WO2024026455A2 - Procédés et compositions pour générer des récepteurs antigéniques chimériques monocytes/macrophages - Google Patents

Procédés et compositions pour générer des récepteurs antigéniques chimériques monocytes/macrophages Download PDF

Info

Publication number
WO2024026455A2
WO2024026455A2 PCT/US2023/071207 US2023071207W WO2024026455A2 WO 2024026455 A2 WO2024026455 A2 WO 2024026455A2 US 2023071207 W US2023071207 W US 2023071207W WO 2024026455 A2 WO2024026455 A2 WO 2024026455A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
polynucleotide
seq
amino acid
acid sequence
Prior art date
Application number
PCT/US2023/071207
Other languages
English (en)
Other versions
WO2024026455A3 (fr
Inventor
Christine HUH
Fereshteh PARVIZ
David Rodgers
May SUMI
Matthew Thayer
Huafeng Wang
Original Assignee
Shoreline Biosciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shoreline Biosciences, Inc. filed Critical Shoreline Biosciences, Inc.
Publication of WO2024026455A2 publication Critical patent/WO2024026455A2/fr
Publication of WO2024026455A3 publication Critical patent/WO2024026455A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4614—Monocytes; Macrophages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/463—Cellular immunotherapy characterised by recombinant expression
    • A61K39/4631—Chimeric Antigen Receptors [CAR]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464402—Receptors, cell surface antigens or cell surface determinants
    • A61K39/464411—Immunoglobulin superfamily
    • A61K39/464412—CD19 or B4
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2887—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0645—Macrophages, e.g. Kuepfer cells in the liver; Monocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A61K2039/507—Comprising a combination of two or more separate antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the cancer treated
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • the present disclosure relates, in part, to methods and compositions for generating monocytes, macrophages, and/or precursors thereof (such as an induced pluripotent stem cell), comprising (i) a chimeric antigen receptor (CAR); (ii) a polynucleotide encoding a CAR; (iii) a CAR polypeptide; and/or (iv) a vector comprising a polynucleotide encoding a CAR.
  • the cells expressing the CAR comprise a genetic disruption of a S1RPA gene, a CISH gene, and/or a SIGLEC10 gene.
  • Chimeric antigen receptor (CAR) T cell therapy is an effective treatment for certain types of hematological cancers, such as B cell leukemia and lymphoma.
  • CAR-T cells the therapeutic efficacy of CAR-T cells in solid tumors remains a challenge due, in part, to limited tumor infiltration of T cells. Macrophages are the innate immune cells with the highest infiltration rate. Yet, macrophages are often unable to identify and attack tumors, and instead behave in an immunosuppressive manner. Modification of the macrophages by introducing a CAR may allow these infiltrating cells to better reduce or eliminate cancer cells.
  • a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen recognition moiety, a hinge domain, a transmembrane domain, and an intracellular domain comprising: (a) a non-lymphoid intracellular signaling domain; and (b) a CD3 ⁇ intracellular signaling domain, and wherein the polynucleotide is operatively linked to a promoter.
  • CAR chimeric antigen receptor
  • the promoter is a myeloid- specific promoter.
  • the myeloid-specific promoter is a native macrophage or a native monocyte promoter.
  • the myeloid-specific promoter is a synthetic promoter.
  • the synthetic promoter is selected from the group consisting of synthetic promoter- 146 (SP146), synthetic promoter- 107 (SP107), and synthetic promoter-60 (SP60).
  • the promoter is selected from the group consisting of a EFla, CD36, CD68, SP60, SP107, SP146, CAG, PGK, T7, and CMV promoter.
  • the antigen recognition moiety comprises a scFv antigen recognition moiety.
  • the scFv antigen recognition moiety recognizes a tumor antigen or fragment thereof.
  • the tumor antigen is selected from the group consisting of HER2/neu, PSMA, Claudinl8, CD20, CD5, mesothelin, GD2, and CD19.
  • the hinge domain comprises a CD8 hinge domain.
  • the transmembrane domain enhances activity of a CAR in a macrophage relative to the CAR having a transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in activity comprises an increase in secretion of a pro-inflammatory cytokine.
  • the increase in secretion of the pro-inflammatory cytokine is about 10-fold to about 100-fold.
  • the increase in secretion of the pro- inflammatory cytokine is about 25-fold.
  • the increase in secretion of the pro-inflammatory cytokine is about 50-fold, about 75-fold, about 100-fold or more than about 100-fold.
  • the pro-inflammatory cytokine is selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP- la/CCL3, IL-10, IL-ip, IFNy, IL-6, TNFA, and CCL20, or a combination thereof.
  • the pro-inflammatory cytokine comprises MIP-loc/CCL3.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of two of more cytokines.
  • the secretion of the pro-inflammatory cytokine is measured by ELISA after culturing the macrophage for 24 hours in the presence of a target antigen.
  • the increase in activity comprises an increase in macrophage phagocytosis.
  • the increase in macrophage phagocytosis is about 10% to about 50%. In other embodiments, the increase is about 10%, the increase is about 20%, the increase is about 30%, the increase is about 40%, or the increase is more than about 40%.
  • phagocytosis is measured by flow cytometry after about four hours of co-incubation of a macrophage expressing the CAR and a target cell expressing a target antigen.
  • the transmembrane domain is selected from the group consisting of IL-1R1, VEGFR2, IFNyRl, CSF3R, CSF2R, SLAMF7, Dectin-1, Dectin-3, TLR4, CSF1R, CD8, CD28, MINCLE, MDL1, BDCA2, DAP12, CDl lb, CD86, and CD40.
  • the transmembrane domain is not CD8.
  • the transmembrane domain is not TLR4.
  • Tn some embodiments, the transmembrane domain is not CD28.
  • the transmembrane domain is not CD86.
  • the intracellular domain increases activity of a CAR in a macrophage relative to the CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the increase in activity comprises an increase in secretion of a pro-inflammatory cytokine.
  • the increase in secretion of the pro-inflammatory cytokine is about 10-fold to about 100- fold.
  • the increase in secretion of the pro-inflammatory cytokine is about 25-fold, about 50-fold, about 75-fold, about 100-fold or more than about 100- fold.
  • the one or more nonlymphoid intracellular signaling domains are selected from the group consisting of BAI- 1, CD86/B7-2, Loxlc, TM4, MEGF10, SCARF1, CD93, DAP12, SLAMF7, IFNyR2, 2B4/CD244, Dectin- 1, CD206, Dectin-3, CLEC2, and CD80/B7-1.
  • a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises
  • transmembrane domain wherein the transmembrane domain is selected from the group consisting of (i) a CD8 transmembrane domain; (ii) a SLAMF7 transmembrane domain; (iii) a CD86 transmembrane domain; (iv) a Dectin-1 transmembrane domain; and (v) a
  • a first intracellular signaling domain wherein the first intracellular signaling domain is selected from the group consisting of (i) a CD86 intracellular signaling domain; (ii) a Loxlc intracellular signaling domain, (iii) a 2B4 intracellular signaling domain; (iv) a Dectin-1 intracellular signaling domain; and (v) a CD40 intracellular signaling domain; and
  • the polynucleotide encodes for a hinge domain comprising an amino acid sequence of SEQ ID NO:1.
  • the transmembrane domain comprises a CD8 transmembrane domain.
  • the first intracellular signaling domain comprises a CD86 intracellular signaling domain.
  • the first intracellular signaling domain comprises a Loxlc intracellular signaling domain.
  • the transmembrane domain comprises a SLAMF7 transmembrane domain.
  • the first intracellular signaling domain comprises a CD86 intracellular signaling domain.
  • the transmembrane domain comprises a CD86 transmembrane domain.
  • the first intracellular signaling domain comprises a 2B4 intracellular signaling domain.
  • the transmembrane domain comprises a Dectin- 1 transmembrane domain.
  • the transmembrane domain comprises a CSF1R transmembrane domain.
  • the first intracellular signaling domain comprises a Dectin-1 intracellular signaling domain.
  • the first intracellular signaling domain comprises a CD40 intracellular signaling domain.
  • the polynucleotide encodes for a hinge domain comprising an amino acid sequence of SEQ ID NO:4.
  • the first intracellular signaling domain comprises a CD86 intracellular signaling domain.
  • the transmembrane domain comprises a SLAMF7 transmembrane domain.
  • the promoter is a constitutive promoter.
  • the constitutive promoter is a EFla promoter.
  • the promoter is a myeloid-specific promoter.
  • the myeloid-specific promoter is a native macrophage promoter or a native monocyte promoter.
  • the myeloid-specific promoter is a synthetic promoter.
  • the synthetic promoter is selected from the group consisting of synthetic promoter- 146 (SP146), synthetic promoter-107 (SP107), and synthetic promoter-60 (SP60).
  • the synthetic promoter is SP146.
  • the antigen recognition moiety comprises a scFv antigen recognition moiety.
  • the scFv antigen recognition moiety recognizes a tumor antigen or fragment thereof.
  • the tumor antigen is selected from your group consisting of HER2/neu, PSMA, Claudinl8, CD20, CD5, mesothelin, GD2, and CD19.
  • a vector comprising the polynucleotide of any one of embodiments disclosed herein.
  • the vector comprises DNA or RNA.
  • the vector is a plasmid vector.
  • the vector is a viral vector.
  • the viral vector is selected from the group consisting of an adenoviral vector, a lentiviral vector, and a retroviral vector.
  • the viral vector is a lentiviral vector.
  • polypeptide comprising:
  • transmembrane domain polypeptide wherein the transmembrane domain is selected from the group consisting of (i) a CD8 transmembrane domain; (ii) a SLAMF7 transmembrane domain; (iii) a CD86 transmembrane domain; (iv) a Dectin- 1 transmembrane domain; and (v) a CSF1R transmembrane domain;
  • a first intracellular signaling domain polypeptide wherein the first intracellular signaling domain is selected from the group consisting of: (i) a CD86 intracellular signaling domain; (ii) a Loxlc intracellular signaling domain, (iii) a 2B4 intracellular signaling domain; (iv) a Dectin- 1 intracellular signaling domain; and (v) a CD40 intracellular signaling domain; and
  • the hinge domain has an amino acid sequence of SEQ ID NO: 1.
  • the transmembrane domain polypeptide comprises a CD8 transmembrane domain polypeptide.
  • the CD8 transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO:11.
  • the first intracellular signaling domain polypeptide comprises a CD86 intracellular signaling domain polypeptide.
  • the CD86 intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO:40.
  • the first intracellular signaling domain polypeptide comprises a Loxlc intracellular signaling domain polypeptide.
  • the Loxlc intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO:41.
  • the transmembrane domain polypeptide comprises a SLAMF7 transmembrane domain polypeptide.
  • the SLAMF7 transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO: 12.
  • the first intracellular signaling domain polypeptide comprises a CD86 intracellular signaling domain polypeptide.
  • the CD86 intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO: 40.
  • the transmembrane domain polypeptide comprises a CD86 transmembrane domain polypeptide.
  • the CD86 transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO: 13.
  • the first intracellular signaling domain polypeptide comprises a 2B4 intracellular signaling domain polypeptide.
  • the 2B4 intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO: 42.
  • the transmembrane domain polypeptide comprises a Dectin-1 transmembrane domain polypeptide.
  • the Dectin-1 transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO: 14.
  • the transmembrane domain polypeptide comprises a CSF1R transmembrane domain polypeptide.
  • the CSF1R transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO:33.
  • the first intracellular signaling domain polypeptide comprises a Dectin-1 intracellular signaling domain polypeptide.
  • the Dectin-1 intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO:43.
  • the first intracellular signaling domain polypeptide comprises a CD40 intracellular signaling domain polypeptide.
  • the CD40 intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO: 46.
  • the hinge domain polypeptide comprises SEQ ID NON.
  • the first intracellular signaling domain polypeptide comprises a CD86 intracellular signaling domain polypeptide.
  • the CD86 intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO: 40.
  • the transmembrane domain polypeptide comprises a SLAMF7 transmembrane domain.
  • the SLAMF7 transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO: 12.
  • the antigen recognition moiety polypeptide comprises a scFv antigen recognition moiety polypeptide.
  • the scFv antigen recognition moiety polypeptide recognizes a tumor antigen or fragment thereof.
  • the tumor antigen is selected from your group consisting of HER2/neu, PSMA, Claudinl8, CD20, CD5, mesothelin, GD2, and CD19.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:97.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:98.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:99.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 100.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 101.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 102.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 103.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 104.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 105.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 106 is provided herein.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 107 is provided herein.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 108.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 110.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 111.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 112.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 113.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 114.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 115.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 116.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 117.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 118.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 119.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 120 is provided herein.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 121 is provided herein.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 125.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 126.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 127.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 128.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 129.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 130.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 131.
  • polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 132.
  • a modified cell wherein the modified cell comprises the polynucleotide of any one of the embodiments disclosed herein, the vector of any one of embodiments disclosed herein, or the polypeptide of any one of embodiments disclosed herein, and wherein the modified cell is a monocyte, a macrophage, or an induced pluripotent stem cell (iPSC).
  • the modified cell is an iPSC.
  • the modified cell is a macrophage.
  • the modified cell is a monocyte.
  • the modified cell is derived from an iPSC.
  • the modified cell is a human cell.
  • the modified cell comprises a genetic disruption of: (a) a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acidbinding Ig-like lectin 10 (SIGLEC10) gene.
  • the modified cell comprises genetic disruption of SIRPA.
  • the modified cell comprises genetic disruption of CISH.
  • the modified cell comprises genetic disruption of SIGLEC10.
  • the modified cell provided herein comprises an agent capable of preventing or reducing interaction between CD47 and SIRPoc.
  • the agent comprises an anti-CD47 antibody.
  • the agent comprises an anti- SIRPa antibody.
  • the modified cell provided herein comprises an agent capable of preventing or reducing interaction between CD24 and SIGLEC10.
  • the agent comprises an anti-CD24 antibody.
  • the agent comprises an anti- SIGLEC10 antibody.
  • composition comprising the modified cell of any one of embodiments disclosed herein.
  • provided herein is a method of treating a cancer, comprising administering the pharmaceutical composition disclosed herein.
  • a method of engineering a modified cell comprising introducing into the cell the polynucleotide of any one of embodiments disclosed herein, the vector of any one of embodiments disclosed herein, or the polypeptide of any one of embodiments disclosed herein, wherein the cell is a monocyte, a macrophage, or an induced pluripotent stem cell (iPSC).
  • the cell is an iPSC.
  • the cell is a macrophage.
  • the cell is a monocyte.
  • the cell is derived from an iPSC.
  • the modified cell is a human cell.
  • the cell comprises a genetic disruption of: (a)a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acid-binding Ig-like lectin 10 (SIGLEC10) gene.
  • the modified cell comprises genetic disruption of SIRPA.
  • the modified cell comprises genetic disruption of CISH.
  • the modified cell comprises genetic disruption of SIGLEC10. 4.
  • FIG. 1A - FIG. IB illustrate exemplary assays for measuring phagocytosis (FIG. 1A) and cytokine secretion (FIG. IB).
  • FIG. 2A - FIG. 2B illustrate results from screening promoters for myeloid specific CAR expression in human THP1 macrophages using an anti-idiotype PE antibody against the CAR scFv.
  • the promoters are listed on the left of the graphical representation in the order in which their respective data is presented. Expression was measured by flow cytometry (FIG. 2A), and quantified by mean fluorescent intensity (MFI) (FIG. 2B).
  • FIG. 3 illustrates results from an exemplary phagocytosis assay in human THP1 macrophages expressing CARs that were substituted with a series of transmembrane (TM) domains from receptors associated with macrophage activity, and normalized to THP1 macrophages expressing an otherwise identical CAR having a CD8 TM domain (“control”).
  • TM transmembrane
  • FIG. 4 illustrates results from an exemplary cytokine assay measuring macrophage inflammatory protein-1 alpha (MIP-la)/CCL3 secretion in human THP1 macrophages after expressing CARs substituted with a series of transmembrane (TM) domains from receptors associated with macrophage activity, and normalized to THP1 macrophages expressing an otherwise identical CAR having a CD8 TM domain (“control”).
  • MIP-la macrophage inflammatory protein-1 alpha
  • TM transmembrane
  • FIG. 5 illustrates results from an exemplary phagocytosis assay in human THP1 macrophages expressing CARs with a CD3 ⁇ intracellular domain that were complimented with a series of additional intracellular domains from receptors associated with macrophage activity, and normalized to THP1 macrophages expressing an otherwise identical CAR where the intracellular domain was only a CD3 ⁇ intracellular domain (“control”).
  • FIG. 6 illustrates results from an exemplary cytokine secretion assay measuring MIP- loc/CCL3 secretion in human THP1 macrophages expressing CARs with a CD3C, intracellular domain that were complimented with a series of additional intracellular domains from receptors associated with macrophage activity, and normalized to THP1 macrophages expressing an otherwise identical CAR where the intracellular domain was only a CD3C, intracellular domain (“control”).
  • FTG. 7 illustrates exemplary CAR constructs.
  • FIG. 8 illustrates a western blot confirming SIRPA knockout in monocytes 17 days and 20 days after differentiation of SIRPA KO iPSCs.
  • Monocytes derived from TC-1133 iPSCs that express SIRPA were wild-type control cells. Vinculin served as the housekeeping gene control.
  • FIG. 9 - FIG. 10 illustrate flow cytometry data for iPSC derived SIRPA KO monocytes at Day 17 (FIG. 9) and Day 20 (FIG. 10) relative to wild-type control monocytes derived from TC-1133 iPSCs that express SIRPA. Live singlets were gated on CD45+ and then CD1 lb+ CD 14+ to confirm monocyte purity.
  • FIG. 11A - FIG. 11C illustrate flow cytometry data for SIRPoc expression using an antibody that detects SIRPoc surface expression (FIG. 1 IB) or intracellular expression (FIG.
  • iPSC-derived SIRPA KO macrophages obtained from D17 or D20 iPSC-derived monocytes relative to wild-type control monocytes derived from TC-1133 iPSCs that express SIRPA.
  • FIG. 12A and FIG. 12B illustrate that SIRPA KO monocytes derived from SIRPA KO iPSCs have increased killing on Raji cells relative to wild-type control monocytes derived from TC-1133 iPSCs that express SIRPA, with the addition of 0.3 pg/mL and 0.5 pg/mL rituximab.
  • FIG. 13A and FIG. 13B illustrates that SIRPA KO macrophages derived from SIRPA KO iPSCs have increased killing relative to wild-type control macrophages derived from TC-1133 iPSCs that express SIRPA, with the addition of 0.1 pg/mL and 0.3 pg/mL rituximab in Raji cells (FIG. 13 A), and with the addition of 10 pg/mL trastuzumab in BT474 cells FIG. 13B).
  • FIG. 14A and FIG. 14B illustrate that SIRPA KO macrophages derived from iPSCs have increased killing on Raji cells relative to wild-type control macrophages derived from TC- 1133 iPSCs that express SIRPA, with the addition of 0.1 pg/mL and 0.3 pg/mL rituximab.
  • FIG. 15A and FIG. 15B illustrate a schema of iMACs pre-complexed with rituximab (RTX) (FIG. 15 A) and in vivo results that demonstrated the iMACs pre-complexed with rituximab (RTX) kill Raji cells (FIG. 15B).
  • FTG. 16A - FIG. 16F illustrate CD 19 (top panel) and red fluorescent protein (RFP) (bottom panel) expression, as measured by flow cytometry, post knock-in of CAR29 (FIG. 16A), CAR30 (FIG. 16B), CAR31 (FIG. 16C), CAR32 (FIG. 16D), CAR33 (FIG. 16E), and CAR34 (FIG. 16F) in iMACs.
  • RFP red fluorescent protein
  • FIG. 17A and FIG. 17B illustrate iMAC CAR function for CAR29-CAR34 according to tumor cell killing against CD 19+ Raji cells over 96 hours at a 5:1 effectortarget ratio, without (FIG. 17A) or with (FIG. 17B) rituximab (anti-CD20).
  • FIG. 18A - FIG. 18B illustrate CD 19 (top panel) and red fluorescent protein (RFP) (bottom panel) expression, as measured by flow cytometry, post knock-in of CAR31 (FIG. 18A), and CAR32 (FIG. 18B) in iMAC.
  • RFP red fluorescent protein
  • FIG. 19 illustrates iMAC CAR function for CAR31, and CAR32 according to tumor cell killing against CD19+ Raji cells over 96 hours at a 5: 1 effectortarget ratio.
  • FIG. 20A - FIG. 20C illustrate viability for SirpaKO iMonocyte on day 20, as measured by flow cytometry (FIG. 20A); CD 19 expression 24 hour post-electroporation for SirpaKO iMonocyte on day 20, as measured by flow cytometry (FIG. 20B); and SirpaKO iMAC CAR function for CAR25, CAR26, CAR27, and CAR28, or SirpaKO iMAC cells with 1 pg/mL rituximab (Rtx) according to tumor cell killing against CD 19+ Raji cells over 96 hours at a 5:1 effectortarget ratio.
  • Rtx rituximab
  • the present disclosure is directed, in part, to methods and compositions for generating monocytes, macrophages, and/or precursors thereof (such as an induced pluripotent stem cell) comprising (i) a chimeric antigen receptor (CAR); (ii) a polynucleotide encoding a CAR; (iii) a CAR polypeptide; and/or (iv) a vector comprising a polynucleotide encoding a CAR.
  • methods of treating a disease or disorder comprising administering a pharmaceutical composition (such as a pharmaceutical composition provided herein).
  • a method for treating cancer in a subject in need thereof comprising administering a pharmaceutical composition (such as a pharmaceutical composition provided herein).
  • a pharmaceutical composition such as a pharmaceutical composition provided herein.
  • percent identity has the same meaning as commonly understood to one of ordinary skill in the art. A representative way to determine percent identity is by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100.
  • the terms “about” and “approximately” mean within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, or less of a given value or range.
  • non-lymphoid intracellular domain is intended to mean a signaling or costimulatory domain that is not part of the native T cell receptor complex (e.g., CD3( ⁇ , CD35, or CD3E) native B cell receptor complex (e.g. CD22, CD79a, CD79b), or involved in the classical T cell signaling pathway, such as a co-stimulatory molecule from the CD28 family (e.g., CD28 or ICOS) or tumor necrosis factor receptor (TNFR) family (e.g., 4- IBB, 0X40, or CD27).
  • CD3( ⁇ , CD35, or CD3E) native B cell receptor complex e.g. CD22, CD79a, CD79b
  • TNFR tumor necrosis factor receptor
  • myeloid specific promoter is intended to mean a promoter that enhances or facilitates transcription of a gene in a myeloid cell (e.g., a macrophage or monocyte), relative to a non-myeloid cell as measured by, for example, a reporter gene assay (e.g., a luciferase, or chemiluminescent reporter assay) or measure of the downstream protein encoded by the gene.
  • a reporter gene assay e.g., a luciferase, or chemiluminescent reporter assay
  • a representative non-myeloid reference cell may be a HeLa or a 293 T cell.
  • a CAR comprises an antigen recognition moiety (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain (such as a hinge domain described in Section 5.1.2), a transmembrane domain (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain (such as an intracellular domain described in Section 5.1.4), and the transmembrane domain and/or intracellular domain comprise domains derived from a receptor associated with macrophage activity.
  • a CAR provided herein comprises an antigen recognition moiety (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain (such as a hinge domain described in Section 5.1.2), a transmembrane domain (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain (such as an intracellular domain described in Section 5.1.4), and the transmembrane domain comprises a transmembrane domain derived from a receptor associated with macrophage activity.
  • an antigen recognition moiety such as an antigen recognition moiety described in Section 5.1.1
  • a hinge domain such as a hinge domain described in Section 5.1.2
  • a transmembrane domain such as a transmembrane domain described in Section 5.1.3
  • an intracellular domain such as an intracellular domain described in Section 5.1.4
  • a CAR provided herein comprises an antigen recognition moiety (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain (such as a hinge domain described in Section 5.1.2), a transmembrane domain (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain (such as an intracellular domain described in Section 5.1.4), and the intracellular domain comprises an intracellular domain derived from a receptor associated with macrophage activity.
  • an antigen recognition moiety such as an antigen recognition moiety described in Section 5.1.1
  • a hinge domain such as a hinge domain described in Section 5.1.2
  • a transmembrane domain such as a transmembrane domain described in Section 5.1.3
  • an intracellular domain such as an intracellular domain described in Section 5.1.4
  • the intracellular domain comprises an intracellular domain derived from a receptor associated with macrophage activity.
  • a CAR provided herein comprises an antigen recognition moiety (such as an antigen recognition moiety described in Section 5.1 .1), a hinge domain (such as a hinge domain described in Section 5.1.2), a transmembrane domain (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain (such as an intracellular domain described in Section 5.1.4), and both the transmembrane domain and intracellular domain comprise domains derived from a receptor associated with macrophage activity.
  • the macrophage activity comprises secretion of a pro-inflammatory cytokine.
  • the macrophage activity comprises phagocytosis of a cell expressing a target antigen.
  • the macrophage activity comprises secretion of a pro-inflammatory cytokine and phagocytosis of a cell expressing a target antigen.
  • the chimeric antigen receptor (CAR) of the present disclosure comprises a signal peptide.
