WO2024053984A1 - L-퓨코스 대사가 가능한 재조합 사카로마이세스 보울라디 - Google Patents

L-퓨코스 대사가 가능한 재조합 사카로마이세스 보울라디 Download PDF

Info

Publication number
WO2024053984A1
WO2024053984A1 PCT/KR2023/013219 KR2023013219W WO2024053984A1 WO 2024053984 A1 WO2024053984 A1 WO 2024053984A1 KR 2023013219 W KR2023013219 W KR 2023013219W WO 2024053984 A1 WO2024053984 A1 WO 2024053984A1
Authority
WO
WIPO (PCT)
Prior art keywords
fucose
gene encoding
saccharomyces boulardii
cerevisiae
fuculose
Prior art date
Application number
PCT/KR2023/013219
Other languages
English (en)
French (fr)
Inventor
김경헌
김정연
정유은
Original Assignee
고려대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 고려대학교 산학협력단 filed Critical 고려대학교 산학협력단
Publication of WO2024053984A1 publication Critical patent/WO2024053984A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C12N1/18—Baker's yeast; Brewer's yeast
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/02—Aldehyde-lyases (4.1.2)
    • C12Y401/02017—L-Fuculose-phosphate aldolase (4.1.2.17)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y501/00—Racemaces and epimerases (5.1)
    • C12Y501/03—Racemaces and epimerases (5.1) acting on carbohydrates and derivatives (5.1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y503/00—Intramolecular oxidoreductases (5.3)
    • C12Y503/01—Intramolecular oxidoreductases (5.3) interconverting aldoses and ketoses (5.3.1)
    • C12Y503/01025—L-Fucose isomerase (5.3.1.25)

