WO2024071397A1 - Il13ra2に標的化した単純ヘルペスウイルス及び抗il13ra2抗体またはその抗原結合断片 - Google Patents
Il13ra2に標的化した単純ヘルペスウイルス及び抗il13ra2抗体またはその抗原結合断片 Download PDFInfo
- Publication number
- WO2024071397A1 WO2024071397A1 PCT/JP2023/035689 JP2023035689W WO2024071397A1 WO 2024071397 A1 WO2024071397 A1 WO 2024071397A1 JP 2023035689 W JP2023035689 W JP 2023035689W WO 2024071397 A1 WO2024071397 A1 WO 2024071397A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino acid
- seq
- il13ra2
- acid mutation
- antigen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2866—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for cytokines, lymphokines, interferons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/10—Cells modified by introduction of foreign genetic material
- C12N5/12—Fused cells, e.g. hybridomas
- C12N5/16—Animal cells
- C12N5/163—Animal cells one of the fusion partners being a B or a T lymphocyte
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
- C12N2710/16622—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
- C12N2710/16641—Use of virus, viral particle or viral elements as a vector
- C12N2710/16643—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
- C12N2710/16641—Use of virus, viral particle or viral elements as a vector
- C12N2710/16645—Special targeting system for viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
- C12N2810/80—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
- C12N2810/85—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
- C12N2810/859—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from immunoglobulins
Definitions
- the present invention relates to a herpes simplex virus that can target and specifically lyse tumor cells expressing IL13RA2 by presenting an anti-IL13RA2 antibody on the viral surface.
- the present invention also relates to an anti-IL13RA2 antibody or an antigen-binding fragment thereof that can specifically recognize the target tumor cells.
- Interleukin 13 receptor subunit alpha 2 (IL13RA2) has been reported to be expressed in various solid tumors, including malignant gliomas and malignant melanomas, and blood tumors such as cutaneous T-cell lymphomas, while its expression in normal cells is limited, making it a promising target molecule for cancer treatment (Non-Patent Documents 1-3). Since the dissociation constant of IL13RA2 and its ligand interleukin 13 (IL-13) is very low at less than 100 fM (Non-Patent Document 4), attempts have been made to use IL-13 as a drug delivery module (cancer targeting module) to develop a cancer treatment targeting IL13RA2.
- cancer targeting module drug delivery module
- Non-Patent Document 5 a treatment for malignant glioma has been developed using a recombinant protein (IL13-PE) in which IL-13 is bound to Pseudomonas aeruginosa exotoxin (PE) (Non-Patent Document 5).
- IL13RA1 interleukin 13 receptor subunit alpha 1
- IL13RA1 which functions as a physiological receptor for IL-13
- IL13RA1 interleukin 13 receptor subunit alpha 1
- IL13RA1 which functions as a physiological receptor for IL-13
- Non-Patent Document 7 It has also been reported that when IL13RA1 forms a complex with interleukin 4 receptor (IL4R), its binding affinity with IL-13 is about five times higher (Non-Patent Document 7). Therefore, concerns have been raised about side effects due to damage to normal cells expressing IL13RA1 in a therapy that aims to specifically kill cancer cells using IL-13 in a cancer targeting module (Non-Patent Document 8). Therefore, there has been a continuing demand for an alternative treatment scheme that specifically recognizes only cancer cells.
- IL4R interleukin 4 receptor
- Oncolytic virus therapy is a cancer treatment method using a virus that selectively grows in cancer cells.
- HSV herpes simplex virus
- RR-oHSV receptor-targeted oncolytic HSV
- Non-Patent Documents 9-10 have reported receptor-targeted oncolytic HSV (RR-oHSV), which enables infection via a target molecule that is selectively expressed in cancer cells, rather than the original HSV receptor, by genetically modifying HSV.
- this method modifies glycoprotein D (gD), which is essential for HSV to enter cells, to disable binding to the original gD receptors herpesvirus entry mediator (HVEM), 3-OS-HS, and nectin-1, and then fuses a cancer targeting module to gD to modify HSV so that it can selectively enter cancer cells.
- HVEM herpesvirus entry mediator
- IL-13 IL13RA2-targeted RR-oHSV by using IL-13 as a cancer targeting module
- Non-Patent Document 11 Non-Patent Document 11
- the infectivity of this IL-13-inserted RR-oHSV to IL13RA1-expressing cells and its antitumor effect in vivo have not been examined, and further studies are thought to be necessary to determine whether it can be developed clinically.
- RR-oHSV that invades and spreads only in cells expressing the target molecule by deleting the 2nd to 24th amino acids of gD to disable binding to HVEM and 3-OS-HS, and by mutating the 38th amino acid from tyrosine to cysteine to disable binding to nectin-1, and then inserting a single-chain antibody (scFv) as a cancer targeting module into the 2nd to 24th deleted region (Patent Document 1, Non-Patent Document 12).
- scFv single-chain antibody
- RR-oHSV can be modified to target various target molecules by replacing the single-chain antibody inserted into the modified gD, and thus far, RR-oHSVs have been successfully developed against epidermal growth factor receptor (EGFR), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), and epiregulin (EREG) (Non-Patent Documents 12-14).
- EGFR epidermal growth factor receptor
- CEA carcinoembryonic antigen
- EpCAM epithelial cell adhesion molecule
- EREG epiregulin
- the present invention aims to provide a herpes simplex virus that can specifically lyse tumor cells and is highly safe.
- the present invention aims to provide a new antibody or an antigen-binding fragment thereof that can specifically recognize tumor cells.
- a targeting module e.g., an antibody or an antigen-binding fragment thereof
- a target antigen that satisfies the conditions that, when incorporated into a receptor-targeted oncolytic HSV (RR-oHSV), it specifically recognizes the tumor-associated antigen and causes the tumor-associated antigen to function as a viral receptor, thereby completing the molecular mechanism required for invasion into target cells.
- RR-oHSV receptor-targeted oncolytic HSV
- Non-Patent Document 14 reported that not all scFvs that recognize target antigens can cause invasion of RR-oHSV into target cells (Non-Patent Document 14).
- the inventors therefore attempted to obtain an antibody and antigen-binding fragment capable of specifically recognizing IL13RA2, and obtained an anti-IL13RA2 antibody and its antigen-binding fragment.
- the inventors found that the obtained anti-IL13RA2 antibody and its antigen-binding fragment were capable of specifically binding to IL13RA2. Furthermore, surprisingly, they found that the anti-IL13RA2 antibody was efficiently internalized into tumor cells.
- the inventors further conducted intensive research and produced a herpes simplex virus engineered to display the antigen-binding fragment of the aforementioned anti-IL13RA2 antibody on its surface. As a result, they found that this virus was able to infect and lyse IL13RA2-positive cells with higher efficiency and with higher IL13RA2 selectivity than a herpes simplex virus engineered to display its original ligand, IL-13, on its surface.
- the present invention can include the following aspects:
- HCDR1, HCDR2, HCDR3 and light chain CDRs (LCDR1, LCDR2, LCDR3) of the anti-IL13RA2 antibody or antigen-binding fragment thereof are (i) HCDR1: RHGIH (SEQ ID NO: 1) (ii) HCDR2: VIWAGGSTNYNSALMS (SEQ ID NO: 2) (iii) HCDR3: DHFDSFDY (SEQ ID NO: 3) (iv) LCDR1: TASSSVSSSSYLH (SEQ ID NO: 4) (v) LCDR2: STSNLAS (SEQ ID NO: 5) and (vi) LCDR3: HQYHRSPLT (SEQ ID NO: 6) 2.
- the herpes simplex virus according to claim 1 having an amino acid sequence as set forth above, or having one to several amino acid mutations in said amino acid sequence.
- the anti-IL13RA2 antibody or antigen-binding fragment thereof A sequence showing 80% or more sequence identity to the amino acid sequence of the VL region set forth in SEQ ID NO: 8; A sequence showing 80% or more sequence identity to the amino acid sequence of the VH region set forth in SEQ ID NO: 10; 3.
- the herpes simplex virus according to item 1 or 2 comprising: [4] The herpes simplex virus according to any one of items 1 to 3, wherein the antigen-binding fragment is a Fab, a Fab', an F(ab')2, an Fv, an scFv, a dsFv, a bis-scFv, a diabody, a triabody, or a tetrabody. [5] The herpes simplex virus according to any one of items 1 to 4, wherein the antigen-binding fragment is an scFv.
- the anti-IL13RA2 antibody or antigen-binding fragment thereof is a chimeric or humanized anti-IL13RA2 antibody or antigen-binding fragment thereof.
- the herpes simplex virus according to Aspect 8 wherein the anti-IL13RA2 antibody or an antigen-binding fragment thereof is incorporated into the deleted amino acid portion of the envelope protein gD from the 2nd to the 24th amino acids of SEQ ID NO: 12, the deleted amino acid portion between the 24th and 25th amino acids or the 6th to the 38th amino acids of SEQ ID NO: 12, or the deleted amino acid portion from the 61st to the 218th amino acids of SEQ ID NO: 12.
- the herpes simplex virus according to Aspect 12 wherein the amino acid mutation that weakens infectivity to a cell expressing Nectin-1 is one or more selected from the group consisting of a deletion of all of the amino acids from positions 6 to 38 of SEQ ID NO: 12, a deletion of all of the amino acids from positions 61 to 218 of SEQ ID NO: 12, a mutation at positions 3 and/or 38 of SEQ ID NO: 12, and a mutation at positions 222 and 223 of SEQ ID NO: 12.
- the amino acid mutation that promotes entry into target cells and/or the amino acid mutation that promotes multinucleated giant cell formation are any of the mutations described in (a), (b), (c) and/or (d) below.
- the herpes simplex virus according to item 18 characterized in that the amino acid mutation at position 62 of SEQ ID NO: 16 is substituted with glycine, the amino acid mutation at position 63 is substituted with valine, and the amino acid mutation at position 64 is substituted with serine.
- a pharmaceutical composition comprising the herpes simplex virus according to any one of items 1 to 21.
- the tumor is melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), glioma, head and neck cancer, renal cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer, or ovarian cancer.
- the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and the light chain CDRs (LCDR1, LCDR2, LCDR3) are (i) HCDR1: RHGIH (SEQ ID NO: 1) (ii) HCDR2: VIWAGGSTNYNSALMS (SEQ ID NO: 2) (iii) HCDR3: DHFDSFDY (SEQ ID NO: 3) (iv) LCDR1: TASSSVSSSSYLH (SEQ ID NO: 4) (v) LCDR2: STSNLAS (SEQ ID NO: 5) and (vi) LCDR3: HQYHRSPLT (SEQ ID NO: 6) or an antigen-binding fragment thereof, which has an amino acid sequence as set forth above or has one to several amino acid mutations in said amino acid sequence.
- the anti-IL13RA2 antibody or antigen-binding fragment thereof A sequence showing 80% or more sequence identity to the amino acid sequence of the VL region set forth in SEQ ID NO: 8; A sequence showing 80% or more sequence identity to the amino acid sequence of the VH region set forth in SEQ ID NO: 10; 29.
- the anti-IL13RA2 antibody or antigen-binding fragment thereof according to item 28, comprising: [30] The anti-IL13RA2 antibody or antigen-binding fragment thereof according to Aspect 28 or 29, wherein the antigen-binding fragment is a Fab, a Fab', an F(ab')2, an Fv, a scFv, a dsFv, a bis-scFv, a diabody, a triabody, or a tetrabody.
- the anti-IL13RA2 antibody or antigen-binding fragment thereof according to any one of items 28 to 30, wherein the antigen-binding fragment comprises a sequence that shows 90% or more sequence identity to the sequence of SEQ ID NO: 7 (sequence of scFv).
- a pharmaceutical composition comprising the anti-IL13RA2 antibody or antigen-binding fragment thereof according to any one of items 28 to 32.
- the pharmaceutical composition according to Item 39 wherein the tumor is melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), glioma, head and neck cancer, renal cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer, or ovarian cancer.
- IL13RA2-positive cancer cells can be selectively and efficiently dissolved/dead. Therefore, the present invention can provide a new therapeutic method that has few side effects, is safe for the living body, and requires a small dosage.
- FIG. 1 is a schematic diagram of the genome of IL-13-inserted HSV and the structure of targeted gD mutants.
- the genome of IL-13-inserted HSV and the structure of IL-13-inserted gD mutants are shown.
- UL unique long segment
- US unique short segment
- CMVp human cytomegalovirus major immediate early (HCMV-IE) promoter
- EGFP expression cassette of EGFP inserted between UL3 and UL4
- NT intracellular entry-promoting mutation in gB (D285N/A549T)
- gD-IL13 IL-13-inserted gD
- black square terminal and internal inverted repeats
- SP signal peptide
- TM transmembrane domain
- CT cytosolic tail
- N amino terminus
- C carboxy terminus.
- Figure 2 shows the target specificity of IL-13-inserted HSV at the stage of intracellular entry.
- the intracellular entry of IL-13-inserted HSV into J1.1-2 cell sublines forced to express gD receptor or IL13RA2 was examined.
- the cells shown at the bottom of the panel were infected with the virus shown on the left side of the panel, and the EGFP fluorescent signal was observed 8 hours later. Bars: 300 ⁇ m.
- Figure 3 shows the specificity of intracellular entry of IL-13-inserted HSV using CHO-K1 cells and its sublines.
- the intracellular entry of IL-13-inserted HSV into CHO-K1 cell sublines forcedly expressing gD receptor or IL13RA2 was examined.
- Figure 4 shows the target specificity of IL-13-inserted RR-oHSV and anti-IL13RA2 single chain antibody-inserted RR-oHSV at the stage of intracellular entry.
- the intracellular entry of IL-13 or anti-IL13RA2 single chain antibody-inserted RR-oHSV into J1.1-2 cell sublines forced to express gD receptor, IL13RA2, or IL13RA1 and IL4R was examined.
- the cells shown in the lower panel were infected with the viruses shown on the left side of the panel, and the EGFP fluorescent signal was observed 8 hours later.
- Figure 5 shows the specificity of intracellular entry of IL-13-inserted HSV and anti-IL13RA2 single-chain antibody-inserted HSV into CHO-K1 cells and its sublines. Intracellular entry of IL-13 or anti-IL13RA2 single-chain antibody-inserted HSV into CHO-K1 cell sublines forced to express gD receptor, IL13RA2, and IL13RA1 and IL4R. The cells shown in the upper part of the panel were infected with the virus shown on the left side of the panel at an MOI of 1, and the EGFP fluorescent signal was observed 8 hours later. Bars: 300 ⁇ m.
- Figure 6 shows the infectivity of IL-13-inserted HSV and anti-IL13RA2 single-chain antibody-inserted HSV to human umbilical vein endothelial cells.
- HUVEC or Vero-IL13RA2 were infected with the viruses shown on the left side of the panel at the MOI shown in the upper part of the panel, and the fluorescent signal was observed 12 hours later.
- Vero-IL13RA2 was infected with the same virus solution as that used to infect HUVEC at an MOI of 0.1. Bars: 300 ⁇ m.
- Figure 7 shows the expression of IL13RA2 in U87 and H1299 cells. Flow analysis was performed after staining with mouse anti-IL13RA2 antibody SHM38 and Alexa Fluor 488-conjugated goat anti-mouse IgG antibody. Grey histogram shows isotype-matched negative control antibody.
- Figure 8 shows the target specificity of anti-IL13RA2 single-chain antibody-inserted RR-oHSV in intracellular invasion and cell-to-cell spread.
- the gray histogram indicates the isotype-matched negative control antibody.
- FIG. 9 shows the effect of BhKt mutation on the cell-to-cell transmission and cytotoxicity of anti-IL13RA2 single-chain antibody-inserted RR-oHSV against IL13RA2-positive human cancer cell lines.
- (a) Plaque size in IL13RA2-positive cancer cell lines. IL13RA2-positive cancer cells (top of the graph) were cultured in monolayers with the viruses shown in the bottom of the graph, and the plaque area was calculated from the EGFP fluorescent signal after three days of culture in methylcellulose-containing medium. The average plaque area (gray line) ⁇ standard deviation (black line) is shown (n 15). Two-tailed Mann-Whitney U test was used for statistical analysis.
- U87-IL13RA2+ was subcutaneously implanted into SCID Beige mice, and when the tumor volume reached approximately 290 mm 3 , PBS or 10 2 pfu of each virus was administered intratumorally.
- (A) Changes in the average tumor volume (mm 3 ) of mice administered with PBS, KGN-sc13R2-BhKt, or KG ⁇ N-sc13R2-BhKt are shown.
- the changes in tumor volume (mm 3 ) in each mouse administered with (B) PBS, (C) KGN-sc13R2-BhKt, or (D) KG ⁇ N-sc13R2-BhKt are shown.
- an amino acid mutation when described, unless otherwise specified, it means the substitution or deletion of the amino acid, or the insertion of one or several amino acids (for example, about 1 to 10, preferably 1 to 5, and more preferably about 1 to 3) between the amino acid and the adjacent amino acid.
- the description "mutation of R21" means the deletion of the 21st amino acid in the amino acid sequence, the substitution with another amino acid, or the insertion of one or several amino acids between the 21st amino acid and the adjacent amino acid.
