down regulation, blocking, suppression, abrogation or degradation, directly or indirectly, in the expression, amount or activity of a target gene, target protein, or signaling pathway relative to (1) a control, endogenous or reference target or pathway, or (2) the absence of a target or pathway, wherein the alteration, interference, reduction, down regulation, blocking, suppression, abrogation or degradation is statistically, biologically, or clinically significant.
  • inhibitor or “inhibitor” includes gene “knock out” and gene “knock down” methods, such as by chromosomal editing.
  • Treatment of an individual or a cell is any type of intervention provided as a means to alter the natural course of a disease or pathology in the individual or cell.
  • Treatment includes, but is not limited to, administration of, e.g., a pharmaceutical composition, and may be performed either prophylactically, or subsequent to the initiation of a pathologic event or contact with an etiologic agent.
  • Treatment includes any desirable effect on the symptoms or pathology of a disease or condition associated with inflammation, among others described herein.
  • prophylactic treatments which can be directed to reducing the rate of progression of the disease or condition being treated, delaying the onset of that disease or condition, or reducing the severity of its onset.
  • Treatment or “prophylaxis” does not necessarily indicate complete eradication, cure, or prevention of the disease or condition, or associated symptoms thereof.
  • the present disclosure provides novel UNC13A targeting oligonucleotides that reduce cryptic splice variants that includes a cryptic exon between exons 20 and 21. These cryptic exons are absent from wild type UNC13A from neuronal nuclei and not present in any of the known isoforms of UNC13A. The cryptic exons are obtained from intron 20-21 of the UNC13A gene (SEQ ID NO:4).
  • the chr19: 17642541 3’ splicing acceptor which is more frequently used than the chr19: 17642591 3’ splicing acceptor, and alternative 5’ splicing donor results in a 128 bp cryptic exon having a nucleotide sequence as set forth in SEQ ID NO:5 (“cryptic exon #1”).
  • the UNC13A cryptic exon #1 variant comprises a nucleotide sequence as set forth in SEQ ID NO:7, encoding a protein comprising an amino acid sequence as set forth in SEQ ID NO:8.
  • the chr19: 17642591 3’ splicing acceptor and alternative 5’ splicing donor results in a 179 bp cryptic exon having a nucleotide sequence as set forth in SEQ ID NO:6 (“cryptic exon #2”).
  • the UNC13A cryptic exon #2 variant comprises a nucleotide sequence as set forth in SEQ ID NO:9, encoding a protein comprising an amino acid sequence as set forth in SEQ ID NO: 10.
  • UNC13A cryptic exon #1 splice variant expression level is significantly increased in frontal cortexes of frontotemporal lobar degeneration with TDP-43 inclusions (FTLD-TDP) patients compared to normal controls.
  • UNC13A cryptic exon #1 splice variant has also been detected in disease relevant tissues of ALS patients.
  • expression of UNC13A cryptic splice variant #1 or UNC13A cryptic splice variant #2 may be used as a biomarker for identifying a subject with a TDP-43 proteinopathy, e.g., FTLD or ALS.
  • TDP-43 becomes depleted from the nucleus and accumulates in the cytoplasm, it becomes phosphorylated.
  • Hyperphosphorylated TDP-43 (pTDP-43) is a key feature of pathology of TDP-43 proteinopathies.
  • UNC13A cryptic exon #1 splice variant is strongly associated with phosphorylated TDP-43 levels in FTD/ALS patients.
  • expression of UNC13A cryptic splice variant #1 or UNC13A cryptic splice variant #2 may be used as a biomarker for phosphorylated TDP-43 level in a subject.
  • UNC13A genetic mutations that increase cryptic exon inclusion are associated with decreased survival in FTD- ALS patients.
  • identification of a genetic mutation in intron 20-21 of UNC13A in a subject may be used as a biomarker for UNC13A cryptic exon inclusion.
  • identification of a genetic mutation in intron 20-21 of UNC13A in a subject with a TDP-43 proteinopathy e.g., FTD, ALS
  • FTD FTD, ALS
  • the cryptic exon is obtained from intron 20-21 of the UNC13A gene.
  • the cryptic exon comprises SEQ ID NO:5 or SEQ ID NO:6.
  • the UNC13 cryptic exon splice variant comprises a polynucleotide sequence of SEQ ID NO:7 or SEQ ID NO:9.
  • the UNC13A cryptic exon splice variant comprises the amino acid sequence of SEQ ID NO: 8 or SEQ ID NO: 10.
  • the ASOs decrease the level of the UNC13A cryptic exon splice variant.
  • the antisense oligonucleotide comprises an inhibitory nucleic acid.
  • the inhibitory nucleic acid may be an antisense oligonucleotide, siRNA, shRNA, miRNA, double-stranded RNA (dsRNAs), or esiRNA.
  • the inhibitory nucleic acid comprises an antisense oligonucleotide that is complementary to: the exon 20 splice donor site region in a preprocessed mRNA encoding UNC13A; the cryptic exon splice acceptor site region in a preprocessed mRNA encoding UNC13A; the cryptic exon splice donor site region in a preprocessed mRNA encoding UNC13A; or the exon 21 splice acceptor site region in a preprocessed mRNA encoding UNC13A.
  • the exon 20 splice donor site region comprises or consists of SEQ ID NO: 800.
  • the cryptic exon splice acceptor site region comprises or consists of SEQ ID NO:801. In embodiments, the cryptic exon splice donor site region comprises or consists of SEQ ID NO:802. In embodiments, the exon 21 splice acceptor site comprises or consists of SEQ ID NO:803.
  • the antisense oligonucleotide selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant over full length UNC13A (wild type) or other variants thereof (i. e. , variants that do not contain a cryptic exon from intron 20-21 such as SEQ ID NO:5 or SEQ ID NO:6).
  • Table 2B Additional antisense oligonucleotide sequences
  • the antisense oligonucleotides (ASOs) provided herein are alternatively referred to by the sequence ID number and ASO number provided in Table 2A and Table 2B.
  • the ASO number MTx_ASO_(number) and just the number are used interchangeably.
  • MTx_ASO_280 is alternatively referred to as ASO 280.
  • the ASO number refers to a region that is targeted by a respective ASO.
  • MTx_ASO_Region_4_Child_l targets region 4 (SEQ ID NO:703) of the cryptic exon as described herein.
  • the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-40.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20-40.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355 or SEQ ID NO: 810-957.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20-355 or SEQ ID NO: 810-975. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355 or SEQ ID NO: 400-638 or SEQ ID NO: 810-957 .
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20-355 or SEQ ID NO: 400-638 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NOs: 20-355, 400-638, 810-959, or 961- 1332.
  • the antisense oligonucleotide is about 13-50 bases in length, for example, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 5’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 1 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:700. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20 or SEQ ID NO: 38.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 20 or SEQ ID NO: 38 In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the cryptic 5’ donor site splice.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 5’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 1 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:700. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 41- 55 or SEQ ID NO: 810-825.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises or consists of a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 41- SEQ ID NO: 55 or SEQ ID NO: 810-825.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the cryptic 5’ donor site splice.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 5’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 1 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:700. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 311- 325 or SEQ ID NO: 910-929.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises or consists of a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to anyone of SEQ ID NO: 311- 325 or SEQ ID NO: 910-929.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the cryptic 5’ donor site splice.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 34 -37.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises or consists of a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 34-37. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 251-265 or SEQ ID NO: 877-890.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 251-265 or SEQ ID NO: 877-890. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 266 -280 or SEQ ID NO: 891-894.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 266-280 or SEQ ID NO: 891-894. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites.
  • the antisense oligonucleotide targets region 2 of the UNC13A mRNA.
  • the antisense oligonucleotide is complementary to SEQ ID NO:701.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 281 -295 or SEQ ID NO: 895-899.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 281-295 or SEQ ID NO: 895-899. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 296 -310 or SEQ ID NO: 900-909.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 296-310 or SEQ ID NO: 900-909. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA or region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701 or 702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 40.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 40. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA or region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701 or 702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 341-355 or SEQ ID NO: 934-957.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 341- 355 or SEQ ID NO: 934-957. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the middle region of the cryptic exon of the UNCI 3 mRNA located between the 5’ and 3’ splice sites. In some embodiments, the antisense oligonucleotide targets region 2 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 1116-1332.
  • the antisense oligonucleotide is about 13-50 bases in length, for example, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 1116-1332.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A mRNA expression.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 30-33. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 21 - 31, SEQ ID NO: 33, or SEQ ID NO: 39.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 191-205 or SEQ ID NO: 851-860.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 191- 205 or SEQ ID NO: 851-860. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structures of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA.
  • the antisense oligonucleotide targets region 3 of the UNC13A mRNA.
  • the antisense oligonucleotide is complementary to SEQ ID NO:702.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 206-220 or SEQ ID NO: 861-863.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 206- 220 or SEQ ID NO: 861-863. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 221-234 or SEQ ID NO: 864-866.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 221- 225 or SEQ ID NO: 864-866. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 3 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:702. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 236- 250 or SEQ ID NO: 867-876.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 236- 250 or SEQ ID NO: 867-876. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 21-29, or SEQ ID NO:39.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 21-29 or SEQ ID NO:39. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 56-70 or SEQ ID NO: 826-834.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 56-70 or SEQ ID NO: 826-834. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 71-85 or SEQ ID NO: 835-837.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 71-85 or SEQ ID NO: 835-837. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 86-100. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 86-100.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO: 703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 101-115. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 101-115.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 116-130. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 116-130.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 131-145. In some embodiments the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 131-145.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 56-70.
  • the antisense oligonucleotide is about 146-160 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 146-160. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 161-175 or SEQ ID NO: 838-840.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 161- 175 or SEQ ID NO: 838-840. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 176-190 or SEQ ID NO: 841-850.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 176- 190 or SEQ ID NO: 841-850. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 326-340 or SEQ ID NO: 930-933.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 326- 340 or SEQ ID NO: 930-933. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to SEQ ID NO:703. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NOs: 961-1115.
  • the antisense oligonucleotide is about 13-50 bases in length, for example, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide comprises a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or 100% identical to any one of SEQ ID NOs: 961-1115.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A mRNA expression.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligonucleotide is complementary to the 3’ end of the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide targets region 1, 2, 3, or 4 of the UNC13A mRNA. In some embodiments the antisense oligonucleotide is complementary to any of SEQ ID NO: 700-703. In some embodiments the antisense oligonucleotide is complementary to the cryptic exon of the UNCI 3 mRNA. In some embodiments, the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 400-638 .
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases. In some embodiments the antisense oligonucleotide comprises a sequence that is at least 80%, 85%, 90%, 95%, 97%, or 100% identical to any one of SEQ ID NO: 400-638. In some embodiments, the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • the antisense oligo has least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 100% complementarity to any one of SEQ ID NO: 5- 10 or SEQ ID NO: 700-703.
  • the antisense oligonucleotide is about 15-50 bases in length preferably 16 bases, 17 bases, 18 bases, 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, 24 bases or 25 bases.
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the antisense oligonucleotide blocks the inclusion of the cryptic exon through steric blocking of either the cryptic 5’ donor site splice or the 3’ cryptic acceptor site.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by modulating the rate of RNA polymerase II.
  • the antisense oligonucleotide may block inclusion of the cryptic exon by modifying the structure of the mRNA.
  • the antisense oligonucleotides may block inclusion of the cryptic exon by other known or unknown mechanisms capable of blocking inclusion of the cryptic exon.
  • the antisense oligonucleotide increases UNC13A protein expression.
  • the antisense oligonucleotide decreases inclusion of an UNC13A cryptic exon.
  • an antisense oligonucleotide that modulates UNC13A splicing, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.
  • the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO: 1.
  • the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO: 701 or 703.
  • the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:700. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:700. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:700. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:701.
  • the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:702. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:702.
  • the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO: 703. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:703.
  • the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703.
  • the antisense oligonucleotide is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene, where the sequence of UNC13A is uniquely sensitive to antisense oligonucleotide binding.
  • a region of the UNC13A mRNA is identified as being more responsive than other regions. Herein, it is determined that these regions are sensitive to a number of factors, including but not limited to, antisense oligonucleotide length, composition, and positioning on the UNC13A mRNA.