  • the signal peptide has an amino acid sequence of MALPVTALLLPLALLLHAARP (SEQ ID NO: 2).
  • the signal peptide has an amino acid sequence with at least 80% sequence identity with SEQ ID NO: 2.
  • the signal peptide has an amino acid sequence with at least 90%, 95%, 97% or 99% sequence identity with SEQ ID NO: 2.
  • the signal peptide has a polynucleotide sequence of ATGGCACTGCCAGTGACCGCCCTGCTGCTGCCTCTGGCCCTGCTGCTGCACGCAGCA AGGCCA (SEQ ID NO: 3). In some embodiments, the signal peptide has a polynucleotide sequence with at least 80% sequence identity with SEQ ID NO: 3. Tn some embodiments, the signal peptide has a polynucleotide sequence with at least 90%, 95%, 97% or 99% sequence identity with SEQ ID NO: 3.
  • the signal peptide has an amino acid sequence of METDTLLLWVLLLWVPGSTG (SEQ ID NO: 109). In some embodiments, the signal peptide has an amino acid sequence with at least 80% sequence identity with SEQ ID NO: 109. In some embodiments, the signal peptide has an amino acid sequence with at least 90%, 95%, 97% or 99% sequence identity with SEQ ID NO: 109.
  • a chimeric antigen receptor (CAR) of the present disclosure comprises an antigen recognition moiety that recognizes and binds to a specific binding element on the target of interest.
  • the antigen recognition moiety include a single-chain variable fragment (scFv), nanobodies, ligands to cognate receptors, native receptors against targets, and small peptides.
  • the antigen recognition domain recognizes an antigen selected from the group consisting of HER2/neu, PSMA, Claudinl8, CD20, CD5, BCMA, TAC1, GD2, mesothelin and CD19.
  • the antigen recognition domain recognizes HER2/neu.
  • the antigen recognition domain recognizes PSMA.
  • the antigen recognition domain recognizes Claudin 18.
  • the antigen recognition domain recognizes CD20.
  • the antigen recognition domain recognizes CD20.
  • the antigen recognition domain recognizes CD5.
  • the antigen recognition domain recognizes BCMA. In some embodiments, the antigen recognition domain recognizes CD 19. In some embodiments, the antigen recognition domain recognizes mesothelin. In some embodiments, the antigen recognition domain recognizes TACT. In some embodiments, the antigen recognition domain recognizes GD2. In certain aspects, the antigen recognition moiety is a single-chain variable fragment (scFv).
  • a chimeric antigen receptor (“CAR”) comprising a hinge domain.
  • a hinge domain (also referred to as a spacer) is a structure between the antigen recognition moiety and the cell membrane.
  • Non-limiting examples include, for example, a hinge domain derived from an IgG subclass (such as IgGl and IgG4), IgD, CD28, CSF1R, a Fey receptor, and CD8 domains Tn
  • a hinge domain lacking FcyR binding activity.
  • a hinge domain derived from a native T cell molecule e.g., CD28, or CD8.
  • a CAR provided herein comprises a hinge domain derived from CD8. In some embodiments, a CAR provided herein comprises a hinge domain derived from an IgG subclass. In specific embodiments, a CAR provided herein comprises a hinge domain derived from IgGl . Tn specific embodiments, a CAR provided herein comprises a hinge domain derived from IgG2. In specific embodiments, a CAR provided herein comprises a hinge domain derived from IgG3. In specific embodiments, a CAR provided herein comprises a hinge domain derived from IgG4. Tn some embodiments, a CAR provided herein comprises a hinge domain derived from IgD.
  • a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to an amino acid sequence provided in Table 1.
  • a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to an amino acid sequence of SEQ ID NO:1 or SEQ ID NO:4.
  • a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to an amino acid sequence of SEQ ID NO: 1.
  • a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 1.
  • a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 4. In some embodiments, a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 5. In some embodiments, a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 6. In some embodiments, a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 7.
  • a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 8. In some embodiments, a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 9. In some embodiments, a CAR provided herein comprises a hinge domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 10.
  • Table 1 Exemplary hinge domain sequences.
  • a CAR comprising a transmembrane domain
  • a transmembrane domain is a structure that facilitates anchoring the CAR in a cell membrane, and generally consists of a hydrophobic a-helix that spans the cell membrane.
  • Non-limiting examples include, for example, a hinge domain derived from an IgG subclass (such as IgGl and IgG4), IgD, CD28, CSF1R, a Fey receptor, and CD8 domains.
  • the transmembrane domain is a single-span transmembrane (e.g, a transmembrane domain derived from CD4, CD8oc, or CD28).
  • a CAR provided herein comprises a transmembrane domain derived from CD8. In some embodiments, a CAR provided herein does not comprise a transmembrane domain derived from CD8. In some embodiments, a CAR provided herein comprises a transmembrane domain derived from CD28. In some embodiments, a CAR provided herein does not comprise a transmembrane domain derived from CD28. In some embodiments, a CAR provided herein comprises a transmembrane domain derived from CD86. In some embodiments, a CAR provided herein does not comprise a transmembrane domain derived from CD86.
  • a CAR provided herein comprises a transmembrane domain derived from TLR4. In some embodiments, a CAR provided herein does not comprise a transmembrane domain derived from TLR4. In some embodiments, the transmembrane domain is derived from the same source as at least one of the intracellular domains. For example, the transmembrane domain can be derived from CD86 and at least one intracellular domain can also be derived from CD86. As a further example, the transmembrane can be derived from DECTIN- 1 and at least one intracellular domain can also be derived from DECTIN-1. [00131] As provided herein, the present disclosure relates in part to transmembrane domains that enhance macrophage activity.
  • the CAR provided herein comprises a transmembrane domain that enhances activity of a CAR in a macrophage, relative to the CAR having a transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in activity comprises an increase in secretion of a pro-inflammatory cytokine, relative to the CAR having a transmembrane domain consisting of a CD8 transmembrane domain.
  • the pro-inflammatory cytokine is selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-1 , IFNy, IL-10, IL- 6, TNFA, and CCL20, or a combination thereof.
  • the pro-inflammatory cytokine comprises MIP-loc/CCL3. Techniques known to one of skill in the art or described herein (e.g, Section 5.9 1 or in the Examples) may be used to assess secretion of the pro- inflammatory cytokine.
  • secretion of the pro-inflammatory cytokine is measured by ELISA after culturing the macrophage for about 24 hours in the presence of a target antigen.
  • the increase in secretion of the pro-inflammatory cytokine is about 5-fold to about 100-fold, about 5-fold to about 50-fold, about 5-fold to about 40-fold, about 5-fold to about 30-fold, about 5-fold to about 20-fold, about 10-fold to about 100-fold, about 10-fold to about 50-fold, about 10-fold to about 40-fold, about 10-fold to about 30-fold, about 10-fold to about 20-fold, 20-fold to about 100-fold, about 20-fold to about 50-fold, about 20-fold to about 40-fold, or about 20-fold to about 30-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in secretion of the pro-inflammatory cytokine is about 5-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is about 10-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is about 20-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in secretion of the pro-inflammatory cytokine is about 30-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is about 40-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is about 50-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in secretion of the pro-inflammatory cytokine is about 75-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is about 100-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is more than about 100-fold, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of two of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of two or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the two or more cytokines can be calculated.
  • the secretion of the two or more pro-inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the two or more proinflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of three of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-1OC/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of three or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the three or more cytokines can be calculated.
  • the secretion of the three or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the three or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of four of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of four or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the four or more cytokines can be calculated.
  • the secretion of the four or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the four or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of five of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of five or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the five or more cytokines can be calculated.
  • the secretion of the five or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the five or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of six of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of six or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the six or more cytokines can be calculated.
  • the secretion of the six or more pro-inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the six or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of seven of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of seven or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the seven or more cytokines can be calculated.
  • the secretion of the seven or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the seven or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of eight of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of eight or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the eight or more cytokines can be calculated.
  • the secretion of the eight or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the eight or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of nine of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of nine or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the nine or more cytokines can be calculated.
  • the secretion of the nine or more pro-inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the nine or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of ten of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-1 , IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of ten or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the ten or more cytokines can be calculated.
  • the secretion of the ten or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the ten or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of eleven of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of eleven or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the eleven or more cytokines can be calculated.
  • the secretion of the eleven or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having a transmembrane domain consisting of a CD8 transmembrane domain, and a composite score can be generated by calculating the sum of the eleven or more pro-inflammatory cytokines.
  • the increase in activity comprises an increase in macrophage phagocytosis.
  • Techniques known to one of skill in the art or described herein may be used to assess phagocytosis.
  • phagocytosis is measured by flow cytometry after about four hours of co-incubation of a macrophage expressing the CAR and a target cell expressing a target antigen.
  • the increase in phagocytosis is about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, about 5% to about 10%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 50%, about 30% to about 40%, or about 40% to about 50%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in phagocytosis is about 5%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in phagocytosis is about 10%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in phagocytosis is about 20%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in phagocytosis is about 30%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in phagocytosis is about 40%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in phagocytosis is about 50%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, the increase in phagocytosis is more than about 50%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in activity of the macrophage expressing a CAR provided herein is an increase in secretion of a pro-inflammatory cytokine and an increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • both secretion of the pro- inflammatory cytokine and phagocytosis are increased by about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, about 5% to about 10%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 50%, about 30% to about 40%, or about 40% to about 50%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 5%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, both secretion of the pro- inflammatory cytokine and phagocytosis are increased by at least 10%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. Tn some embodiments, both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 20%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 30%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 40%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 50%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, both secretion of the pro-inflammatory cytokine and phagocytosis are increased by more than about 50%, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • the increase in activity of the macrophage expressing a CAR provided herein is an increase in secretion of a pro-inflammatory cytokine and no increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • secretion of the pro- inflammatory cytokine is increased by about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, about 5% to about 10%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 50%, about 30% to about 40%, or about 40% to about 50%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • secretion of the pro-inflammatory cytokine and phagocytosis is increased by at least 5%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, secretion of the pro-inflammatory cytokine and phagocytosis is increased by at least 10%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • secretion of the pro-inflammatory cytokine and phagocytosis is increased by at least 20%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, secretion of the pro-inflammatory cytokine and phagocytosis is increased by at least 30%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • secretion of the pro-inflammatory cytokine and phagocytosis is increased by at least 40%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain. In some embodiments, secretion of the pro-inflammatory cytokine and phagocytosis is increased by at least 50%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • secretion of the pro-inflammatory cytokine and phagocytosis is increased by more than about 50%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an transmembrane domain consisting of a CD8 transmembrane domain.
  • a CAR provided herein comprises a transmembrane domain selected from the group consisting of a IL1R1 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a DAP12 transmembrane domain, a CDl lb transmembrane domain, a VEGFR2 transmembrane domain, a IFNyRl transmembrane domain, a CSF3R transmembrane domain, a CSF2R transmembrane domain, a SLAMF7 transmembrane domain, a DECTIN-1 transmembrane domain, a DECTIN-3 transmembrane domain, a TLR4 transmembrane domain, a CSF1R transmembrane domain, a CD86 transmembrane domain, a macrophage-inducible C-type lectin (MINCLE)
  • a CAR provided herein comprises a transmembrane domain selected from the group consisting of a CD8 transmembrane domain, a SLAMF7 transmembrane domain, a CD86 transmembrane domain, a DECTIN-1 transmembrane domain, and a CSF1R transmembrane domain.
  • a CAR provided herein comprises a transmembrane domain comprising a CD8 transmembrane domain.
  • a CAR provided herein comprises a transmembrane domain comprising a SLAMF7 transmembrane domain.
  • a CAR provided herein comprises a transmembrane domain comprising a CD86 transmembrane domain. Tn specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a DECTIN-1 transmembrane domain. In specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a CD8 transmembrane domain. In specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a IL-1R1 transmembrane domain. In specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a VEGFR2 transmembrane domain.
  • a CAR provided herein comprises a transmembrane domain comprising a IFNvR I transmembrane domain. In specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a CSF3R transmembrane domain. In specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a CSF2R transmembrane domain. In specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a CD86 transmembrane domain. In specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a TLR4 transmembrane domain.