Definitions

  • the present invention relates to recombinant Saccharomyces boulardii, which can metabolize L-fucose, a sugar derived from intestinal mucin.
  • Saccharomyces boulardii (hereinafter Saccharomyces boulardii ) is well known as a probiotic strain that exhibits antibacterial activity, antitoxin effect, and immunomodulatory effect in the human intestine. It has a similar genome to the same species, Saccharomyces cerevisiae, but has a distinct phenotype. As a representative example, due to a point mutation in Pgm2 , Saccharomyces cerevisiae (hereinafter referred to as Saccharomyces cerevisiae ) metabolizes galactose rapidly, while Saccharomyces boulardii metabolizes it slowly.
  • Saccharomyces cerevisiae due to a point mutation in Pgm2 , Saccharomyces cerevisiae metabolizes galactose rapidly, while Saccharomyces boulardii metabolizes it slowly.
  • Saccharomyces boulardii can easily grow at 37°C, the normal human temperature, and has the characteristic of attaching to human or mouse intestinal epithelial cells. It also has higher resistance to environmental stresses such as high temperature and acidity than Saccharomyces cerevisiae.
  • Saccharomyces boulardii is reported to have higher intestinal metabolic activity than Saccharomyces cerevisiae and to provide various health benefits to humans.
  • pathogens such as pathogenic Escherichia coli , Salmonella enterica serotype Typhimurium, Campylobacter jejuni, and Clostridium difficile.
  • pathogens such as pathogenic Escherichia coli , Salmonella enterica serotype Typhimurium, Campylobacter jejuni, and Clostridium difficile.
  • pathogens such as pathogenic Escherichia coli , Salmonella enterica serotype Typhimurium, Campylobacter jejuni, and Clostridium difficile.
  • Preventive and therapeutic effects have been reported through numerous clinical trials. This treatment method has been used for decades as an over-the-counter medicine to treat or prevent diarrhea in Europe, Africa, and the United States.
  • Saccharomyces boulardii can remain in the intestines of humans and mice only after high-dose oral administration and is completely excreted 3-7 days after administration.
  • Saccharomyces boulardii has been reported to colonize intestinal epithelial cells in humans or gnotobiotic mice treated with antibiotics. This suggests that Saccharomyces boulardii can grow in the intestine and exhibit various metabolic activities, but can be easily suppressed by competition with other intestinal microorganisms.
  • Intestinal microorganisms that settle in the intestine metabolize molecules secreted by some of the intestinal epithelial cells. Dietary nutrients provided by the host are consumed competitively by the host and other intestinal microorganisms, so it can be said to be an insufficient nutritional supply. To overcome this, some microorganisms metabolize mucins secreted by mammalian hosts. Mucin is mainly composed of L-fucose, D-galactose, N-acetylgalactosamine, N-acetylglucosamine, D-glucuronic acid, and salicylic acid. Among these, intestinal microorganisms most often use L-fucose as a carbon source.
  • Microorganisms such as Bacteroides thetaiotaomicron , Bacteroides fragilis , and Bifidobacterium bifidum secrete fucosidase, which binds to the glycoprotein ends of mucin molecules. It is known to cleave L-fucose. The isolated L-fucose is metabolized through a phosphorylation process by other microorganisms.
  • the present inventors sought to improve the intestinal colonization and survival ability of Saccharomyces boulardii, which exhibits various functionalities, and L-fucose metabolism so that intestinal microorganisms can metabolize L-fucose, which is the most commonly used carbon source.
  • Saccharomyces boulardii strain transformed with a recombinant vector containing genes expressing the enzymes required for was completed.
  • the purpose of the present invention is to provide a recombinant Saccharomysis boulardii strain capable of metabolizing L-fucose.
  • the present invention includes a gene encoding fucose mutarotase; A gene encoding fucose isomerase; A gene encoding fuculose kinase; A gene encoding fuculose-1-phosphate aldolase; and a recombinant Saccharomyces boulardii strain that metabolizes L-fucose, comprising a gene encoding a hexose transporter.
  • L-fucose is taken into the strain by a hexose transporter.
  • L-fucose There are two types of L-fucose, ⁇ -L-fucose and ⁇ -L-fucose, and ⁇ -L-fucose is converted to ⁇ -L-fucose by fucose mutarotase.
  • ⁇ -L-fucose is converted to L-fuculose by fucose isomerase (fucI), and L-fuculose is phosphorylated into L-fuculose-1-phosphate by fuculose phosphorylase. .
  • L-fuculose-1-phosphate is converted to lactaldehyde and dihydroxyacetophenone by the action of fuculose-1-phosphate aldolase. Dihydroxyacetophenone is used to synthesize intermediates for cell growth, while lactaldehyde is converted to 1,2-propanediol and excreted.
  • a gene encoding fucose mutarotase introduced into the recombinant Saccharomyces boulardii strain of the present invention A gene encoding fucose isomerase; A gene encoding fuculose kinase; A gene encoding fuculose-1-phosphate aldolase; And the gene encoding the hexose transporter may be derived from E. coli.
  • the gene encoding fucose mutarotase is represented by SEQ ID NO: 1;
  • the gene encoding fucose isomerase is represented by SEQ ID NO: 2;
  • the gene encoding fuculose kinase is represented by SEQ ID NO: 3;
  • the gene encoding fuculose-1-phosphate aldolase is represented by SEQ ID NO: 4;
  • the gene encoding the hexose transporter can be represented by SEQ ID NO: 5.
  • Fucose mutarotase is represented by SEQ ID NO: 6; Fucose isomerase is represented by SEQ ID NO: 7; Fuculose kinase is represented by SEQ ID NO: 8; Fuculose-1-phosphate aldolase is represented by SEQ ID NO: 9; And the hexose transporter can be represented by SEQ ID NO: 10.
  • the enzymes are mutant proteins with one or more substitutions, deletions, translocations, additions, etc., and proteins having the above enzymatic activity are also included in the scope of the enzymes of the present invention, and preferably have the amino acid sequences disclosed in SEQ ID NOs: 5 to 10. It may include amino acid sequences having a sequence identity of at least 80%, at least 85%, at least 90%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%.
  • a polypeptide having a certain percentage (e.g., 80%, 85%, 90%, 95%, or 99%) of sequence identity to another sequence means that when the two sequences are aligned, the sequence identity This means that the amino acid residues in the above ratios are the same when compared.
  • the alignment and percent homology or identity can be performed using any suitable software program known in the art, such as those described in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel et al. (eds) 1987 Supplement 30 section 7.7.18). You can use it to decide.
  • Preferred programs include the GCG Pileup program, FASTA (Pearson et al. 1988 Proc. Natl Acad.
  • BLAST BLAST Manual, Altschul et al., Natl. Cent. Biotechnol. Inf., Natl Lib. Med. (NCIB NLM NIH), Bethesda, MD, and Altschul et al. 1997 NAR25:3389-3402).
  • Another preferred alignment program is ALIGN Plus (Scientific and Educational Software, PA), preferably using default parameters.
  • TFASTA Data Searching Program available in Sequence Software Package Version 6.0 (Genetics Computer Group, University of Wisconsin, Madison, WI).
  • the recombinant Saccharomyces boulardii strain of the present invention includes a gene encoding fucose mutarotase; A gene encoding fucose isomerase; A gene encoding fuculose kinase; A gene encoding fuculose-1-phosphate aldolase; and a gene encoding a hexose transporter.
  • the vector may be in a form in which the genes are operably linked.
  • operably linked generally refers to a base expression control sequence and a base sequence encoding a protein of interest being operably linked to perform a function, thereby affecting the expression of the coding base sequence.
  • Operable linkage with a vector can be made using genetic recombination techniques known in the art, and site-specific DNA cutting and linking can be made using cutting and linking enzymes known in the art.
  • vector refers to any vehicle for cloning and/or transferring a base to a host cell.
  • a vector may be a replication unit (replicon) that can bind different DNA fragments and result in replication of the combined fragments.
  • Replication unit refers to any genetic unit (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as a self-unit of DNA replication in vivo, that is, is capable of replicating under its own control.
  • the term “vector” may include viral and non-viral vehicles for introducing bases into host cells in vitro, ex vivo, or in vivo.
  • the term “vector” can also include minispherical DNA.
  • the vector may be a plasmid that does not contain bacterial DNA sequences.
  • the term “vector” may also include transposons such as Sleeping Beauty (Izsvak et.al.J. MoI. Biol. 302:93-102 (2000)), or artificial chromosomes. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and plasmid vectors can be used.
  • Vectors usable in the present invention are not particularly limited, and known expression vectors can be used.
  • a gene encoding fucose mutarotase A gene encoding fucose isomerase; A gene encoding fuculose kinase; A gene encoding fuculose-1-phosphate aldolase; And Candida tropicalis strains introduced with genes encoding hexose transporters not only metabolize L-fucose to produce intermediate products (biomass) for strain growth depending on the survival environment 1,2 -It was confirmed that propanediol was produced and discharged.
  • the present invention provides a genetically engineered Saccharomyces boulardii that metabolizes L-fucose and exhibits improved intestinal survival and intestinal metabolic activity, making it possible to utilize not only probiotics but also various functions possessed by the strain.
  • Figure 1 shows the results of an in silico genome-scale metabolic model analysis of the growth of Saccharomyces cerevisiae while metabolizing L-fucose.
  • A Detailed schematic diagram of fucose metabolism and each reaction for cell growth
  • B In silico calculation of fucose uptake and growth rate
  • C Relationship between oxygen supply and D-glucose or L-fucose growth.