  • Minimal regions of the UNC13A mRNA are specifically targeted to maximize antisense oligonucleotide activity in modulating UNC13A mRNA splicing. In some embodiments, these highly responsive minimal regions of the UNC13A mRNA are referred to as hot spots.
  • a minimal region of the UNC13A mRNA is located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene is identified as highly responsive to binding with an antisense oligonucleotide, or another similar nucleic acid probe.
  • an ASO that binds to such minimal region is effective for preventing inclusion of the UNC13A cryptic exon.
  • the minimal region is between 3 to 30, 4 to 26, 5 to 22, 6 to 18, 7 to 14, or 8 to 10 nucleotides in length.
  • the minimal region is no more than 30, no more than 25, no more than 20, or no more than 15 nucleotides in length. In some embodiments, the minimal region is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the minimal region is 18 nucleotides in length. In some embodiments, the minimal region is 29 nucleotides in length. In some embodiments, the minimal region comprises the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1339 or a portion thereof.
  • the minimal region comprises the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, binding the small region or a portion thereof with an antisense oligonucleotide results in enhanced splice modulation activity. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A mRNA expression.
  • binding the minimal region or a portion thereof with an antisense oligonucleotide results in decreased UNC13A cryptic exon mRNA expression. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A protein expression.
  • Table 3 Minimal targeting regions of the UNC13A mRNA
  • the antisense oligonucleotide comprises 13 to 30 nucleotides, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof.
  • the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.
  • the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.
  • the antisense oligonucleotide is complementary to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340.
  • the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.
  • binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in enhanced UNC13A splice modulation activity.
  • binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in increased UNC13A mRNA expression.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%. In some embodiments, the expression of UNC13A mRNA is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion results in decreased UNC13A cryptic exon mRNA expression.
  • the expression of UNC13A cryptic exon mRNA is decreased in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%.
  • the expression of UNC13A cryptic exon mRNA is decreased in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313.
  • a wild-type cell is one from an individual who does not have amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • a wild-type cell is a cell that expresses a normal level of TDP-43 protein.
  • a wild-type cell is a cell that does not produce transcripts of UNC13A comprising the cryptic exon.
  • antisense oligonucleotides comprising the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of between 13 to 30, 15 to 28, 17 to 26, 19 to 24, or 21 to 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 25 nucleotides.
  • the antisense oligonucleotide comprises or consists of 13, 15, 17, 18, 19, 20, 21, 22, or 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19, 20, 21, or 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of at least 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, or 13 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13 nucleotides.
  • the antisense oligonucleotide comprises or consists of 15 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 17 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 18 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 20 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 21 nucleotides.
  • the antisense oligonucleotide comprises or consists of 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 25 nucleotides.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the antisense oligonucleotide comprises 13 nucleobases that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145. In some embodiments, the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116- 1145.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173. In some embodiments, the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935.
  • the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199.
  • the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxy ethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224.
  • the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247.
  • the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.
  • the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.
  • the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxy ethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313.
  • the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945.
  • the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314-1332.
  • the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946- 951, 1104-1115, and 1314-1332.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.
  • the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a locked nucleic acid (LNA) antisense oligonucleotide.
  • a 2’OMe antisense oligonucleotide a 2’ O-Methoxyethyl antisense oligonucleotide
  • a phosphorothioate antisense oligonucleotide a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • the antisense oligonucleotide comprises a modification.
  • the 5’ end and/or the 3’ end of the antisense oligonucleotide comprises a modification.
  • the 5’ end or the 3’ end of the antisense oligonucleotide comprise a modification.
  • the 5’ end and the 3’ end of the antisense oligonucleotide comprise a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the modification is a 2’OMe antisense oligonucleotide.
  • the 5’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified. In some embodiments, wherein the 5’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified.
  • the 3’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide.
  • the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification
  • at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the modification is a 2’OMe antisense oligonucleotide.
  • the antisense oligonucleotide comprises a modification, and at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the nucleotides comprise a modification. In some embodiments, between 30% and 100%, 40% and 90%, 50% and 80%, or 60% and 70% of the nucleotides comprise a modification. In some embodiments, about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the nucleotides comprise a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the modification is a 2’OMe antisense oligonucleotide.
  • the antisense oligonucleotide contains one or more modified nucleotide, for example, a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide) including, but not limited to deoxynucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides, non-natural basecomprising nucleotides, bridged nucleotides, peptide nucleic acids, 2', 3 '- ⁇ seco nucleotide mimics, locked nucleotides, 3'-O-Methoxy nucleotides, 2'-F-Arabino nucleotides, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, and vinyl phosphonate nucleotides, 2'-'O-methyl nucleotide, 2'-
  • the antisense oligonucleotide is a modified antisense oligonucleotide.
  • the modified antisense oligonucleotide comprises a phosphoramidate morpholino oligonucleotide, phosphorodiamidate morpholino oligonucleotide, phosphorothioate modified oligonucleotide, 2’ O-methyl (2’ O-Me) modified oligonucleotide, peptide nucleic acid (PNA), locked nucleic acid (LNA), phosphorodithioate oligonucleotide, 2’ O-Methoxyethyl (2’ -MOE) modified oligonucleotide, 2’-fluoro-modified oligonucleotide, 2'0,4'C-ethylene-bridged nucleic acid (ENAs), tricyclo-DNA, tricyclo-DNA phosphorothioate nucle
  • the modification of the antisense oligonucleotide increases stability of the oligonucleotide, efficacy of decreasing the inclusion of the cryptic exon, or efficiency in decreasing the inclusion of the cryptic exon. In some embodiments, the modification of the antisense oligonucleotide improves delivery of the oligonucleotide to the UNCI 3 mRNA molecule.
  • the ASO comprises a modification that enhances the pharmacokinetic or biodistribution properties of an ASO trigger or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate.
  • binding of a group to a cell or cell receptor may initiate endocytosis.
  • a modification can be monovalent, divalent, trivalent, tetravalent, or have higher valency.
  • Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules.
  • the modification comprises modifications of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs) or hybrids thereof.
  • RNAs ribonucleic acids
  • DNAs deoxyribonucleic acids
  • TAAs threose nucleic acids
  • GNAs glycol nucleic acids
  • PNAs peptide nucleic acids
  • LNAs locked nucleic acids
  • the ASO comprises a modified sugar moiety.
  • the ASO comprises a sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents.
  • morpholines are modified, by adding or altering various substituent groups from the above morpholino structure.
  • the ASO comprises modified variants of nucleosides that maintain proper base pairing.
  • the ASOs comprises modified A. modified C, modified G or modified U.
  • modified ASOs comprise modified C such as 5- methylcytosine, or 5 -hydroxymethylcytosine, modified U such as 5 -methykmdme or replacement with thymine, or modified A such as Ne-meihyladenine.
  • the ASO may comprise a mixture of non-modified and modified nucleosides.
  • the ASO comprises a modified mtemucleotiside linkage.
  • backbone phosphate groups are modified by replacing one or more of the oxygen atoms with a different substituent
  • the backbone is formed from m RNA (alternating phosphate and ribose), LNA (locked nucleic acid), tcDNA (tn-cyclo DMA), cEt (constrained ethyl bridged nucleic acid); ENA (ethylene-bridged nucleic acid), I-INA (hexitol nucleic acids), TNA (threose nucleic acid), PMO (phosphorodi ami date morpholino oligomer) PMO, PNA (peptide nucleic acid), 2-OMe-RNA, 2'-O-methoxyethyl (MOE) nucleic acids, or 2- O-(2-methylcarbomoyl (MCE) nucleotides, or any combination thereof.
  • the antisense oligonucleotide is used in a method of treatment or the manufacture of a medicament for use in treating, wherein the antisense oligonucleotide is administered to a patient in need to increase the expression of UNC13A mRNA.
  • the expression of UNC13A mRNA is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%.
  • the expression of UNC13A mRNA is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A mRNA is increased in a cell by about 100%, about 200%, about 300%, about 400%, or about 500%.
  • the antisense oligonucleotide increases the expression of UNC13A protein in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide restores the expression of UNC13A mRNA in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, restores the expression of UNC13A protein in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide is used in a method of treatment or the manufacture of a medicament for use m treating, wherein the antisense oligonucleotide is administered to a patient in need to decrease the expression of UNC13A cryptic exon mRNA.
  • the expression of UNC13A cryptic exon mRNA is decreased in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%.
  • the expression of UNC13A cryptic exon mRNA is decreased in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A cryptic exon mRNA is decreased in a cell by about 10%, about 20%, about 30%, about 40%, or about 50%.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide reduces the expression of UNC13A cryptic exon mRNA by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A cryptic exon mRNA expressed in a cell treated with shRNA targeting TARDBP.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313.
  • the antisense oligonucleotide is used in a method of treatment or the manufacture of a medicament for use in treating, wherein the antisense oligonucleotide is administered to a patient in need to increase the expression of UNC13A protein.
  • the expression of UNC13A protein is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%.
  • the expression of UNC13A protein is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased in a cell by about 100%, about 200%, about 300%, about 400%, or about 500%.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide is used in a method of treatment or the manufactme of a medicament for use in treating, wherein the antisense oligonucleotide is administered to a patient in need to increase the expression of UNC13A protein to a level sufficient to improve one or more neuronal functions.
  • the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide improves 1, 2, 3, 4, 5, or 6 neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide improves at least 1, at least 2, at least 3, at least 4, or at least 5 neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313.
  • the antisense oligonucleotide restores the expression of UNC13A protein in a cell to at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide increases UNC13A mRNA expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after contacting the cell with the ASO. In some embodiments, the antisense oligonucleotide is provided to the cell in multiple doses. In some embodiments, the antisense oligonucleotide increases UNC13A mRNA expression about about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after administration of the ASO. In some embodiments, the antisense oligonucleotide increases UNC13A mRNA expression such that the UNC13A expression is fully restored after administration of the ASO.
  • the antisense oligonucleotide decreases UNC13A cryptic exon mRNA expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after contacting the cell with the ASO. In some embodiments, the antisense oligonucleotide is provided to the cell in multiple doses. In some embodiments, the antisense oligonucleotide decreases UNC13A cryptic exon mRNA expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after administration of the ASO.
  • the antisense oligonucleotide decreases UNC13A cryptic exon mRNA expression such that the UNC13A cryptic exon expression is completely reduced after administration of the ASO.
  • the antisense oligonucleotide increase UNC13A protein expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after contacting the cell with the ASO.
  • the antisense oligonucleotide is provided to the cell in multiple doses.
  • the antisense oligonucleotide increase UNC13A protein expression about 4 days, about 8 days, about 12 days, about 16 days, about 20 days, about 24 days after administration of the ASO. In some embodiments, the antisense oligonucleotide increase UNC13A protein expression such that the increase UNC13A protein expression is completely restored after administration of the ASO.
  • the antisense oligonucleotide is provided to a cell, wherein the cell is a human cell or a murine cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a murine cell. In some embodiments, the antisense oligonucleotide is provided to a cell, wherein the cell is a neuron. In some embodiments, the cells is a human neuron. In some embodiments, the cell is a murine neuron. In some embodiments, the neuron is a motor neuron, a cortical neuron, or an excitatory neuron. In some embodiments, the cell is heterozygous or homozygous for a risk allele.
  • the risk allele is selected from the group consisting of rs12608932 (hg38 chr19:17.641,880 A ⁇ C rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C ⁇ A), or any combination thereof.
  • the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide is provided to a cell, wherein the cell is a human cell.
  • the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • the mutation is a mutation in the TDP-43 protein.
  • the mutation in the TDP-43 protein is G298S.
  • the mutation in the TDP-43 protein is A382T.
  • the cell comprises a single nucleotide polymorphism (SNP).
  • the SNP is associated with the UNC13A protein.
  • the SNP is a risk allele, wherein the cell is heterozygous or homozygous for the risk allele.
  • the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A ⁇ C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G). rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C ⁇ A), or any combination thereof.
  • the risk allele is rs12973192 (hg38 chr19: 17,642,430 C ⁇ G).
  • the antisense oligonucleotide is provided to a cell comprising a SNP, wherein the SNP is rs12973192 (hg38 chr19: 17,642,430 C ⁇ G).
  • the cell is selected from the group consisting of GM25256 (GM or GM line), NDS00262 (005 or 005 line), NDS00209 (4048 or 4048 line), and NDS00235 (4157 or 4157 line).
  • the cell is a healthy cell selected from the group consisting of GM25256 (GM or GM line) and NDS00262 (005 or 005 line).