- the amino acid numbers described in this specification may vary by about 1 to 10 depending on the HSV strain. Therefore, in any HSV strain, for example, when the amino acid number varies by ⁇ n (where n is an integer between 1 and 10), R21 should be read as R(21 ⁇ n).
- IL13RA2- targeted herpes simplex virus refers to a herpes simplex virus that has been engineered to specifically bind to and infect IL13RA2-positive cancer cells.
- the gene of the IL13RA2-targeted herpes simplex virus has been genetically engineered.
- Herpes simplex viruses that may be applied to the present invention are oncolytic viruses.
- oncolytic virus refers to a modified virus that is capable of preferentially infecting and killing cancer cells.
- the herpes simplex virus targeted to IL13RA2 of the present invention presents an anti-IL13RA2 antibody or an antigen-binding fragment thereof that binds to IL13RA2 on the surface of the herpes simplex virus.
- the anti-IL13RA2 antibody or an antigen-binding fragment thereof can be incorporated into a glycoprotein or the like, which is an envelope protein exposed on the surface of the virus, to promote targeting of the desired cells.
- Methods for incorporating the anti-IL13RA2 antibody or an antigen-binding fragment thereof include a method using a crosslinker such as glutaraldehyde, a method using a tag (epitopes such as biotin, glutathione, Myc, 6x histidine, etc.) and its ligand, a method using a multispecific antibody (e.g., a bispecific antibody) that recognizes the viral envelope protein and the anti-IL13RA2 antibody or its antigen-binding fragment as two antigens, and a method of expressing the envelope protein as a fusion protein of the anti-IL13RA2 antibody or its antigen-binding fragment, but the method of expressing the envelope protein as a fusion protein with the envelope protein is preferred.
- a recombinant virus is produced in which the anti-IL13RA2 antibody or its antigen-binding fragment is displayed on the outside of the viral envelope.
- IL-13 includes a cytokine secreted primarily by T helper 2 cells.
- IL-13 along with IL-4, which shares a receptor (IL-13R ⁇ 1/IL-4R ⁇ ), plays an important role in inducing humoral immunity through antibody production.
- IL-13 is a monomeric protein of a 13 kDa polypeptide, and the structure of IL-13 is further described, for example, in Moy, Diblasio et al. 2001 J Mol Biol 310 219-30.
- IL13RA2 is known as a high affinity receptor for IL-13, and functions as a decoy for IL-13 while inhibiting STAT6-mediated signal transduction of IL-4. It has also been reported recently that IL13RA2 is involved in many signal transduction pathways (WNT/ ⁇ -Catenin, MAPK/ERK, AKT/PKB, Src/FAK, PIP3K, etc.), and is believed to play a protective role against inflammatory diseases such as dermatitis (Sivaprasad et al., J Immunol. 2010; 185(11):6802).
- a precursor of human IL13RA2 which is one embodiment of IL13RA2 may be a polypeptide having the amino acid sequence shown in SEQ ID NO: 17 (NCBI Accession No.: NP_000631.1).
- the precursor of human IL13RA2 shown in SEQ ID NO:17 contains a signal peptide (1st to 26th), and the mature human IL13RA2 corresponds to the 27th to 380th amino acid sequences shown in SEQ ID NO:17.
- the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and the light chain CDRs (LCDR1, LCDR2, LCDR3) are (i) HCDR1: (SEQ ID NO: 1: RHGIH) (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNYNSALMS) (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY) (iv) LCDR1: (SEQ ID NO: 4: TASSSVSSSSYLH) (v) LCDR2: (SEQ ID NO:5: STSNLAS) and (vi) LCDR3: (SEQ ID NO:6: HQYHRSPLT) or has one to several amino acid mutations in these amino
- CDR refers to a region of the variable region of an immunoglobulin molecule that forms an antigen-binding site, also called a hypervariable region, and refers to a portion in which the amino acid sequence varies greatly from one immunoglobulin molecule to another.
- CDR1, CDR2, and CDR3 There are three CDRs (CDR1, CDR2, and CDR3) in each of the heavy chain (HCDR) and the light chain (LCDR).
- CDR1, CDR2, and CDR3 three CDRs in each of the heavy chain (HCDR) and the light chain (LCDR).
- the CDRs of an immunoglobulin molecule are determined according to the Kabat numbering system (Kabat et al., 1987, Sequences of Proteins of Immunological Interest, US Department of Health and Human Services, NIH, USA).
- the heavy chain CDRs are (i) HCDR1: (SEQ ID NO: 1: RHGIH) (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNYNSALMS) (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY) or has one to several (1, 2 or 3) amino acid mutations in these amino acid sequences.
- the light chain CDRs are (i) LCDR1: (SEQ ID NO: 4: TASSSVSSSSYLH) (ii) LCDR2: (SEQ ID NO:5: STSNLAS) and (iii) LCDR3: (SEQ ID NO:6: HQYHRSPLT) or has one to several (1, 2 or 3) amino acid mutations in these amino acid sequences.
- one embodiment of the anti-IL13RA2 antibody or antigen-binding fragment thereof presented by a herpes simplex virus targeted to IL13RA2 according to the present invention may be an anti- IL13RA2 antibody or antigen-binding fragment thereof comprising a sequence showing 80% or more (e.g., 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100%) sequence identity to the amino acid sequence of the VL region set forth in SEQ ID NO:8 and a sequence showing 80% or more (e.g., 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100%) sequence identity to the amino acid sequence of the VH region set forth in SEQ ID NO:10.
- an amino acid mutation in a CDR refers to a "substitution” in which another amino acid is substituted, a “deletion” in which the amino acid is removed, or an “insertion” in which another amino acid is added, with “conservative amino acid substitutions” being particularly preferred.
- Conservative amino acid substitutions are made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic properties of the residues involved.
- nonpolar (hydrophobic) amino acids include alanine (Ala, A), leucine (Leu, L), isoleucine (Ile, I), valine (Val, V), proline (Pro, P), phenylalanine (Phe, F), tryptophan (Trp, W), and methionine (Met, M); polar neutral amino acids include glycine (Gly, G), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), tyrosine (Tyr, Y), asparagine (Asn, N), and glutamine (Gln, Q); positively charged (basic) amino acids include arginine (Arg, R), lysine (Lys, K), and histidine (His, H); negatively charged (acidic) amino acids include aspartic acid (Asp, D) and glutamic acid (Glu, E).
- polar neutral amino acids include glycine (Gly, G), se
- substitutions are preferably in the range of one, two, or three amino acids. Mutations may be introduced by making systematic or random amino acid substitutions in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant mutants for activity.
- the anti-IL13RA2 antibody presented by the herpes simplex virus targeted to IL13RA2 of the present invention may include a mouse constant region (IgG1, IgG2a, IgG2b, IgG3, IgM, IgD, IgE, IgA).
- the antibody may be a chimeric, humanized, or human antibody having a human constant region (IgG1, IgG2, IgG3, IgG4, IgM, IgD, IgE, IgA1, IgA2).
- the antibody may be a bispecific, trispecific, or multispecific antibody to increase affinity or avidity.
- the antigen-binding fragment that can be applied in the present invention may be an antigen-binding fragment of any of the antibodies described herein.
- Antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv, scFv, dsFv, bis-scFv, diabody, triabody, or tetrabody, etc., as long as they are antigen-binding fragments derived from anti-IL13RA2 antibodies.
- Diabodies (dimers), triabodies (trimers) or tetrabodies (tetramers) are well known in the art. See, for example, Kortt et al., Biomol. Eng.
- the antigen-binding fragment that can be applied in the present invention is preferably an scFv.
- An scFv consists of an antibody heavy chain V region ( VH region) linked to an antibody light chain variable (V) region ( VL region) via a synthetic peptide (linker), and can be produced using routine recombinant DNA technology (see, for example, Janeway et al., Immunobiology, 2nd ed., Garland Publishing, New York, (1996)).
- linker for example, a (Gly 4 Ser) 3 flexible linker can be used, but is not limited thereto.
- the order in which the VL region and the VH region are linked by the linker is not particularly limited.
- disulfide-stabilized variable region fragments (dsFv) can be prepared by recombinant DNA technology (see, for example, Reiter et al., Protein Engineering, 7, 697-704 (1994)).
- an antigen-binding fragment that can be applied in the present invention may be an antigen-binding fragment comprising a sequence that shows 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity to the sequence set forth in SEQ ID NO: 7.
- the amino acid sequence set forth in SEQ ID NO: 7 is specifically a sequence comprising the following amino acid sequence:
- the antigen-binding fragment having the amino acid sequence set forth in SEQ ID NO:7 includes a VL region (SEQ ID NO:8) containing the above-mentioned LCDR1 to LCDR3 (SEQ ID NO:4 to 6), a VH region (SEQ ID NO:10) containing the above-mentioned HCDR1 to HCDR3 (SEQ ID NO:1 to 3), and linker sequences 1 and 2 (SEQ ID NO:9 and 11).
- the antigen-binding fragment presented by the herpes simplex virus targeted to IL13RA2 of the present invention has heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) of: (i) HCDR1: (SEQ ID NO: 1: RHGIH) (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNYNSALMS) (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY) (iv) LCDR1: (SEQ ID NO: 4: TASSSVSSSSYLH) (v) LCDR2: (SEQ ID NO:5: STSNLAS) and (vi) LCDR3: (SEQ ID NO:6: HQYHRSPLT) or having one to several amino acid mutations in this amino acid sequence, and having 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more
- Sequence identity is defined as the percentage of amino acid residues in a candidate sequence that are identical to those of a particular reference polypeptide sequence after aligning the sequences, introducing gaps, if necessary, to obtain maximum sequence identity, and excluding any conservative substitutions from being considered part of the sequence identity. Alignment for purposes of measuring sequence identity can be accomplished by a variety of methods within the skill of the art, such as using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms necessary to achieve maximum alignment over the full length of the sequences being compared. However, for purposes herein, sequence identity values are obtained by using the sequence comparison computer program BLAST in pairwise alignments.
- the percent sequence identity of a given amino acid sequence A to a given amino acid sequence B is calculated as follows: 100 times the fraction X/Y, where X is the number of amino acid residues scored as identical by a program alignment of A and B in the sequence alignment program BLAST, and Y is the total number of amino acid residues in B. It will be understood that if the length of amino acid sequence A is different from the length of amino acid sequence B, the sequence identity of A to B will differ from the % sequence identity of B to A. Unless otherwise specified, all % amino acid sequence identity values herein are obtained using the BLAST computer program as set forth in the immediately preceding paragraph.
- Amino acid mutations in the antigen-binding fragment of SEQ ID NO:7 of the present invention include “substitution” where an amino acid is replaced with another amino acid, “deletion” where the amino acid is removed, and “insertion” where another amino acid is added.
- substitution where an amino acid is replaced with another amino acid
- insertion where another amino acid is added.
- substitution is “conservative amino acid substitution.” Conservative amino acid substitutions are made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic properties of the residues involved.
- nonpolar (hydrophobic) amino acids include alanine (Ala, A), leucine (Leu, L), isoleucine (Ile, I), valine (Val, V), proline (Pro, P), phenylalanine (Phe, F), tryptophan (Trp, W), and methionine (Met, M); polar neutral amino acids include glycine (Gly, G), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), tyrosine (Tyr, Y), asparagine (Asn, N), and glutamine (Gln, Q); positively charged (basic) amino acids include arginine (Arg, R), lysine (Lys, K), and histidine (His, H); negatively charged (acidic) amino acids include aspartic acid (Asp, D) and glutamic acid (Glu, E).
- polar neutral amino acids include glycine (Gly, G), se
- substitutions are preferably in the range of 1-25, 1-20, 1-15, 1-10, or 1-5 amino acids. Mutations may be introduced by making systematic or random amino acid substitutions in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant mutants for activity.
- Herpes simplex viruses that may be used in the present invention include herpes simplex virus type 1 (HSV-1) (sometimes referred to as "HHV-1") and herpes simplex virus type 2 (HSV-2) (sometimes referred to as "HHV-2").
- HSV-1 and HSV-2 used in embodiments of the present invention include all strains classified into these (for example, KOS strain, F strain, 17 strain, VR3 strain, HF strain, HF10 strain, SC16 strain, etc. classified as HSV-1, and 186 strain, G strain, 333 strain, etc. classified as HSV-2) and all those derived from these substrains. That is, for example, taking HSV-1 as an example, GenBank no.
- JQ673480.1 https://www.ncbi.nlm.nih.gov/nuccore/JQ673480.1 (SEQ ID NO: 29)
- other strains classified as HSV-1 and HSV-1 belonging to these substrains may also be used.
- HSV has envelope glycoproteins (gB, gC, gD, gH, gL, gK, etc.) that cause membrane fusion between the host cell membrane and the viral envelope, and are important for viral intracellular entry and cell-to-cell spread.
- gB and gC bind to heparan sulfate expressed on the cell membrane surface, allowing HSV to adhere to the cell membrane.
- gD binds to herpesvirus entry mediator (HVEM), nectin-1, or 3-O-sulfated heparan sulfate (3-OS-HS) (Montgomery et al., Cell 1996; Geraghty et al., Science 1998; Shukla et al., Cell 1999), causing a conformational change in gD (Carfi et al., Cell 1999).
- HVEM herpesvirus entry mediator
- nectin-1 binds to gD
- 3-OS-HS 3-O-sulfated heparan sulfate
- the herpes simplex virus targeted to IL13RA2 of the present invention has an anti-IL13RA2 antibody or an antigen-binding fragment thereof incorporated into an envelope protein and targets IL13RA2 expressed on the cell surface.
- the anti-IL13RA2 antibody or an antigen-binding fragment thereof is incorporated into the envelope protein gD (e.g., SEQ ID NO: 12), envelope protein gB (e.g., SEQ ID NO: 13, or see, e.g., PLoS Pathog 2017; 13(4): e1006352, etc.), envelope protein gC (see, e.g., Cancer Gene Ther 2010; 17(9): 655-663, etc.), or envelope protein gH (see, e.g., PLoS Pathog 2015; 11(5): e1004907, etc.), more preferably, the anti-IL13RA2 antibody or an antigen-binding fragment thereof is incorporated into the envelope protein gD.
- the amino acid sequences e.g.
- the herpes simplex virus targeted to IL13RA2 of the present invention may have an anti-IL13RA2 antibody or an antigen-binding fragment thereof incorporated into the deleted portion of the envelope protein gD from amino acid 2 to amino acid 24 of SEQ ID NO:12, the deleted portion of amino acids between amino acids 24 and 25, or from amino acids 6 to 38 of SEQ ID NO:12, or the deleted portion of amino acids 61 to 218 of SEQ ID NO:12.
- the herpes simplex virus targeted to IL13RA2 according to the present invention may have an envelope protein gD with an amino acid mutation that weakens infectivity to cells expressing Nectin-1, HVEM, and/or 3-OS-HS, for example, a mutation described in WO2020/090871.
- a "gD mutation” refers to a nucleotide or amino acid mutation in the gD gene or gD protein that has any of the following combinations of a mutation in gD, an envelope glycoprotein responsible for entry of the HSV virus into cells, that causes the gD to lose (or reduce) its ability to bind to HVEM, a mutation that causes the gD to lose (or reduce) its ability to bind to nectin-1, a mutation that causes the gD to lose (or reduce) its ability to bind to 3-OS-HS, and a mutation that confers the gD to a tumor antigen (e.g., an insertion mutation of DNA that codes for an scFv against a tumor antigen).
- These mutations weaken the infectivity of the gD to cells expressing nectin-1, HVEM, and/or 3-OS-HS, compared to HSV viruses that do not have these mutations.
- amino acid sequence of the gD protein of the KOS strain shown in SEQ ID NO:12 (not including the signal peptide consisting of 25 amino acid residues from the N-terminus) is shown.
- gD mutation In this specification, a specific example of "gD mutation" will be described below using the KOS strain as an example, but the present invention is similarly applicable to other strains.
- the gD protein of the KOS strain is encoded in the forward direction (rightward) at nucleotide positions 138279. . 139463 in the KOS strain genome sequence registered as GenBank no. JQ673480.1.
- mutations that cause loss of binding ability to Nectin-1 i.e., amino acid mutations that weaken infectivity to cells expressing Nectin-1
- amino acid positions of the gD protein in the amino acid numbers of SEQ ID NO:12 include ⁇ 6-38 (deletion of amino acids at positions 6 to 38) (Menotti et al., J Virol. 82:10153-10161 2008), ⁇ 61-218 (deletion of amino acids at positions 61 to 218) (Menotti et al., Proc Natl Acad Sci USA. 106:9039-9044 2009), R222N/F223I (Uchida et al., J Virol.
- R222N/F223I “Uchida et al., J Virol. 106:9039-9044 2009)
- R222N/F223I “Uchida et al., J Virol. 106:9039-9044 2009
- mutations include R222 and F223 mutations (mutations at amino acid positions 222 and 223) such as Y38C, A3C, or ⁇ A3/Y38C (Connolly et al., J Virol. 79:1282-1295 2005, Uchida et al., J Virol.
- A3 and/or Y38 mutations mutations at amino acid positions 3 and/or 38, e.g., a deletion or substitution with cysteine at amino acid position 3, or a substitution with cysteine at amino acid position 38).