  • Figure 2 shows the results of comparing the growth profile and fucose transport efficiency of Saccharomyces cerevisiae while metabolizing L-fucose.
  • A Growth profile of wild-type Saccharomyces cerevisiae
  • B Growth profile of Saccharomyces cerevisiae FCT
  • C Intracellular L-fucose concentration of HXT-Null strain and HXT1-7 overexpression strain
  • D Growth profile of Saccharomyces cerevisiae FCT
  • Figure 3 shows the growth profile of Saccharomyces boulardii while metabolizing L-fucose under various aerobic conditions.
  • A Growth profile of wild-type Saccharomyces boulardii
  • B Growth profile of Saccharomyces boulardii FCT under aerobic conditions
  • C Growth profile of Saccharomyces boulardii FCT under microaerobic conditions
  • D Anaerobic Growth profile of Saccharomyces boulardii FCT under conditions.
  • Figure 4 shows the results of basic flux mode analysis to explain fucose metabolism under aerobic and anaerobic conditions.
  • Microorganisms that metabolize L-fucose are characterized by low energy levels and slow growth rates.
  • yeast can synthesize sufficient amounts of metabolic intermediates for cell growth while metabolizing L-fucose
  • Saccharomyces cerevisiae S. cerevisiae
  • GEM genome scale metabolic model
  • Dihydroxyacetophenone an important intermediate in intracellular L-fucose metabolism and an intermediate product of the pentose phosphate pathway and glycolysis, is subsequently used for the synthesis of intermediate products.
  • Lactaldehyde another major intermediate product, is known to be converted to 1,2-propanediol.
  • lactaldehyde was converted to pyruvic acid by lactaldehyde dehydrogenase and lactate dehydrogenase.
  • the simulation confirms that ethanol is secreted while metabolizing D-glucose, but extracellular metabolites such as ethanol, glycerol, and acetic acid are not secreted while metabolizing L-fucose.
  • Saccharomyces cerevisiae consumes glucose and efficiently synthesizes metabolites, but the intermediate products produced during L-fucose metabolism are dihydroxyacetophenone and pyruvic acid. Since these are the initial and final molecules of glycolysis, gluconeogenesis is required to synthesize additional intermediate products.
  • fucA genes encoding fucose mutarotase, excluding fucose permease; fucU , a gene encoding fucose isomerase; fucI , a gene encoding fuculose kinase; fucK , a gene encoding fuculose-1-phosphate aldolase;
  • fucA the following primer set was prepared using E. coli K12 MG1655 genomic DNA as a template.
  • Forward primer 1 (SEQ ID NO: 11): 5′-ACTAGTATGGAACGAAATAAACTTGCTC-3′
  • Reverse primer 2 (SEQ ID NO: 12): 5′-CTCGAGTTACTCTTCAATTCGTAACC-3′
  • Reverse Primer 2 (SEQ ID NO: 14): 5′-CTCGAGTTAACGCTTGTACAACGGAC-3′
  • Reverse Primer 2 (SEQ ID NO: 16): 5′-CTCGAGTTACGGTGTTACCCCTTTTT-3′
  • Reverse Primer 2 (SEQ ID NO: 18): 5′-CTCGAGTCACACTTCCTCTATAAATT-3′
  • Reverse Primer 2 (SEQ ID NO: 20): 5′-CTCGAGCTACTTTTTTCCGAACATCT-3′
  • fucU, fucI, fucK, and fucA amplified through PCR using the above primers, they were cloned into pRS423GPD, pRS424GPD, and pRS426GPD vectors, respectively, using the ligation independent cloning (LIC) method.
  • the vector sequence is as follows.
  • prs426GPD_ fucK pRS426GPD harboring fucK from E. coli K12 MG1655-SEQ ID NO: 23
  • prs426GPD_ fucKHXT4 pRS426GPD harboring fucK from E. coli K12 MG1655 and HXT4 from S. cerevisiae CEN.PK2-1D-SEQ ID NO: 24
  • the recombinant vectors were transformed into E. coli DH5 ⁇ strain, an E. coli strain for replication. Thereafter, each recombinant vector was Saccharomyces cerevisiae CEN. PK2-1D was transformed using the lithium acetate/single-stranded carrier DNA/polyethylene glycol method. As a result, both wild-type Saccharomyces cerevisiae ( S. cerevisiae WT) and S. cerevisiae FCT were unable to metabolize L-fucose in yeast nitrogen base (YNB) medium.
  • Saccharomyces cerevisiae CEN Saccharomyces cerevisiae CEN was used.
  • An HXT-null Saccharomyces cerevisiae strain expressing each hexose transporter derived from PK2-1D was constructed and L-fucose transport efficiency was compared. As a result, it was confirmed that HXT4 transporter had the highest L-fucose transport ability.
  • L-fucose metabolism genes from Escherichia coli and Saccharomyces cerevisiae CEN.
  • a transformed Saccharomyces cerevisiae FCT strain overexpressing PK2-1D-derived HXT4 was constructed.
  • Saccharomyces cerevisiae FCT grows under aerobic conditions by metabolizing L-fucose (0.27 ⁇ 0.018 mmol fucose/g DCW/h) in YNB medium. (Specific growth rate: 0.034 ⁇ 0.001/h) Additionally, 1,2-propanediol was produced as an extracellular metabolite. (0.045 ⁇ 0.004mmol 1,2-PDO/g DCW/h)
  • Saccharomyces cerevisiae showed optimal growth when lactaldehyde was converted to lactic acid rather than 1,2-propanediol (Fig. 1A).
  • the production of 1,2-propanediol without overexpression of 1,2-PDO oxidoreductase is consistent with the unidentified oxidation of 1,2-propanediol that occurs during Saccharomyces cerevisiae metabolizing L-fucose.
  • the possibility of reductase was confirmed ( Figure 2).
  • cerevisiae CEN.PK2-1D harboring pRS423GPD, pRS424GPD, pRS426GPD S. cerevisiae F.C. S. cerevisiae CEN.PK2-1D harboring pRS423GPD_ fucA , pRS424GPD_ fucIU , pRS426GPD _fucK S. cerevisiae FCT S. cerevisiae CEN.PK2-1D harboring pRS423GPD_ fucA , pRS424GPD_ fucIU , pRS426GPD _fucK_HXT4 S.
  • boulardii (ATCC MYA-796) MAT ⁇ ura3-52 leu2-3 , 112 trp1-289 his3 ⁇ MAL2-8c SUC2 S. boulardii W.T. S. boulardii harboring pRS423GPD, pRS424GPD, pRS426GPD S. boulardii FCT S. boulardii harboring pRS423GPD_ fucA , pRS424GPD_ fucIU , pRS426GPD _fucK_HXT4 HXT-null S. cerevisiae S.
  • HXT6 S. cerevisiae HXT7 Hxt-null S. cerevisiae with overexpression of HXT7
  • Saccharomyces cerevisiae of Example 2 to obtain a transformed Saccharomyces boulardi ( Saccharomyces boulardi ) strain capable of metabolizing L-fucose.
  • the recombinant vector applied to the FCT strain was cloned into Saccharomyces boulardii and transformed into the Saccharomyces boulardii FCT strain.
  • Saccharomyces boulardii WT Saccharomyces boulardii WT
  • Saccharomyces boulardii FCT strain was able to metabolize L-fucose.
  • L-fucose 0.209 ⁇ 0.004 mmol fucose/g DCW/h
  • cell growth growth rate: 0.047 ⁇ 0.001/h
  • 1,2-propanediol 0.018 ⁇ 0.003 mmol 1,2-PDO/g
  • Saccharomyces boulardii FCT metabolized 14.69 ⁇ 0.98 mmol of L-fucose and produced 1.19 ⁇ 0.16 mmol 1,2-propanediol.
  • This result shows greater cell growth and less 1,2-propanediol production compared to the consumption of the same amount of L-fucose compared to the Saccharomyces cerevisiae FCT strain of Example 1.
  • Saccharomyces boulardii FCT metabolizes 0.081 ⁇ 0.001 mmol fucose/g DCW/h of L-fucose and increases cell growth (growth rate: 0.002 ⁇ 0.0002/h) and 1,2-propanediol 0.050 ⁇ 0.050 mmol. 0.004 mmol was produced.
  • Saccharomyces boulardii FCT metabolized 7.70 ⁇ 0.88 mmol of L-fucose and produced 2.89 ⁇ 0.20 mmol of 1,2-PDO.
  • Saccharomyces boulardii metabolizes L-fucose (0.045 ⁇ 0.014 mmol fucose/g DCW/h) and produces 1,2-propanediol 0.033 ⁇ 0.003 mmol/g DCW/h without cell growth. did. As a result of the first 72 hours, Saccharomyces boulardii FCT metabolized 3.43 ⁇ 0.27 mmol of L-fucose and produced 1.83 ⁇ 0.07 mmol of 1,2-propanediol. Therefore, it was confirmed that when oxygen supply is limited, only 1,2-propanediol production occurs instead of cell growth.
  • the (S)-lactaldehyde-(S)-lactic acid-pyruvate pathway has a high oxygen dependence and thus inhibits the growth of Saccharomyces boulardii FCT when metabolizing L-fucose under anaerobic conditions.
  • the GEM results of Example 1 above showed that a key step in L-fucose-dependent yeast growth is the conversion of lactaldehyde to (S)-lactic acid, which then converts it to pyruvic acid.
  • Saccharomyces boulardii FCT it was confirmed that cell growth slowed down significantly under microaerobic conditions and completely stopped under anaerobic conditions.
  • Saccharomyces boulardii FCT can metabolize L-fucose through a specific metabolic pathway different from that predicted by GEM in Example 1 under limited oxygen supply conditions.
  • Example 1 The GEM results of Example 1 showed that the growth profile of Saccharomyces boulardii FCT under aerobic conditions would be similar to the fermentation profile, but did not predict the synthesis of 1,2-propanediol.
  • Example 3 it was confirmed that even when oxygen supply was limited, Saccharomyces boulardii FCT still metabolized L-fucose, but 1,2-propanediol was produced instead of cell growth. Therefore, it can be seen that the predicted L-fucose metabolic pathway of Example 1 and the actual L-fucose metabolic pathway are different in an oxygen-limited environment. To determine the cause of this result, an investigation of the L-fucose metabolic pathway was conducted through elementary flux mode analysis (EFMA).
  • EFMA elementary flux mode analysis
  • lactaldehyde to pyruvaldehyde results in 1 M of L-fucose being metabolized to produce up to 0.73 M of 1,2-propanediol and 65.57 g/L of biomass, or up to 1 M of 1,2-propanediol and 47.46 g/L of biomass. It was predicted that g/L biomass could be produced.
  • all metabolized L-fucose was converted to biomass, which is consistent with the production of 1,2-propanediol and biomass in the fermentation experiment. there is.
  • Saccharomyces boulardii which metabolizes L-fucose under aerobic conditions, uses the lactaldehyde to (S)-lactic acid pathway to synthesize most of its biomass with a small amount of 1,2-PDO.
  • Saccharomyces boulardii FCT metabolizes L-fucose and synthesizes more 1,2-PDO with little or no biomass.
  • Saccharomyces boulardii FCT metabolizes L-fucose and produces 1,2-propanediol, pyruvate, and ATP under anaerobic conditions.
  • Saccharomyces boulardii FCT can reduce biomass synthesis, but the metabolic flux is enhanced toward the (S)-lactate conversion pathway and 1,2-propanediol and energy production, 1 , It was confirmed that the synthesis of 2-propanediol could be increased.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 장내 뮤신 유래당인 L-퓨코스(L-fucose)를 대사할 수 있는 재조합 사카로마이세스 보울라디(Saccharomyces boulardii)에 관한 것이다. 본 발명은 L-퓨코스를 대사하여 개선된 장내 생존 및 장내 대사 활동을 나타내는 형질 조작된 사카로마이세스 보울라디를 제공함으로써 프로바이오틱스뿐만 아니라 상기 균주가 보유한 다양한 기능성을 보다 활용 가능케 할 수 있다.