  • the cell is a cell comprising a mutation in the TDP-43 protein selected from the group consisting of NDS00209 (4048 or 4048 line) and NDS00235 (4157 or 4157 line).
  • the cell is NDS00209 (4048 or 4048 line), wherein the mutation in the TDP- 43 protein is G298S.
  • the cell is NDS00235 (4157 or 4157 line), wherein the mutation in the TDP-43 protein is A382T.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide is active in one or more iPSC neurons. In some embodiments, the antisense oligonucleotide is active in multiple regardless iPSC neurons having different genetic backgrounds, disease mutations, or UNC13A SNP status. In some embodiments, the antisense oligonucleotide is active in multiple regardless iPSC neurons having different genetic backgrounds, disease mutations, and UNC13A SNP status. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide is provided to a cell, wherein the cell expresses a low level of TDP-43 protein. In some embodiments, the cell expresses less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or less than 1% TDP-43 protein. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. [0194] In some embodiments, the antisense oligonucleotide is provided to the cell by transfection. In some embodiments, the antisense oligonucleotide is provided to the cell by other delivery methods known in the art.
  • the antisense oligonucleotide does not cause any cell morphology changes. In some embodiments, the antisense oligonucleotide does not cause neuronal toxicity. In some embodiments, the antisense oligonucleotide does not bind to a genomic sequence other than the sequence set forth in SEQ ID NO: 1. In some embodiments, the antisense oligonucleotide does not have off-target effects. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide described herein decreases the expression of UNC13A cryptic exon mRNA. In some instances, this reduction of UNC13A cryptic exon mRNA alone is not indicative of upregulation of full length UNC13A mRNA. In some instances, the antisense oligonucleotide interferes with proper splicing of the intron.
  • the antisense oligonucleotide occupies an overlapping region with other antisense oligonucleotide described herein.
  • two antisense oligonucleotides that target adjacent and/or overlapping regions of the UNC13A mRNA have different activities, wherein a first antisense oligonucleotide is active and a second antisense oligonucleotide is inactive.
  • the two antisense oligonucleotides that target adjacent and/or overlapping regions of the UNC13A mRNA are of the same nucleotide length or different nucleotide length.
  • a single nucleotide shift in targeting sequence effects the ability of the antisense oligonucleotide to block the splicing machinery. In some instances, a single nucleotide shift in targeting sequence results in distinctly different antisense oligonucleotide activities, wherein a first antisense oligonucleotide is active and a second antisense oligonucleotide is inert.
  • antisense oligonucleotides described herein consisting of at least 18 nucleotides are the more active.
  • antisense oligonucleotides consisting of at least 20 nucleotides are the most potent, in particular antisense oligonucleotides consisting of 20, 21, or 22 nucleotides.
  • select antisense oligonucleotides consisting of 13 to 17 nucleotides, in particular 13 or 15 nucleotides are active. In some embodiments, this is indicative of a minimal region that needs to be blocked to have the desired effect. This highlights the importance of antisense oligonucleotides of both positioning on the UNC13A mRNA and length for optimal performance.
  • the antisense oligonucleotide is provided to a cell for an extended period of time. In some instances, the antisense oligonucleotide restore UNC13A levels to those of a wild-type cell.
  • the cell is a neurons from one or more different iPSC lines, for example GM25256 (GM or GM line) and NDS00262 (005 or 005 line).
  • the disclosure provides pharmaceutical compositions comprising an UNC13A cryptic exon splice variant specific inhibitor as described herein and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with cells and/or tissues without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • the term "pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function.
  • a pharmaceutically acceptable material, composition or carrier such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the cell or tissue being contacted.
  • the dosage for any one patient depends upon many factors, including the patient's size, weight, body surface area, age, the level of UNC13A cryptic exon splice variant specific inhibitor required to achieve a therapeutic effect, stability of the UNC13A cryptic exon splice variant specific inhibitor, specific disease being treated, stage of disease, sex, time and route of administration, general health, and other drugs being administered concurrently.
  • compositions may be administered in a manner appropriate to the disease or condition to be treated (or prevented) as determined by persons skilled in the medical art.
  • An appropriate dose and a suitable duration and frequency of administration of the compositions will be determined by such factors as the health condition of the patient, size of the patient (i.e. , weight, mass, or body area), the type and severity of the patient's disease, the particular form of the active ingredient, and the method of administration.
  • an appropriate dose and treatment regimen provide the composition(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit (such as described herein, including an improved clinical outcome, such as more frequent complete or partial remissions, or longer disease-free and/or overall survival, or a lessening of symptom severity).
  • a dose should be sufficient to prevent, delay the onset of, or diminish the severity of a disease associated with disease or disorder.
  • Prophylactic benefit of the compositions administered according to the methods described herein can be determined by performing pre-clinical (including in vitro and in vivo animal studies) and clinical studies and analyzing data obtained therefrom by appropriate statistical, biological, and clinical methods and techniques, all of which can readily be practiced by a person skilled in the art.
  • compositions may be administered by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subpial, intraparenchymal, intrastriatal, intracranial, intracistemal, intra-cerebral, intracerebral ventricular, intraocular, intraventricular, intralumbar, subcutaneous, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), mucosal, nasal, bucal, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol.
  • enteral e.g., oral
  • parenteral intravenous, intramuscular, intra-arterial, intramedullary
  • intrathecal subpial, intraparenchymal
  • compositions are directly injected into the CNS of the subject.
  • direct injection into the CNS is intracerebral injection, intraparenchymal injection, intrathecal injection, subpial injection, or any combination thereof.
  • direct injection into the CNS is direct injection into the cerebrospinal fluid (CSF) of the subject, optionally wherein the direct injection is intracistemal injection, intraventricular injection, and/or intralumbar injection.
  • CSF cerebrospinal fluid
  • the antisense oligonucleotides provided herein have a number of beneficial properties that make them useful for increasing UNC13A protein expression, reducing inclusion of UNC13A cryptic exon inclusion and treating neurodegenerative diseases, as further described below.
  • UNC13A protein expression is increased by at least 10% following contacting the cell with the antisense oligonucleotide. In some embodiments, UNC13A protein expression is increased by at least 20%, at least 30%, at least 40%, at least 50%, or at least 75% compared to the level before contact with the antisense oligonucleotide.
  • UNC13A expression is increased by at least 1.1, at least 1.2, at least 1.3, at least 1.5, at least 1.5 or at least 2 fold compared to the level before contact with the antisense oligonucleotide. In some embodiments, the amount of full length UNC13A protein is increased. In some embodiments, the ASO targets regions 1-4 of the UNC13A mRNA transcript, identified herein. In some embodiments, the ASO targets region 2 or 3 of the UNC13A mRNA transcript.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide has a modification. [0207] In some embodiments, UNC13A protein expression is increased to a normal level following contacting the cell with the antisense oligonucleotide.
  • UNC13A protein expression is increased to the level of an individual who does not have a mutation in TDP-43. In some embodiments, UNC13A protein expression is increased to the level of an individual who does not have a decrease in TDP-43 protein expression. In some embodiments, UNC13A protein expression is increased to the level of an individual who does not have a risk allele associated with ALS or FTD. In some embodiments, UNC13A expression is increased to the level of an individual who does not have ALS or FTD.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20- 355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide has a modification.
  • the cell prior to contacting the cell with the antisense oligonucleotide the cell has a low level of UNC13A protein expression.
  • the cell has a mutation in TDP-43, or a decrease in expression of TDP-43 protein.
  • the cell has a level of UNC13A protein expression that is associated with a TDP- 43 proteinopathy.
  • the cell has a level of UNC13A protein that is associated with a risk allele associated with ALS or FTD.
  • the cell has a level of UNC13A that is associated with ALS or FTD.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide has a modification.
  • the cell prior to contacting the cell with the antisense oligonucleotide the cell has a reduced level of UNC13A protein expression compared to a normal or wild-type cell.
  • a normal cell is one that does not have a mutation in TDP-43, has a normal level of expression of TDP-43 protein level, does not have a risk allele associated with ALS or FTD and/or is not obtained from an individual with ALSO or FTD.
  • the cell has an undetectable level of UNC13A protein expression prior to contacting with the ASO.
  • the cell expresses less than 80%, less than 70%, less than 60%, or less than 50% of the normal level of UNC13A protein.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide has a modification.
  • provided herein is a method of increasing expression of UNC13A protein in a cell by at least 10%, comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • a method of increasing expression of UNC13A protein in a cell by at least 10% comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.
  • the antisense oligonucleotide that modulates UNC13A has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.
  • the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO:1. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO: 1.
  • the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO: 701 or 703.
  • the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID N0:700. In some embodiments, the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID N0:700. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID N0:700. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:701.
  • the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:702.
  • the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:703.
  • the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO:703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:703.
  • the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NOs: 700-703. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703.
  • the methods provided herein comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene, where the sequence of UNC13A is uniquely sensitive to antisense oligonucleotide binding.
  • a region of the UNC13A mRNA is identified as being more responsive than other regions.
  • these regions are sensitive to a number of factors, including but not limited to, antisense oligonucleotide length, composition, and positioning on the UNC13A mRNA.
  • Minimal regions of the UNC13A mRNA are specifically targeted to maximize antisense oligonucleotide activity in modulating UNC13A mRNA splicing.
  • these highly responsive minimal regions of the UNC13A mRNA are referred to as hot spots.
  • a minimal region of the UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene is identified as highly responsive to binding with an antisense oligonucleotide, or another similar nucleic acid probe.
  • an ASO that binds to such minimal region is effective for preventing inclusion of the UNC13A cryptic exon.
  • the minimal region is between 3 to 30, 4 to 26, 5 to 22, 6 to 18, 7 to 14, or 8 to 10 nucleotides in length.
  • the minimal region is no more than 30, no more than 25, no more than 20, or no more than 15 nucleotides in length. In some embodiments, the minimal region is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the minimal region is 18 nucleotides in length. In some embodiments, the minimal region is 29 nucleotides in length. In some embodiments, the minimal region comprises the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1339 or a portion thereof.
  • the minimal region comprises the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, binding the small region or a portion thereof with an antisense oligonucleotide results in enhanced splice modulation activity. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A mRNA expression.
  • binding the minimal region or a portion thereof with an antisense oligonucleotide results in decreased UNC13A cryptic exon mRNA expression. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A protein expression.
  • the methods provided herein comprise contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339- 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof.
  • the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.
  • the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to 1, 2,
  • the antisense oligonucleotide is complementary to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.
  • the antisense oligonucleotide is complementary to 2, 3,
  • the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340.
  • the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.
  • the methods provided herein comprise contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in enhanced UNC13A splice modulation activity. In some embodiments, binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in increased UNC13A mRNA expression.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%.
  • the expression of UNC13A mRNA is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion results in decreased UNC13A cryptic exon mRNA expression.
  • the expression of UNC13A cryptic exon mRNA is decreased in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%.
  • the expression of UNC13A cryptic exon mRNA is decreased in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • a wild-type cell is one from an individual who does not have amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • a wild-type cell is a cell that expresses a normal level of TDP-43 protein.
  • a wild-type cell is a cell that does not produce transcripts of UNC13A comprising the cryptic exon.
  • kits for increasing expression of UNC13A protein in a cell by at least 10% comprising contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides.
  • the antisense oligonucleotide comprises or consists of between 13 to 30, 15 to 28, 17 to 26, 19 to 24, or 21 to 23 nucleotides.
  • the antisense oligonucleotide comprises or consists of 13 to 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13, 15, 17, 18, 19, 20, 21, 22, or 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19, 20, 21, or 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of at least 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, or 13 nucleotides.
  • the antisense oligonucleotide comprises or consists of 13 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 15 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 17 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 18 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 20 nucleotides.
  • the antisense oligonucleotide comprises or consists of 21 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 25 nucleotides.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides.
  • the antisense oligonucleotide comprises a modification.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides.
  • the antisense oligonucleotide comprises a modification.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145.
  • the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173.
  • the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266,
  • the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199.
  • the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024
  • the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225-1247.