  • a CAR provided herein comprises a transmembrane domain comprising a CD40 transmembrane domain. In specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a CSF1R transmembrane domain. In specific embodiments, a CAR provided herein comprises a transmembrane domain comprising a DECTIN-3 transmembrane domain. In some embodiments, a CAR provided herein does not comprise a transmembrane domain derived from CD8. In some embodiments, a CAR provided herein does not comprise a transmembrane domain derived from CD28. In some embodiments, a CAR provided herein does not comprise a transmembrane domain derived from TLR4. In some embodiments, a CAR provided herein does not comprise a transmembrane domain derived from CD 86.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to an amino acid sequence provided in Table 2.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 11.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 12 Tn some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 13. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 14. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 15.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 16. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 17. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 18. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 19.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 20. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 21. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 22. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 23.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 24. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 25. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 26.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 27
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 28.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 29.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 30.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 31. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 32. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 33. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 34.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 35. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 36. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 37. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 38.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 39. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 17 or SEQ ID NO: 18. In some embodiments, a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 26 or SEQ ID NO:27. [00148] Table 2: Exemplary transmembrane domains
  • an intracellular domain transmits activation signals.
  • an intracellular domain provided herein comprises a non-lymphoid intracellular signaling domain (such as a non-lymphoid intracellular signaling domain described in Section 5.1.4.1) and an intracellular domain comprising one or more immune-receptor-tyrosine-based-activation-motif (IT AM) (such as an ITAM containing intracellular signaling domain described in Section 5.1.4.2).
  • I AM immune-receptor-tyrosine-based-activation-motif
  • a CAR provided herein comprises at least one intracellular domain that enhances activity of a CAR in a macrophage, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the increase in activity comprises an increase in secretion of a pro-inflammatory cytokine, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the increase in activity comprises an increase in phagocytosis.
  • the increase in activity comprises an increase in secretion of a pro-inflammatory cytokine and an increase in phagocytosis.
  • the increase in activity comprises Ml polarization of the macrophage.
  • the pro-inflammatory cytokine is selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP- loc/CCL3, IL-ip, IFNy, IL-10, IL-6, TNFA, and CCL20, or a combination thereof.
  • the pro-inflammatory cytokine comprises MIP-loc/CCL3.
  • secretion of the pro-inflammatory cytokine is measured by ELISA after culturing the macrophage for about 24 hours in the presence of a target antigen.
  • the increase in secretion of the pro-inflammatory cytokine is about 5-fold to about 100-fold, about 5-fold to about 50-fold, about 5-fold to about 40-fold, about 5-fold to about 30-fold, about 5-fold to about 20-fold, about 10-fold to about 100-fold, about 10-fold to about 50-fold, about 10-fold to about 40-fold, about 10-fold to about 30-fold, about 10-fold to about 20-fold, 20-fold to about 100-fold, about 20-fold to about 50-fold, about 20-fold to about 40-fold, or about 20-fold to about 30-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the increase in secretion of the pro-inflammatory cytokine is about 5-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain. In some embodiments, the increase in secretion of the pro- inflammatory cytokine is about 10-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is about 20-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the increase in secretion of the pro-inflammatory cytokine is about 30-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is about 40-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is about 50-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain.
  • the increase in secretion of the pro- inflammatory cytokine is about 75-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is about 100-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, the increase in secretion of the pro-inflammatory cytokine is more than about 100-fold, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of two of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-loc/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-loc/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of two or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the two or more cytokines can be calculated.
  • the secretion of the two or more pro-inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain, and a composite score can be generated by calculating the sum of the two or more proinflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of three of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MlP-loc/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of three or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the three or more cytokines can be calculated.
  • the secretion of the three or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain, and a composite score can be generated by calculating the sum of the three or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of four of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of four or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the four or more cytokines can be calculated.
  • the secretion of the four or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain, and a composite score can be generated by calculating the sum of the four or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of five of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of five or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the five or more cytokines can be calculated.
  • the secretion of the five or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain, and a composite score can be generated by calculating the sum of the five or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of six of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MlP-loc/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of six or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the six or more cytokines can be calculated.
  • the secretion of the six or more pro-inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain, and a composite score can be generated by calculating the sum of the six or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of seven of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of seven or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the seven or more cytokines can be calculated.
  • the secretion of the seven or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain, and a composite score can be generated by calculating the sum of the seven or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of eight of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of eight or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the eight or more cytokines can be calculated.
  • the secretion of the eight or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain, and a composite score can be generated by calculating the sum of the eight or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of nine of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MlP-loc/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of nine or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the nine or more cytokines can be calculated.
  • the secretion of the nine or more pro-inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain, and a composite score can be generated by calculating the sum of the nine or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of ten of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of ten or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the ten or more cytokines can be calculated.
  • the secretion of the ten or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain, and a composite score can be generated by calculating the sum of the ten or more pro-inflammatory cytokines.
  • the increase in secretion of the pro-inflammatory cytokine comprises a composite score of the secretion of eleven of more pro-inflammatory cytokines, such as a pro-inflammatory cytokine selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-la/CCL3, IL-10, IFNy, IL-10, IL-6, TNFA, and CCL20.
  • the secretion amount of eleven or more pro-inflammatory cytokines can be determined using techniques known in the art or provided herein, and an average score of the eleven or more cytokines can be calculated.
  • the secretion of the eleven or more pro- inflammatory cytokines can be normalized against an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain, and a composite score can be generated by calculating the sum of the eleven or more pro-inflammatory cytokines.
  • the increase in activity comprises an increase in macrophage phagocytosis.
  • Techniques known to one of skill in the art or described herein e. ., Section 5.9.2 or in the Examples
  • phagocytosis is measured by flow cytometry after about four hours of co-incubation of a macrophage expressing the CAR and a target cell expressing a target antigen.
  • the increase in phagocytosis is about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, about 5% to about 10%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 50%, about 30% to about 40%, or about 40% to about 50%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, the increase in phagocytosis is about 5%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the increase in phagocytosis is about 10%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, the increase in phagocytosis is about 20%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, the increase in phagocytosis is about 30%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. Tn some embodiments, the increase in phagocytosis is about 40%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the increase in phagocytosis is about 50%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. Tn some embodiments, the increase in phagocytosis is more than about 50%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain.
  • the increase in activity of the macrophage expressing a CAR provided herein is an increase in secretion of a pro-inflammatory cytokine and an increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • both secretion of the pro- inflammatory cytokine and phagocytosis are increased by about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, about 5% to about 10%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 50%, about 30% to about 40%, or about 40% to about 50%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 5%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 10%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain. In some embodiments, both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 20%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain.
  • both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 30%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 40%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain. In some embodiments, both secretion of the pro-inflammatory cytokine and phagocytosis are increased by at least 50%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, both secretion of the pro- inflammatory cytokine and phagocytosis are increased by more than about 50%, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the increase in activity of the macrophage expressing a CAR provided herein is an increase in secretion of a pro-inflammatory cytokine and no increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • secretion of the pro-inflammatory cytokine is increased by about 5% to about 50%, about 5% to about 40%, about 5% to about 30%, about 5% to about 20%, about 5% to about 10%, about 10% to about 50%, about 10% to about 40%, about 10% to about 30%, about 10% to about 20%, about 20% to about 50%, about 20% to about 40%, about 20% to about 30%, about 30% to about 50%, about 30% to about 40%, or about 40% to about 50%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • secretion of the pro-inflammatory cytokine is increased by at least 5%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, secretion of the pro-inflammatory cytokine is increased by at least 10%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain. In some embodiments, secretion of the pro-inflammatory cytokine is increased by at least 20%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • secretion of the pro-inflammatory cytokine is increased by at least 30%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain. In some embodiments, secretion of the pro-inflammatory cytokine is increased by at least 40%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3C, intracellular signaling domain. In some embodiments, secretion of the pro-inflammatory cytokine is increased by at least 50%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • secretion of the pro-inflammatory cytokine is increased by more than about 50%, and there is no increase in phagocytosis, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • the present disclosure is based, in part, on the discovery that a CAR comprising a non-lymphoid intracellular signaling domain can enhance the activity of a macrophage, relative to an otherwise identical CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • a CAR comprising an intracellular domain that does not consist of a CD3C, intracellular signaling domain.
  • the intracellular signaling domain comprises a non- lymphoid intracellular signaling domain and a CD3 ⁇ intracellular signaling domain.
  • the CAR comprises at least one intracellular domain that does not include an intracellular signaling domain derived from (a) the native B cell receptor complex (e.g CD20, CD22, CD79a, CD79b), or (b) the native T cell receptor complex ( ⁇ ?.g, CD3( ⁇ , CD35, or CD3E).
  • the CAR comprises at least one intracellular domain that does not include an intracellular signaling domain involved in the classical T cell signaling pathway, such as a co-stimulatory molecule from the CD28 family (e.g., CD28 or ICOS) or tumor necrosis factor receptor (TNFR) family e.g, 4-1BB/CD137, 0X40, or CD27).
  • non-lymphoid intracellular signaling domains are provided in Table 3, below.
  • the non-lymphoid intracellular signaling domain is selected from the group consisting of BAI-1, CD86/B7-2, Loxlc, TIM4, MEGF10, SCARF1, CD93, DAP12, SLAMF7, !FNyR2, 2B4/CD244, DECTIN- 1, CD206, DECTIN-3, CLEC2, and CD80/B7-1.
  • the non-lymphoid intracellular signaling domain is selected from the group consisting of CD86, Loxlc, 2B4, and DECTIN-1.
  • the non-lymphoid intracellular signaling domain is selected from the group consisting of CD80 and CD86. Tn some embodiments, the non-lymphoid intracellular signaling domain is not derived from a 2B4 intracellular signaling domain. [00167] Table 3: Exemplary non-lymphoid intracellular signaling domains
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to an amino acid sequence provided in Table 3.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:40, SEQ ID NO:41, SEQ TD NO:42, or SEQ ID NO:43.
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 54.
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 85.
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 81 or SEQ ID NO:82.
  • a CAR provided herein does not comprise an intracellular signaling domain that comprises a TLR intracellular signaling domain, e.g., a TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7 or TLR8 intracellular signaling domain.
  • a TLR intracellular signaling domain e.g., a TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7 or TLR8 intracellular signaling domain.
  • the present disclosure relates, in part, to a CAR having at least two intracellular signaling domains (e.g., a first intracellular signaling domain, such as a nonlymphoid intracellular signaling domain described in Section 5.1.4.1, and a second intracellular signaling domain comprising one or more immune-receptor-tyrosine-based-activation-motifs (IT AMs)).
  • a first intracellular signaling domain such as a nonlymphoid intracellular signaling domain described in Section 5.1.4.1
  • IT AMs immune-receptor-tyrosine-based-activation-motifs
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to an amino acid sequence provided in Table 4.
  • a CAR provided herein comprises a transmembrane domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:89, or SEQ ID NO:92.
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 89.
  • a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 90 Tn some embodiments, a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 91. In some embodiments, a CAR provided herein comprises an intracellular signaling domain comprising an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 92.
  • Table 4 Exemplary IT AM containing intracellular signaling domains
  • a CAR provided herein comprises an intracellular domain having a CD86 intracellular signaling domain and a CD3 ⁇ intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a CD86 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:40 and a CD3 ⁇ intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR provided herein comprises an intracellular domain having a 2B4 intracellular signaling domain and a CD3 ⁇ intracellular signaling domain.
  • a CAR provided herein does not comprise an intracellular domain having a 2B4 intracellular signaling domain and a CD3 ⁇ intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a 2B4 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:42 and a CD3 ⁇ intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR provided herein comprises an intracellular domain having a 2B4 intracellular signaling domain and a FcyRI intracellular signaling domain.
  • a CAR provided herein does not comprise an intracellular domain having a 2B4 intracellular signaling domain and a FcyRI intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a 2B4 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:42 and a FcyRT intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:92.
  • a CAR provided herein comprises an intracellular domain having a DECTIN- 1 intracellular signaling domain and a CD3 ⁇ intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a DECTIN- 1 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:43 and a CD3 ⁇ intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR provided herein comprises an intracellular domain having a DECTIN- 1 intracellular signaling domain and a FcyRI intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a DECTIN- 1 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:43 and a FcyRT intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:92.
  • a CAR provided herein comprises an intracellular domain having a Loxlc intracellular signaling domain and a CD3 intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a Loxlc intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:41 and a CD3 ⁇ intracellular signaling domain comprising an amino acid sequence of SEQ ID NO: 89.
  • a CAR provided herein comprises an intracellular domain having a Loxlc intracellular signaling domain and a FcyRl intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a Loxlc intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:41 and a FcyRI intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:92.
  • a CAR provided herein comprises an intracellular domain having a CD80 intracellular signaling domain and a CD3 ⁇ intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a CD80 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:81 or SEQ ID NO:82, and a CD3 ⁇ intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR provided herein comprises an intracellular domain having a CD80 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:81, and a CD3 ⁇ intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR provided herein comprises an intracellular domain having a CD80 intracellular signaling domain comprising an amino acid sequence of SEQ ID SEQ ID NO:82, and a CD3 ⁇ intracellular signaling domain comprising an amino acid sequence of SEQ ID NO: 89.