Description

L-퓨코스 대사가 가능한 재조합 사카로마이세스 보울라디
본 발명은 장내 뮤신 유래당인 L-퓨코스를 대사할 수 있는 재조합 사카로마이세스 보울라디(Saccharomyces boulardii)에 관한 것이다.
사카로마이세스 보울라디(이하 Saccharomyces boulardii)는 인간의 장에서 항균활성, 항독소 효과 및 면역 조절 효과를 나타내는 프로바이오틱스 균주로 잘 알려져 있다. 동일 종인 사카로마이세스 세레비지에와 유사한 게놈을 가지고 있지만 뚜렷한 표현형을 가지고 있다. 대표적인 예시로 Pgm2의 점 돌연변이로 인해 사카로마이세스 세레비지에(이하 Saccharomyces cerevisiae)는 갈락토오스를 빠르게 대사하는 반면 사카로마이세스 보울라디는 대사속도가 느리다.
또한 사카로마이세스 보울라디는 정상인체온도인 37°C에서 쉽게 성장할 수 있으며, 인간 또는 마우스의 장 상피 세포에 부착하는 특징을 가진다. 또한 사카로마이세스 세레비지에보다 고온 및 산성과 같은 환경적 스트레스에 대한 저항성이 더 높다.
이러한 표현형의 특징에 의해 사카로마이세스 보울라디는 사카로마이세스 세레비지에보다 장내 대사 활성이 높고 인간에게 다양한 건강상의 이점을 제공하는 것으로 보고되어있다. 특히 병원성 대장균(Escherichia coli), 살모넬라 티피뮤리움(Salmonella enterica serotype Typhimurium), 캄필로박터 제주니(Campylobacter jejuni), 클로스트리디움 디피실(Clostridium difficile )과 같은 병원체에 의해 유발되는 많은 위장 질환에 대한 예방 및 치료 효과가 수 많은 임상시험을 통해 보고되었다. 이러한 치료 방법은 유럽, 아프리카 및 미국에서 설사를 치료하거나 예방하기 위한 일반 의약품으로 수십 년 동안 사용되어 왔다.
일반적으로 사카로마이세스 보울라디는 고용량 경구 투여 후에만 인간 및 마우스 장에 잔류할 수 있으며 투여 후 3-7일에 완전히 배설된다. 뿐만 아니라 사카로마이세스 보울라디는 항생제 치료를 받은 인간이나 노토바이오틱 마우스에서 장 상피 세포에 정착하는 것으로 보고되었다. 이는 사카로마이세스 보울라디가 장내에서 성장하여 다양한 대사 활성을 나타낼 수 있지만, 다른 장내 미생물과의 경쟁에 의해 쉽게 억제될 수 있음을 시사한다.
장내 정착한 장내 미생물은 장 상피 세포의 일부에서 분비되는 분자를 대사한다. 숙주에 의해 제공되는 식이 영양소는 숙주와 다른 장내 미생물에 의해 경쟁적으로 소비되므로 불충분한 영양 공급이라 할 수 있다. 이를 극복하기 위해 일부 미생물은 포유동물 숙주에서 분비되는 뮤신을 대사한다. 뮤신은 주로 L-퓨코스, D-갈락토스, N-아세틸갈락토사민, N-아세틸글루코사민, D-글루쿠로닉산, 살리실산으로 구성되어 있다. 이 중 장내미생물은 L-퓨코스를 탄소원으로 가장 많이 사용한다.
박테로이드 테타이오타오미크론 (Bacteroides thetaiotaomicron), 박테로이데스 프라질리스(Bacteroides fragilis) 및 비피도박테리움 비피덤(Bifidobacterium bifidum)과 같은 미생물은 푸코시데이즈를 분비하여 뮤신 점액분자의 당단백질 말단에서 L-퓨코스를 절단하는 것으로 알려져있다. 분리된 L-퓨코스는 다른 미생물에 의해 인산화되는 과정을 통해 대사된다.
이에 본 발명자들은 다양한 기능성을 나타내는 사카로마이세스 보울라디의 장 내 정착능 및 생존능을 향상시키고자 하였고, 장내 미생물이 탄소원으로 가장 많이 사용하는 L-퓨코스를 대사할 수 있도록 L-퓨코스 대사에 요구되는 효소를 발현하는 유전자들을 포함하는 재조합 벡터로 형질전환된 사카로마이세스 보울라디 균주를 완성하였다.
본 발명의 목적은 L-퓨코스를 대사할 수 있는 재조합 사카로마이시스 보울라디 균주를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자; 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자; 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자; 및 6탄당 트랜스포터(hexose transporter)를 코딩하는 유전자를 포함하는, L-퓨코스를 대사하는 재조합 사카로마이세스 보울라디 균주를 제공한다.
본 발명의 재조합 사카로마이세스 보울라디 균주 내에서 L-퓨코스의 구체적인 대사 과정은 도 1에 나타난다. 먼저, 6탄당 트랜스포터(hexose transporter)에 의해 균주 내로 L-퓨코스가 흡입(intake)된다. L-퓨코스는 α-L-퓨코스 및 β-L-퓨코스 두 종류가 존재하고, β-L-퓨코스는 퓨코스 뮤타로테이스에 의해 α-L-퓨코스로 전환된다. 그 다음, 퓨코스 이성질화효소(fucI)에 의해 α-L-퓨코스는 L-푸쿨로스로 전환되며, 퓨쿨로스 인산화효소에 의해 L-푸쿨로스는 L-푸쿨로스-1-포스페이트로 인산화된다. 이후 푸쿨로스-1-인산염 알돌라아제의 작용에 의해 L-푸쿨로스-1-포스페이트가 락트알데히드와 다이하이드록시아세토페논으로 전환된다. 다이하이드록시아세토페논은 세포 성장을 위한 중간산물을 합성하는 데 사용되는 반면, 락트알데히드는 1,2-프로판디올로 전환되어 배출된다.
본 발명의 재조합 사카로마이세스 보울라디 균주에 도입된 퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자; 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자; 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자; 및 6탄당 트랜스포터(hexose transporter)를 코딩하는 유전자는 대장균 유래일 수 있다.
구체적으로, 퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자는 서열번호 1로 표시되고; 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자는 서열번호 2로 표시되며; 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자는 서열번호 3으로 표시되고; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자는 서열번호 4로 표시되며; 및 6탄당 트랜스포터(hexose transporter)를 코딩하는 유전자는 서열번호 5로 표시될 수 있다.
퓨코스 뮤타로테이스(fucose mutarotase)는 서열번호 6으로 표시되고; 퓨코스 이성질화효소(fucose isomerase)는 서열번호 7로 표시되며; 푸쿨로스 인산화효소(fuculose kinase)는 서열번호 8로 표시되고; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)는 서열번호 9로 표시되며; 및 6탄당 트랜스포터(hexose transporter)는 서열번호 10으로 표시될 수 있다. 또한, 상기 효소들은 하나 이상의 치환, 결손, 전위, 첨가 등의 변이 단백질로서 상기 효소 활성을 가지는 단백질도 본 발명의 효소의 권리범위에 포함되며, 바람직하게는 서열번호 5 내지 10에 개시된 아미노산 서열과 서열 동일성이 80% 이상, 85% 이상, 90% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상 및 99% 이상인 아미노산 서열을 포함할 수 있다.
본 발명에서 폴리펩티드가 또 다른 서열에 대하여 특정 비율 (예컨대, 80%, 85%, 90%, 95%, 또는 99%) 의 서열 동일성을 가진다는 것은, 상기 두 서열을 정렬시킬 때, 상기 서열들의 비교시에 상기 비율의 아미노산 잔기가 동일함을 의미한다. 상기 정렬 및 백분율 상동성 또는 동일성은, 당업계에 공지된 임의의 적당한 소프트웨어 프로그램, 예를 들어 문헌[CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel 등 (eds) 1987 Supplement 30 section 7.7.18)]에 기재된 것들을 사용하여 결정할 수 있다. 바람직한 프로그램으로는, GCG Pileup 프로그램, FASTA(Pearson 등 1988 Proc. Natl Acad. Sci USA85:2444-2448), 및 BLAST (BLAST Manual, Altschul 등, Natl. Cent. Biotechnol. Inf., Natl Lib. Med. (NCIB NLM NIH), Bethesda, MD, 및 Altschul 등 1997 NAR25:3389-3402)이 있다. 또 다른 바람직한 정렬 프로그램은 ALIGN Plus(Scientific and Educational Software, PA) 로서, 바람직하게는 기본 매개변수를 사용하는 것이다. 사용가능한 또 다른 서열 소프트웨어 프로그램은 Sequence Software Package Version 6.0 (Genetics Computer Group, University of Wisconsin, Madison, WI) 에서 이용가능한 TFASTA Data Searching Program 이다.
본 발명의 재조합 사카로마이세스 보울라디 균주는 퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자; 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자; 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자; 및 6탄당 트랜스포터(hexose transporter)를 코딩하는 유전자를 포함하는 재조합 벡터로 형질도입되어 제조될 수 있다.
상기 벡터는 상기 유전자들이 작동가능하게 연결된 형태일 수 있다. 본 발명에서 용어, "작동 가능하게 연결된"이란 일반적으로 기능을 수행하도록 염기 발현 조절 서열과 목적하는 단백질을 코딩하는 염기서열이 작동 가능하게 연결되어 코딩하는 염기서열의 발현에 영향을 미칠 수 있다. 벡터와의 작동가능한 연결은 당업계의 공지된 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당업계의 절단 및 연결 효소 등을 사용하여 제작할 수 있다.
본 발명에서 용어, "벡터"는 숙주 세포로 염기의 클로닝 및/또는 전이를 위한 임의의 매개물을 말한다. 벡터는 다른 DNA 단편이 결합하여 결합된 단편의 복제를 가져올 수 있는 복제단위(replicon)일 수 있다. "복제단위"란 생체 내에서 DNA 복제의 자가 유닛으로서 기능하는, 즉, 스스로의 조절에 의해 복제가능한, 임의의 유전적 단위 (예를 들면, 플라스미드, 파지, 코스미드, 염색체, 바이러스)를 말한다. 용어 "벡터"는 시험관 내, 생체 외 또는 생체 내에서 숙주 세포로 염기를 도입하기 위한 바이러스 및 비 바이러스 매개물을 포함할 수 있다. 용어 "벡터"는 또한 미니구형 DNA를 포함할 수 있다. 예를 들면, 상기 벡터는 박테리아 DNA 서열을 갖지 않는 플라스미드일 수 있다. 용어 "벡터"는 또한 슬리핑 뷰티(Sleeping Beauty)같은 트랜스포존(Izsvak et.al.J. MoI. Biol. 302:93-102 (2000)), 또는 인공 염색체를 포함할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터를 사용할 수 있다. 본 발명에서 사용 가능한 벡터는 특별히 제한되는 것이 아니며 공지된 발현 벡터를 사용할 수 있다.
본 발명의 일 실시예를 통해서, 퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자; 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자; 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자; 및 6탄당 트랜스포터(hexose transporter)를 코딩하는 유전자가 도입된 캔디다 트로피칼리스 균주는 L-퓨코스를 대사하여 생존 환경에 따라 균주 성장을 위한 중간산물(바이오매스)을 생성할 뿐만 아니라 1,2-프로판디올을 생산하여 배출하는 것을 확인하였다.