  • the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225- 1247.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.
  • the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’0Me antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.
  • the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293- 1313.
  • the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945.
  • the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942-945.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951
  • the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314- 1332.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wildtype cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271- 1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953
  • the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888- 890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248- 1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the methods of increasing expression of UNC13A protein in a cell by at least 10% described herein comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a modification.
  • the 5’ end and/or the 3’ end of the antisense oligonucleotide comprises a modification.
  • the 5’ end or the 3’ end of the antisense oligonucleotide comprise a modification.
  • the 5’ end and the 3’ end of the antisense oligonucleotide comprise a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the modification is a 2’OMe antisense oligonucleotide.
  • the 5’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified. In some embodiments, wherein the 5’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified.
  • the 3’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide.
  • the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification
  • at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide.
  • the modification is selected from the group consisting of a 2’0Me antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the modification is a 2’0Me antisense oligonucleotide.
  • the method of increasing expression of UNC13A protein in a cell by at least 10% comprises contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a modification, and at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the nucleotides comprise a modification. In some embodiments, between 30% and 100%, 40% and 90%, 50% and 80%, or 60% and 70% of the nucleotides comprise a modification.
  • the nucleotides comprise a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the modification is a 2’OMe antisense oligonucleotide.
  • the method provided herein further comprises measuring the level of UNC13A protein in the cell.
  • UNC13A protein level is measured by western blot, ELISA, immune blot, immunohistochemistry, a fluorescent reporter assay, a luminescence assay, imagining, or other methods known in the art.
  • the protein level is measured prior to contacting the cell with the ASO and/or following contacting the cell with the ASO.
  • contacting the cell with the oligonucleotide comprises administering the oligonucleotide to an individual. In some embodiments, contacting the cell with the oligonucleotide comprises incubating a cell with the oligonucleotide. In some embodiments, the cell is cultured with the oligonucleotide. In some embodiments, the ASO is provided via gymnotic delivery.
  • provided herein is a method of treating ALS or FTD comprising administering an ASO provided herein and increasing UNC13A protein expression level.
  • a method of treating ALSO or FTD comprising administering an ASO provided herein and increasing the ratio of full length UNC13A transcript to UNC13A transcript comprising the cryptic exon.
  • the method comprises increasing UNC13A mRNA expression.
  • the method comprises reducing the level of UNC13A transcript comprising the cryptic exon.
  • the method increases the level of UNC13A protein is increased by blocking inclusion of a cryptic exon.
  • the UNC13A protein level is increased by reducing the amount of inclusion of a cryptic exon, which results in a lower amount of full length UNC13A protein.
  • the ASO sterically blocks inclusion of the UNC13A cryptic exon.
  • the ASO binds to the UNC13A cryptic exon and alters its secondary structure, resulting in exclusion of the cryptic exon from the UNC13A transcript.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961- 1332. In some embodiments, the antisense oligonucleotide has a modification.
  • the method reduces inclusion of the cryptic exon by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% compared to the level before contacting the cell with the ASO. In some embodiments, the method reduces inclusion of the cryptic exon by about 30% to about 80%, about 30%, to about 70%, about 30% to about 50%, about 60% to about 80%, or about 50% to about 80% compared to the level before contacting the cell with the ASO. In some embodiments, the method reduces inclusion of the cryptic exon to an undetectable level.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide has a modification.
  • the ASO selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant over full length UNC13A (wild type) or other variants thereof (i.e., variants that do not contain a cryptic exon from intron 20-21.)
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide has a modification.
  • the methods increase the ratio of full length UNC13A transcript that does not comprise the cryptic exon to transcript comprising the cryptic exon.
  • the ratio of full length UNC13A transcript that does not comprise the cryptic exon to transcript comprising the cryptic exon is at least about 1 : 1, at least about 2: 1, at least about 4: 1, at least about 10: 1, at least about 20: 1, at least about 50: 1, or at least about 100: 1 following contacting the cell with the ASO.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090- 1103, 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, and 1090-1103. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide has a modification.
  • the UNC13A cryptic exon splice variant specific inhibitor selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant over full length UNC13A (wild type) or other variants thereof.
  • the antisense oligonucleotide comprises or consists of a sequence set forth in SEQ ID NO: 20-355, or SEQ ID N0:20-40, or SEQ ID NO:41-355 or SEQ ID NO: 810-957.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide has a modification.
  • the methods of the present disclosure reduces UNC13A cryptic splice variant expression or activity in a cell by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% at least 95% or more in a cell compared to the expression level of UNC13A cryptic splice variant in a cell that has not been contacted with the ASO.
  • the methods of the present disclosure reduces UNC13A cryptic splice variant expression or activity in a cell by 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20- 95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, 40- 50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50- 90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70- 95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% compared to the expression level of UNC13A
  • the methods of the present disclosure reduces UNC13A cryptic splice variant expression or activity in the CNS of a subject by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% at least 95% or more in the CNS compared to the expression level of UNC13A cryptic splice variant in the CNS of an untreated subject.
  • the methods of the present disclosure reduces UNC13A cryptic splice variant expression or activity in the CNS of a subject by 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90%, 10-95%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20- 90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30- 100%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50- 80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70- 90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% compared to the expression level of UNC13
  • the presence, absence, or amount of the UNC13A cryptic exon is measured or detected by PCR (such as by qPCR). In some embodiments, the UNC13A cryptic exon is measured or detected by fluorescence in situ hybridization or Northern Blot.
  • the cell expresses a low level of TDP-43 protein. In some embodiments cell expresses a low level of TDP-protein in comparison to a normal or wildtype cell. In some embodiments, a normal cell is one that does not have a mutation in TDP-43, has a normal level of expression of TDP-43 protein level, does not have a risk allele associated with ALS or FTD and/or is not obtained from an individual with ALSO or FTD. In some embodiments, the cell has an undetectable level of TDP-43 protein expression prior to contacting with the ASO. In some embodiments, the cell expresses less than 80%, less than 70%, less than 60%, or less than 50% of the normal level of TDP-43 protein.
  • the methods of the present disclosure comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%.
  • the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the antisense oligonucleotide increases the expression of UNC13A mRNA in a cell by about 100%, about 200%, about 300%, about 400%, or about 500%. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide restores the expression of UNC13A mRNA in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, restores the expression of UNC13A protein in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.
  • the methods of the present disclosure comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide decreases the expression of UNC13A cryptic exon mRNA in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the antisense oligonucleotide decreases the expression of UNC13A cryptic exon mRNA in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • the antisense oligonucleotide decreases the expression of UNC13A cryptic exon mRNA in a cell by about 10%, about 20%, about 30%, about 40%, or about 50%.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide reduces the expression of UNC13A cryptic exon mRNA by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A cryptic exon mRNA expressed in a cell treated with shRNA targeting TARDBP.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the methods of the present disclosure comprise contacting the cell with an antisense oligonucleotide, wherein the antisense oligonucleotide increases the expression of UNC13A protein in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%.
  • the antisense oligonucleotide increases the expression of UNC13A protein in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the antisense oligonucleotide increases the expression of UNC13A protein in a cell by about 100%, about 200%, about 300%, about 400%, or about 500%. In some embodiments, the antisense oligonucleotide increases the expression of UNC13A protein in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell.
  • the antisense oligonucleotide increases the expression of UNC13A protein in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the method comprises contacting the cell with an antisense oligonucleotide, wherein contacting the cell with the antisense oligonucleotide increases the expression of UNC13A protein to a level sufficient to improve one or more neuronal functions.
  • restoration of UNC13A protein to at least 50% of normal levels is likely to improve neuronal function and benefit ALS and FTD patients with reduced TDP43 and UNC13A levels.
  • the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide improves 1, 2, 3, 4, 5, or 6 neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide improves at least 1, at least 2, at least 3, at least 4, or at least 5 neuronal functions selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide restores the expression of UNC13A protein in a cell to at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, restores the expression of UNC13A protein in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.
  • the methods of the present disclosure comprise providing the antisense oligonucleotide to a cell, wherein the cell is a human cell or a murine cell.
  • the cell is a human cell.
  • the cell is a murine cell.
  • the antisense oligonucleotide is provided to a cell, wherein the cell is a neuron.
  • the cells is a human neuron.
  • the cell is a murine neuron.
  • the neuron is a motor neuron, a cortical neuron, or an excitatory neuron.
  • the cell is heterozygous or homozygous for a risk allele.
  • the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A ⁇ C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C ⁇ A), or any combination thereof.
  • the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the methods of the present disclosure comprise providing the antisense oligonucleotide to a cell, wherein the cell is a human cell.
  • the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • the mutation is a mutation in the TDP-43 protein.
  • the mutation in the TDP-43 protein is G298S. In some embodiments, the mutation in the TDP-43 protein is A382T. In some embodiments, the cell comprises a single nucleotide polymorphism (SNP). In some embodiments, the SNP is associated with the UNC13A protein. In some embodiments, the SNP is a risk allele, wherein the cell is heterozygous or homozygous for the risk allele.
  • SNP single nucleotide polymorphism
  • the risk allele is selected from the group consisting of rs12608932 (hg38 chr19:17.641,880 A— >C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C ⁇ A), or any combination thereof.
  • the risk allele is rs 12973192 (hg38 chr19: 17,642,430 C ⁇ G).
  • the antisense oligonucleotide is provided to a cell comprising a SNP, wherein the SNP is rs12973192 (hg38 chr19: 17,642,430 C ⁇ G).
  • the cell is selected from the group consisting of GM25256 (GM or GM line), NDS00262 (005 or 005 line), NDS00209 (4048 or 4048 line), and NDS00235 (4157 or 4157 line).
  • the cell is a healthy cell selected from the group consisting of GM25256 (GM or GM line) and NDS00262 (005 or 005 line).
  • the cell is a cell comprising a mutation in the TDP-43 protein selected from the group consisting of NDS00209 (4048 or 4048 line) and NDS00235 (4157 or 4157 line).
  • the cell is NDS00209 (4048 or 4048 line), wherein the mutation in the TDP-43 protein is G298S.
  • the cell is NDS00235 (4157 or 4157 line), wherein the mutation in the TDP- 43 protein is A382T.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide of the methods described herein is active in one or more iPSC neurons. In some embodiments, the antisense oligonucleotide is active in multiple regardless iPSC neurons having different genetic backgrounds, disease mutations, or UNC13A SNP status. In some embodiments, the antisense oligonucleotide is active in multiple regardless iPSC neurons having different genetic backgrounds, disease mutations, and UNC13A SNP status. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.
  • the methods of the present disclosure comprise providing the antisense oligonucleotide to a cell, wherein the cell expresses a low level of TDP-43 protein. In some embodiments, the cell expresses less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, or less than 1% TDP-43 protein.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide is provided to the cell by transfection. In some embodiments, the antisense oligonucleotide is provided to the cell by other delivery methods known in the art.
  • the methods of the present disclosure comprise providing the antisense oligonucleotide to a cell, wherein the antisense oligonucleotide that is provided to the cell does not cause any cell morphology changes. In some embodiments, the antisense oligonucleotide does not cause neuronal toxicity. In some embodiments, the antisense oligonucleotide does not bind to a genomic sequence other than the sequence set forth in SEQ ID NO:1. In some embodiments, the antisense oligonucleotide does not have off-target effects. In some embodiments, the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the cell is a mammalian cell. In some embodiments, the cell is a murine or human cell. In some embodiments, the cell is a neuron. In some embodiments, the cell is a cortical neuron, a motor neuron, or an excitatory neuron. In some embodiments, the cell engages in neuronal signaling. In some embodiments, prior to contacting the cell with the ASO, the cell has reduced neuronal function such as reduced or impaired neuronal signaling, abnormal neurite length or morphology, reduced or aberrant action potential, or reduced or aberrant neurotransmitter release. In some embodiments, the cell is an iPSC derived motor neuron.
  • the cell is an animal cell, such as a human, cow, horse, sheep, lamb, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit or guinea pig.
  • the animal can be a mammal, such as a non-primate and a primate (e.g., monkey and human).
  • a patient is a human, such as a human infant, child, adolescent or adult.
  • contacting the cell with the ASO comprises incubation with a composition the ASO.