- the positions of the amino acid mutations that abolish the ability to bind to HVEM, i.e., that weaken the infectivity of HVEM-expressing cells, as shown by the amino acid numbers in SEQ ID NO:12, are ⁇ 7-32 (deletion of amino acids at positions 7 to 32) (Yoon et al., J. Virol. 77:9221-9231 2003), ⁇ 2-24 (deletion of amino acids at positions 2 to 24) (Shibata et al., Gene Ther. 23:479-488 2016), ⁇ 7-11 (deletion of amino acids at positions 7 to 11) (Uchida et al., J. Virol.
- mutations include deletion of all or part of the amino acids at amino acid positions 2 to 38 (e.g., ⁇ 61-218 (deletion of amino acids at positions 61 to 218) (Menotti et al., Proc Natl Acad Sci USA. 106:9039-9044 2009), and mutations at Q27, T29, and D30 (mutations at amino acid positions 27, 29, and 30) such as Q27A, Q27P, Q27R, T29A, and D30A (Spear et al., Virology 344:17-24 2006).
- the scope of the present invention also includes sequences that show 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100% sequence identity to the amino acid sequence of the gD protein of the KOS strain shown in SEQ ID NO:12, and sequences thereof that include the mutations specified above.
- the herpes simplex virus of the present invention has an envelope protein gB, an envelope protein gK, a UL20 protein, and/or a UL24 protein that has an amino acid mutation that promotes entry into target cells and/or an amino acid mutation that promotes multinucleated giant cell formation.
- the amino acid mutations that promote the formation of multinucleated giant cells are mutations introduced into the gB gene (or gB protein), gK gene (or gK protein), UL20 gene (or UL20 protein: envelope protein UL20) and/or UL24 gene (or UL24 protein: nuclear protein UL24) of HSV, and these mutations promote the membrane fusion activity of HSV. Furthermore, the amino acid mutations that promote entry into target cells are mutations introduced into the gB gene (or gB protein) of HSV, and these mutations promote the efficiency of entry of HSV into target cells.
- SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 show the amino acid sequences of the gB protein of the KOS strain, the gK protein of the KOS strain, the UL20 protein of the KOS strain and the UL24 protein of the KOS strain, respectively.
- the gB protein of the KOS strain is encoded in the reverse direction (leftward) at nucleotide number 53022. . 55736 of the genome sequence registered as GenBank no. JQ673480.1, the gK protein is encoded in the forward direction (rightward) at nucleotide number 112101. . 113117, the UL20 protein is encoded in the reverse direction (leftward) at nucleotide number 40763. .
- the UL24 protein is encoded in the forward direction (rightward) at nucleotide number 47678. . 48487.
- Amino acid mutations that promote invasion into target cells and/or amino acid mutations that promote the formation of multinucleated giant cells have been disclosed in many publicly known documents, and a person skilled in the art can select an appropriate mutation as appropriate.
- Amino acid mutations that promote the entry of major gB proteins into target cells include mutations at D285, such as D285N, and mutations at A549, such as A549T.
- major amino acid mutations in gB protein that promote multinucleated giant cell formation include R796 mutations such as R796C, R800 mutations such as R800W, T813 mutations such as T813I, L817 mutations such as L817H and L817P, S854 mutations such as S854F, A855 mutations such as A855V, R858 mutations such as R858C and R858H, insertions between E816 and L817 (VN (2 amino acid insertion) and VNVN (4 amino acid insertion)), nonsense mutations at S869, and nonsense mutations at T877.
- R796 mutations such as R796C
- R800 mutations such as R800W
- T813 mutations such as T813I
- L817 mutations such as L817H and L817P
- S854 mutations such as S854F
- A855 mutations such as A855V
- R858 mutations such as R8
- Amino acid mutations in major gK proteins that promote multinucleated giant cell formation include P33 mutations such as P33S, A40 mutations such as A40V and A40T, L86 mutations such as L86P, D99 mutations such as D99N, A111 mutations such as A111V, T121 mutations such as T121I, C243 mutations such as C243Y, L304 mutations such as L304P, and R310 mutations such as R310L.
- the main amino acid mutations in UL20 protein that promote multinucleated giant cell formation include a single Y49A mutation, mutations of Y49, S50 and R51 such as Y49A/S50A/R51A, a single R209A mutation, mutations of R209, T212 and R213 such as R209A/T212A/R213A, deletion of the C-terminus after N217, and deletion of the entire UL20 protein.
- the main amino acid mutations in UL24 protein that promote multinucleated giant cell formation include mutations of T62, R63, and V64, such as T62G/R63V/V64S, as shown by the amino acid numbers in SEQ ID NO:16, as the amino acid positions of the UL24 protein.
- the herpes simplex virus of the present invention may, in addition to carrying the syn mutation described above, carry in an expressible state a foreign gene that promotes membrane fusion of HSV (hereinafter also referred to as a "membrane fusion-promoting foreign gene").
- a foreign gene that promotes membrane fusion of HSV hereinafter also referred to as a "membrane fusion-promoting foreign gene”
- the position on the HSV genome where the foreign gene is integrated is not particularly limited, and may be at any position on the HSV genome as long as it does not inhibit the functions that the HSV virus should have as an oncolytic virus.
- the membrane fusion-promoting foreign gene is not particularly limited, but may be, for example, the fusogenic membrane glycoprotein (FMG) derived from gibbon ape leukemia virus (GALV).
- FMG fusogenic membrane glycoprotein
- GALV gibbon ape leukemia virus
- the herpes simplex virus of the present invention may have a mutation (also referred to as a "restricted replication modification" in this specification) that weakens the proliferation in normal cells instead of or in addition to the above mutation.
- the restricted replication modification may be, for example, a mutation that inactivates the expression of functional ICP34.5.
- ICP34.5 (for example, the amino acid sequence of SEQ ID NO: 30 (KOS strain)) is a neurotoxic factor possessed by herpes simplex viruses.
- PLR protein kinase R
- herpes simplex viruses and the like possess ICP34.5 protein, which is a viral gene product that acts to cancel the action of PKR. It is known that herpes simplex viruses that have a mutation that inactivates the expression of functional ICP34.5 are significantly inhibited in proliferation in normal cells, but proliferate well in cancer cells with almost no effect. Therefore, a herpes simplex virus having a mutation that inactivates the expression of functional ICP34.5 grows only in cancer cells and inhibits growth in normal cells, and is expected to be safer.
- the herpes simplex virus of the present invention may be one having a mutation that inactivates the expression of functional ICP34.5, for example, one having any mutation (e.g., nonsense mutation), deletion or substitution that makes ICP34.5 nonfunctional, or one in which a part or all of the gene encoding ICP34.5 is deleted and the expression of functional ICP34.5 is inactivated, for example, WO 2020/090871, JP 2006-528484, Chou et al. 1990, Science 250: 1262-1266; and Maclean et al. 1991, J. Gen. Virol. 72:631-639, etc.
- any mutation e.g., nonsense mutation
- deletion or substitution that makes ICP34.5 nonfunctional
- the expression of a functional ICP34.5 protein that shows 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100% sequence identity to the amino acid sequence of the ICP34.5 protein of the KOS strain shown in SEQ ID NO:30 may be inactivated, and the amino acid sequence may have any mutation (e.g., nonsense mutation), deletion or substitution that makes the protein non-functional, or a part or all of the gene encoding the protein is deleted, thereby inactivating the expression of the functional ICP34.5.
- any mutation e.g., nonsense mutation
- functional ICP34.5 means an ICP34.5 protein that can exert the function of wild-type ICP34.5 (e.g., the function of neutralizing the action of PKR), and "expression of functional ICP34.5 is inactivated” means that the function of neutralizing the action of PKR is not exerted, or the function is weakened compared to that of wild-type ICP34.5.
- the limited proliferation type modification applicable to the present invention may be a limited proliferation type modification introduced by various methods as listed in the paper by Peters et al. (Mol Ther Oncolytics. 2015; 2. pii: 15010.
- one or more genes selected from ICP6/UL39, thymidine kinase/UL23, UL2/UNG, ICP47/Us12, Us11, Us3, ICP0, UL56, VP16/UL48, and UL24 may be modified (mutated, deleted, and/or substituted).
- the HSV of the present invention may incorporate a reporter gene and any therapeutic gene (e.g., a gene that enhances the killing effect of cancer cells, a gene that suppresses tumor angiogenesis, a gene that promotes antitumor immune responses, etc.) in a state in which they can be expressed (for details, see Peters et al., Mol Ther Oncolytics. 2015; 2. pii: 15010. Epub 2015 Jul 22, etc.).
- the position on the HSV genome where the gene is incorporated is not particularly limited, and may be any position on the HSV genome as long as it does not inhibit the functions that the HSV virus should have as an oncolytic virus.
- Reporter genes include, but are not limited to, the LacZ gene (Mineta et al., Nat Med. 1:938-943, 1995), the Luc gene (Yamamoto et al., Gene Ther. 13:1731-1736, 2006), the GFP gene (Adusumilli et al., FASEB J. 20:726-728, 2006), and the NIS gene (Li et al., Cancer Gene Ther. 20:478-485, 2013).
- Therapeutic genes are not particularly limited, but examples of genes encoding cytotoxic molecules include the CD gene (Nakamura et al., Cancer Res. 61:5447-5452 2001) and the TRAIL gene (Tamura et al., Mol Ther. 21:68-77 2013), and genes encoding immune activating molecules include the GM-CSF gene (Liu et al., Gene Ther. 10:292-303 2003) and the IL-12 gene (Roth et al., Ther Clin Dev. 25:16-27 2014), and genes encoding microenvironment control molecules include the angiostatin gene (Zhang et al., Mol Ther.
- the present invention also includes nucleic acids (nucleic acid molecules) that encode the herpes simplex viruses described herein.
- the herpes simplex virus of the present invention can be produced by standard methods known to those skilled in the art of HSV virology. However, to facilitate the manipulation of the HSV genome and the production of the vectors of the present invention, the present invention also provides vectors carrying the genomic nucleic acid of the recombinant virus of the present invention.
- a preferred vector is a bacterial artificial chromosome ("BAC") carrying the genome of the recombinant virus of the present invention, which facilitates the manipulation of HSV in bacterial systems.
- BAC bacterial artificial chromosome
- KOS-37 BAC Even et al., 2006 Virus Res.
- HSV-BAC construct can be used as an HSV-BAC construct, and various mutations can be introduced by homologous recombination (e.g., Red homologous recombination method: Tischer et al., 2006. Biotechniques. 40(2):191).
- homologous recombination e.g., Red homologous recombination method: Tischer et al., 2006. Biotechniques. 40(2):191).
- HSV-based vectors and methods for their construction are described, for example, in U.S. Patent Nos. 7,078,029, 6,261,552, 5,998,174, 5,879,934, 5,849,572, 5,849,571, 5,837,532, 5,804,413, and 5,658,724, and International Patent Applications Nos. WO 91/02788, WO 96/04394, WO 98/15637, and WO 99/06583, the entireties of which are incorporated herein by reference.
- the sequence of HSV has been published (NCBI Accession No. NC_001806; see also McGoech et al., J. Gen.
- the oncolytic recombinant virus of the present invention is a herpes simplex virus (HSV-1), and includes ⁇ 2-24, a gD gene having a Y38C mutation, a gB gene having a D285N/A549T mutation (NT mutation), a R858H mutation, and a gK gene having an A40T mutation, and further includes a nucleic acid sequence encoding an anti-IL13RA2 antibody or an antigen-binding fragment thereof fused to the gD gene (e.g., the ⁇ 2-24 portion).
- HSV-1 herpes simplex virus
- the genome of the herpes simplex virus of the present invention may further include a reporter protein such as green fluorescent protein (GFP) or luciferase, or a non-viral gene (exogenous expression cassette) of a payload molecule.
- a reporter protein such as green fluorescent protein (GFP) or luciferase, or a non-viral gene (exogenous expression cassette) of a payload molecule.
- the reporter protein makes it easy to identify target cells infected with the recombinant virus of the present invention, and the reporter protein released from lysed tumor cells can be used as an indicator to monitor tumor lysis.
- the present invention also includes a method for producing the herpes simplex virus described herein.
- the herpes simplex virus of the present invention can be infected into producer cells, and the herpes simplex virus can be collected from the culture supernatant or the producer cells.
- producer cells include, but are not limited to, RPMI7951, U87, CHO, 293, COS, BHK, HeLa, or Vero cells, or substrains of these cell lines expressing IL13RA2 (e.g., Vero-IL13RA2 cells), or substrains of these cell lines expressing gD (e.g., VD60 cells).
- the herpes simplex virus can be purified by a method such as centrifugation.
- the present invention also encompasses cells that produce the herpes simplex virus described herein.
- the cells that produce the herpes simplex virus may be cells that have been introduced with a nucleic acid (nucleic acid molecule) encoding the herpes simplex virus described herein and that temporarily produce the herpes simplex virus, or may be cells that have a nucleic acid (nucleic acid molecule) encoding the herpes simplex virus described herein integrated into the genome of the cells and that continuously produce the herpes simplex virus described herein.
- Examples of cells that produce the herpes simplex virus described herein include, but are not limited to, RPMI7951, U87, CHO, 293, COS, BHK, HeLa, or Vero cells, or substrains of these cell lines that express IL13RA2 (e.g., Vero-IL13RA2 cells), or substrains of these cell lines that express gD (e.g., VD60 cells).
- the invention relates to viral stocks comprising the recombinant viruses described herein.
- the viral stocks are homogenous stocks. Preparation and analysis of viral stocks is well known in the art. For example, viral stocks can be produced in roller bottles containing cells transduced with the viral vector of interest. The viral stocks can then be purified on a continuous Nycodenz gradient, aliquoted, and stored until needed. Viral stocks vary considerably in titer, depending largely on the viral genotype and the protocols and cell lines used to prepare them.
- the titer of a virus stock contemplated herein is at least about 10 plaque forming units (pfu)/mL, e.g., at least about 10 pfu/mL, or even more preferably, at least about 10 pfu/mL.
- the titer may be at least about 10 pfu/mL, or at least about 10 pfu/mL, with high titer stocks of at least about 10 pfu/mL or at least about 10 pfu/mL being most preferred.
- compositions comprising a herpes simplex virus as described herein and a pharma- ceutically acceptable carrier.
- pharmaceutical acceptable refers to molecular entities and compositions that do not cause allergic or similar adverse reactions when administered to a subject (e.g., a human).
- pharmaceutical composition refers to a formulation of one or more herpes simplex viruses as described herein that can be administered or delivered to a subject and/or cell.
- the formulation includes an active ingredient, a herpes simplex virus as described herein, and any physiologically acceptable carriers, diluents, and/or excipients.
- a "pharmaceutical composition” is a composition of one or more agents that can be administered or delivered to a patient and/or subject and/or cell for the treatment of a particular disease or disorder.
- the pharmaceutical composition can include a nucleic acid molecule encoding a herpes simplex virus as described herein in place of the herpes simplex virus of the present invention.
- compositions disclosed herein may be formulated in a neutral or salt form.
- “Pharmaceutically acceptable salts” include both acid addition and base addition salts.
- Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of a protein) including inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethane
- Salts formed with the free carboxyl groups can likewise be derived from inorganic bases such as, for example, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, etc.
- Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine,
- Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.
- carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
- pharmacologically acceptable carrier includes, but is not limited to, any physiologically compatible adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, surfactant, dispersion medium, coating, antibacterial and antifungal agent, isotonic and absorption delaying agent, etc., including pharmacokinetic and metabolic pathways, which have been approved by the U.S. Food and Drug Administration (FDA) as acceptable for human and/or veterinary use.
- FDA U.S. Food and Drug Administration
- Exemplary pharma- ceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose and sucrose, starches such as corn starch and potato starch, cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetate, tragacanth, malt, gelatin, talc, cocoa butter, waxes, animal and vegetable fats, paraffin, silicones, bentonite, silicic acid, zinc oxide, oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil, glycols such as propylene glycol, polyols such as glycerin, sorbitol, mannitol and polyethylene glycol, esters such as ethyl oleate and ethyl laurate, agar, buffers such as magnesium hydroxide and aluminum hydroxide, alginic acid, pyrogen-free water, isotonic s
- wetting agents such as sodium lauryl sulfate and magnesium stearate, as well as colorants, release agents, coating agents, sweeteners, flavorings and fragrances, preservatives and antioxidants may also be included in the composition.
- antioxidants examples include: (1) water-soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, etc.; and (3) metal chelating agents, such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc.
- water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.
- oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin,
- the pharmaceutical composition containing the carrier is suitable for parenteral administration, e.g., intravascular (intravenous or intraarterial), intrathoracic, intraperitoneal, intracerebral, other organ, intratumoral, subcutaneous or intramuscular administration.
- parenteral administration e.g., intravascular (intravenous or intraarterial), intrathoracic, intraperitoneal, intracerebral, other organ, intratumoral, subcutaneous or intramuscular administration.
- Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
- the use of such media and agents for pharma- ceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the recombinant virus or nucleic acid molecule, its use in the pharmaceutical composition of the present invention is contemplated.