본 발명은 L-fucose를 대사하여 개선된 장내 생존 및 장내 대사 활동을 나타내는 형질 조작된 사카로마이세스 보울라디를 제공함으로써 프로바이오틱스뿐만 아니라 상기 균주가 보유한 다양한 기능성을 보다 활용 가능케 한다.
도 1은 L-퓨코스를 대사하는 동안 사카로마이세스 세레비지에의 성장에 대한 in silico genome-scale 대사 모델 분석 결과이다. (A) 세포 성장을 위한 푸코스 대사 및 각 반응의 상세한 모식도 (B) 푸코스 흡수 및 성장률의 인실리코 계산 (C) 산소 공급과 D-글루코스 또는 L-푸코스 성장 사이의 관계.
도 2는 L-퓨코스를 대사하는 동안 사카로마이세스 세레비지에의 성장 프로필 및 퓨코스 수송 효율을 비교한 결과이다. (A) 야생형 사카로마이세스 세레비지에의 성장 프로파일 (B) 사카로마이세스 세레비지에 FCT의 성장 프로파일 (C) HXT-Null 균주 및 HXT1-7 과발현 균주의 세포 내 L-퓨코스 농도 (D) 사카로마이세스 세레비지에 FCT의 성장 프로파일
도 3은 다양한 호기성 조건에서 L-퓨코스를 대사하는 동안 사카로마이세스 보울라디의 성장 프로필을 나타낸 것이다. (A) 야생형 사카로마이세스 보울라디의 성장 프로필 (B) 호기성 조건에서 사카로마이세스 보울라디 FCT의 성장 프로필 (C) 미세호기성 조건에서 사카로마이세스 보울라디 FCT의 성장 프로필 (D) 혐기성 조건에서 사카로마이세스 보울라디 FCT의 성장 프로필.
도 4는 호기성 및 혐기성 조건에서 퓨코스 대사를 설명하기 위한 기본 플럭스 모드 분석 결과를 나타낸 것이다. (A) 호기성 조건 및 (B) 혐기성 조건 하에서 추정 퓨코스 대사에 대한 개략도. (C) 호기성 조건에서 퓨코스를 대사하여 생성된 1,2-PDO 및 바이오매스의 양 (D) 각 조건에서 1,2-PDO, 바이오매스 또는 에너지의 최대 생산을 위한 화학양론.
이하, 본 발명에 따르는 실시예 통하여 본 발명을 보다 상세히 설명하나, 본 발명의 범위가 하기 제시된 실시예에 의해 제한되는 것은 아니다.
[실시예 1] Genome scale metabolic model(GEM) 분석을 사카로마이세스 세레비지에의 L-퓨코스 대사 및 세포성장 시뮬레이션(도 1)
L-퓨코스를 대사하는 미생물은 낮은 에너지 수준과 느린 성장률이 특징이다. 효모가 L-퓨코스를 대사하는 동안 세포 성장을 위한 충분한 양의 대사 중간산물을 합성할 수 있는지 확인하기 위해 사카로마이세스 세레비지에(S. cerevisiae)의 genome scale metabolic model(이하 GEM)을 사용하여 세포 성장에 대한 in silico 시뮬레이션을 실시하였다.
호기성 조건에서의 시뮬레이션 결과, 세포가 성장하는 동안 사카로마이세스 세레비지에에는 1mmol/g 건조 세포 중량(DCW)/h의 속도로 L-퓨코스를 대사하고 0.08145/h의 성장률을 나타냈다.
세포 내 L-퓨코스 대사의 중요한 중간체이자 오탄당 인산 경로 및 해당과정의 중간산물인 다이하이드록시아세토페논은 이후 중간산물의 합성에 사용된다. 또 다른 주요 중간산물인 락트알데히드는 1,2-프로판다이올로 전환되는 것으로 알려져 있다. 그러나 본 성장 시물레이션 결과, 락트알데히드는 락트알데히드 탈수소효소와 젖산 탈수소효소에 의해 피루브산으로 전환되는 것으로 나타났다. 또한, 시뮬레이션에서는 D-글루코스를 대사하는 동안 에탄올이 분비됨이 확인되지만 L-퓨코스를 대사하는 동안 에탄올, 글리세롤, 아세트산과 같은 세포외 대사산물이 분비되지 않는다.
장 내 환경을 고려할 때, 장의 위치에 따라 산소 농도는 각각 다르므로 호기적으로 탄소원을 대사하는데 필요한 산소의 양이 중요한 인자이다. 따라서 장내 환경에서 효모의 L-퓨코스 대사 효율을 추론하기 위해 L-퓨코스 대사 효모의 성장을 위한 산소 요구량을 D-글루코스 대사 효모의 산소 요구량과 비교를 실시하였다. 그 결과, 각 탄소원 1mmol이 대사될 때 D-글루코스를 대사하는 효모는 성장을 위해 0.1mmol 미만의 산소를 필요로 하는 반면, L-퓨코스를 대사하는 효모는 최소 0.507mmol의 산소가 필요한 것으로 나타났다. 이러한 결과는 L-퓨코스를 대사할 수 있는 효모의 성장이 D-글루코스를 대사하는 효모의 성장보다 더 산소 의존적임을 알 수 있다.
혐기성 조건에서 사카로마이세스 세레비지에는 글루코스를 소비하며 효울적으로 대사산물을 합성하지만 L-퓨코스 대사 시 생성되는 중간산물은 다이하이드록시아세토페논과 피루브산이다. 이는 해당과정의 초기 및 최종분자이므로 추가적인 중간산물 합성을 위해서는 글루코스 신생합성이 필요하다.
호기성 조건에서 피루브산은 TCA 회로를 통한 에너지 생산에 사용되고 다이하이드록시아세토페논은 중간산물 합성에 사용되므로 L-퓨코스 대사에서 탄소 흐름이 효율적이다. 그러나 혐기성 조건에서는 TCA 회로를 사용할 수 없어 한정된 양의 다이하이드록시아세토페논에서 대부분이 해당과정에 도입되어 에너지를 생산하고 중간산물 합성을 위한 대사흐름이 약해진다. 또한, (S)-락트알데히드-(S)-젖산-피루브산 경로의 활성화는 산화제가 없기 때문에 어렵다. 따라서 L-퓨코스 대사는 비효율적인 탄소흐름과 보조인자 불균형으로 인해 산소 의존도가 높다고 할 수 있다.
[실시예 2] L-퓨코스 대사 경로 강화 사카로마이세스 세레비지에 균주의 개발(도 2)
상기 실시예 1의 GEM 결과, L-퓨코스 대사 관련 유전자가 사카로마이세스 세레비지에의 세포 성장 시 발현 가능함을 확인하였다. 이와 관련한 선행연구에서 사카로마이세스 세레비지에가 세포 내로 소량의 L-퓨코스를 운반할 수 있다고 보고된 바 있다(Yu S, Liu J-J, Yun EJ, Kwak S, Kim KH, Jin Y-S. Microb Cell Fact. 2018;17:101.) 또한, 원핵생물인 대장균 유래 L-퓨코스 permease는 진핵생물 사카로마이세스 세레비지에에서 발현될 가능성이 낮다. 따라서, 퓨코스 permease를 제외한 퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자; fucU, 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자; fucI, 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자; fucK, 퓨쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자; fucA의 유전자 서열을 얻기 위해 대장균 K12 MG1655 유전체 DNA를 주형으로 다음과 같은 프라이머 세트를 제작하였다.
1) fucA
정방향 프라이머 1(서열번호 11): 5′-ACTAGTATGGAACGAAATAAACTTGCTC-3′
역방향 프라이머 2(서열번호 12): 5′-CTCGAGTTACTCTTCAATTCGTAACC-3′
2) fucI
정방향 프라이머 1(서열번호 13): 5′-ACTAGTATGAAAAAAATCAGCTTACCGAA-3′
역방향 프라이머 2(서열번호 14): 5′-CTCGAGTTAACGCTTGTACAACGGAC-3′
3) fucU
정방향 프라이머 1(서열번호 15): 5′-ACTAGTATGCTGAAAACAATTTCGCC-3′
역방향 프라이머 2(서열번호 16): 5′-CTCGAGTTACGGTGTTACCCCTTTTT-3′
4) fucK
정방향 프라이머 1(서열번호 17): 5′-ACTAGTATGAAACAAGAAGTTATCCTGG-3′
역방향 프라이머 2(서열번호 18): 5′-CTCGAGTCACACTTCCTCTATAAATT-3′
5) HXT4
정방향 프라이머 1(서열번호 19): 5′-ACTAGTATGTCTGAAGAAGCTGCCTATCAA-3′
역방향 프라이머 2(서열번호 20): 5′-CTCGAGCTACTTTTTTCCGAACATCT-3′
상기 프라이머로 이용하여 PCR을 통해 증폭된 fucU, fucI, fucK, fucA를 얻은 후 각각pRS423GPD, pRS424GPD, pRS426GPD 벡터에 ligation independent cloning(LIC) 방법을 사용하여 클로닝하였다. 벡터 서열은 아래와 같다.
1) prs423GPD_ fucA ( pRS423GPD harboring fucA from E. coli K12 MG1655)-서열번호 21)
tatgacttccctgactaatgccgtgttcaaacgatacctggcagtgactcctagcgctcaccaagctcttaaaacgggaatttatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga
2) prs424GPD_ fucIfucU : pRS424GPD harboring fucI and fucU from E. coli K12 MG1655-서열번호 22
aaaaaaagaaaagctccggatcaagattgtacgtaaggtgacaagctatttttcaataaagaatatcttccactactgccatctggcgtcataactgcaaagtacacatatattacgatgctgtctattaaatgcttcctatattatatatatagtaatgtcgtttatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga
3) prs426GPD_ fucK: pRS426GPD harboring fucK from E. coli K12 MG1655-서열번호 23
caaaaggcctctaggttcctttgttacttcttctgccgcctgcttcaaaccgctaacaatacctgggcccaccacaccgtgtgcattcgtaatgtctgcccattctgctattctgtatacacccgcagagtactgcaatttgactgtattaccaatgtcagcaaattttctgtcttcgaagagtaaaaaattgtacttggcggataatgcctttagcggcttaactgtgccctccatggaaaaatcagtcaagatatccacatgtgtttttagtaaacaaattttgggacctaatgcttcaactaactccagtaattccttggtggtacgaacatccaatgaagcacacaagtttgtttgcttttcgtgcatgatattaaatagcttggcagcaacaggactaggatgagtagcagcacgttccttatatgtagctttcgacatgatttatcttcgtttcctgcaggtttttgttctgtgcagttgggttaagaatactgggcaatttcatgtttcttcaacactacatatgcgtatatataccaatctaagtctgtgctccttccttcgttcttccttctgttcggagattaccgaatcaaaaaaatttcaaagaaaccgaaatcaaaaaaaagaataaaaaaaaaatgatgaattgaattgaaaagctgtggtatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga
4) prs426GPD_ fucKHXT4: pRS426GPD harboring fucK from E. coli K12 MG1655 and HXT4 from S. cerevisiae CEN.PK2-1D-서열번호 24
tttcgtgcatgatattaaatagcttggcagcaacaggactaggatgagtagcagcacgttccttatatgtagctttcgacatgatttatcttcgtttcctgcaggtttttgttctgtgcagttgggttaagaatactgggcaatttcatgtttcttcaacactacatatgcgtatatataccaatctaagtctgtgctccttccttcgttcttccttctgttcggagattaccgaatcaaaaaaatttcaaagaaaccgaaatcaaaaaaaagaataaaaaaaaaatgatgaattgaattgaaaagctgtggtatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcga
상기 재조합 벡터들은 복제용 대장균인 E. coli DH5α 균주에 형질전환하였다. 이후 각각의 재조합 벡터는 사카로마이세스 세레비지에 CEN. PK2-1D에 lithium acetate/single-stranded carrier DNA/polyethylene glycol method를 이용해 형질전환하였다. 그 결과, 야생형 사카로마이세스 세레비지에 (S. cerevisiae WT)와 S. cerevisiae FCT 모두 효모 질소 염기(YNB) 배지에서 L-퓨코스를 대사할 수 없었다.
