WO2024073638A2 - Méthodes et compositions pour générer des cellules capillaires vestibulaires de type i - Google Patents

Méthodes et compositions pour générer des cellules capillaires vestibulaires de type i Download PDF

Info

Publication number
WO2024073638A2
WO2024073638A2 PCT/US2023/075477 US2023075477W WO2024073638A2 WO 2024073638 A2 WO2024073638 A2 WO 2024073638A2 US 2023075477 W US2023075477 W US 2023075477W WO 2024073638 A2 WO2024073638 A2 WO 2024073638A2
Authority
WO
WIPO (PCT)
Prior art keywords
tbx2
promoter
inhibitor
mir
hsa
Prior art date
Application number
PCT/US2023/075477
Other languages
English (en)
Other versions
WO2024073638A3 (fr
Inventor
Joseph Burns
Noah DRUCKENBROD
Amanda KEDAIGLE
Ryan MCCARTHY
Nivanthika WIMALASENA
Original Assignee
Decibel Therapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Decibel Therapeutics, Inc. filed Critical Decibel Therapeutics, Inc.
Publication of WO2024073638A2 publication Critical patent/WO2024073638A2/fr
Publication of WO2024073638A3 publication Critical patent/WO2024073638A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • Vestibular hair cells are the sensory receptors in the inner ear that are essential for balance and spatial orientation. Loss of hair cells in the vestibular system can be caused by certain medicines or can occur as a result of the aging process. Extensive hair cell loss can lead to chronic balance problems and increased risk of falls and can result in significant life impairment or incapacitation.
  • a subset of individuals with chronic balance disorders suffer from bilateral vestibulopathy (BVP), a profound bilateral loss of vestibular sensation. There are estimated to be approximately 130,000 adults with BVP in the United States and the major markets in Europe.
  • BVP bilateral vestibulopathy
  • the present invention provides compositions and methods for treating vestibular dysfunction (e.g., vertigo, dizziness, balance loss, bilateral vestibulopathy (also known as bilateral vestibular hypofunction), oscillopsia, or a balance disorder) in a subject, such as a human subject.
  • the compositions and methods of the disclosure pertain to Tbx2 inhibitors that can be delivered to a Type II vestibular hair cell, a regenerated hair cell, an immature vestibular hair cell, or a supporting cell to reduce Tbx2 expression or activity, leading to the generation of Type I vestibular hair cells.
  • the Tbx2 inhibitors can also be administered in combination with a regeneration agent, such as an agent that increases Atohl expression or an agent that reduces Notch expression or activity, or in combination with a Sox2 inhibitor.
  • the invention provides a method of generating Type I vestibular hair cells in a subject in need thereof, the method including the step of administering to an inner ear of the subject an effective amount of a Tbx2 inhibitor.
  • the subject has or is at risk of developing vestibular dysfunction.
  • the invention provides a method of treating a subject having or at risk of developing vestibular dysfunction, the method including the step of administering to an inner ear of the subject an effective amount of a Tbx2 inhibitor.
  • the vestibular dysfunction is associated with damage to or loss of vestibular hair cells (e.g., damage to or loss of Type I vestibular hair cells, such as due to aging, head trauma, disease or infection, or exposure to ototoxic drugs).
  • the invention provides a nucleic acid vector including a Tbx2 inhibitor operably linked to a promoter.
  • the invention provides a nucleic acid vector including an inner ear cell typespecific promoter operably linked to a polynucleotide encoding Tbx2 inhibitor.
  • the nucleic acid vector further includes a polynucleotide that can be transcribed to produce (i.e., a polynucleotide encoding) a microRNA target sequence that reduces or inhibits expression of the of the Tbx2 inhibitor in Type I vestibular hair cells.
  • the invention provides a nucleic acid vector including a promoter operably linked to a polynucleotide encoding a Tbx2 inhibitor, in which the nucleic acid vector further includes a polynucleotide that can be transcribed to produce a microRNA target sequence that reduces or inhibits expression of the of the Tbx2 inhibitor in Type I vestibular hair cells.
  • the promoter is an inner ear cell type-specific promoter.
  • the inner ear cell type-specific promoter is a supporting cell promoter, a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter.
  • the Tbx2 inhibitor is an inhibitory RNA molecule targeting Tbx2 or a Tbx2 promoter or is a polynucleotide that can be transcribed to produce (i.e., a polynucleotide encoding) an inhibitory RNA molecule targeting Tbx2 or a Tbx2 promoter, a component of a gene editing system targeting Tbx2 or a polynucleotide encoding a component of a gene editing system targeting Tbx2, a dominant negative Tbx2 protein or polynucleotide encoding a dominant negative Tbx2 protein, or a small molecule Tbx2 inhibitor.
  • the Tbx2 inhibitor is an inhibitory RNA molecule targeting Tbx2 or a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Tbx2 (e.g., targeting a Tbx2 mRNA transcript, such as human Tbx2 (SEQ ID NO: 1 ) or murine Tbx2 mRNA (SEQ ID NO: 3)).
  • the inhibitory RNA molecule is a short interfering RNA (siRNA).
  • the inhibitory RNA molecule is a short hairpin RNA (shRNA).
  • the siRNA or shRNA targeting Tbx2 has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases (e.g., 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobases) having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of a target region of an mRNA transcript of a human (e.g., SEQ ID NO: 1 ) or murine (SEQ ID NO: 3) TBX2 gene.
  • a human e.g., SEQ ID NO: 1
  • murine SEQ ID NO: 3
  • the target region is at least 8 to 21 (e.g., 8 to 21 , 9 to 21 , 10 to 21 , 11 to 21 , 12 to 21 , 13 to 21 , 14 to 21 , 15 to 21 , 16 to 21 , 17 to 21 , 18 to 21 , 19 to 21 , 20 to 21 , or all 21 ) contiguous nucleobases of SEQ ID NO: 5.
  • the siRNA or shRNA targeting Tbx2 has a nucleobase sequence having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to SEQ ID NO: 5.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity
  • the target region is at least 8 to 22 (e.g., 8 to 22, 9 to 22, 10 to 22, 11 to 22, 12 to 22, 13 to 22, 14 to 22, 15 to 22, 16 to 22, 17 to 22, 18 to 22, 19 to 22, 20 to 22, 21 to 22, or all 22) contiguous nucleobases of SEQ ID NO: 6 or SEQ ID NO: 7.
  • the siRNA or shRNA targeting Tbx2 has a nucleobase sequence having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to SEQ ID NO: 6 or SEQ ID NO: 7.
  • the shRNA has the sequence of any one of SEQ ID NOs: 72-89.
  • the shRNA has the sequence of any one of SEQ ID NOs: 72-81 .
  • the shRNA is embedded in a microRNA (miRNA; e.g., embedded in a miRNA backbone to produce an shRNA-mir).
  • the shRNA is embedded in a miR-30 backbone.
  • the shRNA is embedded in mir-E backbone.
  • the shRNA has the sequence of any one of SEQ ID NOs: 72-89.
  • the shRNA has the sequence of any one of SEQ ID NOs: 72-81 .
  • the shRNA is embedded into the backbone of a miRNA (e.g., miRNA-30 or mir-E, e.g., to produce an shRNA-mir).
  • the siRNA has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to any one of SEQ ID NOs: 8-24 or includes a sense strand and an anti-sense strand having the sequences of SEQ ID NO: 25 and SEQ ID NO: 26.
  • the inhibitory RNA is a miRNA.
  • the miRNA is hsa-miR-1180, hsa-miR-1203, hsa-miR-1205, hsa- miR-1207-5p, hsa-miR-1224-3p, hsa-miR-124-3p, hsa-miR-1292, hsa-miR-1470, hsa-miR-153, hsa-miR- 21 , hsa-miR-216b, hsa-miR-3120-3p, hsa-miR-3175, hsa-miR-3186-3p, hsa-miR-3192, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-331 -3p, hsa-miR
  • the miRNA is hsa-miR-1180, hsa-miR-1203, hsa-miR-1205, hsa-miR-1207-5p, hsa-miR-1224-3p, hsa-miR- 124-3p, hsa-miR-1292, hsa-miR-1470, hsa-miR-153, or hsa-miR-21.
  • the Tbx2 inhibitor is an inhibitory RNA molecule targeting a Tbx2 promoter, or is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting a Tbx2 promoter.
  • the inhibitory RNA molecule is a miRNA.
  • the Tbx2 inhibitor is a component of a gene editing system targeting Tbx2 or is a polynucleotide encoding a component of a gene editing system targeting Tbx2 (e.g., targeting Tbx2 to engineer an alteration in Tbx2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Tbx2, thereby inhibiting Tbx2).
  • Tbx2 e.g., targeting Tbx2 to engineer an alteration in Tbx2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Tbx2, thereby inhibiting Tbx2).
  • the gene editing system is a zinc finger nuclease (ZFN) system, a transcription activator-like effector-based nuclease (TALEN) system, or a clustered regulatory interspaced short palindromic repeat (CRISPR) system.
  • ZFN zinc finger nuclease
  • TALEN transcription activator-like effector-based nuclease
  • CRISPR clustered regulatory interspaced short palindromic repeat
  • the Tbx2 inhibitor is a dominant negative Tbx2 protein or is a polynucleotide encoding a dominant negative Tbx2 protein.
  • the dominant negative Tbx2 protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4, or the polynucleotide encoding the dominant negative Tbx2 protein encodes a protein having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%,
  • the dominant negative Tbx2 protein has the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4, or the polynucleotide encoding the dominant negative Tbx2 protein encodes a protein having the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4.
  • the Tbx2 inhibitor is a small molecule Tbx2 inhibitor.
  • the small molecule Tbx2 inhibitor is a small molecule Tbx2 inhibitor listed in Table 5.
  • the small molecule Tbx2 inhibitor is testosterone, dorsomorphin, estropipate, LY-2140023, carbinoxamine, tyrphostin-AG-1295, DMeOB, methantheline, or HDAC6 inhibitor ISOX.
  • the Tbx2 inhibitor is TGF-p1 or a polynucleotide encoding TGF-p1 .
  • the method further includes administering a regeneration agent (e.g., administering the regeneration agent to an inner ear of the subject).
  • a regeneration agent e.g., administering the regeneration agent to an inner ear of the subject.
  • the regeneration agent is administered before the Tbx2 inhibitor.
  • the regeneration agent is administered after the Tbx2 inhibitor.
  • the regeneration agent is administered concurrently with the Tbx2 inhibitor.
  • the nucleic acid vector further includes a regeneration agent.
  • the regeneration agent is an agent that increases Atohl expression and/or a Notch inhibitor. In some embodiments, the regeneration agent is an agent that increases Atohl expression. In some embodiments, the agent that increases Atohl expression is a polynucleotide encoding Atohl (e.g., a polynucleotide encoding SEQ ID NO: 27, such as a polynucleotide having the sequence of SEQ ID NO: 28). In some embodiments, the agent that increases Atohl expression is a small molecule. In some embodiments, the regeneration agent is a Notch inhibitor.
  • the Notch inhibitor is an inhibitory RNA targeting Notch or a polynucleotide that can be transcribed to produce (i.e., a polynucleotide encoding) an inhibitory RNA molecule targeting Notch, a small molecule Notch inhibitor (e.g., a gamma-secretase inhibitor), an anti-Notch antibody, or a polynucleotide encoding an anti-Notch antibody.
  • the Notch inhibitor is an inhibitory RNA targeting Notch or is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Notch.
  • the inhibitory RNA targeting Notch is an siRNA.
  • the inhibitory RNA targeting Notch is an shRNA. In some embodiments, the inhibitory RNA targeting Notch is a miRNA. In some embodiments, the Notch inhibitor is a small molecule Notch inhibitor. In some embodiments, the Notch inhibitor is an anti-Notch antibody. In some embodiments, the Notch inhibitor is a polynucleotide encoding an anti-Notch antibody.
  • the regeneration agent is administered using a nucleic acid vector.
  • the nucleic acid vector includes a promoter operably linked to the regeneration agent.
  • the regeneration agent is a polynucleotide encoding Atohl , a polynucleotide that can be transcribed to produce an siRNA targeting Notch, a polynucleotide that can be transcribed to produce an shRNA targeting Notch, a polynucleotide that can be transcribed to produce a miRNA targeting Notch, or a polynucleotide encoding an anti-Notch antibody and the promoter is a pol II promoter.
  • the pol II promoter is a supporting cell promoter (e.g., a vestibular supporting cell promoter, such as an SLC6A14 promoter).
  • regeneration agent is a polynucleotide that can be transcribed to produce an siRNA targeting Notch, a polynucleotide that can be transcribed to produce an shRNA targeting Notch, or a polynucleotide that can be transcribed to produce a miRNA targeting Notch and the promoter is a pol III promoter.
  • the method further includes administering a Sox2 inhibitor (e.g., administering the Sox2 inhibitor to an inner ear of the subject).
  • a Sox2 inhibitor e.g., administering the Sox2 inhibitor to an inner ear of the subject.
  • the Sox2 inhibitor is administered before the Tbx2 inhibitor.
  • the Sox2 inhibitor is administered after the Tbx2 inhibitor.
  • the Sox2 inhibitor is administered concurrently with the Tbx2 inhibitor.
  • the nucleic acid vector further includes a Sox2 inhibitor.
  • the Sox2 inhibitor is an inhibitory RNA molecule targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Sox2 or a Sox2 promoter, a component of a gene editing system targeting Sox2, a polynucleotide encoding a component of a gene editing system targeting Sox2, a dominant negative Sox2 protein, or a polynucleotide encoding a dominant negative Sox2 protein.
  • the Sox2 inhibitor is an inhibitory RNA molecule targeting Sox2 or is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Sox2.
  • the inhibitory RNA molecule is a siRNA.
  • the inhibitory RNA molecule is a shRNA.
  • the siRNA or shRNA targeting Sox2 has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 80% complementarity (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of a target region of an mRNA transcript of a human or murine SOX2 gene (e.g., at least 80% complementarity to an equal length portion of a target region of SEQ ID NO: 90 or SEQ ID NO: 32).
  • at least 80% complementarity e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or
  • the target region is a portion of an mRNA transcript of the human SOX2 gene (SEQ ID NO: 90). In some embodiments, the target region is at least 8 to 21 contiguous nucleobases of any one of SEQ ID NOs: 34-52, at least 8 to 22 contiguous nucleobases of SEQ ID NO: 57 or SEQ ID NO: 58, or at least 8 to 19 contiguous nucleobases of any one of SEQ ID NOs: 54-56.
  • the siRNA or shRNA has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of any one of SEQ ID NOs: 34-52 and 54-38.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%
  • the shRNA has a nucleobase sequence having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) complementarity to any one of SEQ ID NO: 40, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 9
  • the shRNA comprises the sequence of nucleotides 2234-2296 of SEQ ID NO: 59 or nucleotides 2234-2296 of SEQ ID NO: 61 .
  • the shRNA is embedded in a miRNA backbone (e.g., embedded in a miRNA backbone to produce an shRNA-mir).
  • the shRNA is embedded in a miR-30 or mir-E backbone.
  • the shRNA comprises the sequence of nucleotides 2109-2426 of SEQ ID NO: 59, nucleotides 2109-2408 of SEQ ID NO: 60, nucleotides 2109-2426 of SEQ ID NO: 61 , or nucleotides 2109-2408 of SEQ ID NO: 62.
  • the siRNA comprises a sense strand and an antisense strand selected from the following pairs: SEQ ID NO: 64 and SEQ ID NO: 65; SEQ ID NO: 66 and SEQ ID NO: 67; SEQ ID NO: 68 and SEQ ID NO: 69; and SEQ ID NO: 70 and SEQ ID NO: 71 .
  • the inhibitory RNA is a miRNA.
  • the miRNA is human miR-145, miR-126, miR-200c, miR-429, miR-200b, miR-140, miR-9, miR-21 , miR-590, miR-182, or miR-638, or murine miR-134, miR-200c, miR-429, miR- 200b, miR-34a, or miR-9.
  • the Sox2 inhibitor is an inhibitory RNA molecule targeting a Sox2 promoter or is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting a Sox2 promoter.
  • the inhibitory RNA molecule is a miRNA.
  • the Sox2 inhibitor is a component of a gene editing system targeting Sox2 or a polynucleotide encoding a component of a gene editing system targeting Sox2 (e.g., targeting Sox2 to engineer an alteration in Sox2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Sox2, thereby inhibiting Sox2).
  • the gene editing system is a ZFN system, a TALEN system, or a CRISPR system.
  • the Sox2 inhibitor is a dominant negative Sox2 protein or a polynucleotide encoding a dominant negative Sox2 protein.
  • the polynucleotide encoding the dominant negative Sox2 protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO: 24 or SEQ ID NO: 34.
  • the polynucleotide encoding the dominant negative Sox2 protein has the sequence of SEQ ID NO: 24 or SEQ ID NO: 34.
  • the dominant negative Sox2 protein is a Sox2 protein that lacks most or all of the high mobility group domain (HMGD), a Sox2 protein in which the nuclear localization signals in the HMGD are mutated, a Sox2 protein in which the HMGD is fused to an engrailed repressor domain, or a c-terminally truncated Sox2 protein comprising only the DNA binding domain.
  • HMGD high mobility group domain
  • Sox2 protein in which the nuclear localization signals in the HMGD are mutated
  • Sox2 protein in which the HMGD is fused to an engrailed repressor domain or a c-terminally truncated Sox2 protein comprising only the DNA binding domain.
  • the Sox2 inhibitor is administered using a nucleic acid vector.
  • the nucleic acid vector includes a promoter operably linked to the Sox2 inhibitor.
  • the Sox2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Sox2 or a Sox2 promoter embedded in a miRNA (e.g., embedded in a miRNA backbone to produce an shRNA-mir), a polynucleotide that can be transcribed to produce a miRNA targeting Sox2, or a polynucleotide that can be transcribed to produce a miRNA targeting a Sox22 promoter and the promoter is a pol III promoter.
  • the Sox2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Sox2 or a Sox2 promoter embedded in a miRNA (embedded in a miRNA backbone to produce an shRNA-mir), a polynucleotide that can be transcribed to produce a miRNA targeting Sox2, a polynucleotide that can be transcribed to produce a miRNA targeting a Sox2 promoter, a polynucleotide encoding a component of a gene editing system targeting Sox2, or a polynucleotide encoding a dominant negative Sox2 protein and the promoter is a pol II promoter.
  • the pol II promoter is a supporting cell promoter (e.g., a vestibular supporting cell promoter, such as an SLC6A14 promoter), a hair cell promoter, a type II vestibular hair cell promoter, or an immature vestibular hair cell promoter.
  • a supporting cell promoter e.g., a vestibular supporting cell promoter, such as an SLC6A14 promoter
  • a hair cell promoter e.g., a type II vestibular hair cell promoter, or an immature vestibular hair cell promoter.
  • the Tbx2 inhibitor is administered using a nucleic acid vector.
  • the nucleic acid vector includes a promoter operably linked to the Tbx2 inhibitor.
  • the Tbx2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Tbx2 or a Tbx2 promoter embedded in a miRNA (an shRNA-mir), a polynucleotide that can be transcribed to produce a miRNA targeting Tbx2, or a polynucleotide that can be transcribed to produce a miRNA targeting a Tbx2 promoter and the promoter is a pol III promoter.
  • the Tbx2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Tbx2 or a Tbx2 promoter embedded in a miRNA backbone, a polynucleotide that can be transcribed to produce a miRNA targeting Tbx2, a polynucleotide that can be transcribed to produce a miRNA targeting a Tbx2 promoter, a polynucleotide encoding a component of a gene editing system targeting Tbx2, or a polynucleotide encoding a dominant negative Tbx2 protein and the promoter is a pol II promoter.
  • the pol II promoter is a supporting cell promoter (e.g., a vestibular supporting cell promoter, such as an SLC6A14 promoter), a hair cell promoter, a type II vestibular hair cell promoter, or an immature vestibular hair cell promoter.
  • a supporting cell promoter e.g., a vestibular supporting cell promoter, such as an SLC6A14 promoter
  • a hair cell promoter e.g., a type II vestibular hair cell promoter, or an immature vestibular hair cell promoter.
  • the pol II promoter is a supporting cell promoter.
  • the supporting cell promoter is a Glial Acidic Fibrillary Protein (GFAP) promoter, a Solute Carrier Family 1 Member 3 (GLAST) promoter, a Hes Family BHLH Transcription Factor 1 (HES1 ) promoter, a Jagged 1 (JAG1 ) promoter, a Notch 1 (NOTCH1 ) promoter, a Leucine Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5) promoter, a SRY-box 2 transcription factor (SOX2) promoter, a Hes Family BHLH Transcription Factor 5 (HES5) promoter, a LFNG O-Fucosylpeptide 3-Beta-N-Acetylglucosaminyltransferase (LFNG) promoter, a Kringle Containing Trans
  • GFAP Glial Acidic Fibrillary Protein
  • GLAST Solute Carrier
  • the pol II promoter is a hair cell promoter.
  • the hair cell promoter is a Myosin 15A (MY015) promoter, a Growth Factor Independent 1 Transcriptional Repressor (GFI1 ) promoter, a POU Class 4 Homeobox 3 (POU4F3) promoter, or Myosin 7a (MY07A) promoter.
  • the pol II promoter is a Type II vestibular hair cell promoter.
  • the Type II vestibular hair cell promoter is a Calbindin 2 (CALB2) promoter, a Microtubule associated protein tau (MAPT) promoter, an Annexin A4 (ANXA4) promoter, or an Otoferlin (OTOF) promoter.
  • the pol II promoter is an immature vestibular hair cell promoter. In some embodiments of any of the foregoing aspects, the immature vestibular hair cell promoter is an Atohl promoter.
  • the pol III promoter is a ubiquitous pol III promoter.
  • the ubiquitous pol III promoter is a U6 promoter, an H1 promoter, or a 7SK promoter.
  • the pol II promoter is a ubiquitous promoter.
  • the ubiquitous pol II promoter is a CAG promoter, a CBA promoter, a CBh promoter, an smCBA promoter, a CASI promoter, a dihydrofolate reductase (DHFR) promoter, a p- actin promoter, a phosphoglycerol kinase (PGK) promoter, a ubiquitin C (UBC) promoter, an EF1 a promoter, an EF1 a-short (EFS) promoter, a spleen focus-forming virus (SFFV) promoter, a murine stem cell virus (MSCV) promoter, a p-globin promoter, a CMV promoter, an HSV promoter, or an SV40 promoter.
  • the promoter is a minimal p-globin promoter, a CMVmini promoter, a minCMV promoter, a CMV-TATA+INR promoter, a min CMV-T6 promoter, a minimal HSV ICPO promoter, a truncated HSV ICPO promoter, or an SV40 minimal promoter.
  • the Tbx2 inhibitor and the regeneration agent are administered using separate nucleic acid vectors.
  • the Tbx2 inhibitor and the regeneration agent are administered using a single nucleic acid vector that expresses (encodes) both the Tbx2 inhibitor and the regeneration agent.
  • the Tbx2 inhibitor and the regeneration agent are expressed using two different promoters (e.g., a first promoter, such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter, is operably linked to a polynucleotide encoding the Tbx2 inhibitor and a second promoter, such as a supporting cell promoter, is operably linked to the polynucleotide encoding the regeneration agent).
  • a first promoter such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter
  • a second promoter such as a supporting cell promoter
  • the Tbx2 inhibitor and the regeneration agent are expressed using the same promoter (e.g., both the Tbx2 inhibitor and the regeneration agent are operably linked to supporting cell promoter or a ubiquitous promoter, either by including two copies of the promoter in the vector, with one copy operably linked to the Tbx2 inhibitor and the other copy operably linked to the regeneration agent, or by operably linking both the Tbx2 inhibitor and regeneration agent to a single copy of the promoter and placing an IRES or 2A polypeptide (e.g., F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), P2A (porcine teschovirus-1 2A), or T2A (thosea asigna virus 2A)) between the polynucleotides encoding the Tbx2 inhibitor and regeneration agent).
  • an IRES or 2A polypeptide e.g., F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), P
  • the nucleic acid vector further includes a polynucleotide encoding a miRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor and/or the regeneration agent in Type I vestibular hair cells (e.g., a polynucleotide encoding a target sequence for a miRNA that is expressed in Type I vestibular hair cells and not in Type II vestibular hair cells and/or vestibular supporting cells, e.g., operably linked to the same promoter as the Tbx2 inhibitor and/or regeneration agent).
  • a polynucleotide encoding a miRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor and/or the regeneration agent in Type I vestibular hair cells e.g., a polynucleotide encoding a target sequence for a miRNA that is expressed in Type I vestibular hair cells and not in Type II vestibular hair cells and/or vestibular supporting cells, e.g., operably linked to the
  • the regeneration agent is a polynucleotide encoding Atohl .
  • the Tbx2 inhibitor and the Sox2 inhibitor are administered using separate nucleic acid vectors.
  • the Tbx2 inhibitor and the Sox2 inhibitor are administered using a single nucleic acid vector that expresses (encodes) both the Tbx2 inhibitor and the Sox2 inhibitor.
  • the Tbx2 inhibitor and the Sox2 inhibitor are expressed using two different promoters (e.g., a first promoter, such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter, is operably linked to a polynucleotide encoding the Tbx2 inhibitor and a second promoter (different from the first promoter), such as a supporting cell promoter, a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter is operably linked to the polynucleotide encoding the Sox2 inhibitor).
  • a first promoter such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter
  • the Tbx2 inhibitor and the Sox2 inhibitor are expressed using the same promoter (e.g., both the Tbx2 inhibitor and the Sox2 inhibitor are operably linked to a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter, either by including two copies of the promoter in the vector, with one copy operably linked to the Tbx2 inhibitor and the other copy operably linked to the Sox2 inhibitor, or by operably linking both the Tbx2 inhibitor and the Sox2 inhibitor to a single copy of the promoter and placing an IRES or 2A polypeptide (e.g., F2A, E2A, P2A, or T2A) between the polynucleotides encoding the Tbx2 inhibitor and the Sox2 inhibitor).
  • an IRES or 2A polypeptide e.g., F2A, E2A, P2A, or T2A
  • the nucleic acid vector further includes a polynucleotide encoding a miRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor and/or the Sox2 inhibitor in Type I vestibular hair cells (e.g., a polynucleotide encoding a target sequence for a miRNA that is expressed in Type I vestibular hair cells and not in Type II vestibular hair cells and/or vestibular supporting cells, e.g., operably linked to the same promoter as the Tbx2 inhibitor and/or Sox2 inhibitor).
  • a polynucleotide encoding a miRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor and/or the Sox2 inhibitor in Type I vestibular hair cells e.g., a polynucleotide encoding a target sequence for a miRNA that is expressed in Type I vestibular hair cells and not in Type II vestibular hair cells and/or vestibular supporting cells, e.g.
  • the nucleic acid vector further includes a polynucleotide encoding a miRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor in Type I vestibular hair cells (e.g., a polynucleotide encoding a target sequence for a miRNA that is expressed in Type I vestibular hair cells and not in Type II vestibular hair cells and/or vestibular supporting cells, e.g., operably linked to the same promoter as the Tbx2 inhibitor).
  • a polynucleotide encoding a miRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor in Type I vestibular hair cells e.g., a polynucleotide encoding a target sequence for a miRNA that is expressed in Type I vestibular hair cells and not in Type II vestibular hair cells and/or vestibular supporting cells, e.g., operably linked to the same promoter as the Tbx2 inhibitor.
  • the nucleic acid vector is a plasmid, cosmid, artificial chromosome, or viral vector.
  • the nucleic acid vector is a viral vector.
  • the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, or a lentivirus vector.
  • the viral vector is an AAV vector.
  • the AAV vector has an AAV1 , AAV2, AAV2quad(Y-F), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ, DJ/8, DJ/9, 7m8, PHP.B, PHP.B2, PBP.B3, PHP. A, PHP. eb, or PHP.S capsid.
  • the AAV vector has an AAV1 capsid.
  • the AAV vector has an AAV2 capsid.
  • the AAV vector has an AAV8 capsid.
  • the AAV vector has an AAV9 capsid. In some embodiments, the AAV vector has an Anc80 capsid. In some embodiments, the AAV vector has a DJ capsid. In some embodiments, the AAV vector has a 7m8 capsid. In some embodiments, the AAV vector has a PHP.B capsid. In some embodiments, the AAV vector has a PHP.B2 capsid. In some embodiments, the AAV vector has a PHP.B3 capsid. In some embodiments, the AAV vector has a PHP. A capsid. In some embodiments, the AAV vector has a PHP. eb capsid. In some embodiments, the AAV vector has a PHP.S capsid.
  • the subject is a human subject.
  • a diagnosis of vestibular dysfunction can only be made in a subject with a mature vestibular system (e.g., a vestibular system that has completed the development process that occurs during a term pregnancy, which is defined as the onset of labor at 37 weeks or later (e.g., 37 weeks, 38 weeks, 39 weeks, 40 weeks, 41 weeks, 42 weeks, or later) in humans).
  • a mature vestibular system e.g., a vestibular system that has completed the development process that occurs during a term pregnancy, which is defined as the onset of labor at 37 weeks or later (e.g., 37 weeks, 38 weeks, 39 weeks, 40 weeks, 41 weeks, 42 weeks, or later) in humans).
  • the term “human subject” as used herein refers to human adults, adolescents, children, infants, and term newborns.
  • the subject is an adult.
  • the subject is an adolescent.
  • the subject is a child.
  • the subject is an infant.
  • the subject is a term newborn.
  • the vestibular dysfunction comprises vertigo, dizziness, loss of balance (imbalance), bilateral vestibulopathy, oscillopsia, or a balance disorder.
  • the vestibular dysfunction comprises loss of balance.
  • the vestibular dysfunction comprises vertigo.
  • the vestibular dysfunction comprises dizziness.
  • the vestibular dysfunction comprises bilateral vestibulopathy.
  • the vestibular dysfunction comprises oscillopsia.
  • the vestibular dysfunction comprises a balance disorder.
  • the vestibular dysfunction is age-related vestibular dysfunction, head trauma-related vestibular dysfunction, disease or infection-related vestibular dysfunction, or ototoxic (e.g., vestibulotoxic) drug-induced vestibular dysfunction.
  • the ototoxic drug is an aminoglycoside (an aminoglycoside antibiotic, e.g., gentamycin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin, amikacin, dibekacin, or netilmicin), viomycin, an antineoplastic drug (e.g., a platinum-containing chemotherapeutic agent, such as cisplatin, carboplatin, or oxaliplatin, or another chemotherapeutic agent, such as a nitrogen mustard or vincristine), a loop diuretic (e.g., ethacrynic acid or furosemide), a salicylate, or quinine.
  • an aminoglycoside antibiotic e.g., gentamycin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin, amikacin, dibekacin, or netilmicin
  • viomycin e.g., an an