- compositions of the invention may comprise one or more of the polypeptides, polynucleotides, vectors containing them, cells infected with a recombinant virus of the invention, etc., described herein, formulated in a pharma- ceutically or physiologically acceptable solution for administration to a cell or subject (e.g., a human) alone or in combination with one or more other therapies.
- a cell or subject e.g., a human
- the compositions of the invention may be administered in combination with other agents, as well, such as, for example, antibodies, cytokines, growth factors, hormones, small molecules, or various pharma- ceutical active agents, if desired.
- agents such as, for example, antibodies, cytokines, growth factors, hormones, small molecules, or various pharma- ceutical active agents, if desired.
- the formulation of pharma- ceutically acceptable excipient and carrier solutions is well known to those of skill in the art, as is the development of appropriate dosing and treatment regimens for use with the particular compositions described herein in various treatment regimens.
- the solutions are administered in a manner compatible with the dosage formulation and in a therapeutically effective amount to effect amelioration or treatment of the condition.
- the formulations are easily administered in a variety of dosage forms, e.g., ingestible solutions, drug release capsules, and the like. Some variation in dosing may occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, be able to determine the appropriate dose for the individual subject.
- the formulations meet the standards of sterility, general safety, and purity as required by the standards of the Center for Biologics Evaluation and Research of the U.S. Food and Drug Administration (FDA).
- compositions, recombinant viruses, and nucleic acid molecules disclosed herein parenterally (e.g., intravascularly (intravenously or intraarterially), intrathoracically, intraperitoneally, intracerebrally, other organs, intratumorally, subcutaneously, or intramuscularly), as described, for example, in U.S. Pat. Nos. 5,543,158, 5,641,515, and 5,399,363, each of which is expressly incorporated herein by reference in its entirety.
- Solutions of the active compounds as free base or pharma-ceutically acceptable salts may be prepared in water suitably mixed with a surfactant, e.g., hydroxypropylcellulose.
- Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
- compositions suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No. 5,466,468, expressly incorporated herein by reference in its entirety).
- the form should be sterile and fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and/or vegetable oils.
- Proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
- Prevention of the action of microorganisms can be promoted by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
- an isotonic agent for example, sugar or sodium chloride.
- Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents that delay absorption, such as aluminum monostearate and gelatin.
- agents that delay absorption such as aluminum monostearate and gelatin.
- aqueous compositions containing proteins as active ingredients is well understood in the art.
- injectables either as liquid solutions or suspensions; solid forms suitable for solution or suspension in liquid prior to injection can also be prepared.
- the formulations may also be emulsified.
- aqueous solutions for example, the solution should be suitably buffered if necessary and the liquid diluent should first be made isotonic with sufficient saline or glucose.
- aqueous solutions are particularly suitable for parenteral administration (e.g., intravascular (intravenous or intraarterial), intrathoracic, intraperitoneal, intracerebral, other organ, intratumoral, subcutaneous, or intramuscular).
- parenteral administration e.g., intravascular (intravenous or intraarterial), intrathoracic, intraperitoneal, intracerebral, other organ, intratumoral, subcutaneous, or intramuscular.
- sterile aqueous media that may be employed will be known to those of skill in the art in light of this disclosure.
- a dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion fluid or injected at the proposed infusion site (see, e.g., Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000).
- Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
- the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
- preparations should meet sterility, pyrogenicity, and general safety and purity standards as required by the standards of the Office of Biologics of the U.S. Food and Drug Administration (FDA).
- Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in the appropriate solvent with various other ingredients as enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient, plus any additional desired ingredients, from a previously sterile-filtered solution thereof.
- the compositions may be delivered by intranasal spray, inhalation, and/or other aerosol delivery vehicles.
- Methods for delivering polynucleotide and peptide compositions directly to the lungs via nasal aerosol sprays are described, for example, in U.S. Pat. Nos. 5,756,353 and 5,804,212, each of which is expressly incorporated herein by reference in its entirety.
- intranasal microparticle resins (Taken et al., 2003) are known to be effective in treating lung cancer. Delivery of drugs using lysophosphatidyl-glycerol compounds (U.S. Pat. No. 5,725,871, expressly incorporated herein by reference in its entirety) is also well known in the pharmaceutical art.
- transmucosal drug delivery in the form of a polytetrafluoroethylene support matrix is described in U.S. Pat. No. 5,780,045, expressly incorporated herein by reference in its entirety.
- the delivery may be achieved by using liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, optionally in admixture with a CPP polypeptide, to introduce the compositions of the invention into suitable host cells.
- the compositions of the invention may be formulated for delivery encapsulated in either lipid particles, liposomes, vesicles, nanospheres, nanoparticles, etc. The formulation and use of such delivery vehicles may be achieved using known conventional techniques.
- compositions of the invention may include one or more of the polypeptides, polynucleotides, and small molecules described herein, formulated in a pharma- ceutically or physiologically acceptable solution (e.g., medium) for administration to a cell or subject (e.g., a human), alone or in combination with one or more other therapies.
- a pharma- ceutically or physiologically acceptable solution e.g., medium
- the compositions of the invention may be administered in combination with other agents, such as, for example, cells, other proteins or polypeptides, or various pharma- ceutically active agents, as well as other agents, if desired.
- the formulations or pharmaceutical compositions of the present invention comprise cells contacted with a combination of various polynucleotides contemplated herein or herpes simplex viruses described herein.
- Exemplary formulations for ex vivo delivery of various polynucleotides, including viral vectors, to cells may include the use of various transfection agents known in the art, such as calcium phosphate, electroporation, heat shock, and various liposome formulations (i.e., lipid-mediated transfection).
- transfection agents such as calcium phosphate, electroporation, heat shock, and various liposome formulations (i.e., lipid-mediated transfection).
- liposomes are lipid bilayers that encapsulate a fraction of an aqueous fluid. DNA spontaneously binds to the outer surface of cationic liposomes (due to their charge), and these liposomes interact with cell membranes.
- Certain embodiments of the invention may include other formulations, e.g., those well known in the pharmaceutical art, e.g., those described in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000.
- the present invention provides pharma- ceutical acceptable compositions comprising a therapeutically effective amount of one or more viral vectors or polynucleotides described herein, formulated with one or more pharma- ceutical acceptable carriers (additives) and/or diluents (e.g., pharma- ceutical acceptable cell culture media).
- pharma- ceutical acceptable compositions comprising a therapeutically effective amount of one or more viral vectors or polynucleotides described herein, formulated with one or more pharma- ceutical acceptable carriers (additives) and/or diluents (e.g., pharma- ceutical acceptable cell culture media).
- a "therapeutically effective amount” refers to the amount of a composition or recombinant virus described herein required to achieve a desired physiological and/or biological result.
- a “therapeutically effective amount” of a virus, viral stock, or composition may vary depending on factors such as the disease state, age, sex, and weight of an individual, and the ability of stem and progenitor cells in the individual to induce a desired response.
- a therapeutically effective amount is also one in which any toxic or deleterious effects of the virus or transduced therapeutic cells are outweighed by therapeutically beneficial effects.
- the term “therapeutically effective amount” includes an amount effective to "treat" a subject (e.g., a patient).
- a therapeutically effective amount may be quantified by the total number of plaque forming units (pfu) (e.g., at least about 10 1 to at least about 10 20 , specifically, about 10 4 to about 10 15 , and more specifically, about 10 6 to about 10 12 pfu) or by the number of viral genomes (e.g., at least about 10 1 to at least about 10 20 , specifically, about 10 4 to about 10 15 , and more specifically, about 10 6 to about 10 12 viral genomes).
- pfu plaque forming units
- viral genomes e.g., at least about 10 1 to at least about 10 20 , specifically, about 10 4 to about 10 15 , and more specifically, about 10 6 to about 10 12 viral genomes.
- the therapeutically effective amount will vary based on the type of virus administered, the nature of the formulation, the route of administration, the nature and/or severity of the disease being treated, and/or the general condition and health of the subject.
- Some aspects of the invention include a method of killing a cancerous cell, comprising exposing the cancerous cell to a herpes simplex virus or composition thereof described herein under conditions sufficient for the herpes simplex virus to infect and replicate in the cancerous cell, where replication of the herpes simplex virus in the cancerous cell results in cell death.
- the cancerous cell killed by the method is in vivo. In certain embodiments, the cancerous cell killed by the method is in a tumor.
- administering refers to the introduction of a herpes simplex virus, virus stock, or composition thereof targeted to IL13RA2, or a nucleic acid molecule or composition encoding the recombinant virus, into a subject, and in one embodiment refers to contacting a cell and/or tissue with a herpes simplex virus, virus stock, or composition thereof, or a nucleic acid molecule or composition encoding the virus, as described in the specification. Administration may be by injection, irrigation, inhalation, ingestion, electroosmosis, hemodialysis, iontophoresis, and other methods known in the art.
- the route of administration will, of course, vary with the location and nature of the disease to be treated, and may be, for example, auricular, buccal, conjunctival, cutaneous, dental, intracervical, intrasinus, intratracheal, enteral, epidural, interstitial, intra-articular, intra-arterial, intraperitoneal, intraauricular, intrabiliary, intrabronchial, intracapsular, intracavity, intracerebral, intracisternal, intracorneal, intracranial, intracoronary, intracranial, intradermal, intradiscal, intraductal, intraduodenal, intradural, intrapericardial, intraepidermal, intraesophageal, intragastric, intragingival, intrahepatic, intraileal, intralesional, intralingual, intracavity, intralymphatic, intramammary, intramedullary, intrameningeal, intramuscular, intranasal, intranodal,
- the terms “treating” and “treatment” refer to administering to a subject a therapeutically effective amount of a virus or composition thereof as described herein such that the subject improves the disease or condition or symptoms of the disease or condition.
- the improvement is any amelioration or cure of the disease or condition or symptoms of the disease or condition.
- the improvement may be a visible or measurable improvement or an improvement in the subject's general sense of well-being.
- a “prophylactically effective amount” refers to an amount of a virus, virus stock, or composition effective to achieve a desired prophylactic result.
- prevention can mean completely preventing symptoms of a disease, delaying the onset of symptoms of a disease, or reducing the severity of later manifestations of the disease.
- a prophylactically effective amount is less than a therapeutically effective amount because a prophylactic dose is used in a subject prior to or at an early stage of a disease.
- the pharmaceutical composition containing the herpes simplex virus targeted to IL13RA2 according to the present invention can be a therapeutic agent for tumors expressing IL13RA2.
- tumors expressing IL13RA2 include melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), glioma (e.g., glioblastoma, astrocytoma, medulloblastoma), head and neck cancer, renal cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer, and ovarian cancer. Therefore, these types of cancer can be therapeutic targets of the present invention.
- Antibody or Antigen-Binding Fragment thereof One embodiment of the anti-IL13RA2 antibody or antigen-binding fragment thereof according to the present invention is an antibody or antigen-binding fragment thereof that specifically recognizes tumor cells expressing IL13RA2.
- the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and the light chain CDRs (LCDR1, LCDR2, LCDR3) are (i) HCDR1: (SEQ ID NO: 1: RHGIH) (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNYNSALMS) (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY) (iv) LCDR1: (SEQ ID NO: 4: TASSSVSSSSYLH) (v) LCDR2: (SEQ ID NO:5: STSNLAS) and (vi) LCDR3: (SEQ ID NO:6: HQYHRSPLT) or have one to several amino acid mutations in these amino acid sequences.
- the heavy chain CDRs are (i) HCDR1: (SEQ ID NO: 1: RHGIH) (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNYNSALMS) (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY) or has one to several (1, 2 or 3) amino acid mutations in these amino acid sequences.
- the light chain CDRs are (i) LCDR1: (SEQ ID NO: 4: TASSSVSSSSYLH) (ii) LCDR2: (SEQ ID NO:5: STSNLAS) and (iii) LCDR3: (SEQ ID NO:6: HQYHRSPLT) or has one to several (1, 2 or 3) amino acid mutations in these amino acid sequences.
- one embodiment of the anti-IL13RA2 antibody or antigen-binding fragment thereof according to the present invention may be an anti- IL13RA2 antibody or antigen-binding fragment thereof comprising a sequence that shows 80% or more (e.g., 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100%) sequence identity to the amino acid sequence of the VL region set forth in SEQ ID NO:8, and a sequence that shows 80% or more (e.g., 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, or 100%) sequence identity to the amino acid sequence of the VH region set forth in SEQ ID NO:10.
- the anti-IL13RA2 antibodies of the present invention may include a murine constant region (IgG1, IgG2a, IgG2b, IgG3, IgM, IgD, IgE, IgA).
- the antibodies may be chimeric, humanized, or human antibodies having a human constant region (IgG1, IgG2, IgG3, IgG4, IgM, IgD, IgE, IgA1, IgA2).
- the antibodies may be bispecific, trispecific, or multispecific antibodies to enhance affinity or avidity.
- the anti-IL13RA2 antibodies or antigen-binding fragments thereof of the present invention are humanized antibodies.
- the term "humanized" when used in connection with antibodies is used to refer to antibodies having at least the CDR regions derived from a non-human source that are engineered to have a structure and immune function more similar to a true human antibody than the original source antibody.
- humanizing can involve grafting CDRs from a non-human antibody, such as a mouse antibody, onto a human antibody. Humanizing can also involve selecting amino acid substitutions that make the non-human sequence more human-like, as known in the art.
- the invention is an antigen-binding fragment of an anti-IL13RA2 antibody.
- the antigen-binding fragment may be any of the antigen-binding fragments of the antibodies described herein.
- Antigen-binding fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv, scFv, dsFv, diabodies, triabodies, and bis-scFv, as long as they are antigen-binding fragments derived from an anti-IL13RA2 antibody.
- Diabodies (dimers), triabodies (trimers), or tetrabodies (tetramers) are well known in the art. See, for example, Kortt et al., Biomol. Eng. 2001,18:95-108, (2001) and Todorovska et al., J. ImmunolMethods. 248:47-66, (2001).
- An scFv consists of an antibody heavy chain variable (V) domain linked to an antibody light chain variable (V) domain via a synthetic peptide (linker), and can be produced using routine recombinant DNA technology (see, for example, Janeway et al., Immunobiology, 2nd ed., Garland Publishing, New York, (1996)).
- linker for example, a flexible linker containing (Gly 4 Ser) 3 can be used.
- the order in which the V L domain and the V H domain connected by the linker are linked is not particularly limited.
- disulfide-stabilized variable fragments (dsFv) can be prepared by recombinant DNA technology (see, for example, Reiter et al., Protein Engineering, 7, 697-704 (1994)).
- an antigen-binding fragment of an anti-IL13RA2 antibody according to the present invention may be an antigen-binding fragment comprising a sequence that exhibits 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity to the sequence set forth in SEQ ID NO: 7.
- an antigen-binding fragment of an anti-IL13RA2 antibody may be an antigen-binding fragment comprising a heavy chain CDR (HCDR1, HCDR2, HCDR3) and a light chain CDR (LCDR1, LCDR2, LCDR3) that are (i) HCDR1: (SEQ ID NO: 1: RHGIH) (ii) HCDR2: (SEQ ID NO: 2: VIWAGGSTNYNSALMS) (iii) HCDR3: (SEQ ID NO: 3: DHFDSFDY) (iv) LCDR1: (SEQ ID NO: 4: TASSSVSSSSYLH) (v) LCDR2: (SEQ ID NO:5: STSNLAS) and (vi) LCDR3: (SEQ ID NO:6: HQYHRSPLT) or having one to several amino acid mutations in this amino acid sequence, and having 80% or more, 85% or more, 90% or more, 95% or more, 98% or
- the amino acid mutations include “substitution” in which another amino acid is substituted, “deletion” in which the amino acid is removed, and “insertion” in which another amino acid is added.
- substitution is “conservative amino acid substitution.” Conservative amino acid substitutions are made based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic properties of the residues involved.
- nonpolar (hydrophobic) amino acids include alanine (Ala, A), leucine (Leu, L), isoleucine (Ile, I), valine (Val, V), proline (Pro, P), phenylalanine (Phe, F), tryptophan (Trp, W), and methionine (Met, M); polar neutral amino acids include glycine (Gly, G), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), tyrosine (Tyr, Y), asparagine (Asn, N), and glutamine (Gln, Q); positively charged (basic) amino acids include arginine (Arg, R), lysine (Lys, K), and histidine (His, H); negatively charged (acidic) amino acids include aspartic acid (Asp, D) and glutamic acid (Glu, E).
- polar neutral amino acids include glycine (Gly, G), se
- substitutions may preferably be in the range of 1-25, 1-20, 1-15, 1-10, or 1-5 amino acids. Mutations may be introduced by making systematic or random amino acid substitutions in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant mutants for activity.
- anti-IL13RA2 antibody or antigen-binding fragment thereof of the present invention is an anti-IL13RA2 antibody or antigen-binding fragment thereof that at least partially competes with an anti-IL13RA2 antibody or antigen-binding fragment thereof comprising the amino acid sequences of heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) set forth in SEQ ID NOs: 1 to 6 in binding to human IL13RA2.