  • contacting the cell with the ASO comprises transduction or transfection with a virus or plasmid encoding the ASO.
  • the cell is within an individual In embodiments, the individual has been identified as having a UNC13A gene mutation in intron 20-21.
  • the UNC13 gene mutation comprises rs12608932 (hg38 chr19: 17.641,880 A— >C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0- 2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C ⁇ A), or any combination thereof.
  • the cell is within an non-human animal, such as cow, horse, sheep, lamb, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, primate, or guinea pig-
  • an non-human animal such as cow, horse, sheep, lamb, pig, chicken, turkey, quail, cat, dog, mouse, rat, rabbit, primate, or guinea pig-
  • the method improves or restores one or more neuronal functions in a cell. In some embodiments, the method improves, neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • the ASO targets regions 1-4 of the UNC13A mRNA transcript (SEQ ID NOs: 700-703).
  • the ASO comprises or consists of the sequence set forth in SEQ ID NO: 20-355 or SEQ ID NO: 400-638 or SEQ ID NO: 810-957.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the ASO is a modified oligonucleotide.
  • the ASO comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the individual has a TDP-43 proteinopathy.
  • the TDP-43 proteinopathy comprises amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), facial onset sensory and motor neuronopathy (FOSMN), hippocampal sclerosis (HS), limbic-predominant age-related TDP-43 encephalopathy (LATE), cerebral age-related TDP-43 with sclerosis (CARTS), Guam Parkinson-dementia complex (G-PDC), Guan ALS (G- ALS), Multisystem proteinopathy (MSP), Perry disease, Alzheimer's disease (AD), and chronic traumatic encephalopathy (CTE), or a combination thereof.
  • ALS amyotrophic lateral sclerosis
  • FTLD frontotemporal lobar degeneration
  • PLS primary lateral sclerosis
  • PMA progressive muscular atrophy
  • FOS progressive muscular atrophy
  • FOS progressive muscular atrophy
  • FOS
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • a method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide comprising 13 to 30 nucleobases that are complementary to the sequence set forth in SEQ ID NO: 1 to the individual, wherein the individual is homozygous for a reference allele, homozygous for a risk allele, heterozygous for a risk allele or comprises a mutation associated with ALS or FTD.
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A ⁇ C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats ⁇ 3-3 CATC repeats), and rs62121687 (hg38 chr19: 17,642,351 C ⁇ A), or any combination thereof.
  • the mutation associated with ALS or FTD is a mutation in TDP43.
  • the mutation in the TDP-43 protein is G298S.
  • the mutation in the TDP-43 protein is A382T.
  • the cell comprises a single nucleotide polymorphism (SNP).
  • the SNP is associated with the UNC13A protein.
  • the SNP is a risk allele, wherein the cell is heterozygous or homozygous for the risk allele.
  • the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A ⁇ C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C ⁇ A), or any combination thereof.
  • the risk allele is rs12973192 (hg38 chr19: 17,642,430 C ⁇ G).
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332, as describe in the present disclosure.
  • the modification is a 2’OMe antisense oligonucleotide.
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell.
  • the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • the expression of UNC13A cryptic exon mRNA is decreased in the cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A protein expressed in a wild-type cell.
  • the expression of UNC13A protein is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A protein expressed in a wild-type cell. In some embodiments, the expression of UNC13A protein is increased in the cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%. In some embodiments, wherein the antisense oligonucleotide is provided to a cell, the expression of UNC13A protein is increased to a level sufficient to improve one or more neuronal functions.
  • the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313. In some embodiments, the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059- 1074, 1075-1089, and 1090-1103.
  • the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1248-1270, 1271-1292, and 1293-1313.
  • the antisense oligonucleotide comprises a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • a wild-type cell is one from an individual who does not have amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • a wild-type cell is a cell that expresses a normal level of TDP-43 protein.
  • a wild-type cell is a cell that does not produce transcripts of UNC13A comprising the cryptic exon.
  • the method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO:1.
  • the antisense oligonucleotide has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% complementarity to the sequence set forth in SEQ ID NO: 1.
  • the method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 700-703.
  • the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 701 or 703.
  • the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO: 701 or 703.
  • the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO: 701 or 703. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:700. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:700. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:700.
  • the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:701. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:701. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:702.
  • the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:702. In some embodiments, the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NO:703. In some embodiments, the antisense oligonucleotide has at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% complementarity to the sequence set forth in SEQ ID NO:703. In some embodiments, the antisense oligonucleotide is completely complementarity to the sequence set forth in SEQ ID NO:703.
  • the method of treating amyotrophic lateral sclerosis comprises:
  • ALS ALS
  • FTD frontal temporal dementia
  • the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NOs: 700-703.
  • the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701.
  • the antisense oligonucleotide comprises at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703.
  • the methods provided herein for treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprise administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene, where the sequence of UNC13A is uniquely sensitive to antisense oligonucleotide binding.
  • a region of the UNC13A mRNA is identified as being more responsive than other regions.
  • these regions are sensitive to a number of factors, including but not limited to, antisense oligonucleotide length, composition, and positioning on the UNC13A mRNA.
  • Minimal regions of the UNC13A mRNA are specifically targeted to maximize antisense oligonucleotide activity in modulating UNC13A mRNA splicing.
  • these highly responsive minimal regions of the UNC13A mRNA are referred to as hot spots.
  • the method of treating amyotrophic lateral sclerosis comprises:
  • ALS frontal temporal dementia
  • FTD frontal temporal dementia
  • an antisense oligonucleotide targeting a minimal region wherein the minimal region of the UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene is identified as highly responsive to binding with an antisense oligonucleotide, or another similar nucleic acid probe.
  • an ASO that binds to such minimal region is effective for preventing inclusion of the UNC13A cryptic exon.
  • the minimal region is between 3 to 30, 4 to 26, 5 to 22, 6 to 18, 7 to 14, or 8 to 10 nucleotides in length. In some embodiments, the minimal region is no more than 30, no more than 25, no more than 20, or no more than 15 nucleotides in length. In some embodiments, the minimal region is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the minimal region is 18 nucleotides in length. In some embodiments, the minimal region is 29 nucleotides in length. In some embodiments, the minimal region comprises the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.
  • the minimal region comprises the sequence set forth in SEQ ID NO: 1339 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1340 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the minimal region comprises the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, binding the small region or a portion thereof with an antisense oligonucleotide results in enhanced splice modulation activity. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A mRNA expression.
  • binding the minimal region or a portion thereof with an antisense oligonucleotide results in decreased UNC13A cryptic exon mRNA expression. In some embodiments, binding the minimal region or a portion thereof with an antisense oligonucleotide results in increased UNC13A protein expression.
  • the methods provided herein treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.
  • the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1339 or a portion thereof.
  • the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1340 or a portion thereof.
  • the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1341 or a portion thereof. In some embodiments, the antisense oligonucleotide is complimentary to the sequence set forth in SEQ ID NO: 1342 or a portion thereof. In some embodiments, the antisense oligonucleotide is complementary to at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.
  • the antisense oligonucleotide is complementary to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342. In some embodiments, the antisense oligonucleotide is complementary to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339-1342.
  • the antisense oligonucleotide is complementary to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 1339- 1342. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340.
  • the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341. In some embodiments, the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.
  • the methods provided herein for treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprise administering an antisense oligonucleotide, wherein binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in enhanced UNC13A splice modulation activity. In some embodiments, binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof results in increased UNC13A mRNA expression.
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • the expression of UNC13A mRNA is increased in a cell to at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell between about 10% to about 95%, 20% to about 85%, 30% to about 75%, 40% to about 65%, or 50% to about 55% of the level of UNC13A mRNA expressed in a wild-type cell. In some embodiments, the expression of UNC13A mRNA is increased in a cell by at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%.
  • the expression of UNC13A mRNA is increased in a cell by between about 25% to about 1000%, about 50% to about 800%, about 100% to about 700%, about 200% to about 600%, or about 300% to about 500%.
  • binding of the antisense oligonucleotide to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion results in decreased UNC13A cryptic exon mRNA expression.
  • the expression of UNC13A cryptic exon mRNA is decreased in a cell by at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%.
  • the expression of UNC13A cryptic exon mRNA is decreased in a cell by between about 10% to about 90%, about 20% to about 80%, about 30% to about 70%, or about 40% to about 60%.
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides.
  • the antisense oligonucleotide comprises or consists of between 13 to 30, 15 to 28, 17 to 26, 19 to 24, or 21 to 23 nucleotides.
  • the antisense oligonucleotide comprises or consists of 13 to 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 13, 15, 17, 18, 19, 20, 21, 22, or 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19, 20, 21, or 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of at least 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, or 13 nucleotides.
  • the antisense oligonucleotide comprises or consists of 13 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 15 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 17 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 18 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 19 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 20 nucleotides.
  • the antisense oligonucleotide comprises or consists of 21 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 22 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 23 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 24 nucleotides. In some embodiments, the antisense oligonucleotide comprises or consists of 25 nucleotides.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20- 355, 400-638, 810-959, or 961-1332.
  • the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides.
  • the antisense oligonucleotide comprises a modification.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961- 1332.
  • the antisense oligonucleotide comprises or consists of 13 to 30 nucleotides.
  • the antisense oligonucleotide comprises a modification.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145.
  • the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961- 983 and 1116-1145.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173.
  • the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984- 1004 and 1146-1173.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 8
  • the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174-1199.
  • the antisense oligonucleotide consists of 17 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 43, 58, 73, 88, 103, 118, 133, 148, 163, 178, 193, 208, 223, 238, 253, 268, 283, 298, 312, 313, 327, 328, 342, 343, 814, 815, 816, 828, 829, 836, 839, 843, 844, 853, 854, 862, 865, 869, 870, 879, 880, 881, 891, 896, 897, 902, 903, 1005-1023, and 1174- 1199.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817, 818, 845, 855, 871, 882, 904, 958, 959, 960, 1024-1041, and 1200-1224.
  • the antisense oligonucleotide consists of 18 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 38-40, 44, 45, 59, 60, 74, 75, 89, 90, 104, 105, 119, 120, 134, 135, 149, 150, 164, 165, 179, 180, 194, 195, 209, 210, 224, 225, 239, 240, 254, 255, 269, 270, 284, 285, 299, 300, 314, 329, 344, 518-638, 817,
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225- 1247.
  • the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346,
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347,
  • the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.
  • the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350,
  • the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352, 820, 831, 847, 857, 873, 885, 886, 893, 906, 915-918, 930, and 942- 945.
  • the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232, 247, 262, 277, 292, 307, 321, 322, 336, 337, 351, 352,
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353,
  • the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide comprises the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.
  • the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a modification.
  • the 5’ end and/or the 3’ end of the antisense oligonucleotide comprises a modification.
  • the 5’ end or the 3’ end of the antisense oligonucleotide comprise a modification.
  • the 5’ end and the 3’ end of the antisense oligonucleotide comprise a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O- Methoxy ethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the modification is a 2’OMe antisense oligonucleotide.
  • the 5’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified. In some embodiments, wherein the 5’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified.
  • the 3’ end of the antisense oligonucleotide comprises a modification, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified. In some embodiments, wherein the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification, 1, 2, 3, 4, or 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide.
  • the 5’ end and the 3’ end of the antisense oligonucleotide comprises a modification
  • at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotides are modified at each of the 5’ end and the 3’ end of the antisense oligonucleotide.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the modification is a 2’0Me antisense oligonucleotide.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide comprises a modification, and at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the nucleotides comprise a modification. In some embodiments, between 30% and 100%, 40% and 90%, 50% and 80%, or 60% and 70% of the nucleotides comprise a modification.
  • the nucleotides comprise a modification.
  • the modification is selected from the group consisting of a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, and a LNA antisense oligonucleotide.