  • the vestibular dysfunction is due to aminoglycoside ototoxicity. In some embodiments, the vestibular dysfunction is bilateral vestibulopathy due to aminoglycoside ototoxicity. In some embodiments, the vestibular dysfunction is oscillopsia due to aminoglycoside ototoxicity.
  • the vestibular dysfunction is associated with a genetic mutation.
  • the vestibular dysfunction is idiopathic vestibular dysfunction.
  • the method further comprises evaluating the vestibular function of the subject prior to administering the nucleic acid vector or composition.
  • the method further comprises evaluating the vestibular function of the subject after administering the nucleic acid vector or composition.
  • the Tbx2 inhibitor and/or regeneration agent is locally administered.
  • the Tbx2 inhibitor and/or regeneration agent is administered to the middle or inner ear (e.g., into the perilymph or endolymph, such as through the oval window, round window, or semicircular canal (e.g., the horizontal canal)).
  • the Tbx2 inhibitor and/or regeneration agent is administered to a semicircular canal (e.g., intra-labyrinth delivery).
  • the Tbx2 inhibitor and/or regeneration agent is administered to or through the oval window.
  • the Tbx2 inhibitor and/or regeneration agent is administered to or through the round window.
  • the Tbx2 inhibitor and/or regeneration agent is administered by transtympanic or intratympanic injection.
  • the Tbx2 inhibitor decreases the expression or activity of Tbx2.
  • the Tbx2 inhibitor, Sox2, inhibitor, or regeneration agent is administered in an amount sufficient to prevent or reduce vestibular dysfunction, delay the development of vestibular dysfunction, slow the progression of vestibular dysfunction, improve vestibular function, improve balance, reduce dizziness, reduce vertigo, increase Type I vestibular hair cell numbers, increase the generation of Type I vestibular hair cells, or promote or increase vestibular hair cell regeneration.
  • the Tbx2 inhibitor, Sox2 inhibitor, or regeneration agent increases the generation of Type I vestibular hair cells, increases the number of Type I vestibular hair cells, and/or induces or increases hair cell regeneration in the striolar region, in the extrastriolar region, or in both the striolar and extrastriolar regions of one or more vestibular organs (e.g., the utricle and/or the crista).
  • the Tbx2 inhibitor and/or regeneration agent increases the generation of Type I vestibular hair cells, increases the number of Type I vestibular hair cells, and/or induces or increases hair cell regeneration in the striolar region of one or more vestibular organs.
  • the Tbx2 inhibitor and/or regeneration agent increases the generation of Type I vestibular hair cells, increases the number of Type I vestibular hair cells, and/or induces or increases hair cell regeneration in the extrastriolar region of one or more vestibular organs. In some embodiments, the Tbx2 inhibitor and/or regeneration agent increases the generation of Type I vestibular hair cells, increases the number of Type I vestibular hair cells, and/or induces or increases hair cell regeneration in both the striolar and extrastriolar regions of one or more vestibular organs.
  • the Tbx2 inhibitor and/or regeneration agent increases the generation of Type I vestibular hair cells, increases the number of Type I vestibular hair cells, and/or induces or increases hair cell regeneration in the crista. In some embodiments of any of the foregoing aspects, the Tbx2 inhibitor and/or regeneration agent increases the generation of Type I vestibular hair cells, increases the number of Type I vestibular hair cells, and/or induces or increases hair cell regeneration in the utricle.
  • the Tbx2 inhibitor and/or regeneration agent increases the generation of Type I vestibular hair cells, increases the number of Type I vestibular hair cells, and/or induces or increases hair cell regeneration in both the crista and the utricle.
  • the term “about” refers to a value that is within 10% above or below the value being described.
  • administration refers to providing or giving a subject a therapeutic agent (e.g., an agent that reduces Tbx2 activity or expression), by any effective route. Exemplary routes of administration are described herein below.
  • a therapeutic agent e.g., an agent that reduces Tbx2 activity or expression
  • administering to the inner ear refers to providing or giving a therapeutic agent described herein to a subject by any route that allows for transduction of inner ear cells.
  • routes of administration to the inner ear include administration into the perilymph or endolymph, such as to or through the oval window, round window, or semicircular canal (e.g., horizontal canal), or by transtympanic or intratympanic injection, e.g., administration to a vestibular supporting cell.
  • cell type refers to a group of cells sharing a phenotype that is statistically separable based on gene expression data. For instance, cells of a common cell type may share similar structural and/or functional characteristics, such as similar gene activation patterns and antigen presentation profiles. Cells of a common cell type may include those that are isolated from a common tissue (e.g., epithelial tissue, neural tissue, connective tissue, or muscle tissue) and/or those that are isolated from a common organ, tissue system, blood vessel, or other structure and/or region in an organism.
  • tissue e.g., epithelial tissue, neural tissue, connective tissue, or muscle tissue
  • the terms “complementarity” or “complementary” of nucleic acids means that a nucleotide sequence in one strand of nucleic acid, due to orientation of its nucleobase groups, forms hydrogen bonds with another sequence on an opposing nucleic acid strand.
  • the complementary bases in DNA are typically A with T and C with G. In RNA, they are typically C with G and U with A. Complementarity can be perfect or substantial/sufficient. Perfect complementarity between two nucleic acids means that the two nucleic acids can form a duplex in which every base in the duplex is bonded to a complementary base by Watson-Crick pairing.
  • “Substantial” or “sufficient” complementary means that a sequence in one strand is not completely and/or perfectly complementary to a sequence in an opposing strand, but that sufficient bonding occurs between bases on the two strands to form a stable hybrid complex in set of hybridization conditions (e.g., salt concentration and temperature). Such conditions can be predicted by using the sequences and standard mathematical calculations to predict the Tm (melting temperature) of hybridized strands, or by empirical determination of Tm by using routine methods. Tm includes the temperature at which a population of hybridization complexes formed between two nucleic acid strands are 50% denatured (i.e., a population of double-stranded nucleic acid molecules becomes half dissociated into single strands).
  • conservative amino acid substitution refers to a substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric volume.
  • conservative amino acid families include (i) G, A, V, L and I; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W.
  • a conservative amino acid substitution is therefore one that substitutes one amino acid for a member of the same amino acid family (e.g., a substitution of Ser for Thr or Lys for Arg).
  • the terms “effective amount,” “therapeutically effective amount,” and a “sufficient amount” of a composition, vector construct, or viral vector described herein refer to a quantity sufficient to, when administered to the subject, including a mammal, for example a human, effect beneficial or desired results, including clinical results, and, as such, an “effective amount” or synonym thereto depends upon the context in which it is being applied. For example, in the context of treating vestibular dysfunction, it is an amount of the composition, vector construct, or viral vector sufficient to achieve a treatment response as compared to the response obtained without administration of the composition, vector construct, or viral vector.
  • a “therapeutically effective amount” of a composition, vector construct, or viral vector of the present disclosure is an amount which results in a beneficial or desired result in a subject as compared to a control.
  • a therapeutically effective amount of a composition, vector construct, or viral vector of the present disclosure may be readily determined by one of ordinary skill by routine methods known in the art. Dosage regimen may be adjusted to provide the optimum therapeutic response.
  • the term “endogenous” describes a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is found naturally in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, a tissue, or a cell, such as a human cell, e.g., a human vestibular supporting cell).
  • a particular organism e.g., a human
  • a particular location within an organism e.g., an organ, a tissue, or a cell, such as a human cell, e.g., a human vestibular supporting cell.
  • the term “express” refers to one or more of the following events: (1 ) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and/or 3' end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.
  • exogenous describes a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is not found naturally in a particular organism (e.g., a human) or in a particular location within an organism (e.g., an organ, a tissue, or a cell, such as a human cell, e.g., a human vestibular supporting cell).
  • Exogenous materials include those that are provided from an external source to an organism or to cultured matter extracted there from.
  • exon refers to a region within the coding region of a gene, the nucleotide sequence of which determines the amino acid sequence of the corresponding protein.
  • exon also refers to the corresponding region of the RNA transcribed from a gene. Exons are transcribed into pre-mRNA and may be included in the mature mRNA depending on the alternative splicing of the gene. Exons that are included in the mature mRNA following processing are translated into protein, wherein the sequence of the exon determines the amino acid composition of the protein.
  • heterologous refers to a combination of elements that is not naturally occurring.
  • a heterologous transgene refers to a transgene that is not naturally expressed by the promoter to which it is operably linked.
  • the terms “increasing” and “decreasing” refer to modulating resulting in, respectively, greater or lesser amounts, of function, expression, or activity of a metric relative to a reference.
  • the amount of a marker of a metric e.g., Tbx2 expression
  • the amount of a marker of a metric may be increased or decreased in a subject by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more relative to the amount of the marker prior to administration.
  • the metric is measured subsequent to administration at a time that the administration has had the recited effect, e.g., at least one week, one month, 3 months, or 6 months, after a treatment regimen has begun.
  • linker refers to a series of nucleotides that connects two different regions of a polynucleotide.
  • a linker is functionally inert and does not disrupt the function of the two regions of the polynucleotide that it connects.
  • locally or “local administration” means administration at a particular site of the body intended for a local effect and not a systemic effect.
  • local administration are epicutaneous, inhalational, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intra-lesional administration, lymph node administration, intratumoral administration, administration to the middle or inner ear, and administration to a mucous membrane of the subject, wherein the administration is intended to have a local and not a systemic effect.
  • operably linked refers to a first molecule joined to a second molecule, wherein the molecules are so arranged that the first molecule affects the function of the second molecule.
  • the two molecules may or may not be part of a single contiguous molecule and may or may not be adjacent.
  • a promoter is operably linked to a transcribable polynucleotide molecule if the promoter modulates transcription of the transcribable polynucleotide molecule of interest in a cell.
  • two portions of a transcription regulatory element are operably linked to one another if they are joined such that the transcription-activating functionality of one portion is not adversely affected by the presence of the other portion.
  • Two transcription regulatory elements may be operably linked to one another by way of a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operably linked to one another with no intervening nucleotides present.
  • plasmid refers to a to an extrachromosomal circular double stranded DNA molecule into which additional DNA segments may be ligated.
  • a plasmid is a type of vector, a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • Certain plasmids are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial plasmids having a bacterial origin of replication and episomal mammalian plasmids).
  • Other vectors e.g., non-episomal mammalian vectors
  • Certain plasmids are capable of directing the expression of genes to which they are operably linked.
  • polynucleotide refers to a polymer of nucleosides.
  • a polynucleotide is composed of nucleosides that are naturally found in DNA or RNA (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) joined by phosphodiester bonds.
  • nucleosides or nucleoside analogs containing chemically or biologically modified bases, modified backbones, etc., whether or not found in naturally occurring nucleic acids, and such molecules may be preferred for certain applications.
  • this application refers to a polynucleotide it is understood that both DNA, RNA, and in each case both single- and double-stranded forms (and complements of each single-stranded molecule) are provided.
  • Polynucleotide sequence as used herein can refer to the polynucleotide material itself and/or to the sequence information (i.e., the succession of letters used as abbreviations for bases) that biochemically characterizes a specific nucleic acid. A polynucleotide sequence presented herein is presented in a 5' to 3' direction unless otherwise indicated.
  • a polynucleotide that can be transcribed to produce refers to a polynucleotide that can direct the production of an RNA or protein, e.g., via transcription or translation.
  • a polynucleotide can be incorporated into a nucleic acid vector or an expression cassette.
  • polynucleotide that can be transcribed to produce and “polynucleotide encoding” are used interchangeably herein to refer to a polynucleotide that can direct the production of a Tbx2 inhibitor, such as a dominant negative Tbx2 protein or an inhibitory RNA (e.g., siRNA, shRNA, or miRNA) targeting Tbx2, or a regeneration agent, such as an Atohl protein or an inhibitory RNA targeting Notch.
  • a Tbx2 inhibitor such as a dominant negative Tbx2 protein or an inhibitory RNA (e.g., siRNA, shRNA, or miRNA) targeting Tbx2, or a regeneration agent, such as an Atohl protein or an inhibitory RNA targeting Notch.
  • promoter refers to a recognition site on DNA that is bound by an RNA polymerase.
  • the polymerase drives transcription of the transgene.
  • Percent (%) sequence identity with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software.
  • percent sequence identity values may be generated using the sequence comparison computer program BLAST.
  • percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows:
  • the term “pharmaceutical composition” refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharmaceutically acceptable excipients, diluents, and/or carriers, to be administered to a subject, such as a mammal, e.g., a human, in order to prevent, treat or control a particular disease or condition affecting or that may affect the subject.
  • the term “pharmaceutically acceptable” refers to those compounds, materials, compositions and/or dosage forms, which are suitable for contact with the tissues of a subject, such as a mammal (e.g., a human) without excessive toxicity, irritation, allergic response and other problem complications commensurate with a reasonable benefit/risk ratio.
  • Regeneration agent refers to an agent that promotes the regeneration of hair cells from supporting cells.
  • Regeneration agents include agents that increase the expression (e.g., lead to overexpression) of Atonal BHLH transcription factor 1 (Atohl ) in vestibular supporting cells.
  • Atohl can be overexpressed using a vector, e.g., a viral vector, such as an AAV vector, adenoviral vector, or lentiviral vector, containing a polynucleotide encoding Atohl .
  • Atohl expression can also be increased using one or more small molecules found to promote regeneration (e.g., using a method described in U.S. Patent Nos.
  • Regeneration agents also include agents that inhibit Notch in vestibular supporting cells, such as small molecule inhibitors (e.g., gamma- secretase inhibitors), inhibitory RNA molecules (e.g., siRNA, shRNA, or miRNA) directed to Notch or to the Notch promoter, or anti-Notch antibodies.
  • small molecule inhibitors e.g., gamma- secretase inhibitors
  • inhibitory RNA molecules e.g., siRNA, shRNA, or miRNA directed to Notch or to the Notch promoter, or anti-Notch antibodies.
  • Agents that increase Atohl expression and agents that inhibit Notch can be used separately or in combination.
  • Sox2 inhibitor refers to an agent that reduces Sox2 activity or expression.
  • Sox2 inhibitors include inhibitory RNA molecules (e.g., siRNA, shRNA, or miRNA) directed to Sox2 mRNA or to a Sox2 promoter, components of gene editing systems that target Sox2 (e.g., gene editing systems such as CRISPR, ZFN, and TALEN-based systems), and dominant negative Sox2 proteins.
  • Tbx2 inhibitor refers to an agent that reduces Tbx2 activity or expression.
  • Tbx2 inhibitors include inhibitory RNA molecules (e.g., siRNA, shRNA, or miRNA) directed to Tbx2 mRNA or to a Tbx2 promoter, components of gene editing systems that target Tbx2 (e.g., gene editing systems such as CRISPR, ZFN, and TALEN-based systems), and dominant negative Tbx2 proteins.
  • transcription regulatory element refers to a nucleic acid that controls, at least in part, the transcription of a gene of interest.
  • Transcription regulatory elements may include promoters, enhancers, and other nucleic acids (e.g., polyadenylation signals) that control or help to control gene transcription. Transcription regulatory elements are described, for example, in Lorence, Recombinant Gene Expression: Reviews and Protocols (Humana Press, New York, NY, 2012).
  • transfection refers to any of a wide variety of techniques commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, e.g., electroporation, lipofection, calcium phosphate precipitation, DEAE-dextran transfection, Nucleofection, squeeze-poration, sonoporation, optical transfection, magnetofection, impalefection and the like.
  • the terms “subject” and “patient” refer to an animal (e.g., a mammal, such as a human).
  • a subject to be treated according to the methods described herein may be one who has been diagnosed with vestibular dysfunction (e.g., dizziness, vertigo, imbalance or loss of balance, bilateral vestibulopathy, oscillopsia, or a balance disorder) or one at risk of developing these conditions (e.g., due to a genetic mutation or exposure to an insult that can cause vestibular hair cell damage or death, such as exposure to an ototoxic drug, head trauma, affliction with certain diseases or infections, or aging).
  • Diagnosis may be performed by any method or technique known in the art.
  • a subject to be treated according to the present disclosure may have been subjected to standard tests or may have been identified, without examination, as one at risk due to the presence of one or more risk factors associated with the disease or condition.
  • transduction refers to a method of introducing a vector construct or a part thereof into a cell.
  • the vector construct is contained in a viral vector such as for example an AAV vector
  • transduction refers to viral infection of the cell and subsequent transfer and integration of the vector construct or part thereof into the cell genome.
  • treatment and “treating” in reference to a disease or condition, refer to an approach for obtaining beneficial or desired results, e.g., clinical results.
  • beneficial or desired results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable.
  • “Ameliorating” or “palliating” a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder, as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented.
  • vector includes a nucleic acid vector, e.g., a DNA vector, such as a plasmid, cosmid, or artificial chromosome, an RNA vector, a virus, or any other suitable replicon (e.g., viral vector).
  • a DNA vector such as a plasmid, cosmid, or artificial chromosome
  • RNA vector e.g., a virus
  • any other suitable replicon e.g., viral vector.
  • a variety of vectors have been developed for the delivery of polynucleotides encoding exogenous proteins into a prokaryotic or eukaryotic cell. Examples of such expression vectors are described in, e.g., Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006).
  • Expression vectors suitable for use with the compositions and methods described herein contain a polynucleotide sequence as well as, e.g., additional sequence elements used for the expression of proteins and/or the integration of these polynucleotide sequences into the genome of a mammalian cell.
  • Certain vectors that can be used for the expression of transgene as described herein include vectors that contain regulatory sequences, such as promoter and enhancer regions, which direct gene transcription.
  • Other useful vectors for expression of a transgene contain polynucleotide sequences that enhance the rate of translation of the transgene or improve the stability or nuclear export of the mRNA that results from gene transcription.
  • sequence elements include, e.g., 5’ and 3’ untranslated regions and a polyadenylation signal site in order to direct efficient transcription of the gene carried on the expression vector.
  • the expression vectors suitable for use with the compositions and methods described herein may also contain a polynucleotide encoding a marker for selection of cells that contain such a vector. Examples of a suitable marker include genes that encode resistance to antibiotics, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.
  • vestibular hair cell refers to group of specialized cells in the inner ear that are involved in sensing movement and contribute to the sense of balance and spatial orientation. There are two types of vestibular hair cells: Type I and Type II hair cells. Vestibular hair cells are located in the semicircular canal end organs and otolith organs of the inner ear. Damage to vestibular hair cells and genetic mutations that disrupt vestibular hair cell function are implicated in vestibular dysfunction such as vertigo and imbalance disorders.
  • vestibular supporting cell refers to a collection of specialized epithelial cells in the vestibular system of the inner ear that are involved in vestibular hair cell development, survival, function, death, and phagocytosis.
  • Vestibular supporting cells provide structural support to vestibular hair cells by anchoring them in the sensory epithelium and releasing neurotrophic factors important for hair cell innervation.
  • wild-type refers to a genotype with the highest frequency for a particular gene in a given organism.
  • FIGS. 1A-1C show scRNAseq ridge plot and violin plot data analysis demonstrating that Tbx2 downregulation is associated with Type I (T1 ) hair cell maturation.
  • FIG. 1 A shows mRNA expression of Tbx2 in adult mouse vestibular supporting cells and hair cells. Supporting cells (SC) and Type II (T2) hair cells showed higher expression relative to Type I hair cells.
  • FIG. 1 B shows hair cell and supporting cell maturity scores at P14 and
  • FIG. 1 C shows associated Tbx2 mRNA expression levels plotted against P14 T1 hair cell maturity scores. Expression was correlated with a hair cell maturity score as defined by the expression of genes that have been previously shown to increase as cells reach maturity. Onset of Type I hair cell maturation was associated with Tbx2 downregulation.
  • FIGS. 2A-2B show scRNAseq SCENIC and UMAP data analysis indicating that Tbx2 and Sox2 have bidirectional regulatory relationships with one another, and that Tbx2 knockdown may be required along with Sox2 knock down to produce mature and functional T1 hair cells.
  • FIG. 2A shows regulatory interactions between Tbx2 and Sox2 in mouse utricles during normal development and maturation. A subset of a gene regulatory network was calculated using SCENIC (Aibar et al., Nature Methods 14:1083- 1086, 2017), based on expression data from mouse vestibular system throughout in utero development and early adult ages. There is a direct regulatory relationship from Sox2 to Tbx2, as well as several indirect paths from Tbx2 to Sox2.
  • FIG. 2B shows that conditional knockout of Sox2 in Type II hair cells drove their conversion into a new more Type Hike cell type "converting Type II.” However, unlike native Type I hair cells, Tbx2 expression remained high in this converting population.
  • compositions and methods for reducing Tbx2 activity or expression in vestibular hair cells of the inner ear features Tbx2 inhibitors (e.g., agents that reduce Tbx2 activity or expression, such as inhibitory RNA molecules directed to Tbx2, nuclease systems directed to Tbx2, and dominant negative Tbx2 proteins).
  • Tbx2 inhibitors e.g., agents that reduce Tbx2 activity or expression, such as inhibitory RNA molecules directed to Tbx2, nuclease systems directed to Tbx2, and dominant negative Tbx2 proteins.
  • the compositions and methods described herein can be used to convert Type II vestibular hair cells, regenerated vestibular hair cells, or immature vestibular hair cells into Type I vestibular hair cells.
  • compositions described herein can be administered to a subject (such as a mammalian subject, for example, a human) to treat disorders caused by dysfunction of, damage to, or loss of vestibular hair cells, such as vestibular dysfunction (e.g., dizziness, vertigo, imbalance or loss of balance, bilateral vestibulopathy, oscillopsia, or a balance disorder).
  • a subject such as a mammalian subject, for example, a human
  • vestibular dysfunction e.g., dizziness, vertigo, imbalance or loss of balance, bilateral vestibulopathy, oscillopsia, or a balance disorder.
  • Hair cells are sensory cells of the auditory and vestibular systems that reside in the inner ear.
  • Cochlear hair cells are the sensory cells of the auditory system and are made up of two main cell types: inner hair cells, which are responsible for sensing sound, and outer hair cells, which are thought to amplify low-level sound.
  • Vestibular hair cells are located in the semicircular canal end organs and otolith organs of the inner ear and are involved in the sensation of movement that contributes to the sense of balance and spatial orientation. Hair cells are named for the stereocilia that protrude from the apical surface of the cell, forming a hair cell bundle.
  • Deflection of the stereocilia leads to the opening of mechanically gated ion channels, which allows hair cells to release neurotransmitters to activate nerves, thereby converting mechanical sound or motion signals into electrical signals that can be transmitted to the brain.
  • Cochlear hair cells are essential for normal hearing, and damage to cochlear hair cells and genetic mutations that disrupt cochlear hair cell function are implicated in hearing loss and deafness.
  • vestibular hair cells and genetic mutations that disrupt vestibular hair cell function are implicated in vestibular dysfunction, such as loss of balance, balance disorders, vertigo, dizziness, bilateral vestibulopathy (also known as bilateral vestibular hypofunction), and oscillopsia.
  • the vestibular system contains two types of hair cells: Type I hair cells, which have a flask morphology, long stereocilia, and are classically defined by the presence of cup-shaped, calyceal afferent innervation, and Type II hair cells, which have a cylindrical morphology, short stereocilia, and synapse upon discrete bouton afferent terminals.
  • Type I hair cells which have a flask morphology, long stereocilia, and are classically defined by the presence of cup-shaped, calyceal afferent innervation
  • Type II hair cells which have a cylindrical morphology, short stereocilia, and synapse upon discrete bouton afferent terminals.
  • Sox2 transcription factor expression expressed in Type II hair cells but not Type I hair cells
  • calcium binding protein expression can be reliable indicators of hair cell subtypes (Oesterle et al., J. Assoc. Res. Otolaryngol. 9(1 ):65-89, 2008).
  • Type I hair cells possess a unique, outwardly rectifying low-voltage-activated potassium conductance called gKL. This feature makes Type I hair cells particularly well-suited to detect higher frequency stimuli with little phase delay, which is likely essential for driving fast reflexes (Burns and Stone, Semin Cell Dev Biol. 65:96-105, 2017).
  • Type I and Type II hair cells are found in both central (referred to as the striola in the utricle and saccule) and extrastriolar/peripheral zones of all five vestibular organs, usually in roughly equal ratios, of all mammals that have been examined, including humans. Accumulating evidence indicates that Type I hair cells, particularly those located centrally within the sensory epithelium, may be better suited for the detection of high frequency head movements compared to Type II hair cells (Burns and Stone, supra).
  • Type II hair cells appear to be less differentiated than Type I hair cells based on electrophysiology, innervation, morphology, and gene expression. Furthermore, single-cell RNA-Seq shows that expression of many supporting cell-specific genes persists in Type II hair cells compared to other, more differentiated hair cells. Although the functional role of Type I and II hair cells is still being elucidated, some evidence suggests that Type I hair cells might encode most motions relevant to balance function in humans. Regeneration of Type I hair cells could therefore have a profound impact on recovery of lost vestibular function. The process of generating new Type I hair cells can also result in the recruitment of new calyceal nerve endings to those cells. Calyces are specialized afferent terminals that transmit signals from Type I hair cells to the brain.
  • the development of the vestibular organs is known to begin as patches of sensory epithelia located in the mid-ventral region of the embryonic inner ear. Some cells within these sensory patches become post-mitotic as early as E1 1 in the mouse and the first differentiating hair cells can be seen by E12. Terminal mitoses begin in the striolar/central portions of the sensory epithelia, and then by 3-4 days later most cell cycle exit occurs at the periphery. Mitotic addition of new hair cells at the periphery of the sensory region continues for 2-4 days after birth, at least in the utricle. In parallel, the total number of hair cells in the sensory epithelium continues to increase significantly until just after the first week of birth, indicating that differentiation of progenitor cells into hair cells can be delayed for several days after cell cycle exit (Burns and Stone, supra).
  • Type I and II hair cells in striolar/central regions differ from their counterparts in extrastriolar/peripheral regions; however, the embryonic versus postnatal separation of Type I and Type II hair cell differentiation appears to hold regardless of region (Burns and Stone, supra).