  • a CAR provided herein comprises an intracellular domain having a CD80 intracellular signaling domain and a FcyRI intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a CD80 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:81 or SEQ ID NO:82 and a FcyRI intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:92.
  • a CAR provided herein comprises an intracellular domain having a CD80 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO: 81 and a FcyRI intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:92.
  • a CAR provided herein comprises an intracellular domain having a CD80 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO: 82 and a FcyRI intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:92.
  • a CAR provided herein comprises an intracellular domain having a CD40 intracellular signaling domain and a CD3 ⁇ intracellular signaling domain.
  • a CAR provided herein comprises an intracellular domain having a CD40 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:46 and a CD3t intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR provided herein does not comprise an intracellular domain having a CD86 intracellular signaling domain comprising an amino acid sequence of SEQ ID NO:40 and a FcyRI intracellular signaling domain comprising an amino acid sequence of SEQ ID NO: 92.
  • polynucleotides that encode a CAR of the present disclosure, such as a CAR described in Section 5.1.
  • the polynucleotide comprises DNA (e.g., cDNA).
  • the polynucleotide comprises RNA (e.g., mRNA).
  • the polynucleotide is isolated. In certain embodiments, the polynucleotide is substantially pure.
  • the polynucleotide provided herein encodes a CARs comprising an antigen recognition moiety (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain (such as a hinge domain described in Section 5.1.2), a transmembrane domain (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain (such as an intracellular domain described in Section 5.1.4), and the transmembrane domain and/or intracellular domain comprise domains derived from a receptor associated with macrophage activity.
  • an antigen recognition moiety such as an antigen recognition moiety described in Section 5.1.1
  • a hinge domain such as a hinge domain described in Section 5.1.2
  • a transmembrane domain such as a transmembrane domain described in Section 5.1.3
  • an intracellular domain such as an intracellular domain described in Section 5.1.4
  • the polynucleotide provided herein encodes a CARs comprising an antigen recognition moiety (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain (such as a hinge domain described in Section 5.1.2), a transmembrane domain (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain (such as an intracellular domain described in Section 5.1.4), and the transmembrane domain comprises a transmembrane domain derived from a receptor associated with macrophage activity.
  • an antigen recognition moiety such as an antigen recognition moiety described in Section 5.1.1
  • a hinge domain such as a hinge domain described in Section 5.1.2
  • a transmembrane domain such as a transmembrane domain described in Section 5.1.3
  • an intracellular domain such as an intracellular domain described in Section 5.1.4
  • the polynucleotide provided herein encodes a CARs comprising an antigen recognition moiety (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain (such as a hinge domain described in Section 5.1.2), a transmembrane domain (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain (such as an intracellular domain described in Section 5.1.4), and the intracellular domain comprises an intracellular domain derived from a receptor associated with macrophage activity.
  • an antigen recognition moiety such as an antigen recognition moiety described in Section 5.1.1
  • a hinge domain such as a hinge domain described in Section 5.1.2
  • a transmembrane domain such as a transmembrane domain described in Section 5.1.3
  • an intracellular domain such as an intracellular domain described in Section 5.1.4
  • the polynucleotide provided herein encodes a CARs comprising an antigen recognition moiety (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain (such as a hinge domain described in Section 5.1.2), a transmembrane domain (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain (such as an intracellular domain described in Section 5.1.4), and both the transmembrane domain and intracellular domain comprise domains derived from a receptor associated with macrophage activity.
  • the macrophage activity comprises secretion of a pro-inflammatory cytokine.
  • the macrophage activity comprises phagocytosis of a cell expressing a target antigen.
  • the macrophage activity comprises secretion of a pro-inflammatory cytokine and phagocytosis of a cell expressing a target antigen.
  • the chimeric antigen receptor (CAR) of the present disclosure comprises a signal peptide.
  • the signal peptide has a polynucleotide sequence of ATGGCACTGCCAGTGACCGCCCTGCTGCTGCCTCTGGCCCTGCTGCTGCACGCAGCA AGGCCA (SEQ ID NO: 3).
  • the signal peptide has a polynucleotide sequence with at least 80% sequence identity with SEQ ID NO: 3.
  • the signal peptide has a polynucleotide sequence with at least 90%, 95%, 97% or 99% sequence identity with SEQ ID NO: 3.
  • a polynucleotide that encodes a CAR such as a polynucleotide described in Section 5.2
  • the promoter is a constitutively active promoter.
  • Constitutively active promoters are known in the art, and any suitable constitutively active promoter capable of expressing the CAR in a mammalian cell, such as a mammalian cell described in Section 5.5, can be used.
  • Non-limiting examples of a constitutively active promoter include, for example, the elongation factor- 1 alpha (EFla) promoter, the cytomegalovirus (CMV) promoter, the cytomegalovirus (CMV) enhancer fused to the chicken beta-actin (CAG) promoter, and the phosphoglycerate kinase (PGK) promoter.
  • EFla elongation factor- 1 alpha
  • CMV cytomegalovirus
  • CAG chicken beta-actin
  • PGK phosphoglycerate kinase
  • the polynucleotide provided herein is operably linked to a EFla promoter.
  • the polynucleotide provided herein is operably linked to a CAG promoter.
  • the polynucleotide provided herein is operably linked to a PGK promoter.
  • the polynucleotide provided herein is operably linked to a CAG promoter.
  • tissue specific promoter can be a promoter that selectively enhances or facilitates transcription of a gene in certain cell types (e.g., a monocyte and/or macrophage), but not in other cell types (e.g, a non-monotype or a non-macrophage).
  • a representative non-myeloid reference cell may be a HeLa or a 293T cell.
  • the promoter is a myeloid-specific promoter.
  • myeloid specific promoter is intended to mean a promoter that enhances or facilitates transcription of a gene in a myeloid cell (e.g., a macrophage or monocyte), relative to a non- myeloid cell as measured by, for example, a reporter gene assay (e.g, a luciferase, or chemiluminescent reporter assay) or measure of the downstream protein encoded by the gene.
  • the myeloid specific promoter enhances transcription of a reporter gene (e.g., GFP) in a monocyte or macrophage, relative to a constitutively active promoter (e.g, CMV), and the myeloid specific promoter does not enhance transcription of a reporter gene (e.g, GFP) in a non-myeloid reference cell, relative to a constitutively active promoter (e.g., CMV).
  • a reporter gene e.g., GFP
  • CMV constitutively active promoter
  • a representative non-myeloid reference cell may be, for example, a human intestinal epithelial cell (e.g, Caco-2), a cervix epithelioid carcinoma cell (e.g, HeLa), a human embryonic kidney cell 293 (e.g., HEK-293 or 293 T), a T lymphocyte (e.g, Jurkat), or a mouse osteoblast (e.g., Oct-1).
  • a human intestinal epithelial cell e.g, Caco-2
  • a cervix epithelioid carcinoma cell e.g, HeLa
  • a human embryonic kidney cell 293 e.g., HEK-293 or 293 T
  • T lymphocyte e.g, Jurkat
  • mouse osteoblast e.g., Oct-1
  • the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 5-fold, relative to in a non-myeloid cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 10-fold, relative to in a non-myeloid cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 20-fold, relative to in a non-myeloid cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 50-fold, relative to in a non-myeloid cell.
  • the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 75-fold, relative to in a non-myeloid cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 100-fold, relative to in a non-myeloid cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell about 5-fold to about 100-fold, relative to in a non-myeloid cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell about 10-fold to about 100-fold, relative to in a non- myeloid cell.
  • the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell about 25-fold to about 100-fold, relative to in a non-myeloid cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell about 50-fold to about 100-fold, relative to in a non-myeloid cell.
  • the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 5-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell . In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 10-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell. Tn some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 20-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell.
  • the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 50-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 75-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell approximately 100-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell.
  • the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell about 5-fold to about 100-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell about 10-fold to about 100-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell about 25-fold to about 100-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell. In some embodiments, the myeloid specific promoter enhances transcription in a macrophage and/or monocyte cell about 50-fold to about 100-fold, relative to a constitutively active promoter in the macrophage and/or monocyte cell.
  • the myeloid specific promoter is a native macrophage or a native monocyte promoter, or fragment thereof.
  • the promoter can include the full- length, or a fraction thereof, of the promoter of a gene that is expressed in monocytes and/or macrophages (e. ., CD36, CD68, CDl lb, or CSF1R).
  • the promoter can include the full-length, or a fraction thereof, of the promoter of a gene that is selectively expressed in monocytes and/or macrophages relative to a non-monotype or a non-macrophage, such as, for example, a HeLa or 293 T cell.
  • the myeloid specific promoter is synthetic promoter. Techniques known to one of skill in the art or described herein (e.g., Section 5.9.3 or in the Examples) may be used to generate and screen synthetic promoters. For example, synthetic promoters can be generated by random ligation of myeloid/macrophage cis elements. Tn some embodiments, synthetic promoter is selected from the group consisting of synthetic promoter- 146 (SP146) (GenBank: DQ107383.1), synthetic promoter-107 (SP107) (GenBank: DQ107382.1), and synthetic promoter-60 (SP60) (GenBank: DQ107381.1). In some embodiments, the promoter is a SP146 promoter. In some embodiments, the promoter is a SP107 promoter. In some embodiments, the promoter is a SP60 promoter. Exemplary promoter polynucleotide sequences are provided in Table 5.
  • a promotor provided herein comprises a promoter within any of the nucleotide sequences provided in Table 5.
  • a promoter provided herein comprises a promote that is at least 90%, at least 95%, or 100% identical to a polynucleotide sequence provided in Table 5.
  • a promoter provided herein comprises a promoter that is at least 90%, at least 95%, or 100% identical to SEQ ID NO: 122.
  • a promoter provided herein comprises a promoter that is at least 90%, at least 95%, or 100% identical to SEQ ID NO: 123.
  • a promoter provided herein comprises a promoter that is at least 90%, at least 95%, or 100% identical to SEQ ID NO: 124.
  • Table 5 Exemplary promoter polynucleotide sequences 5.3. Vectors
  • a vector comprising a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2).
  • the vector is viral vector.
  • the viral vector is selected from the group consisting of an adenoviral vector, a lentiviral vector, and a retroviral vector.
  • the vector is an adenoviral vector.
  • the vector is a lentiviral vector.
  • the vector is a retroviral vector.
  • the vector comprises one or more selection markers.
  • selection markers include, for example, drug resistance genes for G418 (neo), puromycin (pac), hygromycin B (hph), zeocin (zeo), blasticidin S (bsd), and histidinol (hisD), as well selection markers suitable for fluorescence-activated cell sorting (FACS), such as, green fluorescent protein (GFP), yellow fluorescent protein (YFP), mCherry, and cyan fluorescent protein (CFP).
  • the one or more selection markers are operably linked to a promoter that is different from the promoter that regulates expression of the CAR.
  • the one or more selection markers are operably linked to a promoter selected from the group consisting of EFla, CAG, T7 and PGK.
  • the one or more selection markers are operably linked to a EFla promoter.
  • the one or more selection markers are operably linked to a CAG promoter.
  • the one or more selection markers are operably linked to a PGK promoter
  • the one or more selection markers are operably linked to a T7 promoter.
  • the vector comprises constitutive expression or for inducible expression.
  • the vector comprises constitutive expression. In some embodiments, the vector comprises inducible expression.
  • the selection of promoters e.g., strong, weak, tissue-specific, inducible and developmental-specific, is within the ordinary skill of the artisan.
  • the vector comprises two or more selection markers that are muliticistronic.
  • one selection marker e.g., a drug resistance gene
  • another selection marker e.g., a selection marker suitable for fluorescence-activated cell sorting (FACS)
  • FACS fluorescence-activated cell sorting
  • one selection marker e.g., a selection marker suitable for fluorescence-activated cell sorting (FACS)
  • FACS fluorescence-activated cell sorting
  • another selection marker e.g., a drug resistance gene
  • one selection marker e.g., a drug resistance gene
  • IRES Internal Ribosome Entry Site
  • another selection marker e.g., a selection marker suitable for fluorescence-activated cell sorting (FACS) is downstream the IRES element.
  • one selection marker e.g., a selection marker suitable for fluorescence- activated cell sorting (FACS)
  • FACS fluorescence- activated cell sorting
  • *(GSG) residues can be added to the 5' end of the peptide to improve cleavage efficiency.
  • the vector is designed for transient expression, stable expression, or both. In some embodiments, the vector is designed for stable expression. In some embodiments, the vector is designed for transient expression.
  • a CAR (such as a CAR describe in Section 5.1) comprising an antigen recognition moiety polypeptide (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain polypeptide (such as a hinge domain described in Section 5.1.2), a transmembrane domain polypeptide (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain polypeptide (such as an intracellular domain described in Section 5.1.4), and the transmembrane domain polypeptide and/or intracellular domain polypeptide comprise domains derived from a receptor associated with macrophage activity.