- HCDR1, HCDR2, HCDR3 heavy chain CDRs
- LCDR1, LCDR2, LCDR3 light chain CDRs
- the term "competes" by a subject antibody or antigen-binding fragment thereof means that, for example, when the subject antibody or antigen-binding fragment thereof is reacted with an IL13RA2 protein, and then an anti-IL13RA2 antibody or antigen-binding fragment thereof comprising the amino acid sequences of the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) set forth in SEQ ID NOs: 1 to 6 is reacted, the subject antibody or antigen-binding fragment thereof reduces the binding of the anti-IL13RA2 antibody or antigen-binding fragment thereof comprising the amino acid sequences of the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) set forth in SEQ ID NOs: 1 to 6 to the IL13RA2 protein.
- a subject antibody or antigen-binding fragment thereof competes with an anti-IL13RA2 antibody or antigen-binding fragment thereof that contains the amino acid sequences of the heavy chain CDRs (HCDR1, HCDR2, HCDR3) and light chain CDRs (LCDR1, LCDR2, LCDR3) set forth in SEQ ID NOs: 1 to 6 can be verified by a general method such as, for example, ELISA, RIA, FACS, or Biacore (trademark).
- the anti-IL13RA2 antibodies and antigen-binding fragments thereof of the present invention can have any level of affinity or binding activity for IL13RA2.
- the dissociation constant (KD) can be any of the exemplary dissociation constants described herein for the binding unit. Binding constants, including dissociation constants, can be determined by methods known in the art, including, for example, methods utilizing the principles of surface plasmon resonance, e.g., methods utilizing a BiacoreTM system.
- the KD is between about 0.0001 nM and about 1000 nM. In some embodiments, the KD is about 0.0001 nM or more, about 0.001 nM or more, about 0.01 nM or more, about 0.1 nM or more, about 1 nM or more, or about 10 nM or more, or about 1000 nM or less, about 100 nM or less, about 10 nM or less, about 1 nM or less, about 0.1 nM or less, about 0.01 nM or less, or about 0.001 nM or less.
- the antibody can be any type of immunoglobulin known in the art.
- the antibody can be of any isotype, e.g., IgA, IgD, IgE, IgG, or IgM.
- the antibody can be monoclonal or polyclonal.
- the antibody can be a naturally occurring antibody, e.g., an antibody isolated and/or purified from a mammal, such as mouse, rabbit, goat, horse, chicken, hamster, camel, human, etc.
- the antibody may be considered to be a mammalian antibody, e.g., a mouse antibody, a rabbit antibody, a goat antibody, a horse antibody, a chicken antibody, a hamster antibody, a human antibody, etc.
- isolated means removed from its natural environment.
- purified as used herein relates to the isolation of a molecule or compound in a form that is substantially free of contaminants normally associated with the molecule or compound in its native or natural environment, and means that the purity has been increased as a result of separation from other components of the original composition. It is recognized that “purity” is a relative term and should not necessarily be construed as absolute purity, absolute enrichment, or absolute selectivity.
- the purity is at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% (e.g., at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or nearly 100%.
- the anti-IL13RA2 antibody or antigen-binding fragment thereof according to the present invention is internalized into tumor cells expressing IL13RA2.
- Internalization into tumor cells expressing IL13RA2 can be examined by contacting an anti-IL13RA2 antibody or antigen-binding fragment thereof, directly or indirectly labeled with a fluorescent label or the like, with tumor cells expressing IL13RA2 and observing the antibody under a (phase contrast) microscope or the like.
- internalization into tumor cells expressing IL13RA2 can be evaluated by using DT3C, a protein that combines the catalytic domain of diphtheria toxin (DT) and three antibody-binding domains of protein G.
- DT3C a protein that combines the catalytic domain of diphtheria toxin (DT) and three antibody-binding domains of protein G.
- DT3C binds stably to the Fc portion of an antibody specifically and stably, and when taken up into cells, it induces cell death by inhibiting protein synthesis.
- this system it is possible to simultaneously observe the internalization of the antibody and the cell killing effect of the immunotoxin, and it is possible to screen for antibodies that have the effect of being internalized (Yamaguchi, M., Hamada, H., et al., Biochemical and Biophysical Research Communications 454 (2014) 600-603).
- the amount of the anti-IL13RA2 antibody or antigen-binding fragment thereof according to the present invention that is internalized into cells that express IL13RA2 is at least 5 times, at least 10 times, or at least 50 times greater than the amount that is internalized into the same cells that do not express IL13RA2.
- the anti-IL13RA2 antibody or antigen-binding fragment thereof according to the present invention not only specifically recognizes tumor cells expressing IL13RA2, but also has the property of being internalized by tumor cells expressing IL13RA2, and therefore the anti-IL13RA2 antibody or antigen-binding fragment thereof is suitable for use in a drug delivery system (DDS) for delivering drugs, for example, anticancer drugs, into tumor cells.
- DDS drug delivery system
- the anti-IL13RA2 antibody or antigen-binding fragment thereof according to the present invention can be used in an antibody-drug conjugate (ADC).
- ADC antibody-drug conjugate
- the present invention relates to an antibody-drug conjugate (ADC) comprising an anti-IL13RA2 antibody or antigen-binding fragment thereof.
- Suitable methods for making antibodies are known in the art. For example, standard hybridoma methods are described, for example, in Harlow and Lane (eds.), Antibodies: A Laboratory Manual, CSH Press, (1988), and C.A. Janeway et al. (eds.), Immunobiology, 5th ed., Garland Publishing, New York, NY (2001).
- Monoclonal antibodies for use in the present invention may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include those originally described by Koehle et al. Hybridoma methods include, but are not limited to, the hybridoma method described by Kosbor et al., Immunol. Today, 4:72, 1983; Cote et al., Proc. Natl. Acad. Sci. 80:2026-2030, 1983), the human B cell hybridoma method (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R Liss Inc, New York, N.Y., pp77-96, (1985)).
- polyclonal antibodies can be prepared by immunizing an animal with a desired immunogen (e.g., a recombinant human IL13RA2 polypeptide (e.g., a polypeptide having the amino acid sequence set forth in SEQ ID NO: 17 or a portion thereof (e.g., excluding the signal peptide); a membrane fraction of a cell expressing human IL13RA2 (e.g., A375 cell)) and collecting antisera from the immunized animal.
- a desired immunogen e.g., a recombinant human IL13RA2 polypeptide (e.g., a polypeptide having the amino acid sequence set forth in SEQ ID NO: 17 or a portion thereof (e.g., excluding the signal peptide); a membrane fraction of a cell expressing human IL13RA2 (e.g., A375 cell)
- a desired immunogen e.g., a recombinant human IL13RA2 polypeptide
- the animal used for the production of anti-IL13RA2 antisera is a non-human animal, including rabbit, mouse, rat, hamster, goat, sheep, camel, pig or horse. Due to the relatively large blood volume of rabbits, in some exemplary embodiments, rabbits are the preferred choice for the generation of polyclonal antibodies.
- 50 ⁇ g of IL13RA2 antigen is emulsified in Freund's complete adjuvant for immunization of a rabbit.
- polyclonal antisera may be readily obtained by bleeding the animal and preparing serum samples from the whole blood.
- a mouse is immunized with a desired immunogen against which an antibody should be raised (e.g., a recombinant human IL13RA2 polypeptide (e.g., a polypeptide having the amino acid sequence set forth in SEQ ID NO: 17 or a portion thereof (e.g., excluding the signal peptide)); a membrane fraction of a cell expressing human IL13RA2 (e.g., A375 cell), etc.) (e.g., Freund's complete adjuvant may be used).
- a desired immunogen against which an antibody should be raised e.g., a recombinant human IL13RA2 polypeptide (e.g., a polypeptide having the amino acid sequence set forth in SEQ ID NO: 17 or a portion thereof (e.g., excluding the signal peptide)); a membrane fraction of a cell expressing human IL13RA2 (e.g., A375 cell), etc.) (e.g., Freund's complete
- Cells (1 ⁇ 10 8 cells) derived from the spleen of the immunized mouse are combined with myeloma cells (e.g., NS-1 cells, P3U1 cells, etc.) and fused with PEG.
- myeloma cells e.g., NS-1 cells, P3U1 cells, etc.
- Hybridomas producing the desired monoclonal antibodies in the culture supernatant are screened by ELISA or the like.
- the isotype of the monoclonal antibodies produced by the hybridomas can be determined using the IsoStrip system (Boehringer Mannheim, Indianapolis, Ind.).
- P3-X63/Ag8 As myeloma cells, for mouse splenocytes, P3-X63/Ag8, P3-X63-Ag8.653, NS1/1.Ag41, Sp210-Ag14, FO, NSO/U, MPC-11, MPC11-X45-GTG1.7, and S194/15XX0Bul may be used; for rats, R210.RCY3, Y3-Ag1.2.3, IR983F, and 4B210 may be used; and U-266, GM1500-GRG2, LICR-LON-HMy2, and UC729-6 are all useful in conjunction with cell fusion.
- adjuvants may be used to enhance the immune response.
- adjuvants include, but are not limited to, Freund's adjuvant, minerals such as aluminum hydroxide, and surfactants such as lysolecithin, Pluronic® polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol.
- BCG Bacilli Calmette-Guerin
- Corynebacterium parvum may be useful human adjuvants.
- Antibodies may also be produced by inducing in vivo production in lymphocyte populations or by screening libraries or panels of highly specific recombinant immunoglobulins as disclosed by Orlandi et al. (Proc. Natl. Acad. Sci. 86:3833-3837; 1989) and Winter and Milstein (Nature, 349:293-299, 1991).
- phage display can be used to generate the antibodies of the present disclosure.
- standard molecular biology and recombinant DNA techniques see, e.g., Sambrook et al. (eds.), Molecular Cloning, A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, New York (2001)
- V antigen-binding variable domains of antibodies.
- Phages encoding variable regions with the desired specificity are selected for specific binding to the desired antigen, and complete or partial antibodies comprising the selected variable domains are reconstituted.
- the nucleic acid sequence encoding the reconstituted antibody is introduced into a suitable cell line, such as a myeloma cell used to generate hybridomas, so that the cells secrete antibodies with the characteristics of monoclonal antibodies (see, e.g., Janeway et al., supra, Huse et al., supra, and U.S. Pat. No. 6,265,150).
- a suitable cell line such as a myeloma cell used to generate hybridomas.
- Related methods are also described in U.S. Patent Nos. 5,403,484; 5,571,698; 5,837,500 and 5,702,892. It is contemplated that the techniques described in U.S. Patent Nos.
- Antibodies can be produced by transgenic mice transgenic for specific heavy and light chain immunoglobulin genes. Such methods are known in the art and described, for example, in U.S. Pat. Nos. 5,545,806, 5,569,825, and Janeway et al., supra.
- Humanized antibodies can also be produced using the antibody resurfacing method described in U.S. Pat. No. 5,639,641 and Pedersen et al., J. Mol. Biol., 235:959-973 (1994).
- a humanized antibody has one or more amino acid residues introduced into the CDR regions and/or framework regions from a source that is non-human. Humanization can be performed, for example, by substituting at least a portion of a rodent complementarity determining region (CDR) for the corresponding region of a human antibody using the methods described in Jones et al. (Nature, 321:522-525, 1986), Riechmann et al. (Nature, 332:323-327, 1988) and Verhoeyen et al. (Science, 239:1534-1536, 1988). Numerous techniques for preparing engineered antibodies are described, for example, in Owens and Young, J. Immunol. Meth. , 168:149-165 (1994). Further changes can then be introduced into the antibody framework to modulate affinity or immunogenicity.
- CDR rodent complementarity determining region
- the framework regions (FR) of the mouse antibody are humanized by substituting suitable human framework regions selected from a large database of human antibody variable sequences, including over 1200 human VH sequences and over 1000 VL sequences.
- the database of antibody sequences used for comparison is downloaded from Andrew C. R. Martin's KabatMan webpage (http://www.rubic.rdg.ac.uk/abs/).
- the Kabat method of identifying CDRs provides a means to delineate the approximate CDR and framework regions of a human antibody and to compare the mouse antibody sequences for similarity to determine the CDRs and FRs.
- the most matched human VH and VL sequences are selected based on high overall framework agreement, similar CDR lengths, and minimal mismatches of canonical and VH/VL contact residues.
- the human framework regions most similar to the mouse sequences are inserted between the mouse CDRs.
- the murine framework regions may be modified by making amino acid substitutions in whole or in part of the native framework regions that more closely resemble those of human antibodies.
- Nonpolar (hydrophobic) amino acids include alanine (Ala, A), leucine (Leu, L), isoleucine (Ile, I), valine (Val, V), proline (Pro, P), phenylalanine (Phe, F), tryptophan (Trp, W), and methionine (Met, M);
- polar neutral amino acids include glycine (Gly, G), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), tyrosine (Tyr, Y), asparagine (Asn, N), and glutamine (Gln, Q); positively charged (basic) amino acids include arginine (Arg, R), lysine (Lys, K), and histidine
- substitutions are preferably in the range of 1-25, 1-20, 1-15, 1-10, or 1-5. Mutations may be introduced by systematically making amino acid substitutions in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant mutants for activity. Nucleic acid changes can be made at sites where the nucleic acid differs from different species (variable positions) or in regions that are highly conserved (constant regions).
- the anti-IL13RA2 antibodies and antigen-binding fragments thereof of the present invention have high affinity for IL13RA2.
- the antibodies and antigen-binding fragments thereof recognize antigens expressed on the cell surface of cells expressing IL13RA2, demonstrating suitability for targeting IL13RA2-expressing tumor cells in vivo. Because they specifically recognize tumor cells expressing IL13RA2, side effects due to damage to normal cells can be reduced.
- the anti-IL13RA2 antibodies and antigen-binding fragments thereof are also expected to be effective and cost-effective in diagnostic imaging, delivery of antibody-radionuclide conjugates, bioassays for detection of IL13RA2 in various types of tumors overexpressing IL13RA2, and as carriers for therapeutic agents.
- the anti-IL13RA2 antibody and antigen-binding fragment thereof of the present invention in addition to having the above-mentioned affinity for IL13RA2, have the property of being internalized in tumor cells expressing IL13RA2, and therefore can reliably deliver therapeutic agents to target tumor cells. Therefore, the anti-IL13RA2 antibody and antigen-binding fragment thereof of the present invention, for example in the form of an ADC, can be effectively used as a drug delivery system (DDS). Since the therapeutic agent can be reliably delivered to the target tumor cells, it is expected that the therapeutic effect can be enhanced.
- DDS drug delivery system
- the present invention is a cell that produces an anti-IL13RA2 antibody or an antigen-binding fragment thereof.
- the cell is a hybridoma cell that has been internationally deposited on July 4, 2022 at the National Institute of Technology and Evaluation, Biotechnology Center, Patent Microorganisms Depositary (NPMD) (Address: Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan) under the accession number NITE BP-03673.
- NPMD Patent Microorganisms Depositary
- the present invention is a cell that produces an anti-IL13RA2 antibody or an antigen-binding fragment thereof, comprising a nucleic acid encoding an anti-IL13RA2 antibody or an antigen-binding fragment thereof, or a nucleic acid encoding the anti-IL13RA2 antibody or an antigen-binding fragment thereof.
- the present invention relates to a method for producing the aforementioned anti-IL13RA2 antibody or antigen-binding fragment thereof.
- the aforementioned cells are used in the production method.
- the present invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising the aforementioned anti-IL13RA2 antibody or an antigen-binding fragment thereof.
- the pharmaceutical composition comprises an antibody-drug conjugate (ADC) comprising the anti-IL13RA2 antibody or an antigen-binding fragment thereof. That is, the anti-IL13RA2 antibody or an antigen-binding fragment thereof is contained in the pharmaceutical composition in the form of an antibody-drug conjugate (ADC).
- ADC antibody-drug conjugate
- ADCs antibody-drug conjugates
- drugs that can exert a desired therapeutic effect e.g., anticancer drugs (e.g., low molecular weight compounds, proteins, etc.)
- compounds containing radioisotopes, liposomes, etc. and may be bound to substances that can be used as ADCs.
- the pharmaceutical composition is for treating a tumor expressing IL13RA2.
- the tumor is selected from the group consisting of melanoma, osteosarcoma, leukemia, lymphoma, prostate cancer, lung cancer (including malignant mesothelioma), glioma, head and neck cancer, renal cancer, Kaposi's sarcoma, colorectal cancer, pancreatic cancer, adrenal cancer, breast cancer, and ovarian cancer.
- the pharmaceutical composition containing the anti-IL13RA2 antibody or antigen-binding fragment thereof according to this embodiment may be applied with ingredients, formulations, administration forms, etc. known in the art for pharmaceutical compositions containing antibodies, and the matters described herein for pharmaceutical compositions containing herpes simplex virus may also be applied.
- DMEM Dulbecco's modified Eagle's medium
- FBS Thermo Fisher Scientific, MA, USA
- the monkey kidney cell line Vero (ATCC CCL-81) and the gD-complemented Vero cell subline VD60 (Ligas et al., J. Virol. 1988 May;62(5):1486-94.) were cultured in DMEM supplemented with 5% FBS.