이는 효모 세포가 충분한 L-퓨코스를 가져올 수 없기 때문으로 적절한 트랜스포터의 도입을 필요로 한다. 진핵세포인 사카로마이세스 세레비지에에 발현 가능하면서 L-퓨코스의 세포 내 수송에 효율적인 트랜스포터 식별을 위해 사카로마이세스 세레비지에 CEN. PK2-1D 유래 각 6탄당 트랜스포터를 발현하는 HXT-null 사카로마이세스 세레비지에 균주를 제작하여 L-퓨코스 수송 효율을 비교하였다. 그 결과, HXT4 트랜스포터가 가장 높은 L-퓨코스 수송 능력을 가짐을 확인하였다
따라서 우리는 대장균 유래 L-퓨코스 대사 유전자와 사카로마이세스 세레비지에 CEN. PK2-1D 유래 HXT4를 과발현하는 형질전환된 사카로마이세스 세레비지에 FCT 균주를 제작하였다.
호기성 조건에서 사카로마이세스 세레비지에 FCT는 YNB 배지에서 L-퓨코스(0.27 ± 0.018mmol fucose/g DCW/h)를 대사하며 성장함을 확인하였다. (비성장 속도: 0.034 ± 0.001/h) 또한 세포 외 대사산물로 1,2-프로판다이올을 생산하였다. (0.045 ± 0.004mmol 1,2-PDO/g DCW/h)
상기 실시예 1의 GEM 결과에 따르면 사카로마이세스 세레비지에는 락트알데히드가 1,2-프로판다이올이 아닌 젖산으로 전환되었을 때 최적의 성장을 보였다(Fig. 1A). 1,2-PDO 산화환원효소의 과발현 없이 나타난 1,2-프로판다이올의 생산은 사카로마이세스 세레비지에가 L-퓨코스를 대사하는 동안 발현되는 미확인의 1,2-프로판다이올 산화환원효소가 있을 가능성을 확인하였다(도 2).
Table 1. Strains and plasmids used in this study
Strain/plasmid Description
Strains
E. coli DH5α F 80d, lacZ△M15, endA1, recA1, hsdR17(rK mK), supE44, thi-1, gyrA96, relA1, △(lacZYA-argF)U169
S. cerevisiae CEN.PK2-1D MATα　ura3-52 leu2-3,112 trp1-289 his3△　MAL2-8c SUC2
S. cerevisiae WT S. cerevisiae CEN.PK2-1D harboring pRS423GPD, pRS424GPD, pRS426GPD
S. cerevisiae FC S. cerevisiae CEN.PK2-1D harboring pRS423GPD_fucA, pRS424GPD_fucIU, pRS426GPD_fucK
S. cerevisiae FCT S. cerevisiae CEN.PK2-1D harboring pRS423GPD_fucA, pRS424GPD_fucIU, pRS426GPD_fucK_HXT4
S. boulardii (ATCC MYA-796) MATα　ura3-52 leu2-3,112 trp1-289 his3△　MAL2-8c SUC2
S. boulardii WT S. boulardii harboring pRS423GPD, pRS424GPD, pRS426GPD
S. boulardii FCT S. boulardii harboring pRS423GPD_fucA, pRS424GPD_fucIU, pRS426GPD_fucK_HXT4
HXT-null S. cerevisiae S. cerevisiae D452-2 with a xylose pathway and deletion of HXT1-HXT7
S. cerevisiae HXT1 Hxt-null S. cerevisiae with overexpression of HXT1
S. cerevisiae HXT2 Hxt-null S. cerevisiae with overexpression of HXT2
S. cerevisiae HXT3 Hxt-null S. cerevisiae with overexpression of HXT3
S. cerevisiae HXT4 Hxt-null S. cerevisiae with overexpression of HXT4
S. cerevisiae HXT6 Hxt-null S. cerevisiae with overexpression of HXT6
S. cerevisiae HXT7 Hxt-null S. cerevisiae with overexpression of HXT7
Plasmids
prs423GPD HIS3, GPD promoter, CYC1 terminator, 2 μ origin, and Ampr
prs424GPD LEU2, GPD promoter, CYC1 terminator, 2 μ origin, and Ampr
prs426GPD URA3, GPD promoter, CYC1 terminator, 2 μ origin, and Ampr
prs423GPD_fucA pRS423GPD harboring fucA from E. coli K12 MG1655
prs424GPD_fucIfucU pRS424GPD harboring fucI and fucU from E. coli K12 MG1655
prs426GPD_fucKHXT4 pRS426GPD harboring fucK from E. coli K12 MG1655 and HXT4 from S. cerevisiae CEN.PK2-1D
prs426GPD_fucK pRS426GPD harboring fucK from E. coli K12 MG1655
[실시예 3] 산소 공급 제한에 따른 사카로마이세스 보울라디의 L-퓨코스 대사 및 발효 프로파일(도 3)
L-퓨코스를 대사할 수 있는 형질전환된 사카로마이세스 보울라디(사카로마이세스 보울라디) 균주를 얻기 위해 실시예 2의 사카로마이세스 세레비지에 FCT 균주에 적용된 재조합 벡터를 사카로마이세스 보울라디에 클로닝하여 사카로마이세스 보울라디 FCT 균주로 형질전환하였다.
호기성 조건에서 야생형 사카로마이세스 보울라디 (사카로마이세스 보울라디 WT)는 YNB 배지에서 L-퓨코스를 대사할 수 없는 반면 사카로마이세스 보울라디 FCT 균주는 L-퓨코스를 대사할 수 있음을 확인하였다. L-퓨코스 (0.209 ± 0.004mmol fucose/g DCW/h) 소모 시, 세포 성장 (성장률: 0.047 ± 0.001/h) 및 1,2-프로판다이올(0.018 ± 0.003mmol 1,2-PDO/g DCW/h)이 생산됨을 확인하였다.
처음 72시간 동안 사카로마이세스 보울라디 FCT는 14.69 ± 0.98mmol의 L-퓨코스를 대사하고 1.19 ± 0.16mmol 1,2-프로판다이올을 생성하였다. 이 결과는 상기 실시예 1의 사카로마이세스 세레비지에 FCT 균주와 비교하여 동일한 양의 L-퓨코스를 소비 대비 많은 세포성장과 적은 1,2-프로판다이올 생산을 하는 결과이다.
산소 공급이 제한된 장 환경에서 사카로마이세스 보울라디 FCT의 퓨코스 대사를 조사하기 위해 미호기성 및 혐기성 조건에서의 성장 및 대사 프로파일 확인을 진행하였다.
미세호기성 조건에서 사카로마이세스 보울라디 FCT는 L-퓨코스 0.081 ± 0.001mmol fucose/g DCW/h를 대사하고 세포성장(성장률: 0.002 ± 0.0002/h)과 1,2-프로판다이올 0.050 ± 0.004mmol를 생성하였다. 초기 216시간의 결과로 사카로마이세스 보울라디 FCT는 L-퓨코스 7.70 ± 0.88mmol 를 대사하고 2.89 ± 0.20mmol의 1,2-PDO를 생성하였다.
혐기성 조건에서 사카로마이세스 보울라디는 L-퓨코스(0.045 ± 0.014mmol fucose/g DCW/h)를 대사하고 세포성장 없이 1,2-프로판다이올 0.033 ± 0.003mmol/g DCW/h를 생성하였다. 초기 72시간의 결과로 사카로마이세스 보울라디 FCT는 L-퓨코스 3.43 ± 0.27mmol를 대사하고 1.83 ± 0.07mmol의 1,2-프로판다이올을 생성하였다. 따라서, 산소 공급이 제한될 경우, 세포성장 대신 1,2-프로판다이올 생산만 이루어지는 것을 확인하였다.
(S)-락트알데히드-(S)-젖산-피루브산 경로는 높은 산소 의존성을 가지므로 혐기성 조건에서 L-퓨코스를 대사할 경우, 사카로마이세스 보울라디 FCT의 성장을 억제한다. 상기 실시 예 1의 GEM 결과는 L-퓨코스 의존성 효모 성장의 핵심 단계가 락트알데히드를 (S)-젖산으로 전환하여 피루브산으로 전환하는 것으로 나타났다. 이와 달리 사카로마이세스 보울라디 FCT의 성장 프로파일에서, 세포성장은 미세호기성 조건에서 현저히 느려지고 혐기성 조건에서는 완전히 멈추는 것을 확인하였다. 따라서 L-퓨코스를 대사할 수 있는 을 보였다. 이러한 결과는 제한된 산소 공급 조건에서 사카로마이세스 보울라디 FCT가 실시 예 1의 GEM에서 예측한 것과는 다른 특정 대사 경로를 통해 L-퓨코스를 대사할 수 있음을 시사한다.
[실시예 4] Elementary flux mode analysis(EFMA)를 이용한 호기성 및 혐기성 조건에서 효모 L-퓨코스 대사 예측(도 4)
상기 실시 예 1의 GEM 결과는 호기성 조건에서 사카로마이세스 보울라디 FCT의 성장 프로필이 발효 프로필과 유사할 것이나 1,2-프로판다이올의 합성을 예측하지 못하였다. 또한, 상기 실시 예 3의 결과로 산소 공급이 제한된 경우에도 사카로마이세스 보울라디 FCT는 여전히 L-퓨코스를 대사하였지만 세포성장 대신 1,2-프로판다이올이 생산됨을 확인하였다. 따라서 산소가 제한된 환경에서 실시 예 1의 예측된 L-퓨코스 대사 경로와 실제 L-퓨코스 대사경로가 다르다는 것을 알 수 있다. 해당 결과에 대한 원인을 확인하기 위해 elementary flux mode analysis(이하 EFMA)를 통한 L-퓨코스 대사 경로 조사를 실시하였다.
호기성 조건에서 각 경로를 사용하여 세포성장 및 1,2-프로판다이올을 생성하기 위한 일련의 기본 대사경로 조사를 실시하였다. 그 결과, 락트알데히드에서 (S)-젖산으로의 전환경로는 39개의 모델이 있었고, 락트알데히드에서 피루브알데하이드로의 전환경로는 51개의 모델이 있음을 확인하였다. 락트알데히드에서 (S)-젖산으로의 전환경로에서 1M의 L-퓨코스가 대사되어 최대 110.35g/L의 바이오매스 또는 최대 1M의 1,2-프로판다이올 및 47.46g/L의 바이오매스를 합성하는 결과로 나타났다. 락트알데히드에서 피루브알데하이드로의 전환은 1M의 L-퓨코스가 대사되어 최대 0.73M의 1,2-프로판다이올 및 65.57g/L의 바이오매스 또는 최대 1M의 1,2-프로판다이올 및 47.46g/L의 바이오매스를 생성 가능한 것으로 예측되었다. 락트알데히드에서 (S)-젖산으로의 전환경로 모델에서는 대사되는 L-퓨코스가 모두 바이오매스로 전환되었으며, 이는 발효 실험에서 1,2-프로판다이올 및 바이오매스의 생산과 일치함을 알 수 있다.
혐기성 조건의 경우, 상기 EFMA 결과에서 NAD+가 충분히 빠르게 재생될 수 없기 때문에 락트알데히드에서 (S)-락테이트로의 전환경로 또는 락트알데히드에서 피루브알데하이드로의 전환경로가 유지될 수 없으나, 1M의 L-퓨코스를 1M의 1,2-PDO와 1M의 pyruvate로 전환하여 1M의 ATP를 합성 가능한 결과를 확인하였다. 이는 실시 예 3에서 산소가 제한되었을 때 효모가 바이오매스보다 1,2-프로판다이올을 더 많이 합성한 결과와 일치한다. 그러나 피루브알데하이드 경로에 대한 EFMA 모델은 1M의 L-퓨코스를 대사하면서 0.72M 이상의 1,2-PDO의 합성을 예측했는데, 이는 발효 데이터와 불일치함을 확인하였다. 이러한 결과는 호기성 조건에서 L-퓨코스를 대사하는 사카로마이세스 보울라디가 락트알데히드 to (S)-젖산 경로를 사용하여 소량의 1,2-PDO와 함께 대부분 바이오매스를 합성함을 시사한다. 미세호기성 및 혐기성 조건에서 사카로마이세스 보울라디 FCT는 L-퓨코스를 대사하고 바이오매스가 거의 또는 전혀 없이 더 많은 1,2-PDO를 합성한다. 본 EFMA 모델은 사카로마이세스 보울라디 FCT가 혐기성 조건에서 L-퓨코스를 대사하고 1,2-프로판다이올, 피루브산 및 ATP를 생성한다는 것을 시사한다. 산소가 제한될 때 사카로마이세스 보울라디 FCT는 바이오매스 합성을 감소시킬 수 있지만 대사 흐름이 (S)-락테이트 전환경로를 강화하고 1,2-프로판다이올 및 에너지 생산 방향으로 강화됨으로써 1,2-프로판다이올의 합성을 증가시킬 수 있음을 확인하였다.