  • the modification is a 2’OMe antisense oligonucleotide.
  • the method of treating ALS or FTD in an individual comprises administering an antisense oligonucleotide, wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961- 1332.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • the methods for treatment of the present disclosure reduces, prevents, or slows development or progression of one or more symptom characteristic of a TDP- 43 proteinopathy (such as ALS or FTD).
  • symptoms characteristic of TDP-43 proteinopathy include motor dysfunction, cognitive dysfunction, emotional/behavioral dysfunction, paralysis, shaking, unsteadiness, rigidity, twitching, muscle weakness, muscle cramping, muscle stiffness, muscle atrophy, difficulty swallowing, difficulty breathing, speech and language difficulties (e.g., slurred speech), slowness of movement, difficulty with walking, dementia, depression, anxiety, or any combination thereof.
  • the methods for treatment of the present disclosure comprise administration of the antisense oligonucleotide (ASO) as a monotherapy or in combination with one or more additional therapies for the treatment of the TDP-43 proteinopathy.
  • Combination therapy may mean administration of the compositions of the present disclosure (e.g., antisense oligonucleotide) to the subject concurrently, prior to, subsequent to one or more additional therapies.
  • Concurrent administration of combination therapy may mean that the compositions of the present disclosure (e.g., antisense oligonucleotide) and additional therapy are formulated for administration in the same dosage form or administered in separate dosage forms.
  • the one or additional therapies that may be used in combination with the ASO of the present disclosure include: inhibitory nucleic acids or antisense oligonucleotides that target neurodegenerative disease related genes or transcripts (e.g., C9ORF72), gene editing agents (e.g., CRISPR, TALEN, ZFN based systems) that target neurodegenerative related genes (e.g., C9ORF72), agents that reduce oxidative stress, such as free radical scavengers (e.g., Radicava (edaravone), bromocriptine); antiglutamate agents (e.g., Riluzole, Topiramate, Lamotrigine, Dextromethorphan, Gabapentin and AMP A receptor antagonist (e.g., Talampanel)); anti-apoptosis agents (e.g., Minocycline, Sodium phenylbutyrate and Arimoclomol); anti-inflammatory agents (e.g., gan, aminocycline
  • an antisense oligonucleotide (ASO) of the present disclosure is administered in combination with an additional therapy targeting C9ORF72.
  • the additional therapy targeting C9ORF72 comprises an inhibitory nucleic acid targeting C9ORF72 transcript, a C9ORF72 specific antisense oligonucleotide, or a C9ORF72 specific gene editing agent.
  • C9ORF72 specific therapies are described in US Patent No. 9,963,699 (antisense oligonucleotides); PCT Publication No. WO2019/032612 (antisense oligonucleotides); US Patent No. 10,221,414 (antisense oligonucleotides); US Patent No.
  • the methods for treatment of the present disclosure may be used in combination with an STMN2 cryptic splice variant specific inhibitor.
  • STMN2 which encodes a regulator of microtubule stability called Stathmin-2, is the gene whose expression is most significantly reduced when TDP-43 is depleted from neurons.
  • the stathmin-2 gene is annotated to contain 5 constitutive exons plus a proposed alternative exon between exons 4 and 5.
  • STMN2 harbors a cryptic exon (exon 2a) contained in intron 1 that is normally excluded from the mature STMN2 mRNA.
  • the first intron of STMN2 contains a TDP-43 binding site.
  • Exon2a gets incorporated into the mature mRNA.
  • Exon 2a harbors a stop codon and a polyadenylation signal, resulting in truncated STMN2 mRNA and 8-fold reduction of Stathmin-2.
  • Aberrant splicing and reduced Stathmin-2 levels seem to be a major feature of sporadic and familial ALS cases (except those with SOD1 mutations) and in FTLD-TDP.
  • the antisense oligonucleotide selectively inhibits the expression or activity of the UNC13A cryptic exon splice variant over full length UNC13A (wild type) or other variants thereof (i.e., variants that do not contain a cryptic exon from intron 20-21.
  • the antisense oligonucleotide comprises or consists of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • Antisense oligonucelotides (ASOs) of the present disclosure may be administered to a subject by any route, including enteral (e.g., oral), parenteral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subpial, intraparenchymal, intrastriatal, intracranial, intracistemal, intra-cerebral, intracerebral ventricular, intraocular, intraventricular, intralumbar, subcutaneous, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), mucosal, nasal, bucal, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol
  • enteral e.g., oral
  • parenteral intravenous, intramuscular, intra-arterial, intramedull
  • kits comprising the antisense oligonucleotides provided herein and instructions for use.
  • the kit comprises instructions for contacting a cell with an ASO provided herein.
  • the kit comprises an ASO comprising or consisting of any of SEQ ID NO: 20-638 or 810-959.
  • the kit comprises an ASO comprising or consisting of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • the kit comprises an ASO comprising or consisting of 13 to 30 nucleotides, wherein the antisense oligonucleotide is complimentary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.
  • the kit comprises an ASO comprising or consisting of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075-1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • a method of increasing expression of UNC13A protein in a cell by at least 10% comprising contacting the cell with an antisense oligonucleotide comprising 16 to 30 nucleobases that are complementary to the sequence set forth in SEQ ID NO: 1.
  • neuron is a motor neuron, a cortical neuron, or an excitatory neuron.
  • the one or more neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, and neuronal longevity.
  • the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • a method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide comprising 16 to 30 nucleobases that are complementary to the sequence set forth in SEQ ID NO: 1 to the individual, wherein the individual is homozygous for a reference allele, homozygous for a risk allele, heterozygous or comprises a mutation associated with ALS or FTD.
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • antisense oligonucleotide comprises or consists of the sequence set forth in SEQ ID NO: 20-355, SEQ ID NO: 400-638 or SEQ ID NO: 810-957.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a LNA antisense oligonucleotide.
  • An antisense oligonucleotide that modulates UNC13A splicing wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.
  • the antisense oligonucleotide of embodiment 29, comprising at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO: 700-703. 31.
  • An antisense oligonucleotide comprising the sequence set forth in SEQ ID NO: 20-638 or
  • antisense oligonucleotide of embodiment 33 wherein the antisense oligonucleotide consists of 16, 17, 18, 19, 21, or 22 bases.
  • a pharmaceutical composition comprising the antisense oligonucleotide of any one of embodiments 25-37.
  • composition of embodiment 38 comprising an excipient and/or a buffer.
  • kits comprising the antisense oligonucleotide of any one of embodiments 29-37 or the pharmaceutical composition of embodiment 38 or embodiment 39.
  • a method of increasing expression of UNC13A protein in a cell by at least 10% comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • a method of increasing expression of UNC13A protein in a cell by at least 10% comprising contacting the cell with an antisense oligonucleotide comprising 13 to 30 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.
  • antisense oligonucleotide consists of 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1.
  • any one of embodiments 1-5 wherein the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895, 900, 901, 910, 934, and 935.
  • any one of embodiments 1-6 wherein the antisense oligonucleotide consists of 19 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 46, 61, 76, 91, 106, 121, 136, 151, 166, 181, 196, 211, 226, 241, 256, 271, 286, 301, 315, 316, 330, 331, 345, 346, 819, 830, 846, 856, 872, 883, 884, 892, 905, 1042-1058, and 1225- 1247.
  • any one of embodiments 1-6 wherein the antisense oligonucleotide consists of 20 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 47, 48, 62, 63, 77, 78, 92, 93, 107, 108, 122, 123, 137, 138, 152, 153, 167, 168, 182, 183, 197, 198, 212, 213, 227, 228, 242, 243, 257, 258, 272, 273, 287, 288, 302, 303, 317, 332, 347, 911, 936, 937, 1059-1074, and 1248-1270.
  • any one of embodiments 1-6 wherein the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.
  • any one of embodiments 1-6 wherein the antisense oligonucleotide consists of 22 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 50, 51, 65, 66, 80, 81, 95, 96, 110, 111, 125, 126, 140, 141, 155, 156, 170, 171, 185, 186, 200, 201, 215, 216, 230, 231, 245, 246, 260, 261, 275, 276, 290, 291, 305, 306, 320, 335, 350, 912, 913, 914, 938, 939, 940, 941, 1090-1103, and 1293-1313.
  • any one of embodiments 1-5 wherein the antisense oligonucleotide consists of 24 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 53, 54, 68, 69, 83, 84, 98, 99, 113, 114, 128, 129, 143, 144, 158, 159, 173, 174, 188, 189, 203, 204, 218, 219, 233, 234, 248, 249, 263, 264, 278, 279, 293, 294, 308, 309, 323, 338, 353, 821, 822, 832, 848, 858, 874, 887, 907, 919, 920-923, 931, 946-951, 1104-1115, and 1314- 1332.
  • the antisense oligonucleotide consists of 25 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 55, 70, 85, 100, 115, 130, 145, 160, 175, 190, 205, 220, 235, 250, 265, 280, 295, 310, 324, 325, 339, 340, 354, 355, 823, 824, 825, 833, 834, 837, 840, 849, 850, 859, 860, 863, 866, 875, 876, 888-890, 894, 898, 899, 908, 909, 924-929, 932, 933, 952, and 953-957.
  • antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 1059-1074, 1075- 1089, 1090-1103, 1248-1270, 1271-1292, and 1293-1313.
  • neuron is a motor neuron, a cortical neuron, an interneuron, or an excitatory neuron.
  • neuronal functions are selected from the group consisting of neuronal signaling, neuronal morphology, neurite length, neurotransmitter release, action potential, neuronal synaptic plasticity, and neuronal longevity.
  • 61 The method of any one of embodiments 1-60, wherein the cell is heterozygous or homozygous for a risk allele.
  • 62. The method of embodiment 61, wherein the risk allele is selected from the group consisting of rs12608932 (hg38 chr19: 17.641,880 A ⁇ C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C ⁇ A), or any combination thereof.
  • 63 The method of any one of embodiments 1-62, wherein the cell comprises a mutation associated with amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD).
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • a method of treating amyotrophic lateral sclerosis (ALS) or frontal temporal dementia (FTD) in an individual comprising administering an antisense oligonucleotide comprising 13 to 30 nucleotides to the individual, wherein the antisense oligonucleotide is complementary to the sequence set forth in SEQ ID NO: 1, and wherein the individual is homozygous for a reference allele, homozygous for a risk allele, heterozygous for a risk allele or comprises a mutation associated with ALS or FTD.
  • ALS amyotrophic lateral sclerosis
  • FTD frontal temporal dementia
  • rs12608932 (hg38 chr19: 17.641,880 A ⁇ C), rs12973192 (hg38 chr19: 17,642,430 C ⁇ G), rs56041637 (hg38 chr19: 17,642,033-17,642,056 0-2 CATC repeats 3-5 CATC repeats), and rs62121687 (hg38 chr19:17,642,351 C ⁇ A), or any combination thereof.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a locked nucleic acid (LNA) antisense oligonucleotide.
  • the antisense oligonucleotide comprises a 2’OMe antisense oligonucleotide, a 2’ O-Methoxyethyl antisense oligonucleotide, a phosphorothioate antisense oligonucleotide, or a locked nucleic acid (LNA) antisense oligonucleotide.
  • LNA locked nucleic acid
  • An antisense oligonucleotide that modulates UNC13A splicing wherein the antisense oligonucleotide has a sequence that is complementary to a sequence of UNC13A mRNA located between the 5’ splicing donor site and 3’ splicing acceptor site of a cryptic exon located between exons 20 and 21 of the UNC13A gene.
  • the antisense oligonucleotide of any one of embodiments 75-78 comprising at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in any one of SEQ ID NOs: 700-703.
  • antisense oligonucleotide of any one of embodiments 75-79 comprising at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:701.
  • antisense oligonucleotide of any one of embodiments 75-79 comprising at least 80%, at least 90%, at least 95%, at least 98%, or 100% complementarity to the sequence set forth in SEQ ID NO:703.
  • antisense oligonucleotide of embodiment 88 wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339.
  • antisense oligonucleotide of embodiment 88 wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340.
  • the antisense oligonucleotide of embodiment 88 wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341.
  • An antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • antisense oligonucleotide of any one of embodiments 75-93, wherein the antisense oligonucleotide consists of 13-30 nucleotides.
  • antisense oligonucleotide of any one of embodiments 75-95, wherein the antisense oligonucleotide consists of 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.
  • An antisense oligonucleotide consisting of the sequence set forth in any one of SEQ ID NOs: 20-355, 400-638, 810-959, or 961-1332.
  • An antisense oligonucleotide wherein the antisense oligonucleotide is complementary to the sequence set forth in any one of SEQ ID NOs: 1339-1342 or a portion thereof.
  • antisense oligonucleotide of any one of embodiments 75-96 and 98-100 wherein the antisense oligonucleotide consists of 13 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 961-983 and 1116-1145.
  • antisense oligonucleotide of any one of embodiments 75-96 and 98-100, wherein the antisense oligonucleotide consists of 15 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 984-1004 and 1146-1173.
  • antisense oligonucleotide of any one of embodiments 75-96 and 98-100 wherein the antisense oligonucleotide consists of 16 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 41, 42, 56, 57, 71, 72, 86, 87, 101, 102, 116, 117, 131, 132, 146, 147, 161, 162, 176, 177, 191, 192, 206, 207, 221, 222, 236, 237, 251, 252, 266, 267, 281, 282, 296, 297, 311, 326, 341, 810, 811, 812, 813, 826, 827, 835, 838, 841, 842, 851, 852, 861, 864, 867, 868, 877, 878, 895,
  • antisense oligonucleotide of any one of embodiments 75-100 wherein the antisense oligonucleotide consists of 21 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID NOs: 20-37, 49, 64, 79, 94, 109, 124, 139, 154, 169, 184, 199, 214, 229, 244, 259, 274, 289, 304, 318, 319, 333, 334, 348, 349, 400-517, 1075-1089, and 1271-1292.
  • antisense oligonucleotide of any one of embodiments 75-96 and 98-100 wherein the antisense oligonucleotide consists of 23 nucleotides that are complementary to the sequence set forth in SEQ ID NO: 1, and wherein the antisense oligonucleotide consists of the sequence set forth in any one of SEQ ID Nos: 52, 67, 82, 97, 112, 127, 142, 157, 172, 187, 202, 217, 232,
  • antisense oligonucleotide of embodiment 118 wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1339.
  • antisense oligonucleotide of embodiment 118 wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1340.
  • antisense oligonucleotide of embodiment 118 wherein the antisense oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1341.
  • the antisense oligonucleotide of embodiment 118 wherein the antisense oligonucleotide is at least at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to the sequence set forth in SEQ ID NO: 1342.
  • LNA locked nucleic acid
  • a pharmaceutical composition comprising the antisense oligonucleotide of any one of embodiments 75-129.
  • composition of embodiment 130 comprising an excipient and/or a buffer.
  • kit comprising the antisense oligonucleotide of any one of embodiments 75-129 or the pharmaceutical composition of embodiment 130 or embodiment 131.
  • Example 1 Screening antisense oligonucleotide (ASO) to identify exemplary ASOs for modulating UNC13A transcript levels
  • This example describes the screening of candidate splice blocking antisense oligonucleotides (ASO) in human motor neurons for efficacy in increasing full-length UNC13A mRNA transcripts and reducing UNC13A mRNA transcripts containing the cryptic exon (UNC13A CE).
  • ASO splice blocking antisense oligonucleotides
  • This example demonstrates that UNC13A splice blocking ASOs have variable effects on modulating UNC13A and UNC13A cryptic exon (CE) transcript levels depending on the cryptic exon locus binding location.