  • an antigen recognition moiety polypeptide such as an antigen recognition moiety described in Section 5.1.1
  • a hinge domain polypeptide such as a hinge domain described in Section 5.1.2
  • a transmembrane domain polypeptide such as a transmembrane domain described in Section 5.1.3
  • an intracellular domain polypeptide such as an intracellular domain described in Section 5.1.4
  • the CAR provided herein comprises an antigen recognition moiety polypeptide (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain polypeptide (such as a hinge domain described in Section 5.1.2), a transmembrane domain polypeptide (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain polypeptide (such as an intracellular domain described in Section 5.1.4), and the transmembrane domain polypeptide comprises a transmembrane domain derived from a receptor associated with macrophage activity.
  • an antigen recognition moiety polypeptide such as an antigen recognition moiety described in Section 5.1.1
  • a hinge domain polypeptide such as a hinge domain described in Section 5.1.2
  • a transmembrane domain polypeptide such as a transmembrane domain described in Section 5.1.3
  • an intracellular domain polypeptide such as an intracellular domain described in Section 5.1.4
  • the CAR provided herein comprises an antigen recognition moiety polypeptide (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain polypeptide (such as a hinge domain described in Section 5.1.2), a transmembrane domain polypeptide (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain polypeptide (such as an intracellular domain described in Section 5.1.4), and the intracellular domain polypeptide comprises an intracellular domain derived from a receptor associated with macrophage activity.
  • an antigen recognition moiety polypeptide such as an antigen recognition moiety described in Section 5.1.1
  • a hinge domain polypeptide such as a hinge domain described in Section 5.1.2
  • a transmembrane domain polypeptide such as a transmembrane domain described in Section 5.1.3
  • an intracellular domain polypeptide such as an intracellular domain described in Section 5.1.4
  • the CAR provided herein comprises an antigen recognition moiety polypeptide (such as an antigen recognition moiety described in Section 5.1.1), a hinge domain polypeptide (such as a hinge domain described in Section 5.1.2), a transmembrane domain polypeptide (such as a transmembrane domain described in Section 5.1.3), and an intracellular domain polypeptide (such as an intracellular domain described in Section 5.1.4), and both the transmembrane domain polypeptide and intracellular domain polypeptide comprise domains derived from a receptor associated with macrophage activity.
  • the macrophage activity comprises secretion of a pro-inflammatory cytokine.
  • the macrophage activity comprises phagocytosis of a cell expressing a target antigen. In some embodiments, the macrophage activity comprises secretion of a pro-inflammatory cytokine and phagocytosis of a cell expressing a target antigen.
  • a CAR comprising: (a) an antigen recognition moiety polypeptide; (b) a CD8 hinge domain polypeptide; (c) a transmembrane domain polypeptide, wherein the transmembrane domain polypeptide is selected from the group consisting of (i) a CD8 transmembrane domain polypeptide; (ii) a SLAMF7 transmembrane domain polypeptide; (iii) a CD86 transmembrane domain polypeptide; (iv) a DECTIN 1 transmembrane domain polypeptide, and (v) a CSF1R transmembrane domain polypeptide; (d) a first intracellular signaling domain polypeptide, wherein the first intracellular signaling domain polypeptide is selected from the group consisting of: (i) a CD86 intracellular signaling domain polypeptide; (ii) a Loxlc intracellular signaling domain polypeptide, and (iii)
  • a CAR comprising: (a) an antigen recognition moiety polypeptide; (b) a CD8 hinge domain polypeptide; (c) a transmembrane domain polypeptide, wherein the transmembrane domain polypeptide is selected from the group consisting of (i) a CD8 transmembrane domain polypeptide; and (ii) a CSF1R transmembrane domain polypeptide; (d) and an intracellular domain polypeptide comprising a CD3 ⁇ intracellular signaling domain polypeptide.
  • a CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:1 (e g., 98%, 99%, or 100% identical to SEQ ID NO: 1).
  • the CD8 hinge domain polypeptide comprises an amino acid sequence of SEQ ID NO: 1.
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:1 further comprises a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:1 and a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11. In some embodiments, the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:11. In certain embodiments, the CAR comprising a CD8 hinge domain polypeptide and a CD8 transmembrane domain polypeptide further comprises a first intracellular signaling domain polypeptide comprising a CD86 intracellular signaling domain polypeptide.
  • the CAR comprises a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 , a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11, and a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40.
  • the CAR comprising a CD8 hinge domain polypeptide, a CD8 transmembrane domain polypeptide, and a first intracellular signaling domain polypeptide comprising a CD86 intracellular signaling domain polypeptide, further comprises a second intracellular signaling domain polypeptide comprising a CD3 ⁇ intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:11, a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40, and a CD3C, intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO: 89.
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:1 further comprises a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:1 and a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11 .
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11. In some embodiments, the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11. In certain embodiments, the CAR comprising a CD8 hinge domain polypeptide and a CD8 transmembrane domain polypeptide further comprises a first intracellular signaling domain polypeptide comprising a LOX1C intracellular signaling domain polypeptide.
  • the CAR comprises a LOXIC intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:41.
  • the CAR comprises CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11 , and a L0X1 C intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NONE
  • the CAR comprising a CD8 hinge domain polypeptide, a CD8 transmembrane domain polypeptide, and a first intracellular signaling domain polypeptide comprising a LOX1C intracellular signaling domain polypeptide further comprises a second intracellular signaling domain polypeptide comprising a CD3C, intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:11, a LOX1C intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:41, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:89.
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:1 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:1) further comprises a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:1 and a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11. In some embodiments, the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NON E In certain embodiments, the CAR comprising a CD8 hinge domain polypeptide and a CD8 transmembrane domain polypeptide further comprises an intracellular signaling domain polypeptide comprising a CD3t intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:11, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:89.
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:1 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:1) further comprises a SLAMF7 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a SLAMF7 transmembrane domain polypeptide. In some embodiments, the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a SLAMF7 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 12. In certain embodiments, the CAR comprising a CD8 hinge domain polypeptide and a SLAMF7 transmembrane domain polypeptide further comprises a first intracellular signaling domain polypeptide comprising a CD86 intracellular signaling domain polypeptide.
  • the CAR comprises a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a SLAMF7 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 12, and a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40.
  • the CAR comprising a CD8 hinge domain polypeptide, a SLAMF7 transmembrane domain polypeptide, and a first intracellular signaling domain polypeptide comprising a CD86 intracellular signaling domain polypeptide, further comprises a second intracellular signaling domain polypeptide comprising a CD3C intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a SLAMF7 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 12, a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:1 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:1).
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO: 1 (e g , 98%, 99%, or 100% identical to SEQ ID NO:1) further comprises a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:1 and a CD8 transmembrane domain polypeptide.
  • the CAR comprising a CD8 hinge domain polypeptide and a CD8 transmembrane domain polypeptide further comprises a first intracellular signaling domain polypeptide comprising a CD40 intracellular signaling domain polypeptide.
  • the CAR comprises a CD40 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:46.
  • the CAR comprising a CD8 hinge domain polypeptide, a CD8 transmembrane domain polypeptide, and a first intracellular signaling domain polypeptide comprising a CD40 intracellular signaling domain polypeptide further comprises a second intracellular signaling domain polypeptide comprising a CD3 ⁇ intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:11, a CD40 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:46, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:89.
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:1 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:1) further comprises a CD86 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:1 and a CD86 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD86 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 13.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD86 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 13. In some embodiments, the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CD86 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:13. In certain embodiments, the CAR comprising a CD8 hinge domain polypeptide and a CD86 transmembrane domain polypeptide further comprises a first intracellular signaling domain polypeptide comprising a 2B4 intracellular signaling domain polypeptide.
  • the CAR comprises a 2B4 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:42.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a CD86 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 13, and a 2B4 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:42.
  • the CAR comprising a CD8 hinge domain polypeptide, a CD86 transmembrane domain polypeptide, and a first intracellular signaling domain polypeptide comprising a 2B4 intracellular signaling domain polypeptide, further comprises a second intracellular signaling domain polypeptide comprising a CD3 ⁇ intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a CD86 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 13, a 2B4 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:42, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO: 89.
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:1 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:1) further comprises a DECTINl transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a DECTTN1 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a DECTIN1 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 14.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a DECTIN 1 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 14. In some embodiments, the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a DECTIN1 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 14. In certain embodiments, the CAR comprising a CD8 hinge domain polypeptide and a DECTINl transmembrane domain polypeptide further comprises a first intracellular signaling domain polypeptide comprising a DECTIN1 intracellular signaling domain polypeptide.
  • the CAR comprises a DECTTN1 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:43.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a DECTIN1 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 14, and a DECTIN1 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:43.
  • the CAR comprising a CD8 hinge domain polypeptide, a DECTIN1 transmembrane domain polypeptide, and a first intracellular signaling domain polypeptide comprising a DECTINl intracellular signaling domain polypeptide, further comprises a second intracellular signaling domain polypeptide comprising a CD3 ⁇ intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a DECTIN1 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 14, a DECTIN1 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:43, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO: 89.
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:1 further comprises a CSF1R transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CSF1R transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1 and a CSF1R transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:33.
  • the CAR comprising a CD8 hinge domain polypeptide and a CSF1R transmembrane domain polypeptide further comprises an intracellular signaling domain polypeptide comprising a CD3C, intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 1, a CSF1R transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:33, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:4 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:4).
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:4 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:1) further comprises a SLAMF7 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:4 and a SLAMF7 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:4 and a SLAMF7 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 12.
  • the CAR comprising a CD8 hinge domain polypeptide and a SLAMF7 transmembrane domain polypeptide further comprises a first intracellular signaling domain polypeptide comprising a CD86 intracellular signaling domain polypeptide.
  • CAR comprises a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40.
  • CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 4, a SLAMF7 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 12, and a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40.
  • the CAR comprising a CD8 hinge domain polypeptide, a SLAMF7 transmembrane domain polypeptide, and a first intracellular signaling domain polypeptide comprising a CD86 intracellular signaling domain polypeptide further comprises a second intracellular signaling domain polypeptide comprising a CD3 ⁇ intracellular signaling domain polypeptide.
  • CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 4, a SLAMF7 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 12, a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NON (e.g., 98%, 99%, or 100% identical to SEQ ID NON).
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:4 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:1) further comprises a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:4 and a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:4 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11.
  • the CAR comprising a CD8 hinge domain polypeptide and a CD8 transmembrane domain polypeptide further comprises a first intracellular signaling domain polypeptide comprising a CD86 intracellular signaling domain polypeptide.
  • the CAR comprises a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40.
  • a CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 4, a SLAMF7 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11, and a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40.
  • the CAR comprising a CD8 hinge domain polypeptide, a CD8 transmembrane domain polypeptide, and a first intracellular signaling domain polypeptide comprising a CD86 intracellular signaling domain polypeptide further comprises a second intracellular signaling domain polypeptide comprising a CD3t intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 4, a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:11, a CD86 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:40, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:89.
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:4 further comprises a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:4 and a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:4 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:4 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO: 11. In some embodiments, the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:4 and a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:11. In certain embodiments, the CAR comprising a CD8 hinge domain polypeptide and a CD8 transmembrane domain polypeptide further comprises an intracellular signaling domain polypeptide comprising a CD3t intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 4, a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:11, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:89.
  • a CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:4 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:4).
  • the CAR comprising a CD8 hinge domain polypeptide comprising an amino acid sequence at least 98% identical to SEQ ID NO:4 (e.g., 98%, 99%, or 100% identical to SEQ ID NO:1) further comprises a CD8 transmembrane domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO:4 and a CD8 transmembrane domain polypeptide.
  • the CAR comprising a CD8 hinge domain polypeptide and a CD8 transmembrane domain polypeptide further comprises a first intracellular signaling domain polypeptide comprising a CD40 intracellular signaling domain polypeptide.
  • the CAR comprises a CD40 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:46.
  • the CAR comprising a CD8 hinge domain polypeptide, a CD8 transmembrane domain polypeptide, and a first intracellular signaling domain polypeptide comprising a CD40 intracellular signaling domain polypeptide further comprises a second intracellular signaling domain polypeptide comprising a CD3 ⁇ intracellular signaling domain polypeptide.
  • the CAR comprises a CD8 hinge domain polypeptide comprising an amino acid sequence of SEQ ID NO: 4, a CD8 transmembrane domain polypeptide comprising an amino acid sequence of SEQ ID NO:1 1 , a CD40 intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO:46, and a CD3 ⁇ intracellular signaling domain polypeptide comprising an amino acid sequence of SEQ ID NO: 89.