Claims (4)

  1. 퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자; 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자; 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자; 및 6탄당 트랜스포터(hexose transporter)를 코딩하는 유전자를 포함하는, L-퓨코스를 대사하는 재조합 사카로마이세스 보울라디.
  2. 제 1항에 있어서,
    퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자; 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자; 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자; 및 6탄당 트랜스포터(hexose transporter)를 코딩하는 유전자는 대장균 유래인 L-퓨코스를 대사하는 재조합 사카로마이세스 보울라디.
  3. 제 1항에 있어서,
    퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자는 서열번호 1로 표시되고; 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자는 서열번호 2로 표시되며; 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자는 서열번호 3으로 표시되고; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자는 서열번호 4로 표시되며; 및 6탄당 트랜스포터(hexose transporter)를 코딩하는 유전자는 서열번호 5로 표시되는 것인 L-퓨코스를 대사하는 재조합 사카로마이세스 보울라디.
  4. 제 1항에 있어서,
    상기 균주는 퓨코스 뮤타로테이스(fucose mutarotase)를 코딩하는 유전자; 퓨코스 이성질화효소(fucose isomerase)를 코딩하는 유전자; 푸쿨로스 인산화효소(fuculose kinase)를 코딩하는 유전자; 푸쿨로스-1-인산염 알돌라아제(fuculose-1-phosphate aldolase)를 코딩하는 유전자; 및 6탄당 트랜스포터(hexose transporter)를 코딩하는 유전자를 포함하는 재조합 벡터로 형질도입된 것인 L-퓨코스를 대사하는 재조합 사카로마이세스 보울라디.
PCT/KR2023/013219 2022-09-06 2023-09-05 L-퓨코스 대사가 가능한 재조합 사카로마이세스 보울라디 WO2024053984A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220112652 2022-09-06
KR10-2022-0112652 2022-09-06