- a subline (Vero-IL13RA2) in which human IL13RA2 was introduced into Vero was established by infecting Vero cells with a retroviral vector expressing human IL13RA2, which was prepared by transfecting PLAT-A cells with pMXc-puro-hIL13RA2, and then conducting drug selection using a medium containing 5% FBS-supplemented DMEM and 4 ⁇ g/mL puromycin (Thermo Fisher Scientific).
- pMXc-puro-hIL13RA2 was prepared by inserting the ORF of human IL13RA2 into the multicloning site of pMXc-puro (provided by Toshio Kitamura, University of Tokyo).
- Human malignant glioma cell line U87 (ATCC HTB-14) and its subline, and human malignant melanoma cell line RPMI7951 (ATCC HTB-66) were cultured in Eagle's minimum essential medium (E-MEM; FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) supplemented with 10% FBS.
- E-MEM Eagle's minimum essential medium
- U87 (+) and U87 (-) cells were established by separating the U87 cells into populations that bound and those that did not bind the anti-IL13RA2 antibody SHM38 (BioLegend, CA, USA) using a cell sorter FACSAria (BD Biosciences, NJ, USA).
- Mouse myeloma cell line P3U1 (ATCC CRL-1597) and human non-small cell lung cancer cell line H1299 (ATCC CRL-5803) were cultured in Roswell Park Memorial Institute 1640 medium (RPMI1640, Thermo Fisher Scientific) supplemented with 10% FBS.
- H1299 (+) and H1299 (-) cells were established from H1299 cells using the same method as U87 (+) and U87 (-) cells.
- Human umbilical vein endothelial cells (HUVEC) (PromoCell, Heidelberg, Germany) were cultured in Endothelial Cell Growth Medium 2 (PromoCell) or KBM VEC-1 (KOHJIN BIO, Saitama, Japan).
- J-13R2 cells were established by selecting J1.1-2 cells transfected with pcDNA3.1-puro-hIL13RA2 using a medium containing 10% FBS-supplemented DMEM and 16 ⁇ g/mL puromycin, and then isolating the IL13RA2 high expression population using FACSAria.
- pcDNA3.1-puro-hIL13RA2 was prepared by inserting the ORF of human IL13RA2 into the multicloning site of pcDNA3.1-puro, which was prepared by replacing the G418 resistance gene of pcDNA3.1 (Thermo Fisher Scientific) with a puromycin resistance gene.
- CHO-13R2 cells were established by selecting CHO-K1 cells transfected with pCAcc-puro-hIL13RA2 using 10% FBS-supplemented F-12K medium (Thermo Fisher Scientific) supplemented with 4 ⁇ g/mL puromycin, and then isolating the IL13RA2 high expression population using FACSAria.
- J-13R1/4R cells and CHO-13R1/4R cells were established by culturing J1.1-2 cells and CHO-K1 cells cotransfected with pCAcc-puro-hIL13RA1 and pCAcc-puro-hIL4R in the same manner as J-13R2 and CHO-13R2, selecting drugs, and then isolating the IL13RA1 and IL4R high expression population using FACSAria.
- pCAcc-puro-hIL13RA2, pCAcc-puro-hIL13RA1, and pCAcc-puro-hIL4R were constructed by inserting the ORFs of human IL13RA2, human IL13RA1, and human IL4R into the multicloning site of pCAcc-puro, which was constructed by inserting an expression cassette of a puromycin resistance gene into pCAcc (Yoshida et al., Biochem Biophys Res Commun. 230, 426-430 (1997)).
- A375 cells were harvested using 2 mM EDTA, washed with PBS (-), and then a cell suspension of 5 x 107 cells/mL was prepared using a hypotonic solution (20 mM Tris-HCl, 50 mM NaCl, 2 mM EDTA). The cells were disrupted on ice using a Dounce homogenizer, then centrifuged at 4°C, 1,000 xg for 10 minutes to collect the supernatant. The collected supernatant was centrifuged at 4°C, 80,000 xg for 1 hour, the supernatant was removed, and RPMI1640 was added and resuspended to prepare a cell membrane fraction solution.
- the cell membrane fraction solution prepared from 1 x 107 cells was subcutaneously administered to female BALB/c mice (Tokyo Laboratory Animals, Tokyo, Japan) together with 12 ⁇ g of AbISCO-100 (Funakoshi, Tokyo, Japan) a total of six times. Three days after the final administration, the mice were euthanized and the spleens were removed. The spleen cells and P3U1 cells were mixed and fused using polyethylene glycol (PEG1500, Roche, Basel, Switzerland).
- the hybridomas were cultured for 6 days using RPMI1640 medium supplemented with 10% Super Low IgG-FBS (Thermo Fisher Scientific), 1 ⁇ HAT Media Supplement Hybri-Max (Sigma, MO, USA), 5% Briclone (NICB, Dublin, Ireland) and 128 ⁇ M 2-mercaptoethanol (Nacalai Tesque, Kyoto, Japan), and then the medium was replaced.
- the culture supernatant was collected two days after the medium change, and the culture supernatant and 4 ⁇ g/mL antibody-bound diphtheria toxin (DT3C) (Yamaguchi, et al., Biochem Biophys Res Commun.
- hybridoma cells producing the 4E6 antibody are deposited internationally at the National Institute of Technology and Evaluation, Japan Patent Microorganism Depositary (NPMD) (Address: 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan) on July 4, 2022 under the accession number: NITE BP-03673.
- NPMD Japan Patent Microorganism Depositary
- RNA extracted from the 4E6 antibody-producing hybridoma using RNeasy Mini Kit (QIAGEN, CA, USA) as a template the light and heavy chains of the antibody gene were amplified by RT-PCR using SuperScript III One-step RT-PCR System with Platinum Taq High Fidelity DNA polymerase (Thermo Fisher Scientific).
- Primers 5'-GGAAGATCTGAYATTGTGMTSACMCARWCTMCA-3' (SEQ ID NO: 18) and 5'-CCGAATTCGGATACAGTTGGTGCAGCATC-3' (SEQ ID NO: 19) were used to amplify the light chain, and 5'-GGAAGATCTSARGTNMAGCTGSAGSAGTC-3' (SEQ ID NO: 20), 5'-GGAAGATCTSARGTNMAGCTGSAGSAGTCWGG-3' (SEQ ID NO: 21), and 5'-CCGAATTCATAGACAGATGGGGGTGTCGTTTTGGC-3' (SEQ ID NO: 22) were used to amplify the heavy chain (Wang et al., J Immunol Methods 233 2000. 167-177).
- telomere sequence a spacer sequence containing (Gly 4 Ser) 3 to construct scFv.
- Y represents T or C
- M represents A or C
- S represents G or C
- R represents G or A
- W represents A or T
- N represents A, G, C, or T.
- HSV-BAC recombination All HSV-BAC constructs used in this study were derived from KOS-37 BAC (provided by David Leib, Dartmouth Medical School) (Gierasch et al., J Virol Methods. 2006 Aug;135(2):197-206). All recombination procedures were based on the Red homologous recombination system (Tischer et al., Biotechniques. 2006 Feb;40(2):191-7.).
- pKGN-sc13R2, pKGN-IL13 and pKGN-IL13zr were prepared by modifying gD of pKGN in the same manner as previously reported, using transfer constructs prepared by PCR using pgD:224/Y38C-sc13R2kan, pgD:224/Y38C-IL13kan and pgD:dSP-32/V34S-IL13kan as templates (Shibata, et al., Gene Ther. 2016 23(6):479-88).
- pgD:224/Y38C-sc13R2kan, pgD:224/Y38C-IL13kan and pgD:dSP-32/V34S-IL13kan were prepared by inserting an I-SceI recognition sequence, a kanamycin resistance gene and a 50 bp homologous sequence for removing the kanamycin resistance gene into the AflII site of pgD:224/Y38C-sc13R2, pgD:224/Y38C-IL13 and pgD:dSP-32/V34S-IL13 in the same manner as previously reported (Shibata, et al., Gene Ther. 2016 23(6):479-88).
- pgD:224/Y38C-sc13R2 was prepared by inserting an scFv sequence constructed from a 4E6 antibody-producing hybridoma into the deletion region of the 2nd to 24th amino acids of gD of pgD:224/Y38C (Uchida, et al., Mol Ther. 2013 Mar;21(3):561-9.) in the same manner as previously reported (Shibata, et al., Gene Ther. 2016 23(6):479-88).
- pgD:224/Y38C-IL13 was prepared by inserting a BamHI fragment of DNA amplified with primers 5'-AAGAATTCGCTAGCGGTGGTGGTGGATCCGGCCCTGTGCCTCCCTCTA-3' (SEQ ID NO:23) and 5'-CCGGGATCCTGAACCTCCACCACCGTTGAACTGTCCCTCGCGAAAAAG-3' (SEQ ID NO:24) using pGEM-T Easy-hIL13 encoding the ORF of human IL13 as a template, into the deleted region from the 2nd to 24th amino acids of gD of pgD:224/Y38C.
- pgD:dSP-32/V34S-IL13 was synthesized by cloning the sequence from the AflII site to the BspEI site including the N-terminus of gD in pgD:224/Y38C using the IL13 ORF as a template, and primers 5'-CCCTTAAGGTCTCTTTTGTGTGGTGCGTTCCGGTATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCTTGGCGGCTTTGCCTCCCCAGGCCCTGTGCCTCCCTCTAC-3' (SEQ ID NO: 25) and 5'-TTGGATCCGGTACCGTTGAACTGTCCCTCGCGAAAAAGTT-3' (SEQ ID NO:26) and the ORF of wild-type gD as templates, and inserting a fragment from the BamHI site to the BspEI site of DNA amplified with primers 5'-ATCGGATCCCGGCGGCGCGTGTACCACATCCAGG-3' (SEQ ID NO:27) and
- pKGN-sc13R2-BhKt was prepared by modifying the anti-EGFR single-chain antibody-inserted gD of pKGNE-BhKt to 4E6-derived single-chain antibody-inserted gD in the same manner as in modifying pKGN to pKGN-sc13R2.
- KGN which has a double mutation in gB that promotes cell entry (gB:D285N/A549T), was used as previously reported (Shibata, et al., Gene Ther. 2016 23(6):479-88).
- KGN, KGN-IL13, and KGN-IL13zr used in Figures 2 and 3 were prepared by infecting VD60 cells with KGN or by cotransfecting pKGN-IL13 or pKGN-IL13zr with the Cre recombinase expression plasmid pxCANCre (provided by Izumu Saito, The University of Tokyo).
- Vero cells were infected with these viruses complemented with wild-type gD, and the remaining extracellular virus was inactivated by acidic treatment with glycine buffer at pH 3.0. The virus was then purified in a manner similar to that previously reported to prepare purified viruses from which wild-type gD derived from VD60 had been removed (Uchida, et al., J Virol. 2009 Apr;83(7):2951-61). Viral genome titers (gc/mL) were measured by qPCR for the gD gene as previously reported (Miyagawa et al., Proc Natl Acad Sci U S A. 2015 Mar 31;112(13):E1632-41.).
- KGN-IL13, KGN-sc13R2, and KGN-sc13R2-BhKt used in the examples other than those in Figures 2 and 3 were prepared by cotransfecting pKGN-IL13, pKGN-sc13R2, or pKGN-sc13R2-BhKt with pxCANCre into Vero-IL13RA2 cells. These viruses were monocloned by limiting dilution twice using Vero-IL13RA2. The removal of the BAC sequence from the monocloned clones was confirmed by the method previously reported (Miyagawa et al., Proc Natl Acad Sci U S A. 2015 Mar 31; 112 (13): E1632-41.).
- Flow cytometry analysis was performed using LSRFortessa (BD Biosciences). 4E6 antibody, mouse anti-IL13RA2 monoclonal antibody SHM38 (BioLegend), mouse anti-IL13RA1 monoclonal antibody GM-1E7 (Santa Cruz Biotechnology, Dallas, TX), mouse anti-IL4R monoclonal antibody G077F6 (BioLegend), and isotype-matched control antibodies MG1-45 and MOPC-173 (BioLegend) were used as primary antibodies. Alexa Fluor 488-labeled goat anti-mouse IgG (H+L) polyclonal antibody (Thermo Fisher Scientific) was used as secondary antibody.
- mice Animal experiments All animal experiments were approved by the Animal Experiment Committee of the University of Tokyo or Tokyo University of Pharmacy and Life Sciences, and were performed in compliance with the implementation regulations and implementation manuals of each institution. 6-8 week-old female severe combined immunodeficient mice SCID-Beige (CB17.Cg-Prkdc scid Lyst bg-J /CrlCrlj; Charles River Japan, Kanagawa, Japan) were subcutaneously transplanted into the left flank of the mice at 1 x 107 cells/100 ⁇ L.
- SCID-Beige CB17.Cg-Prkdc scid Lyst bg-J /CrlCrlj; Charles River Japan, Kanagawa, Japan
- mice When the average tumor volume reached approximately 290 mm 3 (U87 (+)) or approximately 150 mm 3 (H1299 (+)), the mice were grouped so that the average tumor volume was similar, and PBS or a virus solution suspended in PBS was administered intratumorally in a volume of 30 ⁇ L or intravenously in a volume of 200 ⁇ L.
- the tumor volume was calculated using the formula (long diameter ⁇ short diameter 2 )/2 (Tomayko et al., Cancer Chemother Pharmacol. 1989; 24 (3): 148-54.). Mice with tumor volumes exceeding 10% of body weight were considered to have died from the tumor and were euthanized.
- KGN-IL13 entered cells via IL13RA2, but hardly entered cells via HVEM or nectin-1.
- J1.1-2 cells a cell line lacking expression of the gD receptor, and sublines of J1.1-2 in which gD receptor or IL13RA2 was forcibly expressed (J-HVEM cells, J-nectin-1 cells, and J-13R2 cells) were infected with two IL-13-inserted HSVs (KGN-IL13 and KGN-IL13zr) and their parent strain, a non-targeted HSV (KGN) with a similar EGFP expression cassette and a mutation that enhances intracellular entry (gB:NT mutation). The presence or absence of intracellular entry of the virus was evaluated using the EGFP fluorescent signal 8 hours after the start of infection (Figure 2).
- KGN invaded the two types of cells expressing the gD receptor, but did not invade J1.1-2 or J-13R2 cells.
- KGN-IL13zr was detected to enter J-13R2 cells only at 300 gc/cell, although only slightly. However, while it was not detected to enter J-HVEM cells, it was detected to enter J-nectin-1 cells more than J-13R2 cells.
- Our observation is not consistent with the report by Zhou and Roizman, who reported that R5141, which has the same gD construct as the IL-13-inserted gD of KGN-IL13zr, hardly entered J-nectin-1 cells but entered J-13R2 cells.
- KGN-IL13 In contrast to KGN-IL13zr, KGN-IL13 penetrated J-13R2 cells more efficiently than KGN-IL13zr. Moreover, it was found that KGN-IL13 not only did not penetrate J-HVEM cells, but also that its penetration was hardly detectable in J-nectin-1 cells even at 300 gc/cell. Similar results were observed when using CHO-K1 cells and their sublines, which are another cell line lacking expression of gD receptors ( Figure 3). These results suggest that KGN-IL13 is more suitable for targeting IL13RA2 than KGN-IL13zr.
- KGN-IL13 also invaded IL13RA1-expressing cells, but KGN-sc13R2 specifically invaded only IL13RA2-expressing cells.
- IL-13 also binds to IL13RA1, although with lower affinity than IL13RA2. It has also been reported that when IL13RA1 forms a complex with IL4R (IL13RA1/IL4R), it binds with higher affinity than IL13RA1 alone. Therefore, we investigated whether IL13RA1/IL4R functions as a receptor for KGN-IL13. As a control virus, we created KGN-sc13R2 by inserting an anti-IL13RA2 single-chain antibody (sc13R2), which we independently produced using the method described below, into the same targeting gD platform as KGN-IL13.
- sc13R2 anti-IL13RA2 single-chain antibody
- a hybridoma cell library was prepared by fusing spleen cells extracted from mice immunized with a cell membrane fraction of the malignant melanoma cell line A375, which is known to express IL13RA2, with the mouse myeloma cell line P3U1.
- DT3C antibody-conjugated modified diphtheria toxin
- a protein extract was prepared from A375 cells, and immunoprecipitation was performed using the antibody (4E6 antibody) produced by this clone. Mass spectrometry analysis of the precipitate revealed the presence of peptide fragments thought to be derived from IL13RA2. Based on these results, the binding of the 4E6 antibody to CHO-K1 cells and a subline (CHO-13R2) in which IL13RA2 was forcibly expressed in CHO-K1 cells was confirmed by flow analysis, and the 4E6 antibody did not bind to CHO-K1 cells, but did bind to CHO-13R2 cells. From these results, it was determined that the antigen of the 4E6 antibody is IL13RA2.
- KGN-sc13R2 was constructed by cloning the antibody gene from a hybridoma producing the 4E6 antibody and incorporating a gD mutant in which the scFv sequence derived from that sequence was inserted into the targeting gD platform.
- J-HVEM and J-nectin-1 cells used in Figure 2 an entry assay was performed using a substrain (J-13R1/4R) in which IL13RA1/IL4R was forcibly expressed in J1.1-2, and the specificity of intracellular entry of KGN-sc13R2 was compared with that of KGN-IL13 ( Figure 4). Both KGN-IL13 and KGN-sc13R2 entered J-13R2 cells, but of these two viruses, only KGN-IL13 was observed to enter J-13R1/4R cells. Furthermore, at an MOI of 10, KGN-IL13 entered J-nectin-1 cells only slightly, whereas KGN-sc13R2 did not enter at all.