  • iPSC lines were obtained from public biobanks (Coriell Institute, NINDS) and maintained in mTeSRl media (StemCell Technologies) on Matrigel (Coming). iPSCs were fed daily and split every 4-7 days using ReLeSR (StemCell Technologies) according to manufacturer's instructions. Differentiation of iPSCs into motor neurons was carried out using 3D developmental pathways. iPSCs were dissociated and placed in ultra-low adhesion flasks (Coming) to form 3D spheroids in media containing DMEMF12/Neurobasal (Thermo Fisher), N2 supplement (Thermo Fisher), and B-27 supplement-Xeno free (Thermo Fisher).
  • spheroids Small molecules were added to induce neuronal progenitor patterning of the spheroids, (LDN193189, SB-431542, Chir99021; Sigma), followed by motor neuron induction (RA, SAG, DAPT; Sigma). After 14 days, neuronal spheroids were dissociated with Papain and DNAse (Worthington Biochemical) and plated on Poly-D-Lysine/Laminin (Thermo Fisher) coated plates in Neurobasal medium (Thermo Fisher) containing neurotrophic factors (BDNF, GDNF, CNTF; R&D Systems). For viral transductions, neuronal cultures were incubated for 18 hours with media containing lentivirus particles. Infection efficiency of over 90% was assessed by GFP/RFP expression. Antisense oligonucleotide (ASO) screens
  • 118 splice blocking ASOs were designed to tile the cryptic exon region between exons 20 and 21 of the UNC13A transcript.
  • Human iPSC line GM25256 was differentiated into motor neurons for 14 days using a 3D embryonic body (EB) developmental differentiation protocol. On Day 14, EBs were dissociated and plated on PDL/Laminin coated 96-well plates at a density of 35,000 cells/well. 5-6 days later, ASOs (with PS backbone and 2’MOE sugar modifications at 3pM) were added to cells through gymnotic delivery.
  • EB embryonic body
  • RT-qPCR was performed using the TaqMan Fast Advanced Cells-to-CT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions with the following primer/probe sets: TARDBP (Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse: TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584_ml; Thermo Fisher), STMN2 (Assay ID: Hs00199796_ml; Thermo Fisher), UNC13A CE (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO: 1338)), and TBP (housekeeper; Assay ID: H
  • Percent expression of each target was calculated using the delta delta CT method and normalized against the ASO 432 (SEQ ID NO:958) + shNT or ASO 434 (SEQ ID NO:959) + shNT treatment conditions (for UNC13A and STMN2) or the ASO 432 (SEQ ID NO:958) + sh3TDP43 or ASO 434 (SEQ ID NO:959) + sh3TDP43 treatment conditions (for UNC13A CE) .
  • the change in UNC13A mRNA levels (FIGS. 1A and IB) and UNC13A CE mRNA levels (FIGS. 2A and 2B) upon TARDBP knockdown with ASO addition were plotted as a function of ASO location.
  • top performing antisense oligonucleotides ASOs
  • percent of UNC13A full-length expression x-axis
  • percent UNC13A CE expression y-axis
  • Top performing ASOs were selected based on two cutoff criteria that were likely to result in a significant biological effect: 1) ASOs that showed > 32% UNC13A full-length expression levels and 2) ASOs that showed ⁇ 83% UNC13A CE levels.
  • This filtering resulted in the selection of ASO candidates comprising SEQ ID N0:20-40 provided in Table 4.
  • the genomic location of these filtered ASO candidates on the UNC13A cryptic exon locus is further depicted in FIG. 5A, along with the four modulatory regions identified, shown in FIG. 5B.
  • Example 2 Antisense oligonucleotide (ASO) validation in cultured motor neurons
  • This example describes the validation of exemplary antisense oligonucleotides (ASO) identified in Example 1 in the modulation of UNC13A mRNA transcripts using cultured human motor neurons.
  • ASO antisense oligonucleotides
  • ASOs antisense oligonucleotides
  • locus-tiled inactive ASOs that were identified in the initial screen (431, 339, and 402)
  • control (non-UNC13A transcript targeting) ASOs 434) were used on iPSC line GM25256 derived motor neurons at a concentration of 3 pM.
  • some neurons were not treated with any ASOs (NT).
  • Selected ASOs showed a sizable rescue of UNC13A transcript levels upon TDP-43 knock-down compared to controls (434 and NT conditions) and locus-tiled inactive ASOs (FIG. 6A).
  • Selected ASOs achieved a maximum 50% expression of shNT treated UNC13A transcript levels, representing a nearly 3- fold increase from control samples with sh3TDP43 treatment, further validating the results of the initial screen.
  • Select ASOs also showed a sizable depletion of UNC13A cryptic exon levels upon TDP-43 knock-down compared to controls and locus-tiled inactive ASOs (FIG. 6B).
  • Selected ASOs achieved a maximum depletion of just below 50% UNC13A CE levels, validating the results of the initial screen.
  • TARDBP expression was assessed after ASO addition and showed no difference compared to control ASO samples (FIG. 6C).
  • changes in STMN2 mRNA levels upon TDP-43 knockdown were assessed and showed no difference compared to control ASO samples (FIG. 6D). This data showed that these ASOs are specific to UNC13A as they do not alter STMN2 levels upon TDP-43 knockdown.
  • iPSC line GM26256 derived motor neurons were plated at a density of 50,000 neurons/well in a 96 well plate.
  • Rat astrocytes (Lonza) at -8000 astrocytes/well were added to the cells at two weeks post culturing.
  • a control ASO (434; SEQ ID NO:959) or exemplary ASO 422 (SEQ ID NO:36) were added at 3 pM to the cells through gymnotic delivery.
  • lentivirus was added to the cells encoding one of three scrambled control microRNAs (miRs) (TTCATAGCCAAGATACGACTCC (SEQ ID NO: 1346);
  • AAGAGTAGGCCATAAAAATGGG (SEQ ID NO: 1347); TCATACTACGGTTTCATGCCTC (SEQ ID NO: 1348)) or one of three TDP-43 targeting miRs (TTCATAGCGTTGATACGACTCC (SEQ ID NO: 1349); TTGGCTTTGCTTAGAATTAGGA (SEQ ID NO: 1350); GAATGACCAGTCTTAAGATCTT (SEQ ID NO: 1351)).
  • Reverse transcriptase cDNA synthesis was performed according to the manufacturer's instructions. cDNA was used in a qPCR assay with human specific Taqman probes for TARDBP ((Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse:
  • TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584; Thermo Fisher), UNC13A CE (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO:1338)), and HPRT (Housekeeper; Assay ID: Hs99999909_ml; Thermo Fisher) as a housekeeper gene. Expression levels were determined by the delta delta CT method using one control miR, no ASO population as the baseline.
  • Example 3 Antisense oligonucleotides (ASO) increase protein expression of UNC13A in cultured motor neurons
  • This example describes the assessment of UNC13A protein expression changes in cultured neurons in response to treatment with exemplary antisense oligonucleotides (ASO) described in Examples 1-2.
  • ASO antisense oligonucleotides
  • GM25256 iPSC derived motor neurons were plated at the density of 3.5xl0 5 cells/well. 5- 6 days later, ASOs (3 pM) were added to cells through gymnotic delivery. 48 hours after ASO addition, cells were transduced with lentivirus expressing an shRNA targeting TDP-43 (sh3TDP43; AGATCTTAAGACTGGTCATTC (SEQ ID NO: 1343)) or a non-targeting shRNA (shNT; Cat # SHCTL-NT-pRSI16, Cellecta). 24 hours after viral transduction, a media exchange was performed to remove virus.
  • shRNA targeting TDP-43 sh3TDP43; AGATCTTAAGACTGGTCATTC (SEQ ID NO: 1343)
  • shNT non-targeting shRNA
  • Cells were lysed for immunoblotting 14 days after viral transduction in RIPA buffer.
  • Cells were lysed in ice-cold RIPA buffer (Teknova) supplemented with protease inhibitor cocktail (Thermo Fisher) and PMSF (Cell Signaling Technologies). Lysates were then sonicated in a water bath for 5 minutes and pelleted in a centrifuge at maximum speed for 10 minutes at 4°C. A bicinchoninic acid assay was run on the harvested lysate supernatants to determine protein concentration. 32-35pg of protein for each sample was denatured, loaded onto aNuPage 3-8% Tris Acetate gel, and run for ⁇ lhr at 200V.
  • the gel was then transferred onto a 0.45 pm nitrocellulose membrane at 100V for 2 hours on ice using a wet transfer method.
  • Membranes were blocked for 30 minutes in a 1:1 ratio of Intercept Blocking Buffer to TBS then incubated overnight at 4°C in a 1 :2 ratio of Intercept Blocking Buffer to TBST containing antibodies against UNC13A (Synaptic Systems) and GAPDH (R&D System).
  • Membranes were subsequently incubated for 1 hour at room temperature in a 1 :2 ratio of Intercept Blocking Buffer to TBST containing 680RD donkey anti-rabbit IgG (Li-Cor) for UNC13A or 800CW donkey anti -goat IgG (Li-Cor) for GAPDH.
  • Example 4 Antisense oligonucleotide (ASO) dose response analysis in neuronal cell culture
  • GM25256 iPSC derived motor neurons were incubated with varying amounts of ASOs. 48 hours after ASO addition, cells are transduced with lentivirus expressing an shRNA targeting TDP-43 (sh3TDP43) or a non-targeting shRNA (shNT). RT-qPCR is used to determine expression of UNC13A.
  • This example describes the dose response analysis for exemplary antisense oligonucleotides (ASO) in cultured neuronal cells, assessing changes in UNC13A expression, UNC13A cryptic exon (CE) expression, and UNC13A protein expression levels.
  • ASO antisense oligonucleotides
  • This example demonstrates that several UNC13A splice blocking ASOs i) increase UNC13A expression levels, ii) reduce UNC13A CE expression, and iii) increase UNC13A protein levels in TDP43- depleted cells in a dose dependent manner.
  • Human iPSC lines were obtained from public biobanks (GM25256, NDS00262, NDS00209, NDS00235) and maintained in mTeSRl media (StemCell Technologies) on Matrigel (Coming). iPSCs were fed daily and split every 4-7 days using ReLeSR (StemCell Technologies) according to manufacturer's instructions. Differentiation of iPSCs into motor neurons was carried out using 3D developmental pathways.
  • iPSCs were dissociated and placed in ultra-low adhesion flasks (Coming) to form 3D spheroids in media containing DMEMF12/Neurobasal medium (Thermo Fisher), N2 Supplement (Thermo Fisher), and B-27 Supplement-Xeno Free (Thermo Fisher).
  • Small molecules were added to induce neuronal progenitor patterning of the spheroids, (LDN193189, SB-431542, Chir99021), followed by motor neuron induction (RA, SAG, DAPT).
  • neuronal spheroids were dissociated with Papain and DNAse (Worthington Biochemical) and plated on Poly-D- Lysine/Laminin (Thermo Fisher) coated 96-well plates (Perkin Elmer) in Neurobasal medium (Thermo Fisher) containing neurotrophic factors (BDNF, GDNF, CNTF; R&D Systems). Infection efficiency of over 90% was assessed by GFP/RFP expression.
  • GM25256 (GM) iPSC derived motor neurons were plated on PDL/Laminin coated 96-well plates at a density of 35,000 cells/well. 6 days later, ASOs (3 pM, 0.6 pM, 0.12 pM, or 0.024 pM) were added to cells through gymnotic delivery.
  • RT-qPCR was performed using the TaqMan Fast Advanced Cells-to-CT Kit (Thermo Fisher Scientific) according to the manufacturer's instructions for TARDBP (Forward: TCATCCCCAAGCCATTCAGG (SEQ ID NO: 1333), Reverse: TGCTTAGGTTCGGCATTGGA (SEQ ID NO: 1334), Probe: TGATCAGATTGCGCAGTCTC (SEQ ID NO: 1335)), UNC13A (Assay ID: Hs01000584_ml; Thermo Fisher), STMN2 (Assay ID: Hs00199796_ml; Thermo Fisher), UNC13A Cryptic Exon (Forward: TGGATGGAGAGATGGAACCT (SEQ ID NO: 1336), Reverse: GGGCTGTCTCATCGTAGTAAAC (SEQ ID NO: 1337), Probe: GGGTCGTGAAGATCCCAGAT (SEQ ID NO: 1338)), and TBP (housekeeper; Assay ID: Hs0042
  • TDP-43 TDP-43 expression levels for each ASO treatment condition were compared to the mean and standard deviation of TDP-43 knockdown cells with non-targeting ASO, represented by the dotted line and gray bar.
  • STMN2 expression levels for each ASO treatment condition were compared to the mean and standard deviation of TDP-43 knockdown cells with non-targeting ASO, represented by the dotted line and gray bar.
  • HiBiT is a small 11 -amino acid epitope tag that enables the detection of tagged endogenous proteins.
  • the HiBiT assay allows for rapid quantification of HiBiT tagged proteins within a wide dynamic range, and is especially useful for detecting endogenous proteins without overexpression.
  • GM25256 from Cori ell Institute (GM) iPSCs were dissociated into single cells using Accutase (StemCell Technologies) and 800,000 cells were resuspended in 100 pL of Lonza P3 Primary Cell Nucleofector Solution with Supplement 1 (Lonza).
  • IDT HiFi Cas9 v3
  • 8 pg of sgRNA UGGCCGACCGCCCGCGCUAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 1352); IDT) targeting the C-terminus of UNC13A were incubated together for 10 minutes at room temperature to form a ribonucleoprotein (RNP) complex, and then immediately placed on ice.
  • RNP ribonucleoprotein
  • the RNP solution and 400 pmol of the HiBit tag-containing ssODN (CACGCGCTCCGCCGAGGAGGGCGGTGCCGCGCCTGCGCCTGGCTCGAGCGGCGTGA GCGGCTGGCGGCTGTTCAAGAAGATTAGCTAGCGCGGGCGGTCGGCCGAGCGGCAC TGCGCCTGCGCGGAGG (SEQ ID NO: 1353); IDT) were added to the cell suspension and gently mixed. The cell suspension was moved into the Nucleocuvette Vessel (Lonza) and electroporated with the 4D-Nucleofector (Lonza) using the CA-137 protocol.
  • the resulting motor neurons from both iPSC types were plated at different densities.
  • Cells were lysed for HiBit assay 14 after plating.
  • the HiBit assay was performed using the Nano-Gio HiBit Lytic Detection System (Promega) according to the manufacturer's instructions.
  • Luminescence signal was measured using the Envision 2104 plate reader (Perkin Elmer). Only engineered HiBit-tagged cells produced a luminescence signal compared to unedited GM cells, and this luminescence signal was proportional to cell density. Additionally, UNC13A levels were perturbed in potential engineered HiBit-tagged motor neurons by transduction with a lentivirus expressing an shRNA targeting TDP43 (sh3TDP43) 7 days after plating.
  • a media exchange was performed to remove virus.
  • Cells were lysed for HiBit assay 7 days after viral transduction.
  • Luminescence signal was significantly reduced in sh3TDP43 treated neurons compared to non-treated neurons, helping to confirm that UNC13A was correctly tagged with HiBit in these cells.
  • a cell pellet of the final engineered HiBit-tagged line was sent out for Agilent 180K Standard aCGH+SNP microarray testing (Cell Line Genetics) to ensure normal karyotyping and clonality of the line.
  • HiBit-tagged iPSC derived motor neurons were plated on PDL/Laminin coated 96-well plates at a density of 35,000 cells/well. 6 days later, varying concentrations of ASOs (3 pM, 0.6 pM, 0.12 pM, or 0.024 pM) were added to cells through gymnotic delivery. 48 hours after ASO addition, cells were transduced with lentivirus expressing an shRNA targeting TDP43 (sh3TDP43) or a non-targeting shRNA (shNT). 24 hours after viral transduction, a media exchange was performed to remove virus.
  • sh3TDP43 shRNA targeting TDP43
  • shNT non-targeting shRNA
  • HiBit assay 14 days after viral transduction The HiBit assay was performed using the Nano-Gio HiBit Lytic Detection System (Promega) according to the manufacturer's instructions. Half of the HiBit lysates were taken for a cell viability assay using the CellTiter-Glo 2.0 Cell Viability Assay (Promega) according to the manufacturer's instructions. Luminescence signal was measured using the Envision 2104 plate reader (Perkin Elmer) and the HiBit signal was normalized to the cell viability signal. Percent HiBit signal was calculated by normalizing to the ASO 432 plus shNT treatment condition.
  • FIG. 10A Individual dose-dependent results for each ASO treatment condition are shown in FIG. 10A, and all ASO treatment conditions are shown together in FIG. 10B.
  • ASOs 355-357, 363, and 421 increased the UNC13A protein expression to over 75% of shNT treated neurons, representing a significant improvement over neurons with TDP43 knockdown treated with ASO 432 (non-targeting ASO control).
  • the observed rank order of increased the UNC13A protein expression with 3 pM ASO is shown in FIG. 10C.
  • FIG. 10D the observed correlation of UNC13A mRNA expression and UNC13A protein expression for the four-point dose response analysis is shown in FIG. 10D.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente divulgation concerne, selon certains aspects, des compositions d'oligonucléotides antisens (ASO) UNCI 3A et des méthodes d'utilisation de ces derniers pour modifier l'épissage de l'exon cryptique UNC13A et augmenter l'expression de la protéine UNC13A. De tels ASO peuvent être utilisés pour traiter des troubles neurodégénératifs, en particulier ceux associés à une pathologie de la protéine de liaison à l'ADN TAR 43 (TDP-43), par exemple, la sclérose latérale amyotrophique (SLA) ou la démence fronto-temporale (DFT).
PCT/US2023/076023 2022-10-05 2023-10-04 Oligonucléotides antisens unc13a et leurs utilisations WO2024077109A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263378473P 2022-10-05 2022-10-05
US63/378,473 2022-10-05