Publications (1)

Publication Number Publication Date
WO2024053984A1 true WO2024053984A1 (ko) 2024-03-14

Family

ID=90191474

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/013219 WO2024053984A1 (ko) 2022-09-06 2023-09-05 L-퓨코스 대사가 가능한 재조합 사카로마이세스 보울라디

Country Status (2)

Country Link
KR (1) KR20240034666A (ko)
WO (1) WO2024053984A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006135075A1 (en) * 2005-06-17 2006-12-21 Ajinomoto Co., Inc. A method for producing an l-amino acid using a bacterium of the enterobacteriaceae family with enhanced expression of the fucpikur operon
EP2905341A1 (en) * 2014-02-07 2015-08-12 Jennewein Biotechnologie GmbH Methods for producing nucleotide-activated sugars and recombinant microorganism host cells used therefor
US9260708B2 (en) * 2009-09-29 2016-02-16 Butamax Advanced Biofuels Llc Yeast production host cells

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006135075A1 (en) * 2005-06-17 2006-12-21 Ajinomoto Co., Inc. A method for producing an l-amino acid using a bacterium of the enterobacteriaceae family with enhanced expression of the fucpikur operon
US9260708B2 (en) * 2009-09-29 2016-02-16 Butamax Advanced Biofuels Llc Yeast production host cells
EP2905341A1 (en) * 2014-02-07 2015-08-12 Jennewein Biotechnologie GmbH Methods for producing nucleotide-activated sugars and recombinant microorganism host cells used therefor

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JING-JING LIU, KONG IN, ZHANG GUO-CHANG, JAYAKODY LAHIRU, KIM HEEJIN, XIA PENG-FEI, KWAK SURYANG, SUNG BONG, SOHN JUNG-HOON, WALUK: "Metabolic engineering of probiotic Saccharomyces boulardii", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 82, no. 8, 15 April 2016 (2016-04-15), US , pages 2280 - 2287, XP055448492, ISSN: 0099-2240, DOI: 10.1128/AEM.00057-16 *
KIM JUNGYEON, CHEONG YU EUN, YU SORA, JIN YONG-SU, KIM KYOUNG HEON: "Strain engineering and metabolic flux analysis of a probiotic yeast Saccharomyces boulardii for metabolizing l-fucose, a mammalian mucin component", MICROBIAL CELL FACTORIES, SPRINGER, vol. 21, no. 1, 7 October 2022 (2022-10-07), pages 204, XP093147319, ISSN: 1475-2859, DOI: 10.1186/s12934-022-01926-x *
KIM JUNGYEON, CHEONG YU, JUNG INHO, KIM KYOUNG: "Metabolomic and Transcriptomic Analyses of Escherichia coli for Efficient Fermentation of L-Fucose", MARINE DRUGS, MOLECULAR DIVERSITY PRESERVATION INTERNATIONAL, BASEL, CH, vol. 17, no. 2, 29 January 2019 (2019-01-29), Basel, CH , pages 82, XP093147317, ISSN: 1660-3397, DOI: 10.3390/md17020082 *

Also Published As

Publication number Publication date
KR20240034666A (ko) 2024-03-14

Similar Documents

Publication Publication Date Title
US5602030A (en) Recombinant glucose uptake system
Miller et al. Fermentations by saccharolytic intestinal bacteria
Sriramulu et al. Lactobacillus reuteri DSM 20016 produces cobalamin-dependent diol dehydratase in metabolosomes and metabolizes 1, 2-propanediol by disproportionation
Buntin et al. An inducible operon is involved in inulin utilization in Lactobacillus plantarum strains, as revealed by comparative proteogenomics and metabolic profiling
Forde et al. Genome sequences and comparative genomics of two Lactobacillus ruminis strains from the bovine and human intestinal tracts
WO1990002193A1 (en) Ethanol production by genetically engineered escherichia coli strains
CN109852572B (zh) 一种敲除大肠杆菌pts系统提高l-苏氨酸产量的方法
CN114410672B (zh) 希瓦氏菌中木糖和葡萄糖共利用代谢的构建方法
Gu et al. Bifidobacteria exhibited stronger ability to utilize fructooligosaccharides, compared with other bacteria in the mouse intestine
US20220220522A1 (en) Method for producing anhydrous galactose derived from seaweed
Dank et al. Bacterial microcompartment-dependent 1, 2-propanediol utilization of Propionibacterium freudenreichii
Eckel et al. Genomic and physiological insights into the lifestyle of Bifidobacterium species from water kefir
WO2024053984A1 (ko) L-퓨코스 대사가 가능한 재조합 사카로마이세스 보울라디
Jiang et al. Expression of phenylalanine ammonia lyase as an intracellularly free and extracellularly cell surface-immobilized enzyme on a gut microbe as a live biotherapeutic for phenylketonuria
Wang et al. Transcriptome Analysis of CGMCC 20445 Responses to Different Acidity Levels During Acetic Acid Fermentation
AU668677B2 (en) Recombinant cells that highly express chromosomally-integrated heterologous genes
WO2013187733A1 (ko) 발효산물 고생성능을 가지는 변이 미생물 및 이를 이용한 발효산물의 제조방법
CN114990043B (zh) 代谢赖氨酸的工程菌及其构建方法与应用
CN114540395B (zh) 希瓦氏菌中木糖利用代谢的构建方法
JPS63500493A (ja) 遺伝子的に修飾された生物体を用いるビタミンｃの製造方法
Lawford et al. Comparative energetics of glucose and xylose metabolism in ethanologenic recombinant Escherichia coli B
CN113106049A (zh) 一种不合成肠杆菌共同抗原和鞭毛的基因工程菌及其应用
WO2022265470A1 (ko) 네오아가로올리고당 제조를 위한 재조합 효모 사카로마이세스 보울라디 및 이의 용도
WO2024053959A1 (ko) 콜라닉산으로부터 퓨코실화 올리고당의 생산 방법
CN115089733B (zh) 用于治疗高赖氨酸血症的组合物及应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23863456

Country of ref document: EP

Kind code of ref document: A1