  • the CAR provided herein comprises an antigen recognition moiety polypeptide that comprises a scFv antigen recognition moiety polypeptide.
  • the scFv antigen recognition moiety polypeptide recognizes a tumor antigen or fragment thereof.
  • the tumor antigen is selected from your group consisting of HER2/neu, PSMA, Claudinl8, CD20, CD5, BCMA, mesothelin, TAC1, GD2, and CD 19.
  • the tumor antigen comprises HER2/neu.
  • the tumor antigen comprises PSMA.
  • the tumor antigen comprises Claudinl8.
  • the tumor antigen comprises CD20.
  • the tumor antigen comprises CD5. In some embodiments, the tumor antigen comprises BCMA. In some embodiments, the tumor antigen comprises mesothelin. In some embodiments, the tumor antigen comprises TAC1. In some embodiments, the tumor antigen comprises GD2. In some embodiments, the tumor antigen comprises CD19.
  • the chimeric antigen receptor (CAR) of the present disclosure comprises a signal peptide.
  • the signal peptide has an amino acid sequence of MALPVTALLLPLALLLHAARP (SEQ ID NO: 2).
  • the signal peptide has an amino acid sequence with at least 80% sequence identity with SEQ ID NO: 2.
  • the signal peptide has an amino acid sequence with at least 90%, 95%, 97% or 99% sequence identity with SEQ ID NO: 2.
  • the signal peptide has an amino acid sequence of METDTLLLWVLLLWVPGSTG (SEQ ID NO: 109).
  • the signal peptide has an amino acid sequence with at least 80% sequence identity with SEQ ID NO: 109. In some embodiments, the signal peptide has an amino acid sequence with at least 90%, 95%, 97% or 99% sequence identity with SEQ ID NO: 109.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to an amino acid sequence provided in Table 7. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:97-108. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ TD NO:97. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 98.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:99. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 100. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 101. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 102. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 103.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 104. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 105. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 106. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 107. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 108.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:97-108, without the signal peptide.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:97-108, with an alternative signal peptide.
  • the alternative signal peptide is SEQ ID NO: 109.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 110-121. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 110. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 111. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:112.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:1 13. Tn some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 114. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 115. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 116. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:117.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:118. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 119. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 120. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 121. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 125.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 126. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 127. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 128. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 129. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 130.
  • a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO:I3 I. In some embodiments, a CAR provided herein comprises an amino acid sequence at least 90%, at least 95%, or 100% identical to SEQ ID NO: 132.
  • the present disclosure involves modified cells comprising a CAR (such as a CAR described in Section 5.1), a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2), a vector comprising a polynucleotide encoding a CAR (such as a vector described in Section 5.3), or a CAR polypeptide (such as a polypeptide described in Section 5.4).
  • the modified cells provided herein are generated according to the methods provided herein, such as the methods of generating a modified cell described in Section 5.8.
  • the present disclosure relates to modified mammalian cells.
  • modified human cells are autologous or allogeneic to a subject receiving administration of the modified cells.
  • the modified cells are allogeneic, relative to the subject.
  • the modified cells are autologous, relative to the subject.
  • modified non-human mammalian cells are modified non-human mammalian cells.
  • the present disclosure relates, in part, to modified cells that are monocytes or macrophages.
  • the modified cell is a monocyte.
  • the monocyte is derived from an induced pluripotent stem cell (iPSC).
  • iPSC induced pluripotent stem cell
  • the modified cell is a modified iPSC generated according to the methods provided herein, such as the methods described in Section 5.8, and the modified iPSC is differentiated into a monocyte.
  • the monocyte is derived from an iPSC and the iPSC derived monocyte is modified according to the methods provided herein, such as the methods described in Section 5.8.
  • the monocyte is an isolated monocyte.
  • Techniques known to one of skill in the art may be used to isolate monocytes.
  • monocytes can be isolated from the peripheral blood lymphocytes using techniques known to one of skill in the art or described herein.
  • An exemplary isolation method can include plastic adhesion or magnetic beadbased immuno-isolation kits (negative and CD14pos selection).
  • monocytes are isolated based on their expression of CD 14 and CD 16.
  • a subset of monocytes are isolated based on CD I4 hlgh CD16 neg expression. In some embodiments, a subset of monocytes are isolated based on CDM 1 ⁇ 11 CD16 pos expression. In some embodiments, a subset of monocytes are isolated based on CD14 1OW CD l 111811 expression. Alternatively, or in addition, depletion of non-monocytes can be used, such as removal of thrombocytes, to reduce platelet, lymphocyte, and granulocyte contamination. In some embodiments, the isolated monocyte is 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% pure of other cells and/or substances.
  • the modified cell is a macrophage.
  • the modified macrophage is derived from an induced pluripotent stem cell (iPSC).
  • iPSC induced pluripotent stem cell
  • the modified cell is a modified iPSC generated according to the methods provided herein, such as the methods described in Section 5.8, and the modified iPSC is differentiated into a macrophage.
  • the macrophage is derived from an iPSC and the iPSC derived macrophage is modified according to the methods provided herein, such as the methods described in Section 5.8.
  • the macrophage is derived from a modified monocyte that is modified according to the methods provided herein, such as the methods described in Section 5.8.
  • iPSC iPSC into a macrophage
  • monocyte a monocyte into a macrophage.
  • Lyadova et al. (Front Cell Dev Biol., 2021;9:640703).
  • the macrophage is an isolated macrophage. Techniques known to one of skill in the art may be used to isolate macrophages. In some embodiments, a subset of macrophages are isolated based on cell size and morphology. In some embodiments, the isolated macrophage is 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% pure of other cells and/or substances. [00221] In preferred embodiments, the macrophage is a pro-inflammatory macrophage (i.e., an Ml macrophage). In some embodiments, the macrophage secretes TNFa, IL-17A, and/or type 1 cytokines (e.g., IL-6, or IL-12). In some embodiments, the macrophage expresses a marker in Table 8. In some embodiments, the macrophage do not express a marker in Table 3. In some embodiments, expression of the CAR promotes Ml polarization of the macrophage.
  • Ml macrophage pro-inflammatory macrophage
  • the macrophage is not an anti-inflammatory macrophage (z.e., an M2 macrophage).
  • the macrophage does not secrete IL-4, IL- 13, and/or type 2 cytokines.
  • the macrophage does not express a marker in Table 9.
  • expression of the CAR decreases expression of one of more M2 marker.
  • Table 9 Human Macrophage M2 markers.
  • the present disclosure also relates, in part, to modified cells that are iPSCs.
  • the modified cell is a modified iPSC generated according to the methods provided herein, such as the methods described in Section 5.8.
  • the use of modified iPSCs as the starting material can not only aide in overcoming barriers to macrophage expansion, but also facilitate generation of a homogeneous monocytes/macrophage cell population.
  • the modified cells express a CAR, such as a CAR described in Section 5.1. In some embodiments, about 85% or more of the modified cells express a CAR, such as a CAR described in Section 5.1. In some embodiments, about 90% or more of the modified cells express a CAR, such as a CAR described in Section 5.1. In some embodiments, about 95% or more of the modified cells express a CAR, such as a CAR described in Section 5.1. In some embodiments, about 99% or more of the modified cells express a CAR, such as a CAR described in Section 5.1. In some embodiments, 100% of the modified cells express a CAR, such as a CAR described in Section 5.1.
  • the present disclosure relates to modified mammalian cells comprising a genetic disruption of: (a) a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acid-binding Ig-like lectin 10 (SIGLEC10) gene.
  • SIGLEC10 sialic acid-binding Ig-like lectin 10
  • the modified mammalian cells are modified human cells comprising a genetic disruption of: (a) a signal regulatory protein alpha (STRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acidbinding Ig-like lectin 10 (SIGLEC10) gene.
  • STRPA signal regulatory protein alpha
  • CISH cytokine inducible SH2 containing protein
  • SIGLEC10 sialic acidbinding Ig-like lectin 10
  • Exemplary techniques include genome editing tools, such as TALEN (Transcription Activator-Like Effector Nucleases), Zinc-finger nucleases (ZFN), and CRISPR, as well as variations thereof (e.g., base editing, prime editing, etc.); RNA interference (RNAi) (e. ., shRNA, or siRNA), or Cre/LoxP -based conditional knockout.
  • genome editing tools such as TALEN (Transcription Activator-Like Effector Nucleases), Zinc-finger nucleases (ZFN), and CRISPR, as well as variations thereof (e.g., base editing, prime editing, etc.); RNA interference (RNAi) (e. ., shRNA, or siRNA), or Cre/LoxP -based conditional knockout.
  • TALEN Transcription Activator-Like Effector Nucleases
  • ZFN Zinc-finger nucleases
  • CRISPR CRISPR
  • variations thereof e.g.,
  • a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2) is integrated into (a) a SIRPA gene; (b) a CISH gene; and/or (c) a SIGLEC10 gene, and the modified mammalian cell comprises genetic disruption of the gene(s) in which the polynucleotide encoding the CAR is integrated.
  • the gene editing system comprises a CRISPR system.
  • the CRISPR system comprises a Class 2 CRISPR system.
  • Class 2 systems currently represent a single protein that is categorized into three distinct types (types II, V and VI). Any class 2 CRISPR system suitable for gene editing, for example a type II, a type V or a type VI system, is envisaged as within the scope of the instant disclosure.
  • Exemplary Class 2 type II CRISPR systems include Cas9, Csn2 and Cas4.
  • Exemplary Class 2, type V CRISPR systems include, Casl2, Casl2a (e.g., Cpfl, MAD7), Casl2b (C2cl), Casl2c (C2c3), Casl2d (CasY), Casl2e (CasX), Casl2f, Casl2g, Casl2h, Casl2i and Casl2k (C2c5).
  • Exemplary Class 2 Type VI systems include Cast 3, Cast 3a (C2c2) Cast 3b, Casl3c and Cast 3d.
  • the endonuclease protein (e.g., nucleic acid-directed nuclease) may be derived from any bacterial or archaeal Cas protein. Any suitable CRISPR system is contemplated as within the scope of the instant disclosure.
  • the endonuclease protein comprises one or more of Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl2, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof.
  • the endonuclease protein is a Cas9 protein, a Cpfl protein, a C2cl protein, a C2c2 protein, a C2c3 protein, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Casl O, Casl 2, modified versions thereof, or combinations or complexes of these.
  • the Class 2 CRISPR system comprises a type V system.
  • the Type V system comprises a Casl2a CRISPR/Cas protein.
  • Exemplary Casl2a proteins include MAD7, isolated from Eubacterium rectale.
  • MAD7 uses T-rich protospacer adjacent motifs (PAMs) such as YTTN.
  • PAMs T-rich protospacer adjacent motifs
  • Exemplary MAD7 proteins are described in US 20190360001 and WO 2021119563, the contents of which are incorporated by reference herein in their entireties.
  • the modified cells provided herein comprise genetic disruption of SIRPA (e. ., homo sapiens NCBI Gene ID: 140885, mus musculus NCBI Gene ID: 19261).
  • SIRPA encodes a SIRPa polypeptide, an immunoglobulin-like cell surface receptor for CD47.
  • genetic disruption of SIRPA prevents or reduces expression of a SIRPa polypeptide capable of interaction with CD47.
  • genetic disruption of SIRPA prevents a SIRPa polypeptide from being capable of interaction with CD47.
  • the SIRPA gene is a human SIRPA gene.
  • the SIRPA gene is a non-human SIRPA gene (e.g., a mouse SIRPA gene).
  • genetic disruption of SIRPA is performed by a genome editing tool, such as TALEN, ZFN, or CRISPR (e.g., by deletion of one or more exons, introduction of a stop codon, introduction of a null mutation or inactivation of the promoter).
  • genetic disruption of SIRPA is performed using gRNA.
  • genetic disruption of SIRPA is performed using gRNA and a Casl2a protein.
  • genetic disruption is performed using gRNA and a MAD7 protein.
  • the gRNA comprises a targeting sequence complementary to a SIRPA target sequence.
  • the SIRPA target sequence comprises coding sequence, for example SIRPA mRNA sequence.
  • the gRNA targets exon 1 of SIRPA.
  • the gRNA targets exon 2 of SIRPA.
  • exon 2 of SIRPA can be targeted with a guide RNA (gRNA), such as a guide RNA sequence
  • the gRNA targets exon 3 of SIRPA. In some embodiments, the gRNA targets exon 4 of SIRPA. In some embodiments, the gRNA targets exon 5 of SIRPA Tn some embodiments, the gRNA targets exon 6 of SIRPA. Tn some embodiments, the gRNA targets exon 7 of SIRPA. In some embodiments, the gRNA targets exon 8 of SIRPA. In some embodiments, the gRNA targets exon 9 of SIRPA. In some embodiments, the gRNA targets exon 10 of SIRPA. In some embodiments, the gRNA targets exon 11 of SIRPA.