  • the finding that Type I hair cells primarily differentiate embryonically came as somewhat of a surprise given that the hallmark electrophysiological characteristic of Type I hair cells, gKL, is not readily detectable in the majority of Type I hair cells until the first or second postnatal week (Rusch et al., J. Neurosci. 18(18):7487-7501 , 1998).
  • Type I hair cell differentiation there are two phases of Type I hair cell differentiation: an embryonic phase that might represent commitment to a Type I phenotype and a later, postnatal phase in which distinct Type I functionality emerges.
  • an embryonic phase that might represent commitment to a Type I phenotype
  • a later, postnatal phase in which distinct Type I functionality emerges.
  • mice in which there are distinct and important differentiation events that span from mid-embryonic ages through at least the first two weeks after birth. The molecular cues that control these processes are also beginning to emerge.
  • Recent work using conditional knockout mice has demonstrated that retinoic acid signaling controls the establishment of differences between striolar/central and extrastriolar/peripheral regions (Ono et al., Nat. Commun. 11 (1 ):63, 2020).
  • Type II hair cells There is some spontaneous regeneration of hair cells that occurs in the vestibular system of mammals, but this mechanism appears to only produce Type II hair cells.
  • the methods described to date that seek to stimulate regeneration of vestibular hair cells appear to only produce Type II hair cells.
  • Type I hair cells are often more susceptible to damage than Type II hair cells, and in many vestibular pathologies Type II hair cells survive and persist in the sensory epithelia. Accordingly, it would be beneficial to differentiate regenerated hair cells into Type I hair cells (e.g., Type I hair cells that are able recruit new calyceal nerve endings). Converting pre-existing Type II hair cells into Type I hair cells could also have therapeutic benefit.
  • Tbx2 is a transcription factor in the T-box transcription factor family that has been found to act as a transcriptional repressor to regulate embryonic limb development, cardiac development, and brain development.
  • the present invention is based, in part, on the discovery by the present inventors that Tbx2 is expressed in vestibular Type II hair cells and not in vestibular Type I hair cells, an expression pattern that suggests that Tbx2 may promote Type II hair cell fate and, therefore, that inhibition of Tbx2 may promote conversion of Type II hair cells into Type I hair cells.
  • the present invention provides methods of generating Type I vestibular hair cells (e.g., from Type II vestibular hair cells, regenerating or regenerated vestibular hair cells, immature vestibular hair cells, or vestibular supporting cells that are then regenerated into vestibular hair cells) by reducing Tbx2 activity or expression using a Tbx2 inhibitor.
  • Type I vestibular hair cells e.g., from Type II vestibular hair cells, regenerating or regenerated vestibular hair cells, immature vestibular hair cells, or vestibular supporting cells that are then regenerated into vestibular hair cells
  • Type I vestibular hair cells would have therapeutic utility for the treatment of subjects suffering from vestibular dysfunction (e.g., dizziness, vertigo, imbalance or loss of balance, bilateral vestibulopathy, oscillopsia, or a balance disorder), such as adult subjects suffering from acquired vestibular dysfunction (e.g., age-related vestibular dysfunction, head trauma-related vestibular dysfunction, ototoxic drug-induced vestibular dysfunction, or disease or infection-related vestibular dysfunction).
  • the Tbx2 inhibitor can be administered in combination with an agent that promotes vestibular hair cell regeneration to produce additional vestibular hair cells for conversion into Type I vestibular hair cells.
  • the Tbx2 inhibitors can be directed to a human or murine Tbx2 sequence provided in Table 2 and be expressed using a hair cell, Type II hair cell, immature hair cell, or supporting cell promoter to induce cell-type specific expression.
  • the Tbx2 inhibitors can also be expressed using ubiquitous promoters if specificity will be achieved using other approaches (e.g., a particular AAV capsid).
  • administration of a Tbx2 inhibitor can be performed in combination with methods that promote hair cell regeneration (e.g., Atohl overexpression or Notch inhibition) to provide regenerated hair cells for conversion into Type I hair cells.
  • Type I vestibular hair cells can be used to treat subjects having or at risk of developing vestibular dysfunction, such as loss of balance, dizziness, vertigo, bilateral vestibulopathy, oscillopsia, or a balance disorder.
  • Tbx2 inhibitors such as loss of balance, dizziness, vertigo, bilateral vestibulopathy, oscillopsia, or a balance disorder.
  • a Tbx2 inhibitor for use in the methods and compositions described herein may inhibit Tbx2 by reducing Tbx2 activity or expression.
  • the Tbx2 inhibitor may be a nucleic acid molecule (e.g., an RNA or DNA molecule), a protein, or a component of a gene editing system.
  • the Tbx2 inhibitor reduces Tbx2 activity or expression in Type II hair cells in the vestibular system.
  • a Tbx2 inhibitor can also be used to reduce Tbx2 activity or expression in hair cells that have been produced by regeneration (regenerated hair cells), in hair cells that are currently undergoing regeneration (regenerating hair cells), or in immature vestibular hair cells.
  • the Tbx2 inhibitor is delivered to a supporting cell before the supporting cell is made to regenerate into a hair cell. Exemplary Tbx2 inhibitors are described herein below.
  • the Tbx2 inhibitor is an inhibitory RNA molecule, e.g., that acts by way of the RNA interference (RNAi) pathway.
  • RNAi RNA interference
  • An inhibitory RNA molecule can decrease the expression level (e.g., protein level or mRNA level) of Tbx2.
  • Inhibitory RNA molecules include short interfering RNA (siRNA) molecules, short hairpin RNA (shRNA) molecules, and/or microRNA (miRNA) molecules that target full-length Tbx2.
  • siRNA short interfering RNA
  • shRNA short hairpin RNA
  • miRNA microRNA
  • An siRNA is a double-stranded RNA molecule that typically has a length of about 19-25 base pairs.
  • An shRNA is an RNA molecule containing a hairpin turn that decreases expression of target genes via RNAi.
  • shRNAs can be delivered to cells in the form of plasmids, e.g., viral or bacterial vectors, such as adeno-associated virus vectors (AAV vectors), e.g., by transfection, electroporation, or transduction.
  • An shRNA can also be embedded into the backbone of a miRNA (e.g., miRNA-30 or mir-E, e.g., to produce an shRNA-mir), as described in Silva et al., Nature Genetics 37:1281 -1288, 2005; and Fellmann et al., Cell Reports 5:1704-1713, 2013, to achieve highly efficient target gene knockdown.
  • the target sequence for an siRNA or shRNA directed to TBX2 is ACAGCTGAAGATCGACAACAA (SEQ ID NO: 5), CACCAACAACATCTCGGACAAA (SEQ ID NO: 6), or GCCTGGACAAGAAGGCCAAATA (SEQ ID NO: 7) as described in Peres et al., Genes Cancer 1 :272- 282, 2010 and Manning et al., Dev Cell. 11 :873-885, 2006. Exemplary siRNA sequences are described in Lv et al., Oncotarget 8:52699-52707, 2017; Crawford et al., Oncogene 38:5971 -5986, 2019; Prince et al., Cancer Res.
  • the siRNA or shRNA targeting Tbx2 has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases (e.g., 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , or more nucleobases) having at least 70% complementarity (e.g., 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of a target region of an mRNA transcript of a human (e.g., SEQ ID NO: 1 ) or murine (SEQ ID NO: 3) TBX2 gene.
  • a human e.g., SEQ ID NO: 1
  • murine SEQ ID NO:
  • the target region is at least 8 to 21 (e.g., 8 to 21 , 9 to 21 , 10 to 21 , 11 to 21 , 12 to 21 , 13 to 21 , 14 to 21 , 15 to 21 , 16 to 21 , 17 to 21 , 18 to 21 , 19 to 21 , 20 to 21 , or all 21 ) contiguous nucleobases of SEQ ID NO: 5.
  • the siRNA or shRNA targets SEQ ID NO: 5.
  • the target region is at least 8 to 22 (e.g., 8 to 22, 9 to 22, 10 to 22, 11 to 22, 12 to 22, 13 to 22, 14 to 22, 15 to 22, 16 to 22, 17 to 22, 18 to 22, 19 to 22, 20 to 22, 21 to 22, or all 22) contiguous nucleobases of SEQ ID NO: 6 or SEQ ID NO: 7.
  • the siRNA or shRNA targets SEQ ID NO: 6 or SEQ ID NO: 7.
  • the shRNA has at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to the entire length of SEQ ID NO: 5. In some embodiments, the shRNA has 100% complementarity to the entire length of SEQ ID NO: 5.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity
  • the shRNA has at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to the entire length of SEQ ID NO: 6 or SEQ ID NO: 7. In some embodiments, the shRNA has 100% complementarity to the entire length of SEQ ID NO: 6 or SEQ ID NO: 7.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 9
  • the shRNA has the sequence of any one of SEQ ID NOs: 72-89. In some embodiments, the shRNA has the sequence of any one of SEQ ID NOs: 72-81 . In some embodiments, the shRNA is embedded into the backbone of a miRNA (e.g., miRNA-30 or mir-E, e.g., to produce an shRNA-mir).
  • a miRNA e.g., miRNA-30 or mir-E, e.g., to produce an shRNA-mir.
  • the siRNA has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to any one of SEQ ID NOs: 8-24.
  • the siRNA has the sequence of any one of SEQ ID NOs: 8-24.
  • the siRNA sense and anti-sense strands have the sequences of SEQ ID NO: 25 and SEQ ID NO: 26.
  • a miRNA is a non-coding RNA molecule that typically has a length of about 22 nucleotides. miRNAs bind to target sites on messenger RNA (mRNA) molecules and silence the mRNA, e.g., by causing cleavage of the mRNA, destabilization of the mRNA, or inhibition of translation of the mRNA.
  • mRNA messenger RNA
  • siRNA, shRNA, and miRNA molecules for use in the methods and compositions described herein can target the mRNA sequence of Tbx2 (e.g., human Tbx2 mRNA, which has the sequence of SEQ ID NO: 1 , or murine Tbx2 mRNA, which has the sequence of SEQ ID NO: 3).
  • a miRNA that targets a Tbx2 promoter can also be used to silence Tbx2.
  • miRNA molecules that inhibit Tbx2 include hsa-miR-1180, hsa-miR-1203, hsa-miR-1205, hsa-miR-1207-5p, hsa-miR-1224-3p, hsa-miR-124-3p, hsa-miR-1292, hsa- miR-1470, hsa-miR-153, hsa-miR-21 , hsa-miR-216b, hsa-miR-3120-3p, hsa-miR-3175, hsa-miR-3186- 3p, hsa-miR-3192, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-m
  • the miRNA molecule that inhibits Tbx2 is hsa-miR-1180, hsa-miR-1203, hsa-miR- 1205, hsa-miR-1207-5p, hsa-miR-1224-3p, hsa-miR-124-3p, hsa-miR-1292, hsa-miR-1470, hsa-miR-153, or hsa-miR-21 .
  • siRNA molecules may be delivered without a delivery vehicle, or they may be encapsulated in a nanoparticle (e.g., a lipid nanoparticle) for administration.
  • siRNA, shRNA, and miRNA molecules may be delivered using a plasmid, such as a viral vector (e.g., an AAV vector), and they may be expressed using a cell type-specific promoter (e.g., a hair cell promoter, Type II hair cell promoter, or a supporting cell promoter) or using a ubiquitous promoter (e.g., a ubiquitous pol II or pol III promoter).
  • a viral vector e.g., an AAV vector
  • a cell type-specific promoter e.g., a hair cell promoter, Type II hair cell promoter, or a supporting cell promoter
  • a ubiquitous promoter e.g., a ubiquitous pol II or pol III promoter
  • an inhibitory RNA molecule can be modified, e.g., to contain modified nucleotides, e.g., 2’-fluoro, 2’-o-methyl, 2’-deoxy, unlocked nucleic acid, 2’-hydroxy, phosphorothioate, 2’-thiouridine, 4’-thiouridine, 2’-deoxyuridine. Without wishing to be bound by theory, it is believed that certain modifications can increase nuclease resistance and/or serum stability or decrease immunogenicity.
  • the inhibitory RNA molecule decreases the level and/or activity or function of Tbx2.
  • the inhibitory RNA molecule inhibits expression of Tbx2.
  • the inhibitor RNA molecule increases degradation of Tbx2 and/or decreases the stability (i.e., half-life) of Tbx2.
  • the inhibitory RNA molecule can be chemically synthesized or transcribed in vitro.
  • inhibitory therapeutic agents based on non-coding RNA such as ribozymes, RNAse P, siRNAs, and miRNAs are also known in the art, for example, as described in Sioud, RNA Therapeutics: Function, Design, and Delivery (Methods in Molecular Biology). Humana Press 2010.
  • the Tbx2 inhibitor is a component of a gene editing system.
  • the Tbx2 inhibitor introduces an alteration (e.g., insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation) in Tbx2.
  • exemplary gene editing systems include the zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and the clustered regulatory interspaced short palindromic repeat (CRISPR) system. ZFNs, TALENs, and CRISPR-based methods are described, e.g., in Gaj et al. Trends Biotechnol. 31 .7(2013):397-405.
  • a CRISPR system refers to a system derived from CRISPR and Cas (a CRISPR-associated protein) or other nuclease that can be used to silence or mutate a gene described herein.
  • the CRISPR system is a naturally occurring system found in bacterial and archaeal genomes.
  • the CRISPR locus is made up of alternating repeat and spacer sequences.
  • the spacers are typically sequences that are foreign to the bacterium (e.g., plasmid or phage sequences).
  • the CRISPR system has been modified for use in gene editing (e.g., changing, silencing, and/or enhancing certain genes) in eukaryotes.
  • such modification of the system includes introducing into a eukaryotic cell a plasmid containing a specifically designed CRISPR and one or more appropriate Cas proteins.
  • the CRISPR locus is transcribed into RNA and processed by Cas proteins into small RNAs that contain a repeat sequence flanked by a spacer.
  • the RNAs serve as guides to direct Cas proteins to silence specific DNA/RNA sequences, depending on the spacer sequence.
  • the CRISPR system includes the Cas9 protein, a nuclease that cuts on both strands of the DNA. See, e.g., Id.
  • a CRISPR-Cpf1 system can be used, which is an RNA-guided, class II CRISPR/Cas system that is analogous to CRISPR-Cas9 and has lower off-target incidence (see Moon et al., Nature Communications 9, 3651 (2018)).
  • the guide RNA can be embedded in the untranslated region of the transgene used to deliver the gene editing system.
  • the spacers of the CRISPR are derived from a target gene sequence, e.g., from a Tbx2 sequence.
  • the Tbx2 inhibitor includes a guide RNA (gRNA) for use in a CRISPR system for gene editing.
  • the Tbx2 inhibitor is a ZFN, or an mRNA encoding a ZFN, that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of Tbx2.
  • the Tbx2 inhibitor includes a TALEN, or an mRNA encoding a TALEN, that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of Tbx2.
  • the gRNA can be used in a CRISPR system to engineer an alteration in a gene (e.g., Tbx2).
  • the ZFN and/or TALEN can be used to engineer an alteration in a gene (e.g., Tbx2).
  • Exemplary alterations include insertions, deletions (e.g., knockouts), translocations, inversions, single point mutations, or other mutations.
  • the alteration can be introduced in the gene in a cell, e.g., in vitro, ex vivo, or in vivo.
  • the alteration decreases the level and/or activity of (e.g., knocks down or knocks out) Tbx2, e.g., the alteration is a negative regulator of function.
  • the CRISPR system is used to edit (e.g., to add or delete a base pair) a target gene, e.g., Tbx2.
  • the CRISPR system is used to introduce a premature stop codon, e.g., thereby decreasing the expression of a target gene.
  • the CRISPR system is used to turn off a target gene in a reversible manner, e.g., similarly to RNA interference.
  • the CRISPR system is used to direct Cas to a promoter of a target gene, e.g., Tbx2, thereby blocking an RNA polymerase sterically.
  • a CRISPR system can be generated to edit Tbx2 using technology described in, e.g., U.S. Publication No. 20140068797; Cong, Science 339: 819, 2013; Tsai, Nature Biotechnol., 32:569, 2014; and U.S. Patent Nos.: 8,871 ,445; 8,865,406; 8,795,965; 8,771 ,945; and 8,697,359.
  • the CRISPR interference (CRISPRi) technique can be used for transcriptional repression of specific genes, e.g., the gene encoding Tbx2.
  • an engineered Cas9 protein e.g., nuclease-null dCas9, or a dCas9 fusion protein, e.g., dCas9-KRAB or dCas9-SID4X fusion
  • sgRNA sequence specific guide RNA
  • the Cas9-gRNA complex can block RNA polymerase, thereby interfering with transcription elongation.
  • the complex can also block transcription initiation by interfering with transcription factor binding.
  • the CRISPRi method is specific with minimal off- target effects and is multiplexable, e.g., can simultaneously repress more than one gene (e.g., using multiple gRNAs). Also, the CRISPRi method permits reversible gene repression.
  • the components of the gene editing system can be delivered using a plasmid, e.g., a viral vector, such as an AAV vector.
  • a hair cell, Type II hair cell, immature vestibular hair cell, or supporting cell promoter can be used to direct expression of the gene editing system in regenerated or regenerating hair cells, in Type II hair cells, in immature hair cells, or in vestibular supporting cells to knockdown or knockout Tbx2 in these cell types and convert them to Type I hair cells.
  • the components of the gene editing system or a plasmid (e.g., AAV vector) encoding the components of the gene editing system are delivered using a nanoparticle (e.g., a lipid nanoparticle).
  • the Tbx2 inhibitor is a dominant negative Tbx2 protein.
  • the dominant negative Tbx2 protein can be delivered to regenerated or regenerating hair cells, to Type II hair cells, to immature vestibular hair cells, or to vestibular supporting cells using a plasmid, e.g., a viral vector, such as an AAV vector, containing a polynucleotide encoding the dominant negative Tbx2 protein.
  • the polynucleotide encoding the dominant negative Tbx2 protein can be operably linked to a promoter that induces expression in a cell type of interest, e.g., in a hair cell, Type II hair cell, or vestibular supporting cell.
  • the dominant negative Tbx2 protein has the sequence of amino acids 1 -361 of human Tbx2 (e.g., amino acids 1 -361 of SEQ ID NO: 2), which is the N-terminal half of human Tbx2 including the T-box domain (as described in Crawford et al., Oncogene 38:5971 -5986, 2019).
  • the dominant negative Tbx2 protein has the sequence of amino acids 1 -301 of murine Tbx2 (e.g., amino acids 1 -301 of SEQ ID NO: 4), which is the N-terminal half of murine Tbx2 including the T-box domain (as described in Vance et al., Cancer Res. 65:2260-2268, 2005).
  • the Tbx2 inhibitor is a small molecule inhibitor that reduces the expression or activity of Tbx2.
  • the small molecule inhibitor is an antagonist that binds directly to Tbx2 to reduce or inhibit its function or activity.
  • the small molecule antagonist is selective for Tbx2 and does not exhibit substantial binding to other proteins.
  • Exemplary small molecule Tbx2 inhibitors are provided in Table 5 below.
  • the small molecule Tbx2 inhibitor is testosterone, dorsomorphin, estropipate, LY-2140023, carbinoxamine, tyrphostin-AG-1295, DMeOB, methantheline, or HDAC6 inhibitor ISOX. Additional small molecule Tbx2 inhibitors can be identified through screening based on their ability to reduce or inhibit the activity or signaling of Tbx2.
  • the Tbx2 inhibitor is TGF-p1 or a polynucleotide that encodes
  • the methods described herein are performed by converting Type II vestibular hair cells directly into Type I vestibular hair cells.
  • the Tbx2 inhibitors described herein may be targeted to Type II hair cells using Type II hair cell promoters.
  • the methods described herein may also be performed by targeting Tbx2 inhibitors to hair cells produced by regeneration (regenerated hair cells) or hair cells currently undergoing regeneration (regenerating hair cells). Hair cell promoters can be used to target regenerated or regenerating hair cells.
  • Tbx2 inhibitors may be targeted to vestibular supporting cells using a supporting cell promoter in advance of regeneration.
  • Tbx2 inhibition using an inhibitor described herein is performed in conjunction with a method that promotes hair cell regeneration.
  • an inhibitor described herein e.g., an inhibitory RNA targeting Tbx2 mRNA or a Tbx2 promoter, a component of a gene editing system targeting Tbx2, or a dominant negative Tbx2 protein
  • Such an approach may be used to treat a subject lacking vestibular hair cells (e.g., both Type I and Type II vestibular hair cells), such as a subject with damage to or loss of vestibular hair cells (e.g., damage to or loss of vestibular hair cells due to aging, head trauma, disease or infection, or exposure to ototoxic drugs).
  • This approach may be used to generate new hair cells (e.g., Type II vestibular hair cells) that may then be converted to Type I vestibular hair cells by inhibiting Tbx2.
  • One method of promoting hair cell regeneration includes overexpression of Atonal BHLH transcription factor 1 (Atohl ) in vestibular supporting cells.
  • Atohl can be overexpressed using a vector, e.g., a viral vector, such as an AAV vector, adenoviral vector, or lentiviral vector, to deliver a polynucleotide encoding Atohl to the inner ear.
  • a viral vector such as an AAV vector, adenoviral vector, or lentiviral vector
  • the polynucleotide encoding Atohl is operably linked to a ubiquitous promoter.
  • the polynucleotide encoding Atohl is operably linked to a supporting cell promoter to induce expression in the desired target cell. Atohl expression may also be increased using small molecules, as described in U.S. Patent Nos. 8,188,131 , 10,143,711 , 10,603,295, or 11 ,286,487, which are incorporated herein by reference.
  • the polynucleotide sequence encoding Atohl can be a polynucleotide sequence that encodes wild-type Atohl , or a variant thereof, such as a polynucleotide sequence that encodes a protein having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more, sequence identity) to the amino acid sequence of wild-type mammalian (e.g., human or mouse) Atohl (e.g., SEQ ID NO: 27 or SEQ ID NO: 29).
  • Exemplary Atohl amino acid and polynucleotide sequences are listed in Table 6, below.
  • the polynucleotide sequence encoding Atohl encodes an amino acid sequence that contains one or more conservative amino acid substitutions relative to SEQ ID NO: 27 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 or more conservative amino acid substitutions), provided that the Atohl analog encoded retains the therapeutic function of wild-type Atohl (e.g., the ability to promote hair cell development). No more than 10% of the amino acids in the Atohl protein may be replaced with conservative amino acid substitutions.
  • the polynucleotide sequence that encodes Atohl is any polynucleotide sequence that, by redundancy of the genetic code, encodes SEQ ID NO: 27.
  • the polynucleotide sequence that encodes Atohl can be partially or fully codon-optimized for expression (e.g., in human vestibular supporting cells). Atohl may be encoded by a polynucleotide having the sequence of SEQ ID NO: 28.
  • the Atohl protein may be a human Atohl protein or may be a homolog of the human Atohl protein from another mammalian species (e.g., mouse, rat, cow, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig, or other mammal).
  • another mammalian species e.g., mouse, rat, cow, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig, or other mammal.
  • Atohl sequences Another method of promoting hair cell regeneration includes inhibition of Notch in vestibular supporting cells.
  • Notch can be inhibited using small molecules (e.g., gamma-secretase inhibitors), inhibitory RNA molecules (e.g., siRNA, shRNA, or miRNA) directed to Notch or to the Notch promoter, or anti-Notch antibodies.
  • small molecules e.g., gamma-secretase inhibitors
  • inhibitory RNA molecules e.g., siRNA, shRNA, or miRNA
  • Methods of using Notch inhibitors to promote hair cell regeneration are described in U.S. Patent No. 10,450,317, and U.S. Patent Application Nos. US20190010449 and US20210030775, which are incorporated herein by reference.
  • Inhibitory RNA molecules directed to Notch or to the Notch promoter can be delivered using a vector, e.g., a viral vector, such as an AAV vector, adenoviral vector, or lentiviral vector, and operably linked to a ubiquitous promoter or to a supporting cell promoter, which can be used induce expression in the desired target cell.
  • a viral vector such as an AAV vector, adenoviral vector, or lentiviral vector
  • the Tbx2 inhibitor is administered in combination with an agent that promotes hair cell regeneration (e.g., an agent that increases Atohl overexpression and/or a Notch inhibitor). If the Tbx2 inhibitor is administered concurrently with or after the agent that promotes hair cell regeneration, the Tbx2 inhibitor can be targeted to Type II hair cells, to immature vestibular hair cells, and/or to regenerating or regenerated hair cells.
  • an agent that promotes hair cell regeneration e.g., an agent that increases Atohl overexpression and/or a Notch inhibitor.
  • the Tbx2 inhibitor and the regeneration agent are concurrently delivered using vectors, e.g., viral vectors, such as AAV vectors, adenoviral vectors, or lentiviral vectors (e.g., in embodiments in which the Tbx2 inhibitor is an inhibitory RNA targeting Tbx2, a component of a gene editing system targeting Tbx2, or a dominant negative Tbx2 protein and the regeneration agent is a polynucleotide encoding Atohl or an inhibitory RNA targeting Notch), the Tbx2 inhibitor and the regeneration agent can be delivered using separate vectors or using a single vector (e.g., a single AAV vector can include both the Tbx2 inhibitor and the regeneration agent).
  • viral vectors such as AAV vectors, adenoviral vectors, or lentiviral vectors
  • the regeneration agent is a polynucleotide encoding Atohl or an inhibitory RNA targeting Notch
  • the Tbx2 inhibitor and the regeneration agent can be
  • the Tbx2 inhibitor and the regeneration agent are delivered using a single vector, they may be expressed using the same promoter (e.g., a ubiquitous promoter or a supporting cell promoter) or using different promoters (e.g., a hair cell or Type II hair cell promoter and a supporting cell promoter).
  • the Tbx2 inhibitor and the regeneration agent can also be co-formulated for concurrent administration.
  • the Tbx2 inhibitor is administered prior to administration of an agent that promotes hair cell regeneration.
  • the Tbx2 inhibitor can be targeted to supporting cells (e.g., vestibular supporting cells), which are then induced to regenerate into hair cells using a regeneration agent.
  • the Tbx2 inhibitor can also be targeted to regenerated hair cells, immature vestibular hair cells, and/or Type II hair cells even if a regeneration agent has not yet been administered, as spontaneous regeneration may occur in the vestibular system and Type II cells are more likely to be preserved after hair cell damage.
  • the first therapeutic agent (e.g., the regeneration agent or Tbx2 inhibitor) may be administered immediately, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to, 8 hours, up to 9 hours, up to 10 hours, up to 1 1 hours, up to 12 hours, up to 13 hours, 14 hours, up to hours 16, up to 17 hours, up 18 hours, up to 19 hours up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours, up to 24 hours, or up to 1 -7, 1 -14, 1 -21 or 1 -30 days before or after the second therapeutic agent (e.g., the Tbx2 inhibitor or the regeneration agent).
  • the second therapeutic agent e.g., the Tbx2 inhibitor or the regeneration agent
  • a Tbx2 inhibitor described herein is administered in combination with a Sox2 inhibitor.
  • the Sox2 inhibitor may be a nucleic acid molecule (e.g., an RNA or DNA molecule, such as an inhibitory RNA molecule), a protein (e.g., a dominant negative Sox2), or a component of a gene editing system (e.g., a guide RNA targeting Sox2) that reduces Sox2 activity or expression.
  • Combination therapy with a Tbx2 inhibitor and a Sox 2 inhibitor may lead to the production of more Type I vestibular hair cells than administration of either inhibitor alone and/or may lead to the production of Type I vestibular hair cells that are more mature (e.g., that express more transcripts characteristic of mature Type I vestibular hair cells) than Type I vestibular hair cells produced by administration of a Tbx2 inhibitor or a Sox2 inhibitor alone.
  • Both the Sox2 inhibitor and the Tbx2 inhibitor may be targeted to a cell type of interest (e.g., a Type II hair cell or a regenerating or regenerated hair cell) using a Type II hair cell promoter, a hair cell promoter, or an immature hair cell promoter (e.g., both agents may be expressed using the same promoter or different promoters).
  • a cell type of interest e.g., a Type II hair cell or a regenerating or regenerated hair cell
  • a Type II hair cell promoter e.g., a hair cell promoter, or an immature hair cell promoter (e.g., both agents may be expressed using the same promoter or different promoters).
  • the Sox2 inhibitor is administered prior to the Tbx2 inhibitor. In some embodiments, the Sox2 inhibitor is administered after the Tbx2 inhibitor. In some embodiments, the Sox2 inhibitor and the Tbx2 inhibitor are administered concurrently. In embodiments in which the Tbx2 inhibitor and the Sox2 inhibitor are concurrently delivered using vectors, e.g., viral vectors, such as AAV vectors, adenoviral vectors, or lentiviral vectors (e.g., in embodiments in which the Tbx2 inhibitor is an inhibitory RNA targeting Tbx2, a component of a gene editing system targeting Tbx2, or a dominant negative Tbx2 protein and the Sox2 inhibitor is an inhibitory RNA targeting Sox2, a component of a gene editing system targeting Sox2, or a dominant negative Sox2 protein), the Tbx2 inhibitor and the Sox2 inhibitor can be delivered using separate vectors or using a single vector (e.g., a single AAV vector including a polynucle
  • Tbx2 inhibitor and the Sox2 inhibitor are delivered using a single vector, they may be expressed using the same promoter (e.g., the same ubiquitous promoter, hair cell promoter, Type II hair cell promoter, immature hair cell promoter, or supporting cell promoter) or using different promoters (e.g., using two different promoters of the same type, such as two different hair cell promoters, or two different types of promoters, such as an immature hair cell promoter and a hair cell promoter).
  • the same promoter e.g., the same ubiquitous promoter, hair cell promoter, Type II hair cell promoter, immature hair cell promoter, or supporting cell promoter
  • different promoters e.g., using two different promoters of the same type, such as two different hair cell promoters, or two different types of promoters, such as an immature hair cell promoter and a hair cell promoter.
  • the Tbx2 inhibitor and Sox2 inhibitor can each be independently operably linked to the promoter (e.g., the vector includes two copies of the same promoter, one operably linked to the Tbx2 inhibitor and the other operably linked to the Sox2 inhibitor) or both the Tbx2 inhibitor and Sox2 inhibitor can be operably linked to a single copy of the promoter and an IRES or 2A polypeptide (e.g., F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), P2A (porcine teschovirus-1 2A), or T2A (thosea asigna virus 2A)) can be positioned between the polynucleotides encoding the Tbx2 inhibitor and the Sox2 inhibitor.
  • an IRES or 2A polypeptide e.g., F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), P2A (porcine teschovirus-1 2A), or T
  • the Tbx2 inhibitor and the Sox2 inhibitor can also be co-formulated for concurrent administration.
  • the first therapeutic agent e.g., the Sox2 inhibitor or Tbx2 inhibitor