- KGN-IL13 uses not only IL13RA2 but also IL13RA1/IL4R as receptors for intracellular entry, while KGN-sc13R2 uses only IL13RA2 as a receptor for intracellular entry.
- KGN-IL13 killed vascular endothelial cells, but KGN-sc13R2 did not show cytotoxicity.
- Vascular endothelial cells are one of the normal cells with which the virus is thought to come into contact immediately after intravenous administration of oHSV. Therefore, we compared the infectivity of KGN-IL13 and KGN-sc13R2 to vascular endothelial cells.
- IL-13 receptor and IL4R human umbilical vein endothelial cells (HUVEC) was examined by flow analysis. As a result, anti-IL13RA1 antibody and anti-IL4R antibody bound to HUVEC, but anti-IL13RA2 antibody did not bind to HUVEC ( Figure 6(a)). This result suggests that IL13RA1 and IL4R are expressed in HUVEC, but IL13RA2 is not expressed.
- KGN-IL13 penetrates HUVEC and shows cytotoxicity.
- KGN penetrated HUVEC with the highest efficiency among the three viruses used in the study and showed remarkable cytotoxicity ( Figure 6(b) and Figure 6(c)).
- KGN-IL13 penetrated HUVEC and showed cytotoxicity under conditions where the virus was added at a relatively high MOI.
- KGN-sc13R2 did not penetrate HUVEC or show cytotoxicity even under conditions where the virus was added at the maximum MOI in each experiment.
- KGN-sc13R2 penetrated into Vero-IL13RA2 cells used as a positive control with the same efficiency as KGN-IL13 and showed the same or higher cytotoxicity.
- KGN-sc13R2 invaded and spread only to cells expressing IL13RA2
- the 4E6 antibody bound to U87 (+), H1299 (+) and RPMI7951 cells, but did not bind to U87 (-), H1299 (-) and A2058 cells.
- RRsyn-oHSV virus in which mutations that induce the formation of multinucleated giant cells in infected cells (synchronous mutations) were incorporated into two different glycoproteins, gB and gK, of RR-oHSV (Okubo et al., J Virol. 2016 Nov 28; 90(24):11096-11105.).
- synchronous mutations gB: R858H/gK: A40T, BhKt
- KGN-sc13R2-BhKt by introducing BhKt into KGN-sc13R2 and compare its target specificity and infection efficiency with those of KGN-sc13R2.
- the plaque area in IL13RA2-positive cancer cell lines was compared.
- the plaque area in all IL13RA2-positive cancer cell lines was significantly larger in KGN-sc13R2-BhKt than in KGN-sc13R2 (approximately 7 times in U87 (+) cells, approximately 50 times in H1299 (+) cells, and approximately 9 times in RPMI7951 cells), suggesting that KGN-sc13R2-BhKt can spread more efficiently than KGN-sc13R2 (FIG. 9(a)).
- KGN-sc13R2-BhKt showed lower ED50 values than KGN-sc13R2 in all cell lines (approximately 1/4 in U87 (+) cells, approximately 1/200 in H1299 (+) cells, and approximately 1/10 in RPMI7951 cells), suggesting that KGN-sc13R2-BhKt has a higher cytotoxicity than KGN-sc13R2 ( Figure 9(b)).
- KGN-sc13R2-BhKt is believed to be the virus that can achieve the highest level of both safety and efficacy among the IL13RA2-targeted RR-oHSVs examined in this study.
- KGN-sc13R2-BhKt exerted a strong antitumor effect against IL13RA2-positive tumors in vivo.
- KGN-sc13R2-BhKt has high targeting specificity for IL13RA2 and could be a potential cancer treatment that exerts a strong antitumor effect.
- the anti-IL13RA2 single-chain antibody-inserted gD mutant achieved intracellular entry only via IL13RA2, without achieving intracellular entry via IL13RA1/IL4R.
- the BhKt mutation enhanced the plaque-forming and cytotoxic abilities of KGN-sc13R2 without losing infection specificity. It was revealed that KGN-sc13R2-BhKt exerts an antitumor effect when administered intratumorally to tumor-bearing mouse models of multiple IL13RA2-positive human cancer cell lines, and also exerts a strong antitumor effect when administered intravenously.
- KGN-IL13 entered cells expressing IL13RA1, revealing that IL13RA1 functions as an HSV receptor when IL-13 is used as a cancer targeting module inserted into gD.
- IL-13 functions as an HSV receptor when IL-13 is used as a cancer targeting module inserted into gD.
- Several research groups have suggested that the binding ability of IL-13 to IL13RA1 may be reduced by introducing amino acid mutations such as E13K or E13Y into IL-13 (Debinski, et al., Nat Biotechnol. 1998 May;16(5):449-53.; Kahlon, et al., Cancer Res. 2004 Dec 15;64(24):9160-6.).
- RR-oHSV is created in which IL-13 with these mutations is incorporated into gD as a cancer targeting module, it may be possible to avoid infection of normal cells expressing IL13RA1.
- the virus may acquire a mutation that restores its ability to bind to IL13RA1 during proliferation, resulting in the spread of infection to normal cells expressing IL13RA1. From this perspective, it is believed that anti-IL13RA2 single-chain antibodies are more suitable than IL-13 as a cancer targeting module for developing RR-oHSV that specifically targets IL13RA2.
- KGN-sc13R2-BhKt exerted an antitumor effect on immunodeficient cancer-bearing mice by a single administration of a very small amount of virus, 10 2 pfu, without any obvious toxicity. Therefore, it was suggested that KGN-sc13R2-BhKt could be a highly effective and safe cancer treatment drug not only by intratumoral administration but also by intravenous administration. This characteristic is considered to be particularly beneficial in treating cancer patients with distant metastasis.
- Example 2 A virus (KG ⁇ N-sc13R2-BhKt) in which the ICP34.5 gene of KGN-sc13R2-BhKt prepared in Example 1 was deleted was further prepared.
- a method for preparing a virus in which the ICP34.5 gene of the parent virus KGN-sc13R2-BhKt is deleted can be carried out with reference to the method described in International Publication No. 2020/090871. Specifically, since there are two copies of the ICP34.5 gene on the herpesvirus genome, the deletion operation of the two copies was performed in two stages, one copy at a time, using the method described in detail in Suzuki et al. (Mol Ther Oncolytics. 2021; 22: 265-276.).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Virology (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Hematology (AREA)
- Oncology (AREA)
- Epidemiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2024550507A JPWO2024071397A1 (https=) | 2022-09-30 | 2023-09-29 | |
| EP23872616.0A EP4596687A1 (en) | 2022-09-30 | 2023-09-29 | Il13ra2-targeting herpes simplex virus and anti-il13ra2 antibody or antigen-binding fragment thereof |
| CN202380078878.4A CN120882864A (zh) | 2022-09-30 | 2023-09-29 | 靶向il13ra2的单纯疱疹病毒及抗il13ra2抗体或其抗原结合片段 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2022159009 | 2022-09-30 | ||
| JP2022-159009 | 2022-09-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2024071397A1 true WO2024071397A1 (ja) | 2024-04-04 |
Family
ID=90478148
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2023/035689 Ceased WO2024071397A1 (ja) | 2022-09-30 | 2023-09-29 | Il13ra2に標的化した単純ヘルペスウイルス及び抗il13ra2抗体またはその抗原結合断片 |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP4596687A1 (https=) |
| JP (1) | JPWO2024071397A1 (https=) |
| CN (1) | CN120882864A (https=) |
| WO (1) | WO2024071397A1 (https=) |
Citations (42)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2188638A (en) | 1986-03-27 | 1987-10-07 | Gregory Paul Winter | Chimeric antibodies |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| WO1991002788A1 (en) | 1989-08-15 | 1991-03-07 | British Technology Group Plc | Herpes simplex virus type 1 mutant |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US5399363A (en) | 1991-01-25 | 1995-03-21 | Eastman Kodak Company | Surface modified anticancer nanoparticles |
| US5403484A (en) | 1988-09-02 | 1995-04-04 | Protein Engineering Corporation | Viruses expressing chimeric binding proteins |
| US5466468A (en) | 1990-04-03 | 1995-11-14 | Ciba-Geigy Corporation | Parenterally administrable liposome formulation comprising synthetic lipids |
| WO1996004394A1 (en) | 1994-07-29 | 1996-02-15 | British Technology Group Ltd. | Hsv viral vector |
| US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5639641A (en) | 1992-09-09 | 1997-06-17 | Immunogen Inc. | Resurfacing of rodent antibodies |
| US5641515A (en) | 1995-04-04 | 1997-06-24 | Elan Corporation, Plc | Controlled release biodegradable nanoparticles containing insulin |
| US5658724A (en) | 1992-07-31 | 1997-08-19 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains deficient for the essential immediate early genes ICP4 and ICP27 and methods for their production, growth and use |
| US5702892A (en) | 1995-05-09 | 1997-12-30 | The United States Of America As Represented By The Department Of Health And Human Services | Phage-display of immunoglobulin heavy chain libraries |
| US5714352A (en) | 1996-03-20 | 1998-02-03 | Xenotech Incorporated | Directed switch-mediated DNA recombination |
| US5725871A (en) | 1989-08-18 | 1998-03-10 | Danbiosyst Uk Limited | Drug delivery compositions comprising lysophosphoglycerolipid |
| WO1998015637A1 (en) | 1996-05-22 | 1998-04-16 | The University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains |
| US5756353A (en) | 1991-12-17 | 1998-05-26 | The Regents Of The University Of California | Expression of cloned genes in the lung by aerosol-and liposome-based delivery |
| US5780279A (en) | 1990-12-03 | 1998-07-14 | Genentech, Inc. | Method of selection of proteolytic cleavage sites by directed evolution and phagemid display |
| US5780045A (en) | 1992-05-18 | 1998-07-14 | Minnesota Mining And Manufacturing Company | Transmucosal drug delivery device |
| US5804212A (en) | 1989-11-04 | 1998-09-08 | Danbiosyst Uk Limited | Small particle compositions for intranasal drug delivery |
| US5821047A (en) | 1990-12-03 | 1998-10-13 | Genentech, Inc. | Monovalent phage display |
| US5849571A (en) | 1990-10-10 | 1998-12-15 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Latency active herpes virus promoters and their use |
| US5849572A (en) | 1990-10-10 | 1998-12-15 | Regents Of The University Of Michigan | HSV-1 vector containing a lat promoter |
| US5855885A (en) | 1993-01-22 | 1999-01-05 | Smith; Rodger | Isolation and production of catalytic antibodies using phage technology |
| US5858657A (en) | 1992-05-15 | 1999-01-12 | Medical Research Council | Methods for producing members of specific binding pairs |
| WO1999006583A1 (en) | 1997-07-31 | 1999-02-11 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Targeted hsv vectors |
| US5871907A (en) | 1991-05-15 | 1999-02-16 | Medical Research Council | Methods for producing members of specific binding pairs |
| US5879934A (en) | 1992-07-31 | 1999-03-09 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains for gene transfer |
| US5969108A (en) | 1990-07-10 | 1999-10-19 | Medical Research Council | Methods for producing members of specific binding pairs |
| US5998174A (en) | 1997-05-12 | 1999-12-07 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Multigene vectors |
| US6057098A (en) | 1997-04-04 | 2000-05-02 | Biosite Diagnostics, Inc. | Polyvalent display libraries |
| US6225447B1 (en) | 1991-05-15 | 2001-05-01 | Cambridge Antibody Technology Ltd. | Methods for producing members of specific binding pairs |
| US6261552B1 (en) | 1997-05-22 | 2001-07-17 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus vectors |
| US6265150B1 (en) | 1995-06-07 | 2001-07-24 | Becton Dickinson & Company | Phage antibodies |
| US20020197266A1 (en) | 2000-02-08 | 2002-12-26 | Waldemar Debinski | Immunotherapy using interleukin 13 receptor subunit alpha 2 |
| JP2006528484A (ja) | 2003-07-25 | 2006-12-21 | バイオヴェックス リミテッド | ウイルスベクター |
| JP2016503295A (ja) * | 2012-11-07 | 2016-02-04 | ファイザー・インク | 抗il−13受容体アルファ2抗体および抗体−薬物コンジュゲート |
| WO2020090871A1 (ja) | 2018-10-30 | 2020-05-07 | 国立大学法人東京大学 | がん治療のための腫瘍溶解性ウイルス |
| WO2021041725A1 (en) * | 2019-08-27 | 2021-03-04 | The Trustees Of The Univeristy Of Pennsylvania | SYNTHETIC CARS TO TREAT IL13Rα2 POSITIVE HUMAN AND CANINE TUMORS |
-
2023
- 2023-09-29 EP EP23872616.0A patent/EP4596687A1/en active Pending
- 2023-09-29 WO PCT/JP2023/035689 patent/WO2024071397A1/ja not_active Ceased
- 2023-09-29 JP JP2024550507A patent/JPWO2024071397A1/ja active Pending
- 2023-09-29 CN CN202380078878.4A patent/CN120882864A/zh active Pending
Patent Citations (51)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0239400B1 (en) | 1986-03-27 | 1994-08-03 | Medical Research Council | Recombinant antibodies and methods for their production |
| GB2188638A (en) | 1986-03-27 | 1987-10-07 | Gregory Paul Winter | Chimeric antibodies |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5571698A (en) | 1988-09-02 | 1996-11-05 | Protein Engineering Corporation | Directed evolution of novel binding proteins |
| US5403484A (en) | 1988-09-02 | 1995-04-04 | Protein Engineering Corporation | Viruses expressing chimeric binding proteins |
| US5837500A (en) | 1988-09-02 | 1998-11-17 | Dyax, Corp. | Directed evolution of novel binding proteins |
| US5693762A (en) | 1988-12-28 | 1997-12-02 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5693761A (en) | 1988-12-28 | 1997-12-02 | Protein Design Labs, Inc. | Polynucleotides encoding improved humanized immunoglobulins |
| WO1991002788A1 (en) | 1989-08-15 | 1991-03-07 | British Technology Group Plc | Herpes simplex virus type 1 mutant |
| US5837532A (en) | 1989-08-15 | 1998-11-17 | British Technology Group Limited | Herpes simplex cirus type 1 mutant |
| US5725871A (en) | 1989-08-18 | 1998-03-10 | Danbiosyst Uk Limited | Drug delivery compositions comprising lysophosphoglycerolipid |
| US5804212A (en) | 1989-11-04 | 1998-09-08 | Danbiosyst Uk Limited | Small particle compositions for intranasal drug delivery |
| US5466468A (en) | 1990-04-03 | 1995-11-14 | Ciba-Geigy Corporation | Parenterally administrable liposome formulation comprising synthetic lipids |
| US5969108A (en) | 1990-07-10 | 1999-10-19 | Medical Research Council | Methods for producing members of specific binding pairs |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5849571A (en) | 1990-10-10 | 1998-12-15 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Latency active herpes virus promoters and their use |
| US5849572A (en) | 1990-10-10 | 1998-12-15 | Regents Of The University Of Michigan | HSV-1 vector containing a lat promoter |