Publications (1)

Publication Number Publication Date
WO2024077109A1 true WO2024077109A1 (fr) 2024-04-11

Family

ID=88600179

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/076023 WO2024077109A1 (fr) 2022-10-05 2023-10-04 Oligonucléotides antisens unc13a et leurs utilisations

Country Status (1)

Country Link
WO (1) WO2024077109A1 (fr)

Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017109757A1 (fr) 2015-12-23 2017-06-29 Crispr Therapeutics Ag Matériaux et procédés de traitement de la sclérose latérale amyotrophique et/ou de la dégénérescence lobaire frontotemporale
US9963699B2 (en) 2012-10-15 2018-05-08 Ionis Pharmaceuticals, Inc. Methods for modulating C9ORF72 expression
WO2019032612A1 (fr) 2017-08-08 2019-02-14 Wave Life Sciences Ltd. Compositions oligonucléotidiques et méthodes associées
US10221414B2 (en) 2013-10-11 2019-03-05 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US20190167815A1 (en) 2017-10-24 2019-06-06 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of rare diseases
US10407678B2 (en) 2015-04-16 2019-09-10 Ionis Pharmaceuticals, Inc. Compositions for modulating expression of C9ORF72 antisense transcript
US20190316126A1 (en) 2014-03-18 2019-10-17 University Of Massachusetts Raav-based compositions and methods for treating amyotrophic lateral sclerosis
WO2022122872A1 (fr) * 2020-12-09 2022-06-16 Ucl Business Ltd Agents thérapeutiques pour le traitement des troubles neurodégénératifs
WO2022216759A1 (fr) * 2021-04-06 2022-10-13 Maze Therapeutics, Inc. Compositions et méthodes de traitement de la protéinopathie tdp-43
WO2022246251A2 (fr) * 2021-05-21 2022-11-24 Ionis Pharmaceuticals, Inc. Composés pour moduler l'expression d'unc13a
WO2023004049A1 (fr) * 2021-07-21 2023-01-26 AcuraStem, Inc. Oligonucléotides antisens unc13a
WO2023102225A2 (fr) * 2021-12-03 2023-06-08 Quralis Corporation Traitement de maladies neurologiques à l'aide de modulateurs de transcrits du gène d'unc13a
WO2023102242A2 (fr) * 2021-12-03 2023-06-08 Quralis Corporation Oligonucléotides antisens de commutateur d'épissage avec produits chimiques de squelette modifiés
WO2023118087A1 (fr) * 2021-12-21 2023-06-29 F. Hoffmann-La Roche Ag Oligonucléotides antisens ciblant unc13a

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9963699B2 (en) 2012-10-15 2018-05-08 Ionis Pharmaceuticals, Inc. Methods for modulating C9ORF72 expression
US10221414B2 (en) 2013-10-11 2019-03-05 Ionis Pharmaceuticals, Inc. Compositions for modulating C9ORF72 expression
US20190316126A1 (en) 2014-03-18 2019-10-17 University Of Massachusetts Raav-based compositions and methods for treating amyotrophic lateral sclerosis
US10407678B2 (en) 2015-04-16 2019-09-10 Ionis Pharmaceuticals, Inc. Compositions for modulating expression of C9ORF72 antisense transcript
WO2017109757A1 (fr) 2015-12-23 2017-06-29 Crispr Therapeutics Ag Matériaux et procédés de traitement de la sclérose latérale amyotrophique et/ou de la dégénérescence lobaire frontotemporale
WO2019032612A1 (fr) 2017-08-08 2019-02-14 Wave Life Sciences Ltd. Compositions oligonucléotidiques et méthodes associées
US20190167815A1 (en) 2017-10-24 2019-06-06 Sangamo Therapeutics, Inc. Methods and compositions for the treatment of rare diseases
WO2022122872A1 (fr) * 2020-12-09 2022-06-16 Ucl Business Ltd Agents thérapeutiques pour le traitement des troubles neurodégénératifs
WO2022216759A1 (fr) * 2021-04-06 2022-10-13 Maze Therapeutics, Inc. Compositions et méthodes de traitement de la protéinopathie tdp-43
WO2022246251A2 (fr) * 2021-05-21 2022-11-24 Ionis Pharmaceuticals, Inc. Composés pour moduler l'expression d'unc13a
WO2023004049A1 (fr) * 2021-07-21 2023-01-26 AcuraStem, Inc. Oligonucléotides antisens unc13a
WO2023102225A2 (fr) * 2021-12-03 2023-06-08 Quralis Corporation Traitement de maladies neurologiques à l'aide de modulateurs de transcrits du gène d'unc13a
WO2023102242A2 (fr) * 2021-12-03 2023-06-08 Quralis Corporation Oligonucléotides antisens de commutateur d'épissage avec produits chimiques de squelette modifiés
WO2023118087A1 (fr) * 2021-12-21 2023-06-29 F. Hoffmann-La Roche Ag Oligonucléotides antisens ciblant unc13a

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO.
"Uniprot", Database accession no. Q13148
ALTSCHUL ET AL.: "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402, XP002905950, DOI: 10.1093/nar/25.17.3389
BROWN A ET AL: "UNC13A contains a TDP-43- regulated cryptic exon that is exacerbated by ALS/FTLD-linked genomic variants", AMYOTROPHIC LATERAL SCLEROSIS AND FRONTOTEMPORAL DEGENERATION, vol. 22, no. sup2, 12 November 2021 (2021-11-12), pages 46 - 46, XP055898690, ISSN: 2167-8421, DOI: 10.1080/21678421.2021.1985788 *
BROWN ANNA-LEIGH ET AL: "TDP-43 loss and ALS-risk SNPs drive mis-splicing and depletion of UNC13A", NATURE,, vol. 603, no. 7899, 23 February 2022 (2022-02-23), pages 131 - 137, XP037707129, DOI: 10.1038/S41586-022-04436-3 *
BURGIN ET AL., BIOCHEMISTRY, vol. 35, 1996, pages 14090
MA X ROSA ET AL: "TDP-43 represses cryptic exon inclusion in the FTD-ALS gene UNC13A", NATURE,, vol. 603, no. 7899, 23 February 2022 (2022-02-23), pages 124 - 130, XP037707134, DOI: 10.1038/S41586-022-04424-7 *

Similar Documents

Publication Publication Date Title
JP7049249B2 (ja) 中枢神経系疾患の処置のための組成物および方法
AU2010204639B2 (en) Modulation of pre-mRNA using splice modulating oligonucleotides as therapeutic agents in the treatment of disease
EP3394259B1 (fr) Compositions et méthodes pour diminuer l'expression de tau
US20180312839A1 (en) Methods and compositions for increasing smn expression
KR20240004467A (ko) Tdp-43 단백질병증을 치료하기 위한 조성물 및 방법
KR20120086282A (ko) 다운 증후군 유전자에 대한 천연 안티센스 전사체의 억제에 의한 다운 증후군 유전자 관련된 질환의 치료
CN113811311A (zh) 用于组织特异性apoe调节的寡核苷酸
TW202219273A (zh) 靶向ｒｎａ結合蛋白位點之寡核苷酸
JP2024075673A (ja) 統合失調症及び他の神経精神障害の治療方法
CN111819283A (zh) 靶向α-突触核蛋白的反义寡核苷酸及其用途
US20220025379A1 (en) Methods of treating schizophrenia and other neuropsychiatric disorders
US10537591B2 (en) Method for promoting muscle regeneration
Umek et al. Oligonucleotides targeting DNA repeats downregulate Huntingtin gene expression in Huntington's patient-derived neural model system
WO2024077109A1 (fr) Oligonucléotides antisens unc13a et leurs utilisations
EP4222268A1 (fr) Compositions et méthodes de modulation de l'expression du gène tcf4 et de traitement du syndrome de pitt hopkins
US20220389432A1 (en) Allele-specific silencing therapy for DFNA9 using antisense oligonucleotides
WO2023201046A1 (fr) Compositions et méthode de traitement d'une dystonie-parkinsonisme liée à l'x
CN117580950A (zh) 用于治疗tdp-43蛋白病的组合物和方法
WO2024102867A1 (fr) Agents, compositions et procédés de modulation de staufen-1
JP2022534086A (ja) 新規の網膜色素変性処置

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23798638

Country of ref document: EP

Kind code of ref document: A1