  • the first therapeutic agent may be administered immediately, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to, 8 hours, up to 9 hours, up to 10 hours, up to 1 1 hours, up to 12 hours, up to 13 hours, 14 hours, up to hours 16, up to 17 hours, up 18 hours, up to 19 hours up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours, up to 24 hours, or up to 1 -7, 1 -14, 1 -21 or 1 -30 days before or after the second therapeutic agent (e.g., the Tbx2 inhibitor or the Sox2 inhibitor).
  • the second therapeutic agent e.g., the Tbx2 inhibitor or the Sox2 inhibitor
  • the Sox2 inhibitor is an inhibitory RNA molecule, such as an siRNA molecule, a shRNA molecule, or a miRNA molecule, that targets full-length Sox2.
  • An shRNA can also be embedded into the backbone of a miRNA (e.g., miRNA-30 or mir-E, e.g., to produce an shRNA-mir) to achieve highly efficient target gene knockdown.
  • exemplary shRNA and siRNA target sequences are provided in Tables 8 and 9, below. Sequences for plasmids containing exemplary shRNAs that are embedded in miRNA backbones are provided in Table 10, below.
  • Exemplary siRNA sequences are provided in Table 1 1 , below.
  • the siRNA or shRNA targeting Sox2 has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases (e.g., 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobases) having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of a target region of an mRNA transcript of a human (e.g., SEQ ID NO: 90) or murine (SEQ ID NO: 32) SOX2 gene.
  • a human e.g., SEQ ID NO: 90
  • murine SEQ ID NO: 32
  • the target region is at least 8 to 21 (e.g., 8 to 21 , 9 to 21 , 10 to 21 , 11 to 21 , 12 to 21 , 13 to 21 , 14 to 21 , 15 to 21 , 16 to 21 , 17 to 21 , 18 to 21 , 19 to 21 , 20 to 21 , or all 21 ) contiguous nucleobases of any one or more of SEQ ID NOs: 34-52.
  • the target region is at least 8 to 19 (e.g., 8 to 19, 9 to 19, 10 to 19, 11 to 19, 12 to 19, 13 to 19, 14 to 19, 15 to 19, 16 to 19, 17 to 19, 18 to 19, or all 19) contiguous nucleobases of any one of SEQ ID NOs: 54-56.
  • the target region is at least 8 to 22 (e.g., 8 to 22, 9 to 22, 10 to 22, 11 to 22, 12 to 22, 13 to 22, 14 to 22, 15 to 22, 16 to 22, 17 to 22, 18 to 22, 19 to 22, 20 to 22, 21 to 22, or all 22) contiguous nucleobases of SEQ ID NOs: 57 or 58.
  • the siRNA or shRNA targets SEQ ID NO: 40, SEQ ID NO: 54, SEQ ID NO: 55, or SEQ ID NO: 56, SEQ ID NO: 57, or SEQ ID NO: 58.
  • the shRNA has at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to the entire length of SEQ ID NO: 40, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, or SEQ ID NO: 58. In some embodiments, the shRNA has 100% complementarity to the entire length of SEQ ID NO: 40, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, or SEQ ID NO: 58.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%
  • the shRNA includes the sequence of nucleotides 2234-2296 of SEQ ID NO: 59 or nucleotides 2234-2296 of SEQ ID NO: 61 . In some embodiments, the shRNA has the sequence of nucleotides 2234-2296 of SEQ ID NO: 59 or nucleotides 2234-2296 of SEQ ID NO: 61 . In some embodiments, the shRNA is embedded into the backbone of a miRNA.
  • the miRNA backbone and the shRNA include the sequence of nucleotides 2109-2426 of SEQ ID NO: 59, nucleotides 2109-2408 of SEQ ID NO: 60, nucleotides 2109-2426 of SEQ ID NO: 61 , or nucleotides 2109-2408 of SEQ ID NO: 62.
  • the miRNA backbone and the shRNA have the sequence of nucleotides 2109-2426 of SEQ ID NO: 59, nucleotides 2109-2408 of SEQ ID NO: 60, nucleotides 2109-2426 of SEQ ID NO: 61 , or nucleotides 2109-2408 of SEQ ID NO: 62.
  • the siRNA is a pair of nucleotide sequences (sense and anti-sense strands) selected from SEQ ID NO: 64 and SEQ ID NO: 65; SEQ ID NO: 66 and SEQ ID NO: 67; SEQ ID NO: 68 and SEQ ID NO: 69; and SEQ ID NO: 70 and SEQ ID NO: 71 .
  • Inhibitory RNA molecules targeting Sox2 for use in combination with a Tbx2 inhibitor can target the mRNA sequence of Sox2 (e.g., human Sox2 mRNA, which has the sequence of SEQ ID NO: 90, or murine Sox2 mRNA, which has the sequence of SEQ ID NO: 32).
  • Sox2 e.g., human Sox2 mRNA, which has the sequence of SEQ ID NO: 90, or murine Sox2 mRNA, which has the sequence of SEQ ID NO: 32.
  • a miRNA that targets a Sox2 promoter can also be used to inhibit Sox2.
  • miRNA molecules that inhibit Sox2 include human miRNAs miR-145, miR-126, miR-200c, miR-429, miR-200b, miR-140, miR-9, miR-21 , miR-590, miR-182, and miR-638, and murine miRNAs miR-134, miR-200c, miR-429, miR-200b, miR-34a, and miR-9.
  • siRNA molecules may be delivered without a delivery vehicle, or they may be encapsulated in a nanoparticle (e.g., a lipid nanoparticle) for administration.
  • siRNA, shRNA, and miRNA molecules may be delivered using a plasmid, such as a viral vector (e.g., an AAV vector), and they may be expressed using a cell type-specific promoter (e.g., a hair cell promoter, Type II hair cell promoter, an immature hair cell promoter, or a supporting cell promoter) or using a ubiquitous promoter (e.g., a ubiquitous pol II or pol III promoter).
  • a viral vector e.g., an AAV vector
  • a cell type-specific promoter e.g., a hair cell promoter, Type II hair cell promoter, an immature hair cell promoter, or a supporting cell promoter
  • a ubiquitous promoter e.g., a ubiquitous pol II or pol III promoter
  • An inhibitory RNA molecule targeting Sox2 can be modified, e.g., to contain modified nucleotides, e.g., 2’-fluoro, 2’-o-methyl, 2’-deoxy, unlocked nucleic acid, 2’-hydroxy, phosphorothioate, 2’-thiouridine, 4’-th iouridi ne, 2’-deoxyuridine.
  • modified nucleotides e.g., 2’-fluoro, 2’-o-methyl, 2’-deoxy, unlocked nucleic acid, 2’-hydroxy, phosphorothioate, 2’-thiouridine, 4’-th iouridi ne, 2’-deoxyuridine.
  • the inhibitory RNA molecule decreases the level and/or activity or function of Sox2. In some embodiments, the inhibitory RNA molecule inhibits expression of Sox2. In other embodiments, the inhibitory RNA molecule increases degradation of Sox2 and/or decreases the stability (i.e., half-life) of Sox2.
  • the inhibitory RNA molecule can be chemically synthesized or transcribed in vitro.
  • the Sox2 inhibitor is a component of a gene editing system.
  • the Sox2 inhibitor introduces an alteration (e.g., insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation) in Sox2.
  • the Sox2 inhibitor may be a component of a ZFN, TALEN, or CRISPR system.
  • the spacers of the CRISPR are derived from a target gene sequence, e.g., from a Sox2 sequence.
  • the Sox2 inhibitor includes a guide RNA (gRNA) for use in a CRISPR system for gene editing.
  • the Sox2 inhibitor is a ZFN, or an mRNA encoding a ZFN, that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of Sox2.
  • the Sox2 inhibitor includes a TALEN, or an mRNA encoding a TALEN, that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of Sox2.
  • the gRNA can be used in a CRISPR system to engineer an alteration in a gene (e.g., Sox2).
  • the ZFN and/or TALEN can be used to engineer an alteration in a gene (e.g., Sox2).
  • exemplary alterations include insertions, deletions (e.g., knockouts), translocations, inversions, single point mutations, or other mutations.
  • the alteration can be introduced in the gene in a cell, e.g., in vitro, ex vivo, or in vivo.
  • the alteration decreases the level and/or activity of (e.g., knocks down or knocks out) Sox2, e.g., the alteration is a negative regulator of function.
  • the CRISPR system is used to edit (e.g., to add or delete a base pair) a target gene, e.g., Sox2.
  • the CRISPR system is used to introduce a premature stop codon, e.g., thereby decreasing the expression of a target gene.
  • the CRISPR system is used to turn off a target gene in a reversible manner, e.g., similarly to RNA interference.
  • the CRISPR system is used to direct Cas to a promoter of a target gene, e.g., Sox2, thereby blocking an RNA polymerase sterically.
  • a CRISPR system can be generated to edit Sox2 using technology described in, e.g., U.S. Publication No. 20140068797; Cong, Science 339: 819, 2013; Tsai, Nature Biotechnol., 32:569, 2014; and U.S. Patent Nos.: 8,871 ,445; 8,865,406; 8,795,965; 8,771 ,945; and 8,697,359.
  • the CRISPR interference (CRISPRi) technique can be used for transcriptional repression of specific genes, e.g., the gene encoding Sox2.
  • the components of the gene editing system can be delivered using a plasmid, e.g., a viral vector, such as an AAV vector.
  • a hair cell, Type II hair cell, immature hair cell, or supporting cell promoter can be used to direct expression of the gene editing system in regenerated or regenerating hair cells, in Type II hair cells, or in vestibular supporting cells to knockdown or knockout Sox2 in these cell types and convert them to Type I hair cells.
  • the components of the gene editing system or a plasmid (e.g., AAV vector) encoding the components of the gene editing system are delivered using a nanoparticle (e.g., a lipid nanoparticle).
  • the Sox2 inhibitor is a dominant negative Sox2 protein.
  • the dominant negative Sox2 protein can be delivered to regenerated or regenerating hair cells, to Type II hair cells, to immature hair cells, or to vestibular supporting cells using a plasmid, e.g., a viral vector, such as an AAV vector, containing a polynucleotide encoding the dominant negative Sox2 protein.
  • the polynucleotide encoding the dominant negative Sox2 protein can be operably linked to a promoter that induces expression in a cell type of interest, e.g., in a hair cell, Type II hair cell, immature hair cell, or vestibular supporting cell.
  • the dominant negative Sox2 protein may be produced by mutating the two nuclear localization signals in the high mobility group domain of Sox2 (as described in Li et al., J Biol Chem 282:19481 -92 (2007)), by generating a Sox2 polynucleotide that lacks all or most of the high mobility group domain (as described in Kishi et al., Development 127:791 -800 (2000)), by generating a Sox2 polynucleotide in which the high mobility group domain is fused with the engrailed repressor domain (as described in Kishi et al., Development 127:791 -800 (2000)), or by generating a Sox2 polynucleotide that only encodes the Sox2 DNA binding domain (e.g., a C-terminally truncated version of Sox2 that can compete with wild-type Sox2 by binding to Sox2 recognition sites on DNA but that lacks a transactivation domain, e
  • nucleic acid molecule e.g., by integration into the nuclear or mitochondrial genome of a mammalian cell, or by episomal concatemer formation in the nucleus of a mammalian cell.
  • the nucleic acid may be an inhibitory RNA (e.g., an inhibitory RNA targeting Tbx2, Sox2, or Notch) or a polynucleotide that encodes the primary amino acid sequence of a corresponding protein (e.g., a polynucleotide encoding a dominant negative Tbx2 protein, a dominant negative Sox2 protein, or Atohl ).
  • an inhibitory RNA e.g., an inhibitory RNA targeting Tbx2, Sox2, or Notch
  • a polynucleotide that encodes the primary amino acid sequence of a corresponding protein e.g., a polynucleotide encoding a dominant negative Tbx2 protein, a dominant negative Sox2 protein, or Atohl
  • nucleic acid molecules can be incorporated into a vector.
  • Vectors can be introduced into a cell by a variety of methods, including transformation, transfection, transduction, direct uptake, projectile bombardment, and by
  • transfecting or transforming cells examples include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection and direct uptake. Such methods are described in more detail, for example, in Green, et al., Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014); and Ausubel, et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of each of which are incorporated herein by reference.
  • Nucleic acid molecules can also be introduced into a mammalian cell by targeting a vector containing a nucleic acid molecule of interest to cell membrane phospholipids.
  • vectors can be targeted to the phospholipids on the extracellular surface of the cell membrane by linking the vector molecule to a VSV-G protein, a viral protein with affinity for all cell membrane phospholipids.
  • VSV-G protein a viral protein with affinity for all cell membrane phospholipids.
  • RNA polymerase Recognition and binding of the nucleic acid molecule by mammalian RNA polymerase is important for gene expression.
  • sequence elements within the polynucleotide that exhibit a high affinity for transcription factors that recruit RNA polymerase and promote the assembly of the transcription complex at the transcription initiation site.
  • sequence elements include, e.g., a mammalian promoter, the sequence of which can be recognized and bound by specific transcription initiation factors and ultimately RNA polymerase.
  • Promoter sequences are typically located upstream of the translation start site (e.g., within two kilobases upstream of the translation start site). Examples of mammalian promoters have been described in Smith, et al., Mol. Sys.
  • the promoter used in the methods and compositions described herein can be a ubiquitous promoter (e.g., to induce or increase expression of the nucleic acid molecule in all cells of the vestibular system) or a cell type-specific promoter (e.g., to induce or increase expression of the nucleic acid molecule in one or more inner ear cell types).
  • Ubiquitous promoters include the CAG promoter, a cytomegalovirus (CMV) promoter (e.g., the CMV immediate-early enhancer and promoter, a CMVmini promoter, a minCMV promoter, a CMV-TATA+INR promoter, or a min CMV-T6 promoter), the smCBA promoter (described in Haire et al., Invest. Opthalmol. Vis. Sci.
  • CMV cytomegalovirus
  • DHFR dihydrofolate reductase
  • PGK phosphoglycerol kinase
  • promoters derived from viral genomes can also be used for the stable expression of polynucleotides in primate (e.g., human) cells.
  • functional viral promoters that can be used for the expression of polynucleotides in primate (e.g., human) cells include adenovirus late promoter, vaccinia virus 7.5K promoter, tk promoter of HSV, mouse mammary tumor virus (MMTV) promoter, LTR promoter of HIV, promoter of moloney virus, Epstein barr virus (EBV) promoter, and the Rous sarcoma virus (RSV) promoter.
  • a pol II promoter such as a ubiquitous promoter described above or a promoter described in Table 12, below, can be used to express any Tbx2 inhibitor, Sox2 inhibitor, or regeneration agent described herein.
  • a pol III promoter including ubiquitous pol III promoters U6, H1 , and 7SK, can be used to express a Tbx2 inhibitor, Sox2 inhibitor, or regeneration agent that is an shRNA, a miRNA, or an shRNA embedded in a miRNA (an shRNA-mir).
  • Cell type-specific promoters that can be included in the vectors described herein to express a nucleic acid molecule that is or that encodes a Tbx2 inhibitor, a Sox2 inhibitor, and/or a regeneration agent in one or more inner ear cell types are provided in Table 12, below. Table 12. Inner ear cell type-specific promoters
  • Exemplary Myo15 promoters are described in International Application Publication Nos. WO2019210181 and W02020163761 A1 and U.S. Application Publication Nos. US20210236654A1 and
  • exemplary SLC6A14 promoters are described in International Application Publication Nos. W02021091950 and WO2022235805 and U.S. Application Publication No. US20220331449A1
  • exemplary LGR5 and ATOH1 promoters are described in International Application Publication No. WO2021231567 and in U.S. Application Publication No. US20230201372A1
  • exemplary GFAP promoters are described in International Application Publication Nos. WO2021231885, WO2021067448, and WO2021231567 and U.S. Application Publication Nos. US20230181767A1 , US20210095313A1 , and US20230201372A1 , the disclosures of which are incorporated herein by reference
  • the transcription of this nucleic acid molecule can be induced by methods known in the art.
  • expression can be induced by exposing the mammalian cell to an external chemical reagent, such as an agent that modulates the binding of a transcription factor and/or RNA polymerase to the mammalian promoter and thus regulates gene expression.
  • the chemical reagent can serve to facilitate the binding of RNA polymerase and/or transcription factors to the mammalian promoter, e.g., by removing a repressor protein that has bound the promoter.
  • the chemical reagent can serve to enhance the affinity of the mammalian promoter for RNA polymerase and/or transcription factors such that the rate of transcription of the gene located downstream of the promoter is increased in the presence of the chemical reagent.
  • chemical reagents that potentiate polynucleotide transcription by the above mechanisms include tetracycline and doxycycline. These reagents are commercially available (Life Technologies, Carlsbad, CA) and can be administered to a mammalian cell in order to promote gene expression according to established protocols.
  • conditional regulation elements such as Cre recombinase systems, including FLEx-Cre, as described in Saunders et al., Front Neural Circuits 6:47 (2012).
  • DNA sequence elements that may be included in polynucleotides (e.g., polynucleotides encoding a dominant negative Tbx2 protein, a dominant negative Sox2 protein, or Atohl ) for use in the compositions and methods described herein include enhancer sequences.
  • Enhancers represent another class of regulatory elements that induce a conformational change in the polynucleotide containing the gene of interest such that the DNA adopts a three-dimensional orientation that is favorable for binding of transcription factors and RNA polymerase at the transcription initiation site.
  • polynucleotides for use in the compositions and methods described herein include those that encode a protein of interest and additionally include a mammalian enhancer sequence.
  • Enhancers for use in the compositions and methods described herein also include those that are derived from the genetic material of a virus capable of infecting a eukaryotic cell. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. Additional enhancer sequences that induce activation of eukaryotic gene transcription include the CMV enhancer and RSV enhancer.
  • An enhancer may be spliced into a vector containing a polynucleotide encoding a protein of interest, for example, at a position 5’ or 3’ to this gene.
  • the enhancer is positioned at the 5’ side of the promoter, which in turn is located 5’ relative to the polynucleotide encoding a protein of interest.
  • the nucleic acid vectors containing a Tbx2 inhibitor, a Sox2, inhibitor, and/or a regeneration agent described herein include a polynucleotide that can be transcribed to produce (i.e., a polynucleotide encoding) a miRNA target sequence.
  • the polynucleotide that can be transcribed to produce a miRNA target sequence is located within the vector such that it is operably linked to the same promoter as the polynucleotide it regulates (e.g., the polynucleotide encoding the Tbx2 inhibitor, the Sox2 inhibitor, and/or the polynucleotide encoding the regeneration agent), and it is typically transcribed as part of the same RNA transcript as the polynucleotide it regulates.
  • the miRNA target sequences for use in the vectors described herein are target sequences for miRNAs that are differentially expressed by Type I vestibular hair cells and Type II vestibular hair cells and/or vestibular supporting cells (e.g., target sequences for miRNAs that are expressed in Type I vestibular hair cells but not in Type II vestibular hair cells and/or supporting cells).
  • the miRNA expressed in the Type I vestibular hair cell can recognize (e.g., bind to) the miRNA target sequence and can, therefore, block translation of or degrade the messenger RNA (mRNA) transcribed from the vector to reduce or inhibit expression of the Tbx2 inhibitor, the Sox2 inhibitor, and/or regeneration agent in the Type I vestibular hair cell.
  • mRNA messenger RNA
  • the nucleic acid vector may contain one or more copies of the polynucleotide that can be transcribed to produce the miRNA target sequence (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more copies of the polynucleotide that can be transcribed to produce the miRNA target sequence).
  • the vector may also contain polynucleotides that can be transcribed to produce target sequences for at least two different miRNAs (e.g., the vector contains at least two different polynucleotides that can be transcribed to produce a miRNA target sequence, each of which can be transcribed to produce a target sequence for a different miRNA, such that the vector can be used to produce target sequences for 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different miRNAs).
  • the vector may also contain polynucleotides that can be transcribed to produce target sequences for at least two different miRNAs (e.g., the vector contains at least two different polynucleotides that can be transcribed to produce a miRNA target sequence, each of which can be transcribed to produce a target sequence for a different miRNA, such that the vector can be used to produce target sequences for 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different miRNAs).
  • both the Tbx2 inhibitor and the second agent e.g., a Sox2 inhibitor or a regeneration agent
  • expression of both the Tbx2 inhibitor and the second agent can be regulated by a miRNA target sequence (e.g., at least one polynucleotide that can be transcribed to produce a miRNA target sequence is operably linked to the promoter regulating expression of the Tbx2 inhibitor and at least one polynucleotide that can be transcribed to produce a miRNA target sequence is operably linked to the promoter regulating expression of the second agent (e.g., regeneration agent or Sox2 inhibitor)) or expression of only one of the Tbx2 inhibitor or the second agent (e.g., regeneration agent or Sox2 inhibitor) can be regulated by a miRNA target sequence (e.g., in embodiments in which the Tbx2 inhibitor and second agent (e.g., regeneration agent or Sox2 inhibitor) are
  • expression of the Tbx2 inhibitor and the second agent may be regulated by the same miRNA target sequence(s) or by different miRNA target sequences (e.g., both the Tbx2 inhibitor and the second agent may be regulated by the same miRNA target sequence(s) if both the Tbx2 inhibitor and the second agent are operably linked to a single promoter, or the Tbx2 inhibitor and the second agent may be regulated by different miRNA target sequences if the Tbx2 inhibitor and second agent are each operably linked to their own separate promoter).
  • the nucleic acid vectors containing a Tbx2 inhibitor, a Sox2 inhibitor, or a regeneration agent described herein may include a Woodchuck Posttranscriptional Regulatory Element (WPRE).
  • WPRE acts at the transcriptional level, by promoting nuclear export of transcripts and/or by increasing the efficiency of polyadenylation of the nascent transcript, thus increasing the total amount of mRNA in the cell.
  • the addition of the WPRE to a vector can result in a substantial improvement in the level of transgene expression from several different promoters, both in vitro and in vivo.
  • the nucleic acid vectors containing a Tbx2 inhibitor, a Sox2 inhibitor, and/or a regeneration agent described herein include a reporter sequence, which can be useful in verifying the expression of a nucleic acid molecule or encoded protein, for example, in cells and tissues (e.g., in regenerated hair cells, immature vestibular hair cells, Type II hair cells, or supporting cells).
  • Reporter sequences that may be provided in a transgene include DNA sequences encoding p-lactamase, P -galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others well known in the art.
  • the reporter sequences When associated with regulatory elements that drive their expression, such as a promoter, the reporter sequences provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry.
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • immunohistochemistry for example, where the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by assays for p-galactosidase activity. Where the transgene is green fluorescent protein or luciferase, the vector carrying the signal may be measured visually by color or light production in a luminometer.
  • nucleic acid molecule such as a nucleic acid molecule that is or encodes a Tbx2 inhibitor, a Sox2 inhibitor, or a regeneration agent
  • a target cell e.g., a mammalian cell
  • electroporation can be used to permeabilize mammalian cells (e.g., human target cells) by the application of an electrostatic potential to the cell of interest.
  • mammalian cells such as human cells, subjected to an external electric field in this manner are subsequently predisposed to the uptake of exogenous nucleic acids.
  • Electroporation of mammalian cells is described in detail, e.g., in Chu et al., Nucleic Acids Research 15:1311 (1987), the disclosure of which is incorporated herein by reference.
  • a similar technique, NucleofectionTM utilizes an applied electric field in order to stimulate the uptake of exogenous polynucleotides into the nucleus of a eukaryotic cell.
  • NucleofectionTM and protocols useful for performing this technique are described in detail, e.g., in Distler et al., Experimental Dermatology 14:315 (2005), as well as in US 20100317114, the disclosures of each of which are incorporated herein by reference.
  • Additional techniques useful for the transfection of target cells include the squeeze-poration methodology. This technique induces the rapid mechanical deformation of cells in order to stimulate the uptake of exogenous DNA through membranous pores that form in response to the applied stress. This technology is advantageous in that a vector is not required for delivery of nucleic acids into a cell, such as a human target cell. Squeeze-poration is described in detail, e.g., in Sharei et al., Journal of Visualized Experiments 81 :e50980 (2013), the disclosure of which is incorporated herein by reference.
  • Lipofection represents another technique useful for transfection of target cells. This method involves the loading of nucleic acids into a liposome, which often presents cationic functional groups, such as quaternary or protonated amines, towards the liposome exterior. This promotes electrostatic interactions between the liposome and a cell due to the anionic nature of the cell membrane, which ultimately leads to uptake of the exogenous nucleic acids, for instance, by direct fusion of the liposome with the cell membrane or by endocytosis of the complex. Lipofection is described in detail, for instance, in US Patent No. 7,442,386, the disclosure of which is incorporated herein by reference.
  • Similar techniques that exploit ionic interactions with the cell membrane to provoke the uptake of foreign nucleic acids include contacting a cell with a cationic polymer-nucleic acid complex.
  • exemplary cationic molecules that associate with polynucleotides so as to impart a positive charge favorable for interaction with the cell membrane include activated dendrimers (described, e.g., in Dennig, Topics in Current Chemistry 228:227 (2003), the disclosure of which is incorporated herein by reference) polyethylenimine, and diethylaminoethyl (DEAE)-dextran, the use of which as a transfection agent is described in detail, for instance, in Gulick et al., Current Protocols in Molecular Biology 40:1:9.2:9.2.1 (1997), the disclosure of which is incorporated herein by reference.
  • activated dendrimers described, e.g., in Dennig, Topics in Current Chemistry 228:227 (2003), the disclosure of which is incorporated herein by reference
  • Magnetic beads are another tool that can be used to transfect target cells in a mild and efficient manner, as this methodology utilizes an applied magnetic field in order to direct the uptake of nucleic acids. This technology is described in detail, for instance, in US 2010/0227406, the disclosure of which is incorporated herein by reference.
  • laserfection also called optical transfection
  • Another useful tool for inducing the uptake of exogenous nucleic acids by target cells is laserfection, also called optical transfection, a technique that involves exposing a cell to electromagnetic radiation of a particular wavelength in order to gently permeabilize the cells and allow polynucleotides to penetrate the cell membrane.
  • the bioactivity of this technique is similar to, and in some cases found superior to, electroporation.
  • Impalefection is another technique that can be used to deliver genetic material to target cells. It relies on the use of nanomaterials, such as carbon nanofibers, carbon nanotubes, and nanowires. Needle-like nanostructures are synthesized perpendicular to the surface of a substrate. DNA containing the gene, intended for intracellular delivery, is attached to the nanostructure surface. A chip with arrays of these needles is then pressed against cells or tissue. Cells that are impaled by nanostructures can express the delivered gene(s).
  • An example of this technique is described in Shalek et al., PNAS 107: 1870 (2010), the disclosure of which is incorporated herein by reference.
  • Magnetofection can also be used to deliver nucleic acids to target cells.
  • the magnetofection principle is to associate nucleic acids with cationic magnetic nanoparticles.
  • the magnetic nanoparticles are made of iron oxide, which is fully biodegradable, and coated with specific cationic proprietary molecules varying upon the applications.
  • Their association with the gene vectors (DNA, siRNA, viral vector, etc.) is achieved by salt-induced colloidal aggregation and electrostatic interaction.
  • the magnetic particles are then concentrated on the target cells by the influence of an external magnetic field generated by magnets. This technique is described in detail in Scherer et al., Gene Therapy 9:102 (2002), the disclosure of which is incorporated herein by reference.
  • sonoporation a technique that involves the use of sound (typically ultrasonic frequencies) for modifying the permeability of the cell plasma membrane to permeabilize the cells and allow polynucleotides to penetrate the cell membrane. This technique is described in detail, e.g., in Rhodes et al., Methods in Cell Biology 82:309 (2007), the disclosure of which is incorporated herein by reference.
  • Microvesicles represent another potential vehicle that can be used to modify the genome of a target cell according to the methods described herein. For instance, microvesicles that have been induced by the co-overexpression of the glycoprotein VSV-G with, e.g., a genome-modifying protein, such as a nuclease, can be used to efficiently deliver proteins into a cell that subsequently catalyze the sitespecific cleavage of an endogenous polynucleotide sequence so as to prepare the genome of the cell for the covalent incorporation of a polynucleotide of interest, such as a gene or regulatory sequence.
  • a genome-modifying protein such as a nuclease
  • vesicles also referred to as Gesicles
  • Gesicles for the genetic modification of eukaryotic cells is described in detail, e.g., in Quinn et al., Genetic Modification of Target Cells by Direct Delivery of Active Protein [abstract].
  • Methylation changes in early embryonic genes in cancer [abstract], in: Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy; 2015 May 13, Abstract No. 122.
  • an exogenous polynucleotide in a mammalian cell can be achieved by integration of the polynucleotide into the nuclear genome of the mammalian cell.
  • a variety of vectors for the delivery and integration of polynucleotides into the nuclear DNA of a mammalian cell have been developed. Examples of expression vectors are described in, e.g., Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006).