| US5821047A (en) | 1990-12-03 | 1998-10-13 | Genentech, Inc. | Monovalent phage display |
| US5780279A (en) | 1990-12-03 | 1998-07-14 | Genentech, Inc. | Method of selection of proteolytic cleavage sites by directed evolution and phagemid display |
| US5399363A (en) | 1991-01-25 | 1995-03-21 | Eastman Kodak Company | Surface modified anticancer nanoparticles |
| US5871907A (en) | 1991-05-15 | 1999-02-16 | Medical Research Council | Methods for producing members of specific binding pairs |
| US6225447B1 (en) | 1991-05-15 | 2001-05-01 | Cambridge Antibody Technology Ltd. | Methods for producing members of specific binding pairs |
| US5756353A (en) | 1991-12-17 | 1998-05-26 | The Regents Of The University Of California | Expression of cloned genes in the lung by aerosol-and liposome-based delivery |
| US5858657A (en) | 1992-05-15 | 1999-01-12 | Medical Research Council | Methods for producing members of specific binding pairs |
| US5780045A (en) | 1992-05-18 | 1998-07-14 | Minnesota Mining And Manufacturing Company | Transmucosal drug delivery device |
| US5879934A (en) | 1992-07-31 | 1999-03-09 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains for gene transfer |
| US5804413A (en) | 1992-07-31 | 1998-09-08 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains for gene transfer |
| US5658724A (en) | 1992-07-31 | 1997-08-19 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains deficient for the essential immediate early genes ICP4 and ICP27 and methods for their production, growth and use |
| US5639641A (en) | 1992-09-09 | 1997-06-17 | Immunogen Inc. | Resurfacing of rodent antibodies |
| US5855885A (en) | 1993-01-22 | 1999-01-05 | Smith; Rodger | Isolation and production of catalytic antibodies using phage technology |
| US5543158A (en) | 1993-07-23 | 1996-08-06 | Massachusetts Institute Of Technology | Biodegradable injectable nanoparticles |
| WO1996004394A1 (en) | 1994-07-29 | 1996-02-15 | British Technology Group Ltd. | Hsv viral vector |
| US5641515A (en) | 1995-04-04 | 1997-06-24 | Elan Corporation, Plc | Controlled release biodegradable nanoparticles containing insulin |
| US5824520A (en) | 1995-05-09 | 1998-10-20 | The United States Of America As Represented By The Department Of Health And Human Services | Phage-display of immunoglobulin heavy chain libraries for identification of inhibitors of intracellular constituents |
| US5702892A (en) | 1995-05-09 | 1997-12-30 | The United States Of America As Represented By The Department Of Health And Human Services | Phage-display of immunoglobulin heavy chain libraries |
| US6265150B1 (en) | 1995-06-07 | 2001-07-24 | Becton Dickinson & Company | Phage antibodies |
| US5714352A (en) | 1996-03-20 | 1998-02-03 | Xenotech Incorporated | Directed switch-mediated DNA recombination |
| WO1998015637A1 (en) | 1996-05-22 | 1998-04-16 | The University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains |
| US7078029B2 (en) | 1996-05-22 | 2006-07-18 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus strains |
| US6057098A (en) | 1997-04-04 | 2000-05-02 | Biosite Diagnostics, Inc. | Polyvalent display libraries |
| US5998174A (en) | 1997-05-12 | 1999-12-07 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Multigene vectors |
| US6261552B1 (en) | 1997-05-22 | 2001-07-17 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Herpes simplex virus vectors |
| WO1999006583A1 (en) | 1997-07-31 | 1999-02-11 | University Of Pittsburgh Of The Commonwealth System Of Higher Education | Targeted hsv vectors |
| US20020197266A1 (en) | 2000-02-08 | 2002-12-26 | Waldemar Debinski | Immunotherapy using interleukin 13 receptor subunit alpha 2 |
| JP2006528484A (ja) | 2003-07-25 | 2006-12-21 | バイオヴェックス リミテッド | ウイルスベクター |
| JP2016503295A (ja) * | 2012-11-07 | 2016-02-04 | ファイザー・インク | 抗il−13受容体アルファ2抗体および抗体−薬物コンジュゲート |
| WO2020090871A1 (ja) | 2018-10-30 | 2020-05-07 | 国立大学法人東京大学 | がん治療のための腫瘍溶解性ウイルス |
| WO2021041725A1 (en) * | 2019-08-27 | 2021-03-04 | The Trustees Of The Univeristy Of Pennsylvania | SYNTHETIC CARS TO TREAT IL13Rα2 POSITIVE HUMAN AND CANINE TUMORS |
Non-Patent Citations (99)
| Title |
|---|
| "GenBank", Database accession no. JQ673480.1 |
| "NCBI", Database accession no. NC_001806 |
| ADUSUMILLI ET AL., FASEB J, vol. 20, 2006, pages 726 - 728 |
| AKAIWA ET AL., CYTOKINE, vol. 13, no. 2, 21 January 2001 (2001-01-21), pages 75 - 84 |
| ANDREWS ET AL., J BIOL CHEM, vol. 277, no. 48, 29 November 2002 (2002-11-29), pages 46073 - 8 |
| ATANASIU ET AL., J VIROL, vol. 84, 2010, pages 12200 - 12209 |
| ATANASIU ET AL., MBIO, 2013 |
| ATANASIU ET AL., PROC NATL ACAD SCI, 2007 |
| BALYASNIKOVA ET AL., J BIOL CHEM, vol. 287, no. 36, 31 August 2012 (2012-08-31), pages 30215 - 27 |
| BEARD ET AL., CLIN CANCER RES, vol. 19, no. 18, 15 September 2013 (2013-09-15), pages 4941 - 50 |
| CA. JANEWAY ET AL.: "Immunobiology", 2001, GARLAND PUBLISHING |
| CANCER GENE THER, vol. 17, no. 9, 2010, pages 655 - 663 |
| CARFI ET AL., MOL CELL, 2001 |
| CHOU ET AL., SCIENCE, vol. 250, 1990, pages 1262 - 1266 |
| CHOWDARY ET AL., NAT STRUCT MOL BIOL, 2010 |
| COLE ET AL.: "Monoclonal Antibodies and Cancer Therapy", ALAN R LISS INC, 1985, pages 77 - 96 |
| CONNOLLY ET AL., J VIROL, vol. 79, 2005, pages 1282 - 1295 |
| COTE ET AL., PROC. NATL. ACAD. SCI., vol. 80, 1983, pages 2026 - 2030 |
| DAVID JOHNSON, OREGON HEALTH AND SCIENCE UNIVERSITY |
| DEBINSKI ET AL., NAT BIOTECHNOL, vol. 16, no. 5, May 1998 (1998-05-01), pages 449 - 53 |
| DMITRIEVA ET AL., CLIN CANCER RES, vol. 17, 2011, pages 1362 - 1372 |
| EVEN ET AL., VIRUS RES, vol. 119, no. 2, 2006, pages 195 |
| FUKUHARA, TAKESHI ET AL.: "3LBA-057: Melanoma molecular target IL13Ra2 discovered using unique targeted antibody discovery technology", PROGRAMS AND LECTURE ABSTRACTS OF THE 86TH ANNUAL MEETING OF THE JAPANESE BIOCHEMICAL SOCIETY; SEPTEMBER 11-13, 2013, JAPANESE BIOCHEMICAL SOCIETY, JP, 1 January 2013 (2013-01-01) - 13 September 2013 (2013-09-13), JP, pages 3T19a - 11, XP009553755 * |
| FUSCO ET AL., PROC NATL ACAD SCI, 2005 |
| GERAGHTY ET AL., SCIENCE, 1998 |
| GESKIN ET AL., BLOOD, vol. 125, no. 18, 30 April 2015 (2015-04-30), pages 2798 - 805 |
| GIANNI ET AL., J BIOL CHEM, 2009 |
| GIERASCH ET AL., J VIROL METHODS, vol. 135, no. 2, August 2006 (2006-08-01), pages 197 - 206 |
| HASKARDARCHER, J., IMMUNOL. METHODS, vol. 74, no. 2, 1984, pages 361 - 67 |
| HIROAKI UCHIDA, MARCO MARZULLI, KENJI NAKANO, WILLIAM F GOINS, JANET CHAN, CHANG-SOOK HONG, LUCIA MAZZACURATI, JI YOUNG YOO, AMY H: "Effective Treatment of an Orthotopic Xenograft Model of Human Glioblastoma Using an EGFR-retargeted Oncolytic Herpes Simplex Virus", MOLECULAR THERAPY, ELSEVIER INC., US, vol. 21, no. 3, 1 March 2013 (2013-03-01), US , pages 561 - 569, XP055239489, ISSN: 1525-0016, DOI: 10.1038/mt.2012.211 * |
| HUSE ET AL., SCIENCE, vol. 246, 1989, pages 1275 - 81 |
| IKEDA ET AL., J VIROL, vol. 95, no. 9, 12 April 2021 (2021-04-12), pages 01766 - 20 |
| JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525 |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1987, DEPARTMENT OF HEALTH AND HUMAN SERVICES |
| KAHLON ET AL., CANCER RES, vol. 64, no. 24, 15 December 2004 (2004-12-15), pages 9160 - 6 |
| KOEHLERMILSTEIN, NATURE, vol. 256, 1975, pages 495 - 497 |
| KORTT ET AL., BIOMOL. ENG., vol. 18, 2001, pages 95 - 108 |
| KOSBOR ET AL., IMMUNOL. TODAY, vol. 4, 1983, pages 72 |
| KRUMMENACHER ET AL., EMBO J, 2005 |
| KUNWAR ET AL., J CLIN ONCOL, vol. 25, no. 7, 1 March 2007 (2007-03-01), pages 837 - 44 |
| LI ET AL., CANCER GENE THER, vol. 20, 2013, pages 478 - 485 |
| LIGAS ET AL., J VIROL., vol. 62, no. 5, May 1988 (1988-05-01), pages 1486 - 94 |
| LIU ET AL., GENE THER, vol. 10, 2003, pages 292 - 303 |
| LIU ET AL., MOL CANCER THER, vol. 2, no. 8, August 2003 (2003-08-01), pages 783 - 7 |
| LIU ET AL., MOL THER, vol. 14, 2006, pages 789 - 797 |
| LUPARDUS ET AL., STRUCTURE, vol. 18, no. 3, 10 March 2010 (2010-03-10), pages 332 - 42 |
| MACLEAN ET AL., J. GEN. VIROL., vol. 72, 1991, pages 631 - 639 |
| MCGOECHETAL., J. GEN. VIROL, vol. 69, 1988, pages 1531 |
| MENOTTI ET AL., J VIROL, vol. 82, 2008, pages 10153 - 10161 |
| MENOTTI ET AL., PROC NATL ACAD SCI, vol. 106, 2009, pages 9039 - 9044 |
| MENOTTIAVITABILE, INT J MOL SCI, vol. 21, no. 21, 5 November 2020 (2020-11-05), pages 8310 |
| MINETA ET AL., NAT MED, vol. 1, 1995, pages 938 - 943 |
| MIYAGAWA ET AL., PROC NATL ACAD SCI, vol. 112, no. 13, 31 March 2015 (2015-03-31), pages 1632 - 41 |
| MONTGOMERY ET AL., CELL, 1996 |
| MORRISON ET AL., PROC. NATL. ACAD. SCI., vol. 81, 1984, pages 6851 - 6855 |
| MOY, DIBLASIO ET AL., J MOL BIOL, vol. 310, 2001, pages 219 - 30 |
| NAKAMORI ET AL., CLIN CANCER RES, vol. 9, 2003, pages 2727 - 2733 |
| NAKAMURA ET AL., CANCER RES, vol. 61, 2001, pages 5447 - 5452 |
| NEUBERGER ET AL., NATURE, vol. 312, 1984, pages 604 - 608 |
| OKUBO ET AL., J VIROL, vol. 90, no. 24, 2016, pages 11096 - 11105 |
| OKUBO ET AL., J VIROL., vol. 90, no. 24, 28 November 2016 (2016-11-28), pages 11096 - 11105 |
| ORLANDI ET AL., PROC. NATL. ACAD. SCI., vol. 86, 1989, pages 3833 - 3837 |
| OWENSYOUNG, J. IMMUNOL. METH., vol. 168, 1994, pages 149 - 165 |
| PEDERSEN ET AL., J. MOL. BIOL., vol. 235, 1994, pages 959 - 973 |
| PETERS ET AL., MOL THER ONCOLYTICS, vol. 2, 22 July 2015 (2015-07-22), pages 15010 |
| PLOS PATHOG, vol. 11, no. 5, 2015, pages 1004907 |
| PLOS PATHOG, vol. 13, no. 4, 2017, pages 1006352 |
| REITER ET AL., PROTEIN ENGINEERING, vol. 7, 1994, pages 697 - 704 |
| RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 327 |
| RODER ET AL., METHODS ENZYMOL, vol. 121, 1986, pages 140 - 67 |
| ROTH ET AL., THER CLIN DEV, vol. 25, 2014, pages 16 - 27 |
| SHIBATA ET AL., GENE THER, vol. 23, no. 6, 2016, pages 479 - 488 |
| SHUKLA ET AL., CELL, 1999 |
| SIMPSON ET AL., CANCER RES, vol. 66, 2006, pages 4835 - 4842 |
| SIVAPRASAD ET AL., J IMMUNOL, vol. 185, no. 11, 2010, pages 6802 |
| SPEAR ET AL., VIROLOGY, vol. 344, 2006, pages 17 - 24 |
| SUZUKI ET AL., MOL THER ONCOLYTICS, vol. 22, 2021, pages 265 - 276 |
| TAKEDA ET AL., NATURE, vol. 314, 1985, pages 452 - 454 |
| TAMURA ET AL., MOL THER, vol. 21, 2013, pages 68 - 77 |
| TISCHER ET AL., BIOTECHNIQUES, vol. 40, no. 2, 2006, pages 191 |
| TISCHER ET AL., BIOTECHNIQUES, vol. 40, no. 2, February 2006 (2006-02-01), pages 191 - 7 |
| TODOROVSKA ET AL., J. IMMUNOL METHODS, vol. 248, 2001, pages 47 - 66 |
| TOMAYKO ET AL., CANCER CHEMOTHER PHARMACOL, vol. 24, no. 3, 1989, pages 148 - 54 |
| UCHIDA ET AL., CURR CANCER DRUG TARGETS, vol. 18, no. 2, 2018, pages 162 - 170 |
| UCHIDA ET AL., J VIROL, vol. 83, 2009, pages 2951 - 2961 |
| UCHIDA ET AL., J VIROL, vol. 83, no. 7, April 2009 (2009-04-01), pages 2951 - 61 |
| UCHIDA ET AL., J VIROL, vol. 87, no. 3, February 2013 (2013-02-01), pages 1430 - 42 |
| UCHIDA ET AL., MOL THER, vol. 21, no. 3, March 2013 (2013-03-01), pages 561 - 9 |
| VERHOEYENET, SCIENCE, vol. 239, 1988, pages 1534 - 1536 |
| WANG ET AL., J IMMUNOL METHODS, vol. 233, 2000, pages 167 - 177 |
| WINTERMILSTEIN, NATURE, vol. 349, 1991, pages 293 - 299 |
| YAMAGUCHI ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 454, no. 4, 28 November 2014 (2014-11-28), pages 600 - 3 |
| YAMAGUCHI, M.HAMADA, H. ET AL.: "Biochemical", BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 454, 2014, pages 600 - 603 |
| YAMAMOTO ET AL., GENE THER, vol. 13, 2006, pages 1731 - 1736 |
| YOON ET AL., J VIROL, vol. 77, 2003, pages 9221 - 9231 |
| YOONSPEAR, PROC NATL ACAD SCI, vol. 101, 2004, pages 17252 - 17257 |
| YOSHIDA ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 230, 1997, pages 426 - 430 |
| ZHANG ET AL., MOL THER, vol. 20, 2012, pages 37 - 45 |
| ZHOUROIZMAN, PROC NATL ACAD SCI, vol. 103, no. 14, 4 April 2006 (2006-04-04), pages 5508 - 13 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4596687A1 (en) | 2025-08-06 |
| CN120882864A (zh) | 2025-10-31 |
| JPWO2024071397A1 (https=) | 2024-04-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7146852B2 (ja) | 腫瘍溶解性ウイルスと免疫チェックポイントモジュレーターとの組合せ | |
| US10273306B2 (en) | Antibodies directed against ICOS for treating graft-versus-host disease | |
| CN107683289B (zh) | IL13Rα2结合剂和其在癌症治疗中的用途 | |
| US20240229069A9 (en) | Modified orthopoxvirus vectors | |
| JP6960947B2 (ja) | 生体外での効率的な定向増幅用のキメラ抗原受容体及びその適用 | |
| JP2021006048A (ja) | 免疫チェックポイントモジュレーターの発現用腫瘍溶解性ウイルス | |
| US20250269026A1 (en) | Chimeric antigen receptor which specifically binds to msln, and application thereof | |
| WO2019066435A2 (ko) | Bcma에 높은 친화도를 가지는 항-bcma 항체 및 이를 포함하는 암 치료용 약학적 조성물 | |
| US20220265847A1 (en) | Methods and compositions for treating non-small cell lung cancer | |
| JP2024539630A (ja) | 抗steap2キメラ抗原受容体及びその使用 | |
| US20240226207A1 (en) | Universal retargeting of oncolytic hsv | |
| WO2024071397A1 (ja) | Il13ra2に標的化した単純ヘルペスウイルス及び抗il13ra2抗体またはその抗原結合断片 | |
| TWI793714B (zh) | 結合人cd38的抗體、其製備方法和用途 | |
| WO2024128219A1 (ja) | キメラ抗原受容体 | |
| US20240050567A1 (en) | Modified immune effector cell and use thereof | |
| JP2025503566A (ja) | 抗メソテリンナノボディキメラ抗原受容体及びその応用 | |
| TWI922434B (zh) | 一種融合蛋白及其用途 | |
| EP4393955A1 (en) | Antibody specifically binding to cd47, recombinant oncolytic virus thereof and use thereof | |
| WO2026077989A1 (en) | Isolated tumor antigen-targeting antibody fragments and uses thereof | |
| HK40105313A (zh) | 抗steap2嵌合抗原受体及其用途 | |
| JP2025536561A (ja) | メソテリンに対する親和度が上昇されたキメリック抗原受容体、及びその用途 | |
| CN121285396A (zh) | 包含病毒颗粒的药物组合物及其使用方法 | |
| US20210284718A1 (en) | Antibodies against campylobacter species | |
| CN120399079A (zh) | 靶向cd90的纳米抗体及其应用 | |
| HK40098611A (zh) | 耗竭抗自然杀伤细胞的单克隆抗体 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23872616 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024550507 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202517029724 Country of ref document: IN |
|
| WWP | Wipo information: published in national office |
Ref document number: 202517029724 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023872616 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023872616 Country of ref document: EP Effective date: 20250430 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202380078878.4 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2023872616 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 202380078878.4 Country of ref document: CN |