  • Expression vectors for use in the compositions and methods described herein contain a nucleic acid molecule that is or encodes a Tbx2 inhibitor, a Sox2 inhibitor, or a regeneration agent, as well as, e.g., additional sequence elements used for the expression of these agents and/or the integration of these polynucleotide sequences into the genome of a mammalian cell.
  • Vectors that can contain a Tbx2 inhibitor, a Sox2 inhibitor, or a regeneration agent include plasmids (e.g., circular DNA molecules that can autonomously replicate inside a cell), cosmids (e.g., pWE or sCos vectors), artificial chromosomes (e.g., a human artificial chromosome (HAC), a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), or a P1 -derived artificial chromosome (PAC)), and viral vectors.
  • plasmids e.g., circular DNA molecules that can autonomously replicate inside a cell
  • cosmids e.g., pWE or sCos vectors
  • artificial chromosomes e.g., a human artificial chromosome (HAC), a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), or a P1 -derived artificial chromosome (PAC)
  • vectors that can be used for the expression of a polynucleotide that is or encodes a Tbx2 inhibitor, a Sox2 inhibitor, or a regeneration agent include plasmids that contain regulatory sequences, such as enhancer regions, which direct gene transcription.
  • Other useful vectors for expression of a polynucleotide that is or encodes a Tbx2 inhibitor a Sox2 inhibitor, or a regeneration agent contain polynucleotide sequences that enhance the rate of translation or improve the stability or nuclear export of the mRNA that results from transcription.
  • sequence elements include, e.g., 5’ and 3’ untranslated regions, an internal ribosomal entry site (IRES), and polyadenylation signal site in order to direct efficient transcription of the polynucleotide carried on the expression vector.
  • the expression vectors suitable for use with the compositions and methods described herein may also contain a polynucleotide encoding a marker for selection of cells that contain such a vector. Examples of a suitable marker include genes that encode resistance to antibiotics, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.
  • Viral genomes provide a rich source of vectors that can be used for the efficient delivery of a polynucleotide of interest into the genome of a target cell (e.g., a mammalian cell, such as a human cell). Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are typically incorporated into the nuclear genome of a mammalian cell by generalized or specialized transduction. These processes occur as part of the natural viral replication cycle, and do not require added proteins or reagents in order to induce gene integration.
  • a target cell e.g., a mammalian cell, such as a human cell.
  • Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are typically incorporated into the nuclear genome of a mammalian cell by generalized or specialized transduction. These processes occur as part of the natural viral replication cycle, and do not require added proteins or reagents in order to induce gene integration.
  • viral vectors examples include a retrovirus (e.g., Retroviridae family viral vector), adenovirus (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvovirus (e.g., adeno-associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g.
  • RNA viruses such as picornavirus and alphavirus
  • double stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox and canarypox).
  • herpesvirus e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus
  • poxvirus e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox and canarypox
  • Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, human papilloma virus, human foamy virus, and hepatitis virus, for example.
  • retroviruses examples include avian leukosis-sarcoma, avian C-type viruses, mammalian C-type, B-type viruses, D-type viruses, oncoretroviruses, HTLV-BLV group, lentivirus, alpharetrovirus, gammaretrovirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, Virology, Third Edition (Lippincott-Raven, Philadelphia, 1996)).
  • murine leukemia viruses include murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus and lentiviruses.
  • vectors are described, for example, US Patent No. 5,801 ,030, the disclosure of which is incorporated herein by reference as it pertains to viral vectors for use in gene therapy.
  • polynucleotides of the compositions and methods described herein are incorporated into rAAV vectors and/or virions in order to facilitate their introduction into a cell.
  • rAAV vectors useful in the compositions and methods described herein are recombinant nucleic acid constructs that include (1 ) a promoter, (2) a heterologous nucleic acid molecule that is or encodes a Tbx2 inhibitor, a Sox2 inhibitor, or a regeneration agent, and (3) viral sequences that facilitate stability and expression of the heterologous nucleic acid molecules.
  • the viral sequences may include those sequences of AAV that are required in cis for replication and packaging (e.g., functional ITRs) of the DNA into a virion.
  • Such rAAV vectors may also contain marker or reporter genes.
  • Useful rAAV vectors have one or more of the AAV WT genes deleted in whole or in part but retain functional flanking ITR sequences.
  • the AAV ITRs may be of any serotype suitable for a particular application.
  • the ITRs can be AAV2 ITRs. Methods for using rAAV vectors are described, for example, in Tai et al., J. Biomed. Sci. 7:279 (2000), and Monahan and Samulski, Gene Delivery 7:24 (2000), the disclosures of each of which are incorporated herein by reference as they pertain to AAV vectors for gene delivery.
  • polynucleotides and vectors described herein can be incorporated into a rAAV virion in order to facilitate introduction of the polynucleotide or vector into a cell.
  • the capsid proteins of AAV compose the exterior, non-nucleic acid portion of the virion and are encoded by the AAV cap gene.
  • the cap gene encodes three viral coat proteins, VP1 , VP2 and VP3, which are required for virion assembly.
  • rAAV virions useful in conjunction with the compositions and methods described herein include those derived from a variety of AAV serotypes including AAV 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , rh10, rh39, rh43, rh74, AAV2-QuadYF, Anc80, Anc80L65, DJ, DJ/8, DJ/9, 7m8, and PHP (PHP.B, PHP.B2, PHP.B3, PHP. eb, PHP.S, PHP. A).
  • AAV1 , AAV2, AAV8, AAV9, Anc80, 7m8, DJ, PHP.B, PHP.B2, PHP.B3, PHP.eB, PHP.S, and PHP.A serotypes may be particularly useful.
  • Serotypes evolved for transduction of the retina may also be used in the methods and compositions described herein. Construction and use of AAV vectors and AAV proteins of different serotypes are described, for instance, in Chao et al., Mol. Ther. 2:619 (2000); Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000); Xiao et al., J. Virol.
  • pseudotyped rAAV vectors include AAV vectors of a given serotype (e.g., AAV9) pseudotyped with a capsid gene derived from a serotype other than the given serotype (e.g., AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.).
  • AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc. Techniques involving the construction and use of pseudotyped rAAV virions are known in the art and are described, for instance, in Duan et al., J. Virol. 75:7662 (2001 ); Halbert et al., J. Virol. 74:1524 (2000); Zolotukhin et al., Methods, 28:158 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001 ).
  • AAV virions that have mutations within the virion capsid may be used to infect particular cell types more effectively than non-mutated capsid virions.
  • suitable AAV mutants may have ligand insertion mutations for the facilitation of targeting AAV to specific cell types.
  • the construction and characterization of AAV capsid mutants including insertion mutants, alanine screening mutants, and epitope tag mutants is described in Wu et al., J. Virol. 74:8635 (2000).
  • Other rAAV virions that can be used in methods described herein include those capsid hybrids that are generated by molecular breeding of viruses as well as by exon shuffling. See, e.g., Soong et al., Nat. Genet., 25:436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423 (2001 ).
  • Tbx2 inhibitors, Sox2 inhibitors, and regeneration agents described herein may be incorporated into a vehicle for administration into a patient, such as a human patient suffering from vestibular dysfunction (e.g., dizziness, vertigo, loss of balance or imbalance, bilateral vestibulopathy, oscillopsia, or a balance disorder).
  • a patient such as a human patient suffering from vestibular dysfunction (e.g., dizziness, vertigo, loss of balance or imbalance, bilateral vestibulopathy, oscillopsia, or a balance disorder).
  • Pharmaceutical compositions containing a Tbx2 inhibitor, a Sox2 inhibitor, or a regeneration agent described herein can be prepared using methods known in the art.
  • such compositions can be prepared using, e.g., physiologically acceptable carriers, excipients or stabilizers (Remington: The Science and Practice of Pharmacology 22nd edition, Allen, L. Ed. (2013); incorporated herein by reference), and in a desired form, e.g., in the form
  • Tbx2 inhibitor a Tbx2 inhibitor, a Sox2 inhibitor, or a regeneration agent described herein may be prepared in water suitably mixed with one or more excipients, carriers, or diluents.
  • Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference).
  • the formulation may be sterile and may be fluid to the extent that easy syringability exists. Formulations may be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • suitable mixtures thereof e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • a solution containing a pharmaceutical composition described herein may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration.
  • sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage may be dissolved in 1 ml of isotonic NaCI solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion. Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
  • the composition may be formulated to contain a synthetic perilymph solution.
  • An exemplary synthetic perilymph solution includes 20-200 mM NaCI, 1 -5 mM KCI, 0.1 -10 mM CaCl2, 1 -10 mM glucose, and 2-50 mM HEPEs, with a pH between about 6 and 9 and an osmolality of about 300 mOsm/kg.
  • the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • preparations may meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologies standards.
  • compositions described herein may be administered to a subject having or at risk of developing vestibular dysfunction by a variety of routes, such as local administration to the middle or inner ear (e.g., administration into the perilymph or endolymph, such as through the oval window, round window, or semicircular canal (e.g., the horizontal canal), or by transtympanic or intratympanic injection, e.g., administration to a vestibular supporting cell or hair cell), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration.
  • routes such as local administration to the middle or inner ear (e.g., administration into the perilymph or endolymph, such as through the oval window, round window, or semicircular canal (e.g., the horizontal canal), or by transtympanic or intratympanic injection
  • compositions may be administered once, or more than once (e.g., once annually, twice annually, three times annually, bi-monthly, monthly, or bi-weekly).
  • Subjects that may be treated as described herein are subjects having or at risk of developing vestibular dysfunction.
  • the compositions and methods described herein can be used to treat subjects having or at risk of developing damage to or loss of vestibular hair cells (e.g., damage to or loss of vestibular hair cells related to disease or infection, head trauma, ototoxic (e.g., vestibulotoxic) drugs (e.g., aminoglycosides), or aging), subjects having or at risk of developing vestibular dysfunction (e.g., dizziness, vertigo, loss of balance or imbalance, bilateral vestibulopathy (also called bilateral vestibular hypofunction), oscillopsia, or a balance disorder), subjects carrying a genetic mutation associated with vestibular dysfunction, or subjects with a family history of hereditary vestibular dysfunction.
  • ototoxic e.g., vestibulotoxic
  • aminoglycosides e.glycosides
  • subjects having or at risk of developing vestibular dysfunction e.g., dizziness,
  • the disease associated with damage to or loss of hair cells is an autoimmune disease or condition in which an autoimmune response contributes to hair cell damage or death.
  • Autoimmune diseases linked to vestibular dysfunction include autoimmune inner ear disease (AIED), polyarteritis nodosa (PAN), Cogan's syndrome, relapsing polychondritis, systemic lupus erythematosus (SLE), Wegener's granulomatosis, Sjogren's syndrome, and Behget's disease.
  • Some infectious conditions, such as Lyme disease and syphilis can also cause vestibular dysfunction (e.g., by triggering autoantibody production).
  • Viral infections such as rubella, cytomegalovirus (CMV), lymphocytic choriomeningitis virus (LCMV), HSV types 1 &2, West Nile virus (WNV), human immunodeficiency virus (HIV) varicella zoster virus (VZV), measles, and mumps, can also cause vestibular dysfunction.
  • the subject has vestibular dysfunction that is associated with or results from loss of hair cells (e.g., vestibular hair cells).
  • compositions and methods described herein can be used to treat a subject having or at risk of developing oscillopsia.
  • compositions and methods described herein can be used to treat a subject having or at risk of developing bilateral vestibulopathy.
  • compositions and methods described herein can be used to treat a subject having or at risk of developing a balance disorder (e.g., imbalance).
  • the subject can be a human adult, adolescent, child, infant, or term newborn (e.g., a subject with a mature vestibular system).
  • the methods described herein may include a step of screening a subject for one or more mutations in genes known to be associated with vestibular dysfunction prior to treatment with or administration of the compositions described herein.
  • a subject can be screened for a genetic mutation using standard methods known to those of skill in the art (e.g., genetic testing).
  • the methods described herein may also include a step of assessing vestibular function in a subject prior to treatment with or administration of the compositions described herein.
  • Vestibular function may be assessed using standard tests, such as eye movement testing (e.g., electronystagmogram (ENG) or videonystagmogram (VNG)), tests of the vestibulo-ocular reflex (VOR) (e.g., the head impulse test (Halmagyi-Curthoys test), which can be performed at the bedside or using a video-head impulse test (VHIT), or the caloric reflex test), posturography, rotary-chair testing, ECOG, vestibular evoked myogenic potentials (VEMP), and specialized clinical balance tests, such as those described in Mancini and Horak, Eur J Phys Rehabil Med, 46:239 (2010).
  • eye movement testing e.g., electronystagmogram (ENG) or videonystagmogram (VNG)
  • VOR vestibulo
  • compositions and methods described herein may also be administered as a preventative treatment to patients at risk of developing vestibular dysfunction, e.g., patients who have a family history of vestibular dysfunction (e.g., inherited vestibular dysfunction), patients carrying a genetic mutation associated with vestibular dysfunction who do not yet exhibit symptoms of vestibular dysfunction, or patients exposed to risk factors for acquired vestibular dysfunction (e.g., disease or infection, head trauma, ototoxic drugs, or aging).
  • the compositions and methods described herein can also be used to treat a subject with idiopathic vestibular dysfunction.
  • compositions and methods described herein can be used to induce or increase the generation of Type I vestibular hair cells, to increase the number of Type I vestibular hair cells (e.g., the total number of Type I vestibular hair cells in the vestibular system), and/or to induce or increase hair cell regeneration in a subject (e.g., vestibular hair cell regeneration).
  • the compositions and methods described herein increase the generation of Type I vestibular hair cells, increase the number of Type I vestibular hair cells, and/or induce or increase hair cell regeneration in the striolar region, in the extrastriolar region, or in both the striolar and extrastriolar regions of the vestibular organs (e.g., the utricle and/or the crista).
  • compositions and methods described herein increase the generation of Type I vestibular hair cells, increase the number of Type I vestibular hair cells, and/or induce or increase hair cell regeneration in the crista, in the utricle, in the saccule, in the crista and in the utricle, or in all three of the crista, the utricle, and the saccule.
  • Subjects that may benefit from compositions that promote or increase generation of Type I vestibular hair cells, increase Type I vestibular hair cell numbers, and/or promote or increase vestibular hair cell regeneration include subjects having or at risk of developing vestibular dysfunction as a result of loss of hair cells (e.g., loss of vestibular hair cells related to trauma (e.g., head trauma), disease or infection, ototoxic drugs, or aging), subjects with abnormal vestibular hair cells (e.g., vestibular hair cells that do not function properly compared to normal vestibular hair cells), subjects with damaged vestibular hair cells (e.g., vestibular hair cell damage related to trauma (e.g., head trauma), disease or infection, ototoxic drugs, or aging), or subjects with reduced vestibular hair cell numbers due to genetic mutations or congenital abnormalities.
  • loss of vestibular hair cells related to trauma e.g., head trauma
  • disease or infection ototoxic drugs, or aging
  • abnormal vestibular hair cells e.g.,
  • compositions and methods described herein can also be used to prevent or reduce vestibular dysfunction caused by ototoxic drug-induced hair cell damage or death (e.g., vestibulotoxic drug-induced vestibular hair loss) in subjects who have been treated with ototoxic drugs, or who are currently undergoing or soon to begin treatment with ototoxic drugs.
  • Ototoxic drugs are toxic to the cells of the inner ear, and can cause vestibular dysfunction (e.g., vertigo, dizziness, imbalance, bilateral vestibulopathy, or oscillopsia).
  • Drugs that have been found to be ototoxic include aminoglycoside antibiotics (e.g., gentamycin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin, amikacin, dibekacin, and netilmicin), viomycin, antineoplastic drugs (e.g., platinum-containing chemotherapeutic agents, such as cisplatin, carboplatin, and oxaliplatin, or other chemotherapeutic agents, such as nitrogen mustards and vincristine), loop diuretics (e.g., ethacrynic acid and furosemide), salicylates (e.g., aspirin, particularly at high doses), and quinine.
  • aminoglycoside antibiotics e.g., gentamycin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin, amikacin, dibekacin, and netilmicin
  • viomycin e
  • vestibulotoxic drugs such as nitrogen mustards, vincristine, gentamicin, streptomycin, and tobramycin.
  • the methods and compositions described herein can be used to treat bilateral vestibulopathy or oscillopsia due to aminoglycoside ototoxicity (e.g., generate additional Type I vestibular hair cells to replace damaged or dead cells and/or promote or increase vestibular hair cell regeneration in a subject with aminoglycoside-induced bilateral vestibulopathy or oscillopsia).
  • Treatment may include administration of a composition containing a Tbx2 inhibitor and, optionally, a regeneration agent or a Sox2 inhibitor, described herein in various unit doses.
  • Each unit dose will ordinarily contain a predetermined quantity of the therapeutic composition.
  • the quantity to be administered, and the particular route of administration and formulation, are within the skill of those in the clinical arts.
  • a unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. Dosing may be performed using a syringe pump to control infusion rate in order to minimize damage to the inner ear (e.g., the vestibular labyrinth).
  • a composition of the invention may include a dosage of a Tbx2 inhibitor of the invention ranging from 0.01 to 500 mg/kg (e.g., 0.01 , 0.1 , 0.2, 0.3, 0.4, 0.5, 1 , 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 mg/kg) and, in a more specific embodiment, about 0.1 to about 30 mg/kg and, in a more specific embodiment, about 0.3 to about 30 mg/kg.
  • the dosage may be adapted by the physician in accordance with conventional factors such as the extent of the disease and different parameters of the subject.
  • an AAV vector e.g., an AAV vector containing an siRNA, an shRNA or miRNA targeting Tbx2 mRNA or a Tbx2 promoter, a component of a gene editing system targeting Tbx2, a polynucleotide encoding a dominant negative Tbx2 protein, an siRNA, an shRNA or miRNA targeting Sox2 mRNA or a Sox2 promoter, a component of a gene editing system targeting Sox2, a polynucleotide encoding a dominant negative Sox2 protein, or a polynucleotide encoding Atohl , e.g., an AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV1 1 , rh10, rh39, rh43, rh74, AAV2-Qu
  • the viral vector may be administered to the patient at a dose of, for example, from about 1 x 10 9 vector genomes (VG)/mL to about 1 x 10 16 VG/mL (e.g., 1 x 10 9 VG/mL, 2 x 10 9 VG/mL, 3 x 10 9 VG/mL, 4 x 10 9 VG/mL, 5 x 10 9 VG/mL, 6 x 10 9 VG/mL, 7 x 10 9 VG/mL, 8 x 10 9 VG/mL, 9 x 10 9 VG/mL, 1 x 10 10 VG/mL, 2 x 10 10 VG/mL, 3 x 10 10 VG/mL, 4 x 10 10 VG/mL, 5 x 10 10 VG/mL, 6 x 10 10 VG/mL, 7 x 10 10 VG/mL, 8 x 10 10 VG/mL, 9 x 10 9 VG/mL, 1 x 10
  • VG/mL 8 x 10 15 VG/mL, 9 x 10 15 VG/mL, or 1 x 10 16 VG/mL
  • a volume of 1 piL to 200 piL e.g., 1 , 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, or 200 pL).
  • the AAV vector may be administered to the subject at a dose of about 1 x 10 7 VG/ear to about 2 x 10 15 VG/ear (e.g., 1 x 10 7 VG/ear, 2 x 10 7 VG/ear, 3 x 10 7 VG/ear, 4 x 10 7 VG/ear, 5 x 10 7 VG/ear, 6 x 10 7 VG/ear, 7 x 10 7 VG/ear, 8 x 10 7 VG/ear, 9 x 10 7 VG/ear, 1 x 10 8
  • VG/ear 1 x 10 13 VG/ear, 2 x 10 13 VG/ear, 3 x 10 13 VG/ear, 4 x 10 13 VG/ear, 5 x 10 13 VG/ear, 6 x 10 13
  • VG/ear 1 x 10 15 VG/ear, or 2 x 10 15 VG/ear).
  • compositions described herein are administered in an amount sufficient to improve vestibular function (e.g., improve balance or reduce dizziness or vertigo), treat bilateral vestibulopathy, treat oscillopsia, treat a balance disorder, increase the generation of Type I vestibular hair cells, increase the number of Type I vestibular hair cells, or promote or increase regeneration of vestibular hair cells.
  • improve vestibular function e.g., improve balance or reduce dizziness or vertigo
  • treat bilateral vestibulopathy e.g., treat oscillopsia
  • treat a balance disorder e.g., increase the generation of Type I vestibular hair cells, increase the number of Type I vestibular hair cells, or promote or increase regeneration of vestibular hair cells.
  • Vestibular function may be evaluated using standard tests for balance and vertigo (e.g., eye movement testing (e.g., ENG or VNG), VOR testing (e.g., head impulse testing (Halmagyi-Curthoys testing, e.g., VHIT), or caloric reflex testing), posturography, rotary-chair testing, ECOG, VEMP, and specialized clinical balance tests) and may be improved by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to measurements obtained prior to treatment.
  • vertigo e.g., eye movement testing (e.g., ENG or VNG), VOR testing (e.g., head impulse testing (Halmagyi-Curthoys testing, e.g., VHIT), or caloric reflex testing), posturography, rotary-chair testing, ECOG, VE
  • compositions described herein may also be administered in an amount sufficient to slow or prevent the development or progression of vestibular dysfunction (e.g., in subjects who carry a genetic mutation associated with vestibular dysfunction, who have a family history of vestibular dysfunction (e.g., hereditary vestibular dysfunction), or who have been exposed to risk factors associated with vestibular dysfunction (e.g., ototoxic drugs, head trauma, or disease or infection) but who do not exhibit vestibular dysfunction (e.g., vertigo, dizziness, imbalance, bilateral vestibulopathy, oscillopsia, or a balance disorder), or in subjects exhibiting mild to moderate vestibular dysfunction).
  • a genetic mutation associated with vestibular dysfunction e.g., who have a family history of vestibular dysfunction (e.g., hereditary vestibular dysfunction), or who have been exposed to risk factors associated with vestibular dysfunction (e.g., ototoxic drugs, head trauma, or disease or infection) but who do not exhibit vestibular dysfunction (e.g., ver
  • Type I vestibular hair cell generation or numbers, or hair cell regeneration may be evaluated indirectly based on tests of vestibular function, and may be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to Type I vestibular hair cell generation or numbers, or hair cell regeneration prior to administration of a composition described herein or compared to an untreated subject. These effects may occur, for example, within 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more, following administration of the compositions described herein.
  • the patient may be evaluated 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more following administration of the composition depending on the dose and route of administration used for treatment. Depending on the outcome of the evaluation, the patient may receive additional treatments.
  • compositions described herein can be provided in a kit for use in treating vestibular dysfunction.
  • Compositions may include a Tbx2 inhibitor described herein and may further include a regeneration agent (e.g., an agent that increases Atohl expression and/or a Notch inhibitor) or a Sox2 inhibitor.
  • the kit can further include a package insert that instructs a user of the kit, such as a physician, to perform the methods described herein.
  • the kit may optionally include a syringe or other device for administering the composition.
  • Example 1 - Tbx2 downregulation is associated with Type I hair cell maturation
  • scRNAseq data here and in subsequent examples were generated as follows: vestibular tissue was dissociated, and single cells were captured and prepared for single-cell RNA-Seq with a 10X Genomics Chromium system. Sequencing was performed on an Illumina NovaSeq, reads were aligned with CellRanger, and downstream analysis was performed with Seurat.
  • a “maturity score” was developed and applied to this and subsequent examples as follows: A developmental scRNAseq database of mouse vestibular organs was built by collecting cristae and utricles at 18 developmental time-points between E11 .5 and adult ages. Staged cristae and utricles were prepared for scRNAseq as described above. The database contains -10,000 cells captured at each timepoint with excellent representation of all cells comprising the cristae and utricle. Cells were clustered in principal component analysis (PCA) space and cell types were assigned to each cluster by manual inspection of the expression levels of known marker genes for each cell type.
  • PCA principal component analysis
  • Tbx2 was identified as a candidate while performing a systematic characterization of transcriptional changes leading to the specification of Type I hair cell formation.
  • Downstream analysis of the scRNAseq data was performed to identify the relative levels of Tbx2 in Type I and II in adult vestibular hair cells (HC) (FIG. 1 A).
  • HC vestibular hair cells
  • Signature scores were calculated for each cell by isolating genes from each Top 100 list, taking normalized gene counts, scaling and centering counts per gene in each cell, and then averaging across all genes in the signature list. Maturity index scores were plotted at P14 (i.e., 14-day old mice) to show a moment when T1 hair cells are mature, but not all T2 are matured (FIG. 1B). The relative expression level of Tbx2 relative to T1 HC maturity scores was captured to illustrate the most mature T1 hair cells have downregulated Tbx2 (FIG. 1C).
  • Example 2 - Tbx2 is downstream of Sox2 but unaffected by adult Sox2 deletion
  • SCENIC is a tool used to infer gene regulatory relationships between transcription factors, such as Sox2 and Tbx2, and their downstream targets from single cell RNA-seq data (Aibar et al., Nature Methods 14:1083-1086, 2017.) Given gene expression data in individual cells, it infers regulatory relationships using correlating expression between a transcription factor and its target genes, and then filters for the presence of the transcription factor's DNA binding motif nearby potential target genes, which would indicate that the transcription factor binds at these sites to regulate the gene.
  • This vector was administered locally to naive Sox2fl/fl mice (Sox2tm1 .1 Lan) or C57BI6 mice via posterior semicircular canal.
  • Sox2fl/fl mice Sox2tm1 .1 Lan
  • C57BI6 mice C57BI6 mice via posterior semicircular canal.
  • scRNAseq Examination of transcripts by scRNAseq indicated that Sox2 mRNA was significantly reduced in a subpopulation of hair cells, referred to hereafter as converting type II hair cells, in the Sox2fl/fl mice (FIG. 2B).
  • Downstream analysis showed that while Sox2 knockdown led converting type II hair cells toward an identity more similar to Type I hair cells, these cells still expressed high levels of Tbx2.
  • Example 3 Administration of a composition containing a Tbx2 inhibitor to a subject with vestibular dysfunction
  • a physician of skill in the art can treat a patient, such as a human patient, with vestibular dysfunction (e.g., vertigo, dizziness, loss of balance or imbalance, bilateral vestibulopathy, oscillopsia, or a balance disorder) so as to improve or restore vestibular function.
  • a physician of skill in the art can administer to the human patient a composition containing a Tbx2 inhibitor (e.g., an inhibitory RNA molecule targeting the Tbx2 mRNA or a Tbx2 promoter, a component of a gene editing system targeting Tbx2, or a dominant negative Tbx2 protein).
  • a Tbx2 inhibitor e.g., an inhibitory RNA molecule targeting the Tbx2 mRNA or a Tbx2 promoter, a component of a gene editing system targeting Tbx2, or a dominant negative Tbx2 protein.
  • the Tbx2 inhibitor may be delivered using a viral vector, such as an AAV vector (e.g., an AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , rh10, rh39, rh43, rh74, AAV2-QuadYF, Anc80, Anc80L65, DJ, DJ/8, DJ/9, 7m8, PHP.B, PHP.B2, PBP.B3, PHP.A, PHP.eb, or PHP.S vector).
  • AAV vector e.g., an AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 , rh10, rh39, rh43, rh74, AAV2-QuadYF, Anc80, Anc80L65, DJ, DJ/8, DJ/9, 7m8, PHP.B,
  • the composition containing the Tbx2 inhibitor may be administered to the patient, for example, by local administration to the inner ear (e.g., injection into the semicircular canal), to treat vestibular dysfunction. If the vestibular dysfunction is thought to result from vestibular hair cell loss, the physician can administer to the human patient a composition containing a regeneration agent (e.g., an agent that increases Atohl expression, such as an AAV vector containing a polynucleotide encoding Atohl operably linked to a supporting cell promoter (e.g., an SLC6A14 promoter), and/or a Notch inhibitor, such as a small molecule Notch inhibitor (e.g., a gamma-secretase inhibitor) or an inhibitory RNA molecule targeting Notch), which may be administered prior to or concurrently with the Tbx2 inhibitor.
  • a regeneration agent e.g., an agent that increases Atohl expression, such as an AAV vector containing a polynucleot
  • the viral vector may be administered to the patient at a dose of, for example, from about 1 x 10 9 vector genomes (VG)/mL to about 1 x 10 16 VG/mL (e.g., 1 x 10 9 VG/mL, 2 x 10 9 VG/mL, 3 x 10 9 VG/mL, 4 x 10 9 VG/mL, 5 x 10 9 VG/mL, 6 x 10 9 VG/mL, 7 x 10 9 VG/mL, 8 x 10 9 VG/mL, 9 x 10 9 VG/mL, 1 x 1 O 10 VG/mL, 2 x 1 O 10 VG/mL, 3 x 1 O 10 VG/mL, 4 x 1 O 10 VG/mL, 5 x 1 O 10 VG/mL, 6 x 1 O 10 VG/mL, 7 x 1 O 10 VG/mL,
  • VG/mL 9 x 10 15 VG/mL, or 1 x 10 16 VG/mL
  • a volume of 1 pL to 200 pL e.g., 1 , 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, or 200 pL).
  • the viral vector may be administered to the subject at a dose of about 1 x 10 7 VG/ear to about 2 x 10 15 VG/ear (e.g., 1 x 10 7 VG/ear, 2 x 10 7 VG/ear, 3 x 10 7 VG/ear, 4 x 10 7 VG/ear, 5 x 10 7 VG/ear, 6 x 10 7 VG/ear, 7 x 10 7 VG/ear, 8 x 10 7 VG/ear, 9 x 10 7 VG/ear, 1 x 10 8 VG/ear, 2 x 10 8 VG/ear, 3 x 10 8 VG/ear, 4 x 10 8 VG/ear, 5 x 10 8 VG/ear, 6 x 10 8 VG/ear, 7 x 10 8 VG/ear, 8 x 10 8 VG/ear, 9 x 10 8 VG/ear, 1 x 10 9 VG/ear, 2 x 10 9 VG/ear, 3 x 10 10 15 VG/ear (e.
  • VG/ear 1 x 10 13 VG/ear, 2 x 10 13 VG/ear, 3 x 10 13 VG/ear, 4 x 10 13 VG/ear, 5 x 10 13 VG/ear, 6 x 10 13
  • VG/ear 1 x 10 15 VG/ear, or 2 x 10 15 VG/ear).
  • a practitioner of skill in the art can monitor the patient’s improvement in response to the therapy by a variety of methods.
  • a physician can monitor the patient’s vestibular function by performing standard tests such as electronystagmography, video nystagmography, VOR tests (e.g., head impulse tests (Halmagyi-Curthoys test, e.g., VHIT), or caloric reflex tests), rotation tests, vestibular evoked myogenic potential, or computerized dynamic posturography.
  • a finding that the patient exhibits improved vestibular function in one or more of the tests following administration of the composition compared to test results obtained prior to administration of the composition indicates that the patient is responding favorably to the treatment. Subsequent doses can be determined and administered as needed.
  • Example 4 Administration of a composition containing a Tbx2 inhibitor and a Sox2 inhibitor to a subject with vestibular dysfunction
  • a physician of skill in the art can treat a patient, such as a human patient, with vestibular dysfunction (e.g., vertigo, dizziness, loss of balance or imbalance, bilateral vestibulopathy, oscillopsia, or a balance disorder) so as to improve or restore vestibular function.
  • vestibular dysfunction e.g., vertigo, dizziness, loss of balance or imbalance, bilateral vestibulopathy, oscillopsia, or a balance disorder
  • a physician of skill in the art can administer to the human patient a composition containing a Tbx2 inhibitor (e.g., an inhibitory RNA molecule targeting the Tbx2 mRNA or a Tbx2 promoter, a component of a gene editing system targeting Tbx2, or a dominant negative Tbx2 protein) and a Sox2 inhibitor (e.g., an inhibitory RNA molecule targeting the Sox2 mRNA or a Sox2 promoter, a component of a gene editing system targeting Sox2, or a dominant negative Sox2 protein).
  • a Tbx2 inhibitor e.g., an inhibitory RNA molecule targeting the Tbx2 mRNA or a Tbx2 promoter, a component of a gene editing system targeting Tbx2, or a dominant negative Tbx2 protein
  • Sox2 inhibitor e.g., an inhibitory RNA molecule targeting the Sox2 mRNA or a Sox2 promoter, a component of a gene editing system targeting
  • the Tbx2 inhibitor and the Sox2 inhibitor may be delivered using a viral vector (e.g., a single vector containing both inhibitors or a separate vector containing each inhibitor), such as an AAV vector (e.g., an AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV1 1 , rh10, rh39, rh43, rh74, AAV2-QuadYF, Anc80, Anc80L65, DJ, DJ/8, DJ/9, 7m8, PHP.B, PHP.B2, PBP.B3, PHP.A, PHP.eb, or PHP.S vector).
  • a viral vector e.g., a single vector containing both inhibitors or a separate vector containing each inhibitor
  • AAV vector e.g., an AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10
  • the composition containing the Tbx2 inhibitor may be administered to the patient, for example, by local administration to the inner ear (e.g., injection into the semicircular canal), to treat vestibular dysfunction.
  • the viral vector may be administered to the patient at a dose of, for example, from about 1 x 10 9 vector genomes (VG)/mL to about 1 x 10 16 VG/mL (e.g., 1 x 10 9 VG/mL, 2 x 10 9 VG/mL, 3 x 10 9 VG/mL, 4 x 10 9 VG/mL, 5 x 10 9 VG/mL, 6 x 10 9 VG/mL, 7 x 10 9 VG/mL, 8 x 10 9 VG/mL, 9 x 10 9 VG/mL, 1 x 10 10 VG/mL, 2 x 10 10 VG/mL, 3 x 10 10 VG/mL
  • VG/mL 1 x 10 15 VG/mL, 2 x 10 15 VG/mL, 3 x 10 15 VG/mL, 4 x 10 15 VG/mL, 5 x 10 15 VG/mL, 6 x 10 15
  • VG/mL 7 x 10 15 VG/mL, 8 x 10 15 VG/mL, 9 x 10 15 VG/mL, or 1 x 10 16 VG/mL
  • a volume of 1 piL to 200 pL e.g., 1 , 2, 3, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, or 200 pL).
  • the viral vector may be administered to the subject at a dose of about 1 x 10 7 VG/ear to about 2 x 10 15 VG/ear (e.g., 1 x 10 7 VG/ear, 2 x 10 7 VG/ear, 3 x 10 7 VG/ear, 4 x 10 7 VG/ear, 5 x 10 7 VG/ear, 6 x 10 7 VG/ear, 7 x 10 7 VG/ear, 8 x 10 7 VG/ear, 9 x 10 7 VG/ear, 1 x 10 8 VG/ear, 2 x 10 8 VG/ear, 3 x 10 8 VG/ear, 4 x 10 8 VG/ear, 5 x 10 8 VG/ear, 6 x 10 8 VG/ear, 7 x 10 8 VG/ear, 8 x 10 8 VG/ear, 9 x 10 8 VG/ear, 1 x 10 9 VG/ear, 2 x 10 9 VG/ear, 3 x 10 10 15 VG/ear (e.
  • VG/ear 7 x 10 10 VG/ear, 8 x 10 10 VG/ear, 9 x 10 10 VG/ear, 1 x 10 11 VG/ear, 2 x 10 11 VG/ear, 3 x 10 11
  • VG/ear 1 x 10 12 VG/ear, 2 x 10 12 VG/ear, 3 x 10 12 VG/ear, 4 x 10 12 VG/ear, 5 x 10 12 VG/ear, 6 x 10 12
  • VG/ear 7 x 10 12 VG/ear, 8 x 10 12 VG/ear, 9 x 10 12 VG/ear, 1 x 10 13 VG/ear, 2 x 10 13 VG/ear, 3 x 10 13
  • VG/ear 1 x 10 14 VG/ear, 2 x 10 14 VG/ear, 3 x 10 14 VG/ear, 4 x 10 14 VG/ear, 5 x 10 14 VG/ear, 6 x 10 14
  • VG/ear 7 x 10 14 VG/ear, 8 x 10 14 VG/ear, 9 x 10 14 VG/ear, 1 x 10 15 VG/ear, or 2 x 10 15 VG/ear).
  • a practitioner of skill in the art can monitor the patient’s improvement in response to the therapy by a variety of methods.
  • a physician can monitor the patient’s vestibular function by performing standard tests such as electronystagmography, video nystagmography, VOR tests (e.g., head impulse tests (Halmagyi-Curthoys test, e.g., VHIT), or caloric reflex tests), rotation tests, vestibular evoked myogenic potential, or computerized dynamic posturography.
  • a finding that the patient exhibits improved vestibular function in one or more of the tests following administration of the composition compared to test results obtained prior to administration of the composition indicates that the patient is responding favorably to the treatment. Subsequent doses can be determined and administered as needed.
  • a method of generating Type I vestibular hair cells in a subject in need thereof comprising the step of administering to an inner ear of the subject an effective amount of a Tbx2 inhibitor.
  • E2 The method of E1 , wherein the subject has or is at risk of developing vestibular dysfunction.
  • a method of treating a subject having or at risk of developing vestibular dysfunction comprising the step of administering to an inner ear of the subject an effective amount of a Tbx2 inhibitor.
  • E4 The method of E2 or E3, wherein the vestibular dysfunction is associated with damage to or loss of vestibular hair cells (e.g., Type I vestibular hair cells).
  • vestibular hair cells e.g., Type I vestibular hair cells
  • Tbx2 inhibitor is an inhibitory RNA molecule targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Tbx2 or a Tbx2 promoter, a component of a gene editing system targeting Tbx2, a polynucleotide encoding a component of a gene editing system targeting Tbx2, a dominant negative Tbx2 protein, a polynucleotide encoding a dominant negative Tbx2 protein, or a small molecule Tbx2 inhibitor.
  • the Tbx2 inhibitor is an inhibitory RNA molecule targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Tbx2 or a Tbx2 promoter, a component of a gene editing system targeting Tbx2, a polynucleotide encoding a component of a gene
  • Tbx2 inhibitor is an inhibitory RNA molecule targeting Tbx2 or is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Tbx2.
  • E7 The method of E6, wherein the inhibitory RNA molecule is a short interfering RNA (siRNA).
  • siRNA short interfering RNA
  • E8 The method of E6, wherein the inhibitory RNA molecule is a short hairpin RNA (shRNA).
  • shRNA short hairpin RNA
  • E9 The method of E7 or E8, wherein the siRNA or shRNA targeting Tbx2 has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 80% complementarity to an equal length portion of a target region of an mRNA transcript of a human or murine TBX2 gene (e.g., at least 80% complementarity to an equal length portion of a target region of SEQ ID NO: 1 or SEQ ID NO: 3).
  • E10 The method of E9, wherein the target region is a portion of an mRNA transcript of the human TBX2 gene (SEQ ID NO: 1 ).
  • E11 The method of E9, wherein the target region is at least 8 to 21 contiguous nucleobases of SEQ ID NO: 5.
  • E12 The method of E9, wherein the siRNA or shRNA has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of SEQ ID NO: 5.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
  • E15 The method of any one of E8-E14, wherein the shRNA is embedded in a microRNA (miRNA) backbone (e.g., embedded in a miRNA backbone to produce an shRNA-mir).
  • miRNA microRNA
  • E16 The method of E15, wherein the shRNA is embedded in a miR-30 or mir-E backbone.
  • E17 The method of E8 or E10, wherein the siRNA has at least 85% sequence identity (e.g., 85%,
  • SEQ ID NOs: 8-24 comprises a sense strand and an antisense strand having the sequences of SEQ ID NO: 25 and SEQ ID NO: 26.
  • E18 The method of E6, wherein the inhibitory RNA is a miRNA.
  • E19 The method of E18, wherein the miRNA is hsa-miR-1180, hsa-miR-1203, hsa-miR-1205, hsa- miR-1207-5p, hsa-miR-1224-3p, hsa-miR-124-3p, hsa-miR-1292, hsa-miR-1470, hsa-miR-153, hsa-miR-21 , hsa-miR-216b, hsa-miR-3120-3p, hsa-miR-3175, hsa-miR-3186-3p, hsa-miR-3192, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-331 -3p, h
  • E20 The method of E19, wherein the miRNA is hsa-miR-1180, hsa-miR-1203, hsa-miR-1205, hsa- miR-1207-5p, hsa-miR-1224-3p, hsa-miR-124-3p, hsa-miR-1292, hsa-miR-1470, hsa-miR-153, or hsa-miR-21 .
  • Tbx2 inhibitor is an inhibitory RNA molecule targeting a Tbx2 promoter or is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting a Tbx2 promoter.
  • E22 The method of E21 , wherein the inhibitory RNA molecule is a miRNA.
  • Tbx2 or is a polynucleotide encoding a component of a gene editing system targeting Tbx2 (e.g., targeting Tbx2 to engineer an alteration in Tbx2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Tbx2, thereby inhibiting Tbx2).
  • a component of a gene editing system targeting Tbx2 e.g., targeting Tbx2 to engineer an alteration in Tbx2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Tbx2, thereby inhibiting Tbx2).
  • E24 The method of E23, wherein the gene editing system is a zinc finger nuclease (ZFN) system, a transcription activator-like effector-based nuclease (TALEN) system, or a clustered regulatory interspaced short palindromic repeat (CRISPR) system.
  • ZFN zinc finger nuclease
  • TALEN transcription activator-like effector-based nuclease
  • CRISPR clustered regulatory interspaced short palindromic repeat
  • E26 The method of E25, wherein the dominant negative Tbx2 protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4, or wherein the polynucleotide encoding the dominant negative Tbx2 protein encodes a protein having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4.
  • sequence identity e.g., 85%,
  • E27 The method of E26, wherein the dominant negative Tbx2 protein has the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4, or wherein the polynucleotide encoding the dominant negative Tbx2 protein encodes a protein having the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4.
  • E29 The method of E28, wherein the small molecule Tbx2 inhibitor is a small molecule Tbx2 inhibitor listed in Table 5.
  • E30 The method of E29, wherein the small molecule Tbx2 inhibitor is testosterone, dorsomorphin, estropipate, LY-2140023, carbinoxamine, tyrphostin-AG-1295, DMeOB, methantheline, or HDAC6 inhibitor ISOX.
  • E31 The method of any one of E1 -E4, wherein the Tbx2 inhibitor is TGF-p1 or a polynucleotide encoding TGF-p1 .
  • E32 The method of any one of E1 -E31 , wherein the method further comprises administering a regeneration agent.
  • E33 The method of E32, wherein the regeneration agent is administered before the Tbx2 inhibitor.
  • E34 The method of E32, wherein the regeneration agent is administered after the Tbx2 inhibitor.
  • E35 The method of E32, wherein the regeneration agent is administered concurrently with the Tbx2 inhibitor.
  • E36 The method of any one of E32-E35, wherein the regeneration agent is an agent that increases Atohl expression and/or a Notch inhibitor.
  • E37 The method of E36, wherein the regeneration agent is an agent that increases Atohl expression.
  • E38 The method of E36 or E37, wherein the agent that increases Atohl expression is a polynucleotide encoding Atohl (e.g., a polynucleotide encoding SEQ ID NO: 27, such as a polynucleotide having the sequence of SEQ ID NO: 28).
  • a polynucleotide encoding Atohl e.g., a polynucleotide encoding SEQ ID NO: 27, such as a polynucleotide having the sequence of SEQ ID NO: 28.
  • E39 The method of E36 or E37, wherein the agent that increases Atohl expression is a small molecule.
  • E41 The method of E36 or E40, wherein the Notch inhibitor is an inhibitory RNA targeting Notch, a polynucleotide that can be transcribed to produce an inhibitory RNA targeting Notch, a small molecule Notch inhibitor, an anti-Notch antibody, or a polynucleotide encoding an anti-Notch antibody.
  • the Notch inhibitor is an inhibitory RNA targeting Notch, a polynucleotide that can be transcribed to produce an inhibitory RNA targeting Notch, a small molecule Notch inhibitor, an anti-Notch antibody, or a polynucleotide encoding an anti-Notch antibody.
  • E42 The method of any one of E36, E40, and E41 , wherein the Notch inhibitor is an inhibitory RNA targeting Notch or is a polynucleotide that can be transcribed to produce an inhibitory RNA targeting Notch.
  • E43 The method of E41 or E42, wherein the inhibitory RNA targeting Notch is an siRNA, an shRNA, or a miRNA.
  • E44 The method of any one of E36, E40, and E41 , wherein the Notch inhibitor is a small molecule Notch inhibitor.
  • E45 The method of any one of E36, E40, and E41 , wherein the Notch inhibitor is an anti-Notch antibody or is a polynucleotide encoding an anti-Notch antibody.
  • E46 The method of any one of E32-E38, E40-E43, and E45, wherein the regeneration agent is administered using a nucleic acid vector.
  • E47 The method of E46, wherein the nucleic acid vector comprises a promoter operably linked to the regeneration agent.
  • E48 The method of E47, wherein the regeneration agent is a polynucleotide encoding Atohl , a polynucleotide that can be transcribed to produce an siRNA targeting Notch, a polynucleotide that can be transcribed to produce an shRNA targeting Notch, a polynucleotide that can be transcribed to produce a miRNA targeting Notch, or a polynucleotide encoding an anti-Notch antibody and the promoter is a pol II promoter.
  • E49 The method of E48, wherein the pol II promoter is a supporting cell promoter (e.g., a vestibular supporting cell promoter, such as an SLC6A14 promoter).
  • a supporting cell promoter e.g., a vestibular supporting cell promoter, such as an SLC6A14 promoter.
  • E50 The method of E49, wherein the supporting cell promoter is a Glial Acidic Fibrillary Protein (GFAP) promoter, a Solute Carrier Family 1 Member 3 (GLAST) promoter, a Hes Family BHLH Transcription Factor 1 (HES1 ) promoter, a Jagged 1 (JAG1 ) promoter, a Notch 1 (N0TCH1 ) promoter, a Leucine Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5) promoter, a S0X2 promoter, a Hes Family BHLH Transcription Factor 5 (HES5) promoter, a LFNG O- Fucosylpeptide 3-Beta-N-Acetylglucosaminyltransferase (LFNG) promoter, a Kringle Containing Transmembrane Protein 1 (KREMEN1 ) promoter, an Anterior Gradient 3, Protein Disulphide Isomerase Family Member (AGR3) promoter,
  • E51 The method of E47, wherein the regeneration agent is a polynucleotide that can be transcribed to produce an siRNA targeting Notch, a polynucleotide that can be transcribed to produce an shRNA targeting Notch, or a polynucleotide that can be transcribed to produce a miRNA targeting Notch and the promoter is a pol III promoter.
  • the regeneration agent is a polynucleotide that can be transcribed to produce an siRNA targeting Notch, a polynucleotide that can be transcribed to produce an shRNA targeting Notch, or a polynucleotide that can be transcribed to produce a miRNA targeting Notch and the promoter is a pol III promoter.
  • E52 The method of any one of E1 -E51 , wherein the method further comprises administering a Sox2 inhibitor.
  • E53 The method of E52, wherein the Sox2 inhibitor is administered before the Tbx2 inhibitor.
  • E54 The method of E52, wherein the Sox2 inhibitor is administered after the Tbx2 inhibitor.
  • E55 The method of E52, wherein the Sox2 inhibitor is administered concurrently with the Tbx2 inhibitor.
  • E56. The method of any one of E52-E55, wherein the Sox2 inhibitor is an inhibitory RNA molecule targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Sox2 or a Sox2 promoter, a component of a gene editing system targeting Sox2, a polynucleotide encoding a component of a gene editing system targeting Sox2, a dominant negative Sox2 protein, or a polynucleotide encoding a dominant negative Sox2 protein.
  • E57 The method of E56, wherein the Sox2 inhibitor is an inhibitory RNA molecule targeting Sox2 or is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Sox2.
  • E58 The method of E57, wherein the inhibitory RNA molecule is a short interfering RNA (siRNA).
  • siRNA short interfering RNA
  • E59 The method of E57, wherein the inhibitory RNA molecule is a short hairpin RNA (shRNA).
  • shRNA short hairpin RNA
  • E60 The method of E58 or E59, wherein the siRNA or shRNA targeting Sox2 has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 80% complementarity to an equal length portion of a target region of an mRNA transcript of a human or murine SOX2 gene (e.g., at least 80% complementarity to an equal length portion of a target region of SEQ ID NO: 90 or SEQ ID NO: 32).
  • E61 The method of E60, wherein the target region is a portion of an mRNA transcript of the human SOX2 gene (SEQ ID NO: 90).
  • E62 The method of E60, wherein the target region is at least 8 to 21 contiguous nucleobases of any one of SEQ ID NOs: 34-52, at least 8 to 22 contiguous nucleobases of SEQ ID NO: 57 or SEQ ID NO: 58, or at least 8 to 19 contiguous nucleobases of any one of SEQ ID NOs: 54-56.
  • E63 The method of E60, wherein the siRNA or shRNA has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) complementarity to an equal length portion of any one of SEQ ID NOs: 34-52 and 54-38.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 9
  • E64 The method of E63, wherein the shRNA has a nucleobase sequence having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) complementarity to any one of SEQ ID NO: 40, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 9
  • E65 The method of E63, wherein the shRNA comprises the sequence of nucleotides 2234-2296 of SEQ ID NO: 59 or nucleotides 2234-2296 of SEQ ID NO: 61 .
  • E66 The method of any one of E59-E65, wherein the shRNA is embedded in a miRNA backbone (e.g., embedded in a miRNA backbone to produce an shRNA-mir).
  • E67 The method of E66, wherein the shRNA is embedded in a miR-30 or mir-E backbone.
  • SEQ ID NO: 59 nucleotides 2109-2408 of SEQ ID NO: 60, nucleotides 2109-2426 of SEQ ID NO: 61 , or nucleotides 2109-2408 of SEQ ID NO: 62.
  • E69 The method of E58 or E60, wherein the siRNA comprises a sense strand and an antisense strand selected from the following pairs: SEQ ID NO: 64 and SEQ ID NO: 65; SEQ ID NO: 66 and SEQ ID NO: 67; SEQ ID NO: 68 and SEQ ID NO: 69; and SEQ ID NO: 70 and SEQ ID NO: 71 .
  • E70 The method of E57, wherein the inhibitory RNA is a miRNA.
  • E71 The method of E70, wherein the miRNA is human miR-145, miR-126, miR-200c, miR-429, miR-
  • miR-140 miR-9, miR-21 , miR-590, miR-182, or miR-638, or murine miR-134, miR-200c, miR-429, miR-200b, miR-34a, or miR-9.
  • E72 The method of E56, wherein the Sox2 inhibitor is an inhibitory RNA molecule targeting a Sox2 promoter or is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting a Sox2 promoter.
  • E73 The method of E72, wherein the inhibitory RNA molecule is a miRNA.
  • Sox2 or a polynucleotide encoding a component of a gene editing system targeting Sox2 e.g., targeting Sox2 to engineer an alteration in Sox2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Sox2, thereby inhibiting Sox2).
  • E75 The method of E74, wherein the gene editing system is a zinc finger nuclease (ZFN) system, a transcription activator-like effector-based nuclease (TALEN) system, or a clustered regulatory interspaced short palindromic repeat (CRISPR) system.
  • ZFN zinc finger nuclease
  • TALEN transcription activator-like effector-based nuclease
  • CRISPR clustered regulatory interspaced short palindromic repeat
  • E76 The method of E56, wherein the Sox2 inhibitor is a dominant negative Sox2 protein or a polynucleotide encoding a dominant negative Sox2 protein.
  • E77 The method of E76, wherein the polynucleotide encoding the dominant negative Sox2 protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO: 24 or SEQ ID NO: 34.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity
  • E78 The method of E77, wherein the polynucleotide encoding the dominant negative Sox2 protein has the sequence of SEQ ID NO: 24 or SEQ ID NO: 34.
  • E79 The method of E76, wherein the dominant negative Sox2 protein is a Sox2 protein that lacks most or all of the high mobility group domain (HMGD), a Sox2 protein in which the nuclear localization signals in the HMGD are mutated, a Sox2 protein in which the HMGD is fused to an engrailed repressor domain, or a c-terminally truncated Sox2 protein comprising only the DNA binding domain.
  • HMGD high mobility group domain
  • E80 The method of any one of E52-E79, wherein the Sox2 inhibitor is administered using a nucleic acid vector.
  • E81 The method of E80, wherein the nucleic acid vector comprises a promoter operably linked to the Sox2 inhibitor.
  • E82 The method of E81 , wherein the Sox2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Sox2 or a Sox2 promoter embedded in a miRNA (e.g., embedded in a miRNA backbone to produce an shRNA-mir), a polynucleotide that can be transcribed to produce a miRNA targeting Sox2, or a polynucleotide that can be transcribed to produce a miRNA targeting a Sox22 promoter and the promoter is a pol III promoter.
  • the Sox2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Sox2 or a Sox2 promoter
  • the Sox2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Sox2 or a Sox2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Sox2 or a Sox2 promoter embedded in a miRNA (embedded in a miRNA backbone to produce an shRNA-mir), a polynucleotide that can be transcribed to produce a miRNA targeting Sox2, a polynucleotide that can be transcribed to produce a miRNA targeting a Sox2 promoter, a polynucleotide encoding a component of a gene editing system targeting Sox2, or a polynucleotide encoding a dominant negative Sox2 protein and the promoter is a pol II promoter
  • E84 The method of any one of E1 -E27 and E31 -E83, wherein the Tbx2 inhibitor is administered using a nucleic acid vector.
  • E85 The method of E84, wherein the nucleic acid vector comprises a promoter operably linked to the Tbx2 inhibitor.
  • the Tbx2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Tbx2 or a Tbx2 promoter embedded in a miRNA (e.g., embedded in a miRNA backbone to produce an shRNA-mir), a polynucleotide that can be transcribed to produce a miRNA targeting Tbx2, or a polynucleotide that can be transcribed to produce a miRNA targeting a Tbx2 promoter and the promoter is a pol III promoter.
  • the Tbx2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Tbx2 or a Tbx2 promoter,
  • E87 The method of any one of E51 , E82, and E86, wherein the pol III promoter is a ubiquitous pol III promoter.
  • E88 The method of E87, wherein the ubiquitous pol III promoter is a U6 promoter, an H1 promoter, or a 7SK promoter.
  • the Tbx2 inhibitor is a polynucleotide that can be transcribed to produce an siRNA targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Tbx2 or a Tbx2 promoter, a polynucleotide that can be transcribed to produce an shRNA targeting Tbx2 or a Tbx2 promoter embedded in a miRNA (embedded in a miRNA backbone to produce an shRNA-mir), a polynucleotide that can be transcribed to produce a miRNA targeting Tbx2, a polynucleotide that can be transcribed to produce a miRNA targeting a Tbx2 promoter, a polynucleotide encoding a component of a gene editing system targeting Tbx2, a polynucleotide encoding a dominant negative Tbx2 protein, or
  • E90 The method of any one of E48, E83, and E89, wherein the pol II promoter is a ubiquitous promoter.
  • the ubiquitous pol II promoter is a CAG promoter, a CBA promoter, a CBh promoter, an smCBA promoter, a CASI promoter, a dihydrofolate reductase (DHFR) promoter, a p-actin promoter, a phosphoglycerol kinase (PGK) promoter, a UBC promoter, an EF1a promoter, an EF1a-short (EFS) promoter, a spleen focus-forming virus (SFFV) promoter, a murine stem cell virus (MSCV) promoter, a p-g lobin promoter, a CMV promoter, an HSV promoter, or an SV40 promoter.
  • the ubiquitous pol II promoter is a CAG promoter, a CBA promoter, a CBh promoter, an smCBA promoter, a CASI promoter, a dihydrofolate reductase (DH
  • E92 The method of E91 , wherein the promoter is a minimal p-globin promoter, a CMVmini promoter, a minCMV promoter, a CMV-TATA+INR promoter, a min CMV-T6 promoter, a minimal HSV ICPO promoter, a truncated HSV ICPO promoter, or an SV40 minimal promoter.
  • the promoter is a minimal p-globin promoter, a CMVmini promoter, a minCMV promoter, a CMV-TATA+INR promoter, a min CMV-T6 promoter, a minimal HSV ICPO promoter, a truncated HSV ICPO promoter, or an SV40 minimal promoter.
  • E93 The method of E83 or E89, wherein the pol II promoter is a hair cell promoter.
  • E94 The method of E93, wherein the hair cell promoter is a Myosin 15A (MY015) promoter, a Growth
  • GFI1 Factor Independent 1 Transcriptional Repressor
  • POU4F3 POU Class 4 Homeobox 3
  • MY07A Myosin 7a
  • E95 The method of E83 or E89, wherein the pol II promoter is a Type II vestibular hair cell promoter.
  • E96 The method of E95, wherein the Type II vestibular hair cell promoter is a Calbindin 2 (CALB2) promoter, a Microtubule associated protein tau (MAPT) promoter, an Annexin A4 (ANXA4) promoter, or an Otoferlin (OTOF) promoter.
  • CALB2 Calbindin 2
  • MTT Microtubule associated protein tau
  • ANXA4 Annexin A4
  • OTOF Otoferlin
  • E97 The method of E83 or E89, wherein the pol II promoter is an immature vestibular hair cell promoter.
  • E98 The method of E97, wherein the immature vestibular hair cell promoter is an Atohl promoter.
  • E99 The method of any one of E46-E51 and E84-E98, wherein the Tbx2 inhibitor and the regeneration agent are administered using separate nucleic acid vectors.
  • E100 The method of any one of E46-E51 and E84-E98, wherein the Tbx2 inhibitor and the regeneration agent are administered using a single nucleic acid vector that expresses (i.e., encodes) both the Tbx2 inhibitor and the regeneration agent.
  • E101 The method of E100, wherein the Tbx2 inhibitor and the regeneration agent are expressed using two different promoters (e.g., a first promoter, such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter, is operably linked to a polynucleotide encoding the Tbx2 inhibitor and a second promoter, such as a supporting cell promoter, is operably linked to the polynucleotide encoding the regeneration agent).
  • a first promoter such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter
  • a second promoter such as a supporting cell promoter
  • E102 The method of E100, wherein the Tbx2 inhibitor and the regeneration agent are expressed using the same promoter (e.g., both the Tbx2 inhibitor and the regeneration agent are operably linked to supporting cell promoter or a ubiquitous promoter, either by including two copies of the promoter in the vector, with one copy operably linked to the Tbx2 inhibitor and the other copy operably linked to the regeneration agent, or by operably linking both the Tbx2 inhibitor and regeneration agent to a single copy of the promoter and placing an IRES or 2A polypeptide (e.g., F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), P2A (porcine teschovirus-1 2A), or T2A (thosea asigna virus 2A)) between the polynucleotides encoding the Tbx2 inhibitor and regeneration agent).
  • an IRES or 2A polypeptide e.g., F2A (foot-and-mouth disease virus), E2A (equ
  • E103 The method of any one of E41 -E51 and E84-E102, wherein the nucleic acid vector further comprises a polynucleotide encoding a miRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor and/or the regeneration agent in Type I vestibular hair cells (e.g., a polynucleotide encoding a target sequence for a miRNA that is expressed in Type I vestibular hair cells and not in Type II vestibular hair cells and/or vestibular supporting cells, e.g., operably linked to the same promoter as the Tbx2 inhibitor and/or regeneration agent).
  • E104 The method of any one of E80-E98, wherein the Tbx2 inhibitor and the Sox2 inhibitor are administered using separate nucleic acid vectors.
  • E105 The method of any one of E80-E98, wherein the Tbx2 inhibitor and the Sox2 inhibitor are administered using a single nucleic acid vector that expresses (i.e., encodes) both the Tbx2 inhibitor and the Sox2 inhibitor.
  • E106 The method of E105, wherein the Tbx2 inhibitor and the Sox2 inhibitor are expressed using two different promoters (e.g., a first promoter, such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter, is operably linked to a polynucleotide encoding the Tbx2 inhibitor and a second promoter (that is different from the first promoter), such as a supporting cell promoter, a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter is operably linked to the polynucleotide encoding the Sox2 inhibitor).
  • a first promoter such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter
  • E107 The method of E105, wherein the Tbx2 inhibitor and the Sox2 inhibitor are expressed using the same promoter (e.g., both the Tbx2 inhibitor and the Sox2 inhibitor are operably linked to a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter, either by including two copies of the promoter in the vector, with one copy operably linked to the Tbx2 inhibitor and the other copy operably linked to the Sox2 inhibitor, or by operably linking both the Tbx2 inhibitor and the Sox2 inhibitor to a single copy of the promoter and placing an IRES or 2A polypeptide (e.g., F2A, E2A, P2A, or T2A) between the polynucleotides encoding the Tbx2 inhibitor and the Sox2 inhibitor).
  • an IRES or 2A polypeptide e.g., F2A, E2A, P2A, or T2A
  • E108 The method of any one of E80-E98 and E104-E107, wherein the nucleic acid vector further comprises a polynucleotide encoding a miRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor and/or the Sox2 inhibitor in Type I vestibular hair cells (e.g., a polynucleotide encoding a target sequence for a miRNA that is expressed in Type I vestibular hair cells and not in Type II vestibular hair cells and/or vestibular supporting cells, e.g., operably linked to the same promoter as the Tbx2 inhibitor and/or Sox2 inhibitor).
  • a polynucleotide encoding a miRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor and/or the Sox2 inhibitor in Type I vestibular hair cells e.g., a polynucleotide encoding a target sequence for a miRNA that is expressed in Type I vestibular hair cells and not
  • E109 The method of any one of E46-E108, wherein the nucleic acid vector is a plasmid, cosmid, artificial chromosome, or viral vector.
  • E110 The method of E109, wherein the nucleic acid vector is a viral vector.
  • E111 The method of E110, wherein the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, or a lentivirus vector.
  • AAV adeno-associated virus
  • E112. The method of E111 , wherein the viral vector is an AAV vector.
  • E113 The method of E112, wherein the AAV vector has an AAV1 , AAV2, AAV2quad(Y-F), AAV3,
  • E114 The method of any one of E2-E113, wherein the vestibular dysfunction comprises vertigo, dizziness, loss of balance (imbalance), bilateral vestibulopathy, oscillopsia, or a balance disorder.
  • E115 The method of any one of E2-E114, wherein the vestibular dysfunction is age-related vestibular dysfunction, head trauma-related vestibular dysfunction, disease or infection-related vestibular dysfunction, or ototoxic (e.g., vestibulotoxic) drug-induced vestibular dysfunction.
  • the vestibular dysfunction is age-related vestibular dysfunction, head trauma-related vestibular dysfunction, disease or infection-related vestibular dysfunction, or ototoxic (e.g., vestibulotoxic) drug-induced vestibular dysfunction.
  • the ototoxic drug is an aminoglycoside (an aminoglycoside antibiotic, e.g., gentamycin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin, amikacin, dibekacin, and netilmicin), viomycin, an antineoplastic drug (e.g., a platinum-containing chemotherapeutic agents, such as cisplatin, carboplatin, or oxaliplatin, or another chemotherapeutic agent, such as a nitrogen mustard or vincristine), a loop diuretic (e.g., ethacrynic acid or furosemide), a salicylate, or quinine.
  • an aminoglycoside an aminoglycoside antibiotic, e.g., gentamycin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin, amikacin, dibekacin, and netilmicin
  • viomycin an
  • E117 The method of any one of E2-E114, wherein the vestibular dysfunction is associated with a genetic mutation.
  • E118 The method of any one of E2-E114, wherein the vestibular dysfunction is idiopathic vestibular dysfunction.
  • E119 The method of any one of E1 -E118, wherein the method further comprises evaluating the vestibular function of the subject prior to administering the nucleic acid vector or composition.
  • E120 The method of any one of E1 -E119, wherein the method further comprises evaluating the vestibular function of the subject after administering the nucleic acid vector or composition.
  • E121 The method of any one of E1 -E120, wherein the Tbx2 inhibitor and/or regeneration agent is locally administered.
  • E122 The method of E121 , wherein the Tbx2 inhibitor and/or regeneration agent is administered to a semicircular canal (e.g., intra-labyrinth delivery).
  • a semicircular canal e.g., intra-labyrinth delivery
  • E123 The method of E121 , wherein the Tbx2 inhibitor and/or regeneration agent is administered to the inner ear.
  • E124 The method of E121 , wherein the Tbx2 inhibitor and/or regeneration agent is administered to the middle ear.
  • E125 The method of E121 , wherein the Tbx2 inhibitor and/or regeneration agent is administered transtympanically or intratympanically.
  • E126 The method of E121 , wherein the Tbx2 inhibitor and/or regeneration agent is administered into the perilymph.
  • E127 The method of E121 , wherein the Tbx2 inhibitor and/or regeneration agent is administered into the endolymph.
  • E128 The method of E121 , wherein the Tbx2 inhibitor and/or regeneration agent is administered to or through the oval window.
  • E129 The method of E121 , wherein the Tbx2 inhibitor and/or regeneration agent is administered to or through the round window.
  • E130 The method of any one of E1 -E129, wherein the Tbx2 inhibitor, Sox2 inhibitor, and/or regeneration agent is administered in an amount sufficient to prevent or reduce vestibular dysfunction, delay the development of vestibular dysfunction, slow the progression of vestibular dysfunction, improve vestibular function, improve balance, reduce dizziness, reduce vertigo, increase Type I vestibular hair cell numbers, increase the generation of Type I vestibular hair cells, or promote or increase hair cell regeneration.
  • a nucleic acid vector comprising a Tbx2 inhibitor operably linked to a promoter.
  • E132 The nucleic acid vector of E131 , wherein the Tbx2 inhibitor is a polynucleotide that can be transcribed to produce (i.e., a polynucleotide encoding) an inhibitory RNA molecule targeting Tbx2 or a Tbx2 promoter, a polynucleotide encoding a component of a gene editing system targeting Tbx2, or a polynucleotide encoding a dominant negative Tbx2 protein.
  • the Tbx2 inhibitor is a polynucleotide that can be transcribed to produce (i.e., a polynucleotide encoding) an inhibitory RNA molecule targeting Tbx2 or a Tbx2 promoter, a polynucleotide encoding a component of a gene editing system targeting Tbx2, or a polynucleotide encoding a dominant negative Tbx2 protein.
  • E133 The nucleic acid vector of E132, wherein the Tbx2 inhibitor is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Tbx2.
  • E134 The nucleic acid vector of E132 or E133, wherein the inhibitory RNA molecule is a short interfering RNA (siRNA).
  • siRNA short interfering RNA
  • E135. The nucleic acid vector of E132 or E133, wherein the inhibitory RNA molecule is a short hairpin RNA (shRNA).
  • shRNA short hairpin RNA
  • E136 The nucleic acid vector of E134 or E135, wherein the siRNA or shRNA targeting Tbx2 has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 80% complementarity to an equal length portion of a target region of an mRNA transcript of a human or murine TBX2 gene (e.g., at least 80% complementarity to an equal length portion of a target region of SEQ ID NO: 1 or SEQ ID NO: 3).
  • E137 The nucleic acid vector of E136, wherein the target region is a portion of an mRNA transcript of the human TBX2 gene (SEQ ID NO: 1 ).
  • E138 The nucleic acid vector of E136, wherein the target region of the siRNA or shRNA is at least 8 to 21 contiguous nucleobases of SEQ ID NO: 5.
  • E139 The nucleic acid vector of E136, wherein the siRNA or shRNA has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of SEQ ID NO: 5.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%
  • E140 The nucleic acid vector of E135-E137, wherein the shRNA has the sequence of any one of SEQ ID NOs: 72-89.
  • E141 The nucleic acid vector of 140, wherein the shRNA has the sequence of any one of SEQ ID NOs: 72-81 .
  • E142 The nucleic acid vector of any one of E135-E141 , wherein the shRNA is embedded in a microRNA (miRNA) backbone.
  • miRNA microRNA
  • E143 The nucleic acid vector of E142, wherein the shRNA is embedded in a miR-30 or mir-E backbone.
  • E144 The nucleic acid vector of E134 or E136, wherein the siRNA has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to any one of SEQ ID NOs: 8-24 or comprises a sense strand and an anti-sense strand having the sequences of SEQ ID NO: 25 and SEQ ID NO: 26.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity
  • E145 The nucleic acid vector of E132 or E133, wherein the inhibitory RNA is a miRNA.
  • E146 The nucleic acid vector of E145, wherein the miRNA is hsa-miR-1180, hsa-miR-1203, hsa-miR- 1205, hsa-miR-1207-5p, hsa-miR-1224-3p, hsa-miR-124-3p, hsa-miR-1292, hsa-miR-1470, hsa- miR-153, hsa-miR-21 , hsa-miR-216b, hsa-miR-3120-3p, hsa-miR-3175, hsa-miR-3186-3p, hsa- miR-3192, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-331 -3p
  • E147 The nucleic acid vector of E146, wherein the miRNA is hsa-miR-1180, hsa-miR-1203, hsa-miR- 1205, hsa-miR-1207-5p, hsa-miR-1224-3p, hsa-miR-124-3p, hsa-miR-1292, hsa-miR-1470, hsa- miR-153, or hsa-miR-21 .
  • E148 The nucleic acid vector of E132, wherein the Tbx2 inhibitor is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting a Tbx2 promoter.
  • E149 The nucleic acid vector of E148, wherein the inhibitory RNA molecule is a miRNA.
  • E150 The nucleic acid vector of E132, wherein the Tbx2 inhibitor is a polynucleotide encoding a component of a gene editing system targeting Tbx2 (e.g., targeting Tbx2 to engineer an alteration in Tbx2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Tbx2, thereby inhibiting Tbx2).
  • a component of a gene editing system targeting Tbx2 e.g., targeting Tbx2 to engineer an alteration in Tbx2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Tbx2, thereby inhibiting Tbx2.
  • E151 The nucleic acid vector of E148, wherein the gene editing system is a zinc finger nuclease (ZFN) system, a transcription activator-like effector-based nuclease (TALEN) system, or a clustered regulatory interspaced short palindromic repeat (CRISPR) system.
  • ZFN zinc finger nuclease
  • TALEN transcription activator-like effector-based nuclease
  • CRISPR clustered regulatory interspaced short palindromic repeat
  • E152 The nucleic acid vector of E132, wherein the Tbx2 inhibitor is a polynucleotide encoding a dominant negative Tbx2 protein.
  • E153 The nucleic acid vector of E152, wherein the polynucleotide encoding the dominant negative Tbx2 protein encodes a protein having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity
  • E154 The nucleic acid vector of E153, wherein the polynucleotide encoding the dominant negative Tbx2 protein encodes a protein having the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4.
  • E155 The nucleic acid vector of E131 , wherein the Tbx2 inhibitor is TGF-p1 or a polynucleotide encoding TGF-p1 .
  • E156 The nucleic acid vector of any one of E131 -E155, wherein the nucleic acid vector further comprises a regeneration agent.
  • E157 The nucleic acid vector of E156, wherein the Tbx2 inhibitor and the regeneration agent are expressed using the same promoter (e.g., both the Tbx2 inhibitor and the regeneration agent are operably linked to supporting cell promoter or a ubiquitous promoter, either by including two copies of the promoter in the vector, with one copy operably linked to the Tbx2 inhibitor and the other copy operably linked to the regeneration agent, or by operably linking both the Tbx2 inhibitor and regeneration agent to a single copy of the promoter and placing an IRES or 2A polypeptide (e.g., F2A, E2A, P2A, or T2A) between the polynucleotides encoding the Tbx2 inhibitor and regeneration agent).
  • an IRES or 2A polypeptide e.g., F2A, E2A, P2A, or T2A
  • E158 The nucleic acid vector of E156, wherein the Tbx2 inhibitor and the regeneration agent are expressed using different promoters (e.g., a first promoter, such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter, is operably linked to a polynucleotide encoding the Tbx2 inhibitor and a second promoter, such as a supporting cell promoter, is operably linked to the polynucleotide encoding the regeneration agent).
  • a first promoter such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter
  • a second promoter such as a supporting cell promoter
  • E159 The nucleic acid vector of any one of E156-E158, wherein the regeneration agent is an agent that increases Atohl expression and/or a Notch inhibitor.
  • E160 The nucleic acid vector of E159, wherein the regeneration agent is an agent that increases Atohl expression.
  • E161 The nucleic acid vector of E159 or E160, wherein the agent that increases Atohl expression is a polynucleotide encoding Atohl (e.g., a polynucleotide encoding SEQ ID NO: 27, such as a polynucleotide having the sequence of SEQ ID NO: 28).
  • a polynucleotide encoding Atohl e.g., a polynucleotide encoding SEQ ID NO: 27, such as a polynucleotide having the sequence of SEQ ID NO: 28.
  • E162 The nucleic acid vector of E159, wherein the regeneration agent is a Notch inhibitor.
  • E163 The nucleic acid vector of E159 or E162, wherein the Notch inhibitor is a polynucleotide encoding an anti-Notch antibody.
  • E164 The nucleic acid vector of E159 or E162, wherein the Notch inhibitor is a polynucleotide that can be transcribed to produce (i.e., a polynucleotide encoding) an inhibitory RNA targeting Notch.
  • the Notch inhibitor is a polynucleotide that can be transcribed to produce (i.e., a polynucleotide encoding) an inhibitory RNA targeting Notch.
  • E165 The nucleic acid vector of E164, wherein the inhibitory RNA targeting Notch is an siRNA.
  • E166 The nucleic acid vector of E164, wherein the inhibitory RNA targeting Notch is an shRNA.
  • E167 The nucleic acid vector of E164, wherein the inhibitory RNA targeting Notch is a miRNA.
  • E168 The nucleic acid vector of any one of E131 -E155, wherein the nucleic acid vector further comprises a Sox2 inhibitor.
  • E169 The nucleic acid vector of E168, wherein the Tbx2 inhibitor and the Sox2 inhibitor are expressed using the same promoter (e.g., both the Tbx2 inhibitor and the Sox2 inhibitor are operably linked to a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter, either by including two copies of the promoter in the vector, with one copy operably linked to the Tbx2 inhibitor and the other copy operably linked to the Sox2 inhibitor, or by operably linking both the Tbx2 inhibitor and the Sox2 inhibitor to a single copy of the promoter and placing an IRES or 2A polypeptide (e.g., F2A, E2A, P2A, or T2A) between the polynucleotides encoding the Tbx2 inhibitor and the Sox2 inhibitor).
  • an IRES or 2A polypeptide e.g., F2A, E2A, P2A, or T2A
  • E170 The nucleic acid vector of E168, wherein the Tbx2 inhibitor and the Sox2 inhibitor are expressed using different promoters (e.g., a first promoter, such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter, is operably linked to a polynucleotide encoding the Tbx2 inhibitor and a second promoter (a different promoter than the first promoter), such as a supporting cell promoter, a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter is operably linked to the polynucleotide encoding the Sox2 inhibitor).
  • a first promoter such as a hair cell promoter, a Type II vestibular hair cell promoter, or an immature vestibular hair cell promoter
  • E171 The nucleic acid vector of any one of E168-E170, wherein the Sox2 inhibitor is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Sox2 or a Sox2 promoter, a polynucleotide encoding a component of a gene editing system targeting Sox2, or a polynucleotide encoding a dominant negative Sox2 protein.
  • E172 The nucleic acid vector of E171 , wherein the Sox2 inhibitor is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting Sox2.
  • E173 The nucleic acid vector of E172, wherein the inhibitory RNA molecule is a siRNA.
  • E174 The nucleic acid vector of E172, wherein the inhibitory RNA molecule is a shRNA.
  • E176 The nucleic acid vector of E175, wherein the target region is a portion of an mRNA transcript of the human SOX2 gene (SEQ ID NO: 90).
  • E177 The nucleic acid vector of E175, wherein the target region is at least 8 to 21 contiguous nucleobases of any one of SEQ ID NOs: 34-52, at least 8 to 22 contiguous nucleobases of SEQ ID NO: 57 or SEQ ID NO: 58, or at least 8 to 19 contiguous nucleobases of any one of SEQ ID NOs: 54-56.
  • E178 The nucleic acid vector of E175, wherein the siRNA or shRNA has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 70% complementarity (e.g., 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) complementarity to an equal length portion of any one of SEQ ID NOs: 34-52 and 54-38.
  • 70% complementarity e.g., 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 8
  • E179 The nucleic acid vector of E178, wherein the shRNA has a nucleobase sequence having at least 70% complementarity (e.g., 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) complementarity to any one of SEQ ID NO: 40, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, and SEQ ID NO: 58.
  • 70% complementarity e.g., 70%, 71 %, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 8
  • E180 The nucleic acid vector of E175, wherein the shRNA comprises the sequence of nucleotides 2234-2296 of SEQ ID NO: 59 or nucleotides 2234-2296 of SEQ ID NO: 61 .
  • E181 The nucleic acid vector of any one of E174-E180, wherein the shRNA is embedded in a miRNA backbone (e.g., embedded in a miRNA backbone to produce an shRNA-mir).
  • a miRNA backbone e.g., embedded in a miRNA backbone to produce an shRNA-mir
  • E182 The nucleic acid vector of E181 , wherein the shRNA is embedded in a miR-30 or mir-E backbone.
  • E183 The nucleic acid vector of E182, wherein the shRNA comprises the sequence of nucleotides 2109-2426 of SEQ ID NO: 59, nucleotides 2109-2408 of SEQ ID NO: 60, nucleotides 2109-2426 of SEQ ID NO: 61 , or nucleotides 2109-2408 of SEQ ID NO: 62.
  • E184 The nucleic acid vector of E173 or E175, wherein the siRNA comprises a sense strand and an antisense strand selected from the following pairs: SEQ ID NO: 64 and SEQ ID NO: 65; SEQ ID NO: 66 and SEQ ID NO: 67; SEQ ID NO: 68 and SEQ ID NO: 69; and SEQ ID NO: 70 and SEQ ID NO: 71 .
  • E185 The nucleic acid vector of E172, wherein the inhibitory RNA is a miRNA.
  • E186 The nucleic acid vector of E185, wherein the miRNA is human miR-145, miR-126, miR-200c, miR-429, miR-200b, miR-140, miR-9, miR-21 , miR-590, miR-182, or miR-638, or murine miR- 134, miR-200c, miR-429, miR-200b, miR-34a, or miR-9.
  • E187 The nucleic acid vector of E171 , wherein the Sox2 inhibitor is a polynucleotide that can be transcribed to produce an inhibitory RNA molecule targeting a Sox2 promoter.
  • E188 The nucleic acid vector of E187, wherein the inhibitory RNA molecule is a miRNA.
  • E189 The nucleic acid vector of E171 , wherein the Sox2 inhibitor is a polynucleotide encoding a component of a gene editing system targeting Sox2 (e.g., targeting Sox2 to engineer an alteration in Sox2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Sox2, thereby inhibiting Sox2).
  • a component of a gene editing system targeting Sox2 e.g., targeting Sox2 to engineer an alteration in Sox2, such as an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation, to decrease the expression level and/or activity of Sox2, thereby inhibiting Sox2.
  • E190 The nucleic acid vector of E189, wherein the gene editing system is a zinc finger nuclease (ZFN) system, a transcription activator-like effector-based nuclease (TALEN) system, or a clustered regulatory interspaced short palindromic repeat (CRISPR) system.
  • ZFN zinc finger nuclease
  • TALEN transcription activator-like effector-based nuclease
  • CRISPR clustered regulatory interspaced short palindromic repeat
  • E191 The nucleic acid vector of E171 , wherein the Sox2 inhibitor is a polynucleotide encoding a dominant negative Sox2 protein.
  • E192 The nucleic acid vector of E191 , wherein the polynucleotide encoding the dominant negative Sox2 protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of SEQ ID NO: 24 or SEQ ID NO: 34.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity
  • the nucleic acid vector of E192, wherein the polynucleotide encoding the dominant negative Sox2 protein has the sequence of SEQ ID NO: 24 or SEQ ID NO: 34.
  • the nucleic acid vector of E191 wherein the dominant negative Sox2 protein is a Sox2 protein that lacks most or all of the high mobility group domain (HMGD), a Sox2 protein in which the nuclear localization signals in the HMGD are mutated, a Sox2 protein in which the HMGD is fused to an engrailed repressor domain, or a c-terminally truncated Sox2 protein comprising only the DNA binding domain.
  • HMGD high mobility group domain
  • E195 The nucleic acid vector of any one of E131 -E194, wherein the promoter is a pol II promoter.
  • E196 The nucleic acid vector of E195, wherein the pol II promoter is a supporting cell promoter.
  • E197 The nucleic acid vector of E196, wherein the supporting cell promoter is a Glial Acidic Fibrillary Protein (GFAP) promoter, a Solute Carrier Family 1 Member 3 (GLAST) promoter, a Hes Family BHLH Transcription Factor 1 (HES1 ) promoter, a Jagged 1 (JAG1 ) promoter, a Notch 1 (NOTCH1 ) promoter, a Leucine Rich Repeat Containing G Protein-Coupled Receptor 5 (LGR5) promoter, a SOX2 promoter, a Hes Family BHLH Transcription Factor 5 (HES5) promoter, a LFNG O-Fucosylpeptide 3-Beta-N-Acetylglucosaminyltransferase (LFNG) promoter, a Kringle Containing Transmembrane Protein 1 (KREMEN1 ) promoter, an Anterior Gradient 3, Protein Disulphide Isomerase Family Member (AGR3)
  • E198 The nucleic acid vector of E196 or E197, wherein the supporting cell promoter is operably linked to the regeneration agent.
  • E199 The nucleic acid vector of any one of E196-E198, wherein the supporting cell promoter is operably linked to the regeneration agent and to the Tbx2 inhibitor (e.g., as described above for embodiments in which the Tbx2 inhibitor and the regeneration agent are expressed using the same promoter).
  • E200 The nucleic acid vector of E195, wherein the pol II promoter is a ubiquitous promoter.
  • E201 The nucleic acid vector of E200, wherein the ubiquitous pol II promoter is a CAG promoter, a CBA promoter, a CBh promoter, an smCBA promoter, a CASI promoter, a dihydrofolate reductase (DHFR) promoter, a p-actin promoter, a phosphoglycerol kinase (PGK) promoter, a UBC promoter, an EF1 a promoter, an EF1 a-short (EFS) promoter, a spleen focus-forming virus (SFFV) promoter, a murine stem cell virus (MSCV) promoter, a p-globin promoter, a CMV promoter, an HSV promoter, or an SV40 promoter.
  • the ubiquitous pol II promoter is a CAG promoter, a CBA promoter, a CBh promoter, an smCBA promoter, a CASI promoter,
  • E202 The nucleic acid vector of E201 , wherein the promoter is a minimal p-globin promoter, a CMVmini promoter, a minCMV promoter, a CMV-TATA+INR promoter, a min CMV-T6 promoter, a minimal HSV ICPO promoter, a truncated HSV ICPO promoter, or an SV40 minimal promoter.
  • the promoter is a minimal p-globin promoter, a CMVmini promoter, a minCMV promoter, a CMV-TATA+INR promoter, a min CMV-T6 promoter, a minimal HSV ICPO promoter, a truncated HSV ICPO promoter, or an SV40 minimal promoter.
  • E203 The nucleic acid vector of any one of E200-E202, wherein the ubiquitous pol II promoter is operably linked to the regeneration agent, the Tbx2 inhibitor, or the Sox2 inhibitor.
  • E204 The nucleic acid vector of any one of E200-E202, wherein the ubiquitous pol II promoter is operably linked to the regeneration agent and to the Tbx2 inhibitor (e.g., as described above for embodiments in which the Tbx2 inhibitor and the regeneration agent are expressed using the same promoter).
  • E205 The nucleic acid vector of any one of E200-E202, wherein the ubiquitous pol II promoter is operably linked to the Sox2 inhibitor and to the Tbx2 inhibitor (e.g., as described above for embodiments in which the Tbx2 inhibitor and the Sox2 inhibitor are expressed using the same promoter).
  • E206 The nucleic acid vector of E195, wherein the pol II promoter is a hair cell promoter.
  • E207 The nucleic acid vector of E206, wherein the hair cell promoter is a Myosin 15A (MY015) promoter, a Growth Factor Independent 1 Transcriptional Repressor (GFI1 ) promoter, a POU Class 4 Homeobox 3 (POU4F3) promoter, or Myosin 7a (MY07A) promoter.
  • the hair cell promoter is a Myosin 15A (MY015) promoter, a Growth Factor Independent 1 Transcriptional Repressor (GFI1 ) promoter, a POU Class 4 Homeobox 3 (POU4F3) promoter, or Myosin 7a (MY07A) promoter.
  • GFI1 Growth Factor Independent 1 Transcriptional Repressor
  • POU4F3 POU Class 4 Homeobox 3
  • MY07A Myosin 7a
  • E208 The nucleic acid vector of E195, wherein the pol II promoter is a Type II vestibular hair cell promoter.
  • E209 The nucleic acid vector of E208, wherein the Type II vestibular hair cell promoter is a Calbindin 2 (CALB2) promoter, a Microtubule associated protein tau (MAPT) promoter, an Annexin A4 (ANXA4) promoter, or an Otoferlin (OTOF) promoter.
  • CALB2 Calbindin 2
  • MTT Microtubule associated protein tau
  • ANXA4 Annexin A4
  • OTOF Otoferlin
  • E210 The nucleic acid vector of E195, wherein the pol II promoter is an immature hair cell promoter.
  • E211 The nucleic acid vector of E210, wherein the immature hair cell promoter is an Atohl promoter.
  • E212 The nucleic acid vector of any one of E206-E211 , wherein the promoter is operably linked to the Tbx2 inhibitor (and the regeneration agent, if present, is operably linked to a different promoter, such as a supporting cell promoter or a ubiquitous promoter).
  • E213. The nucleic acid vector of any one of E206-E211 , wherein the promoter is operably linked to the Sox2 inhibitor.
  • E214. The nucleic acid vector of any one of E206-213, wherein the promoter is operably linked to the Sox2 inhibitor and to the Tbx2 inhibitor (e.g., as described above for embodiments in which the Tbx2 inhibitor and the Sox2 inhibitor are expressed using the same promoter).
  • E215. The nucleic acid vector of any one of E131 -E194, wherein the promoter is a pol III promoter.
  • E216 The nucleic acid vector of E215, wherein the pol III promoter is a ubiquitous pol III promoter.
  • E217 The nucleic acid vector of E216, wherein the ubiquitous pol III promoter is a U6 promoter, an H1 promoter, or a 7SK promoter.
  • E218 The nucleic acid vector of any one of E215-E217, wherein the Tbx2 inhibitor, the Sox2 inhibitor, or the regeneration agent is a polynucleotide encoding an inhibitory RNA.
  • E220 The nucleic acid vector of E219, wherein the nucleic acid vector is a viral vector.
  • E221 The nucleic acid vector of E220, wherein the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, or a lentivirus vector.
  • AAV adeno-associated virus
  • E222 The nucleic acid vector of E221 , wherein the viral vector is an AAV vector.
  • E223. The nucleic acid vector of E222, wherein the AAV vector has an AAV1 , AAV2, AAV2quad(Y-F),
  • a nucleic acid vector comprising an inner ear cell type-specific promoter operably linked to a polynucleotide encoding a Tbx2 inhibitor.
  • E225 The nucleic acid vector of E224, wherein the nucleic acid vector further comprises a polynucleotide that can be transcribed to produce (i.e. , a polynucleotide encoding) a microRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor in type I vestibular hair cells (e.g., operably linked to the inner ear cell type-specific promoter).
  • a polynucleotide that can be transcribed to produce i.e. , a polynucleotide encoding
  • a microRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor in type I vestibular hair cells (e.g., operably linked to the inner ear cell type-specific promoter).
  • a nucleic acid vector comprising a promoter operably linked to a polynucleotide encoding a Tbx2 inhibitor, wherein the nucleic acid vector further comprises a polynucleotide that can be transcribed to produce a microRNA target sequence that reduces or inhibits expression of the Tbx2 inhibitor in type I vestibular hair cells (e.g., operably linked to the same promoter as the Tbx2 inhibitor).
  • E227 The nucleic acid vector of E226, wherein the promoter is an inner ear cell type-specific promoter.
  • E228 The nucleic acid vector of any one of E224-E227, wherein the Tbx2 inhibitor is a dominant negative Tbx2 protein.
  • E229. The nucleic acid vector of E228, wherein the dominant negative Tbx2 protein has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity
  • E230 The nucleic acid vector of E229, wherein the dominant negative Tbx2 protein has the sequence of amino acids 1 -361 of SEQ ID NO: 2 or the sequence of amino acids 1 -301 of SEQ ID NO: 4.
  • E231 The nucleic acid vector of any one of E224-E227, wherein the Tbx2 inhibitor is an siRNA or shRNA that targets Tbx2 or a Tbx2 promoter and reduces Tbx2 expression.
  • E232. The nucleic acid vector of E231 , wherein the siRNA or shRNA targeting Tbx2 has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 80% complementarity to an equal length portion of a target region of an mRNA transcript of a human or murine TBX2 gene (e.g., at least 80% complementarity to an equal length portion of a target region of SEQ ID NO: 1 or SEQ ID NO: 3).
  • E233 The nucleic acid vector of E232, wherein the target region is a portion of an mRNA transcript of the human TBX2 gene (SEQ ID NO: 1 ).
  • E234 The nucleic acid vector of E232, wherein the target region is at least 8 to 21 contiguous nucleobases of SEQ ID NO: 5.
  • E235 The nucleic acid vector of E232, wherein the siRNA or shRNA has a nucleobase sequence containing a portion of at least 8 contiguous nucleobases having at least 70% complementarity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity) to an equal length portion of SEQ ID NO: 5.
  • 70% complementarity e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%
  • E236 The nucleic acid vector of any one of E231 -E233, wherein the shRNA has the sequence of any one of SEQ ID NOs: 72-89.
  • E237 The nucleic acid vector of E236, wherein the shRNA has the sequence of any one of SEQ ID NOs: 72-81.
  • E238 The nucleic acid vector of any one of E231 -E237, wherein the shRNA is embedded in a microRNA (miRNA) backbone (e.g., embedded in a miRNA backbone to produce an shRNA-mir).
  • miRNA microRNA
  • E239. The nucleic acid vector of E238, wherein the shRNA is embedded in a miR-30 or mir-E backbone.
  • E240 The nucleic acid vector of any one of E231 -E233, wherein the siRNA has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to any one of SEQ ID NOs: 8-24 or comprises a sense strand and an anti-sense strand having the sequences of SEQ ID NO: 25 and SEQ ID NO: 26.
  • sequence identity e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity
  • E241 The nucleic acid vector of any one of E224-E227, wherein the Tbx2 inhibitor is a miRNA.
  • E242 The nucleic acid vector of E241 , wherein the miRNA is hsa-miR-1180, hsa-miR-1203, hsa-miR- 1205, hsa-miR-1207-5p, hsa-miR-1224-3p, hsa-miR-124-3p, hsa-miR-1292, hsa-miR-1470, hsa- miR-153, hsa-miR-21 , hsa-miR-216b, hsa-miR-3120-3p, hsa-miR-3175, hsa-miR-3186-3p, hsa- miR-3192, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-331
  • E243 The nucleic acid vector of E242, wherein the miRNA is hsa-miR-1180, hsa-miR-1203, hsa-miR- 1205, hsa-miR-1207-5p, hsa-miR-1224-3p, hsa-miR-124-3p, hsa-miR-1292, hsa-miR-1470, hsa- miR-153, or hsa-miR-21 .
  • E245. The nucleic acid vector of E244, wherein the promoter is a supporting cell promoter.
  • E246 The nucleic acid vector of E244 or E245, wherein the supporting cell promoter is a GFAP promoter, a GLAST promoter, a HES1 promoter, a JAG1 promoter, a NOTCH1 promoter, a LGR5 promoter, a SOX2 promoter, a HES5 promoter, a LFNG promoter, a KREMEN1 promoter, an AGR3.
  • the supporting cell promoter is a GFAP promoter, a GLAST promoter, a HES1 promoter, a JAG1 promoter, a NOTCH1 promoter, a LGR5 promoter, a SOX2 promoter, a HES5 promoter, a LFNG promoter, a KREMEN1 promoter, an AGR3.
  • E247 The nucleic acid vector of E244, wherein the promoter is a hair cell promoter.
  • E248 The nucleic acid vector of E244 or E247, wherein the hair cell promoter is a MYO15 promoter, a
  • GFI1 promoter a POU4F3 promoter, or MYO7A promoter.
  • E249 The nucleic acid vector of E244, wherein the promoter is a Type II vestibular hair cell promoter.
  • E250 The nucleic acid vector of E244 or E249, wherein the Type II vestibular hair cell promoter is a
  • CALB2 promoter a MAPT promoter, an ANXA4 promoter, or an OTOF promoter.
  • E251 The nucleic acid vector of E244, wherein the promoter is an immature vestibular hair cell promoter.
  • E252 The nucleic acid vector of E244 or E251 , wherein the immature vestibular hair cell promoter is an Atohl promoter.
  • E254 The nucleic acid vector of E253, wherein the nucleic acid vector is a viral vector.
  • E255 The nucleic acid vector of E254, wherein the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, or a lentivirus vector.
  • AAV adeno-associated virus
  • E256 The nucleic acid vector of E255, wherein the viral vector is an AAV vector.
  • E257 The nucleic acid vector of E256, wherein the AAV vector has an AAV1 , AAV2, AAV2quad(Y-F),

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne des inhibiteurs de Tbx2 qui peuvent être utilisés pour générer des cellules capillaires vestibulaires de type I dans le système vestibulaire. Les inhibiteurs de Tbx2 peuvent être administrés à un sujet seuls ou en combinaison avec un agent de régénération ou un inhibiteur de Sox2 pour convertir des cellules capillaires vestibulaires de type II ou des cellules capillaires vestibulaires régénérées en cellules capillaires vestibulaires de type I.
PCT/US2023/075477 2022-09-30 2023-09-29 Méthodes et compositions pour générer des cellules capillaires vestibulaires de type i WO2024073638A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263412173P 2022-09-30 2022-09-30
US63/412,173 2022-09-30

Publications (2)

Publication Number Publication Date
WO2024073638A2 true WO2024073638A2 (fr) 2024-04-04
WO2024073638A3 WO2024073638A3 (fr) 2024-05-30

Family

ID=90479315

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/075477 WO2024073638A2 (fr) 2022-09-30 2023-09-29 Méthodes et compositions pour générer des cellules capillaires vestibulaires de type i

Country Status (1)

Country Link
WO (1) WO2024073638A2 (fr)

Also Published As

Publication number Publication date
WO2024073638A3 (fr) 2024-05-30

Similar Documents

Publication Publication Date Title
AU2019357048A1 (en) AAV1 vectors and uses thereof for treatment of otic indications
JP2021521842A (ja) ミオシン１５プロモーター及びその使用
US20220265865A1 (en) Compositions and methods for treating sensorineural hearing loss using otoferlin dual vector systems
US20210388045A1 (en) Myosin 15 promoters and uses thereof
US20240148905A1 (en) Methods for treating sensorineural hearing loss using otoferlin dual vector systems
EP4352236A1 (fr) Compositions et procédés pour l'expression génique spécifique de type cellulaire dans l'oreille interne
JP2023500672A (ja) 蝸牛外有毛細胞プロモーター及びその使用
WO2024073638A2 (fr) Méthodes et compositions pour générer des cellules capillaires vestibulaires de type i
WO2023064388A2 (fr) Promoteurs de la stéréociline et leurs utilisations
CA3129422A1 (fr) Promoteurs de myosine 15 et utilisations associees
US20230061456A1 (en) Methods and compositions for generating type 1 vestibular hair cells
JP2024522618A (ja) 内耳における細胞型特異的遺伝子発現のための組成物及び方法
JP2023500670A (ja) 蝸牛内耳有毛細胞プロモーター及びその使用
WO2023150689A2 (fr) Éléments régulateurs de gjb2 et leurs utilisations
WO2024073635A2 (fr) Éléments régulateurs slc26a4 et leurs utilisations
WO2024031040A2 (fr) Éléments régulateurs slc26a4 et leurs utilisations
US20240218391A1 (en) Vestibular supporting cell promoters and uses thereof
JP2024517250A (ja) 前庭支持細胞プロモーター及びその使用
WO2023077016A1 (fr) Ciblage de sirpα neuronal pour le traitement et la prévention de troubles neurologiques
JPH1118779A (ja) 新規核酸及びそのエイズ発症抑制剤としての用途