  • the gRNA targets exon 12 of SIRPA.
  • the SIRPA target sequence comprises non-coding sequence.
  • Exemplary noncoding sequence includes SIRPA intronic, promoter, 5’ untranslated region (UTR), 3’ UTR, or enhancer sequence.
  • genetic disruption of SIRPA is performed by RNAi.
  • the genetic disruption of SIRPA is performed by conditional knockout.
  • the genetic disruption of SIRPA is performed in human cells.
  • the modified cells comprise an agent capable of preventing or reducing interaction between CD47 and SIRPoc (see, e.g., WO 2019/241403, incorporated by reference in its entirety).
  • the agent comprises an anti-CD47 antibody.
  • suitable anti-CD47 antibodies include clones B6H12, 5F9, 8B6, and C3 (see, e.g., WO 2011/143624, incorporated by reference in its entirety).
  • the agent comprises a soluble CD47 polypeptide.
  • the agent comprises an anti -SIRPoc antibody.
  • the modified cells provided herein comprise genetic disruption of CISH (e.g., homo sapiens NCBI Gene ID: 1154, mus musculus NCBI Gene ID: 12700).
  • CISH is an inhibitory immune checkpoint gene.
  • genetic disruption of CISH prevents or reduces expression of a CISH polypeptide.
  • the CISH gene is a human CISH gene.
  • the CISH gene is a non-human CISH gene (e.g., a mouse CISH gene).
  • genetic disruption of CISH is performed by a genome editing tool, such as TALEN, ZFN, or CRISPR (e.g., by deletion of one or more exons, introduction of a stop codon, introduction of a null mutation or inactivation of the promoter).
  • genetic disruption of CISH is performed using gRNA.
  • genetic disruption of CISH is performed using gRNA and a Casl2a protein.
  • genetic disruption is performed using gRNA and a MAD7 protein.
  • the gRNA comprises a targeting sequence complementary to a CISH target sequence.
  • the CISH target sequence comprises coding sequence, for example CISH mRNA sequence.
  • the gRNA targets exon 1 of CISH. In some embodiments, the gRNA targets exon 2 of CISH. In some embodiments, the gRNA targets exon 3 of CISH. In some embodiments, the gRNA targets exon 4 of CISH. In some embodiments, the CISH target sequence comprises non-coding sequence. Exemplary non-coding sequence includes CISH intronic, promoter, 5’ untranslated region (UTR), 3’ UTR, or enhancer sequence. In some embodiments the gRNA is compatible with a gRNA/Cas9 system. In some embodiments the gRNA is compatible with a gRNA/Casl2a (e. ., MAD7) system.
  • genetic disruption of CISH is performed by RNAi. In some embodiments, genetic disruption of CISH is performed by conditional knockout.
  • CISH inhibitors including CISH guide RNAs (gRNAs), include those provided in WO 2017/100861, WO 2017/023803, WO 2018/075664, WO 2019/213610, and WO 2019/217956, each of which are incorporated by reference in its entirety.
  • the genetic disruption of CISH is performed in human cells.
  • the modified cells provided herein comprise genetic disruption of SIGLEC10 (e.g., Homo sapiens NCBI Gene ID: 89790, mus musculus NCBI Gene ID: 243958).
  • SIGLEC10 is a ligand for CD52, vascular adhesion protein 1 (VAP-1), and CD24.
  • VAP-1 vascular adhesion protein 1
  • the CD24- SIGLEC10 interaction can serve as an anti-phagocytic signal (see, e.g., Barkal AA, et al., Nature. 2019 Aug;572(7769):392-396).
  • genetic disruption of SIGLEC10 prevents or reduces expression of a SIGLEC10 polypeptide capable of interaction with CD24 on a target cell.
  • genetic disruption of SIGLEC10 prevents a SIGLEC10 polypeptide from being capable of interaction with CD24 on a target cell.
  • the SIGLEC10 gene is a human SIGLEC10 gene.
  • the SIGLEC10 gene is a non-human SIGLEC10 gene e.g., a mouse SIGLEC10 gene).
  • genetic disruption of SIGLEC10 is performed by a genome editing tool, such as TALEN, ZFN, or CRISPR e.g., by deletion of one or more exons, introduction of a stop codon, introduction of a null mutation or inactivation of the promoter).
  • genetic disruption of SIGLEC10 is performed using gRNA.
  • genetic disruption of SIGLEC10 is performed using gRNA and a Casl2a protein.
  • genetic disruption is performed using gRNA and a MAD7 protein.
  • the gRNA comprises a targeting sequence complementary to a SIGLEC10 target sequence.
  • the SJGLEC10 target sequence comprises coding sequence, for example SIGLEC10 mRNA sequence.
  • the gRNA targets exon 1 of SIGLEC10.
  • the gRNA targets exon 2 of SIGLEC10.
  • the gRNA targets exon 3 of SIGLEC10.
  • the gRNA targets exon 4 of SIGLEC10.
  • the gRNA targets exon 5 of SIGLEC10.
  • the gRNA targets exon 6 of SIGLECIO.
  • the gRNA targets exon 7 of SIGLEC10.
  • the gRNA targets exon 9 of SIGLEC10.
  • the gRNA targets exon 10 of SIGLEC10. In some embodiments, the gRNA targets exon 11 of SIGLEC10. In some embodiments, the SIGLEC10 target sequence comprises non-coding sequence. Exemplary noncoding sequence includes SIGLECIO intronic, promoter, 5’ untranslated region (UTR), 3’ UTR, or enhancer sequence. In some embodiments, genetic disruption of SIGLEC10 is performed by RNAi. In some embodiments, genetic disruption of SIGLEC10 is performed by conditional knockout. In some embodiments, the genetic disruption of SIGLECIO is performed in human cells.
  • the modified cell comprises an agent capable of preventing or reducing interaction between CD24 and SIGLECIO (see, e.g., WO 2019/241403, incorporated by reference in its entirety).
  • the agent comprises an anti-CD24 antibody.
  • the agent comprises an anti-SIGLEClO antibody.
  • the agent comprises a soluble SIGLECIO polypeptide.
  • the modified cells provided herein comprise genetic disruption of SIRPA and CISH. In certain embodiments, the modified cells provided herein comprise genetic disruption of SIRPA and SIGLECIO. In further embodiments, the modified cells provided herein comprise genetic disruption of SIGLECIO and CISH. In still further embodiments, the modified cells provided herein comprise genetic disruption of SIGLECIO, CISH, and SIRPA. In some embodiments, genetic disruption prevents or reduces expression of the full-length protein encoded by the gene.
  • the modified cells provided herein comprise a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2) that is integrated into (a) a SIRPA gene; (b) a CISH gene; and/or (c) a SIGLECIO gene, and the modified cell comprises genetic disruption of the gene(s) in which the polynucleotide encoding the CAR is integrated.
  • a CAR such as a polynucleotide described in Section 5.2
  • a composition comprising a modified cell of the present disclosure (such as a modified cell described in Section 5.5).
  • a composition comprising a modified monocyte of the present disclosure such as a modified monocyte described in Section 5.5.
  • a composition comprising a modified macrophage of the present disclosure such as a modified macrophage described in Section 5.5.
  • a composition comprising a modified iPSC of the present disclosure such as a modified iPSC described in Section 5.5).
  • the modified cell provided herein (such as a such as a modified cell described in Section 5.5) comprises a genetic disruption of (a) a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acid-binding Ig-like lectin 10 (SIGLEC10) gene.
  • the modified cell provided herein comprises genetic disruption of SIRPA.
  • the modified cell provided herein comprises genetic disruption of CISH.
  • the modified cell provided herein comprises genetic disruption of SIGLEC10.
  • the modified cell provided herein comprises genetic disruption of SIRPA and CISH.
  • the modified cell provided herein comprises genetic disruption of SIRPA and SIGLEC10. In further embodiments, the modified cell provided herein comprises genetic disruption of SIGLEC10 and CISH. In still further embodiments, the modified cell provided herein comprises genetic disruption of SIGLEC10, CISH, and SIRPA. In certain embodiments, the modified cell provided herein comprises a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2) that is integrated into (a) a SIRPA gene; (b) a CISH gene; and/or (c) a SIGLEC10 gene, and the modified cell comprises genetic disruption of the gene(s) in which the polynucleotide encoding the CAR is integrated.
  • a CAR such as a polynucleotide described in Section 5.2
  • a pharmaceutical composition comprising a modified cell of the present disclosure (such as a modified cell described in Section 5.5) and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising a modified monocyte of the present disclosure (such as a modified monocyte described in Section 5.5) and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising a modified macrophage of the present disclosure (such as a modified macrophage described in Section 5.5) and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising a modified iPSC of the present disclosure (such as a modified iPSC described in Section 5.5) and a pharmaceutically acceptable carrier.
  • the modified cell provided herein comprises a genetic disruption of: (a) a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acid-binding Ig-like lectin 10 (SIGLEC10) gene.
  • the modified cell provided herein comprises genetic disruption of SIRPA.
  • the modified cell provided herein comprises genetic disruption of CISH.
  • the modified cell provided herein comprises genetic disruption of SIGLEC10.
  • the modified cell provided herein comprises genetic disruption of SIRPA and CISH.
  • the modified cell provided herein comprises genetic disruption of SIRPA and SIGLEC10.
  • the modified cell provided herein comprises genetic disruption of SIGLEC10 and CISH. In still further embodiments, the modified cell provided herein comprises genetic disruption of SIGLEC10, CISH, and SIRPA. In certain embodiments, the modified cell provided herein comprises a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2) that is integrated into (a) a SIRPA gene; (b) a CISH gene; and/or (c) a SIGLEC10 gene, and the modified cell comprises genetic disruption of the gene(s) in which the polynucleotide encoding the CAR is integrated.
  • a CAR such as a polynucleotide described in Section 5.2
  • a pharmaceutical composition comprising an effective amount of a modified cell of the present disclosure (such as a modified cell described in Section 5.5) and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising an effective amount of a modified monocyte of the present disclosure (such as a modified monocyte described in Section 5.5) and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising an effective amount of a modified macrophage of the present disclosure (such as a modified macrophage described in Section 5.5) and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising an effective amount of a modified iPSC of the present disclosure (such as a modified iPSC described in Section 5.5) and a pharmaceutically acceptable carrier.
  • the modified cell provided herein comprises a genetic disruption of: (a) a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acid-binding Tg-like lectin 10 (STGLEC10) gene.
  • SIRPA signal regulatory protein alpha
  • CISH cytokine inducible SH2 containing protein
  • STGLEC10 sialic acid-binding Tg-like lectin 10
  • the modified cell provided herein comprises genetic disruption of SIGLEC10. In specific embodiments, the modified cell provided herein comprises genetic disruption of SIRPA and CISH. In certain embodiments, the modified cell provided herein comprises genetic disruption of SIRPA and SIGLEC10. In further embodiments, the modified cell provided herein comprises genetic disruption of SIGLEC10 and CISH. In still further embodiments, the modified cell provided herein comprises genetic disruption of SIGLEC10, CISH, and SIRPA.
  • the modified cell provided herein comprises a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2) that is integrated into (a) a SIRPA gene; (b) a CISH gene; and/or (c) a SIGLEC10 gene, and the modified cell comprises genetic disruption of the gene(s) in which the polynucleotide encoding the CAR is integrated.
  • a CAR such as a polynucleotide described in Section 5.2
  • the modified cell comprises genetic disruption of the gene(s) in which the polynucleotide encoding the CAR is integrated.
  • the term “pharmaceutically acceptable” when used in reference to a carrier is intended to mean that the carrier, diluent or excipient is not toxic or otherwise undesirable, (z.e., the material may be administered to a subject without causing any undesirable biological effects), and it is compatible with the other ingredients of the formulation.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as saline solutions.
  • a saline solution can be a carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • the pharmaceutical composition comprising a modified cell of the present disclosure (such as a modified cell described in Section 5.5) and a pharmaceutically acceptable carrier further comprises one or more agents.
  • the agent comprises an anti-CD24 antibody.
  • the agent comprises an anti- SIGLEC10 antibody.
  • the agent comprises an anti-CD47 antibody.
  • suitable anti-CD47 antibodies include clones B6H12, 5F9, 8B6, and C3 (see, e.g., WO 2011/143624, incorporated by reference in its entirety).
  • the agent comprises a soluble CD47 polypeptide.
  • the agent comprises an anti- SIRPa antibody.
  • the agent comprises an anti-CD20 antibody (e.g., rituximab). In some embodiments, the agent comprises an anti-HER2/neu antibody (e.g., trastuzumab). In certain embodiments, the modified cell of the present disclosure is precomplexed with one or more agents.
  • the agent comprises an anti-CD24 antibody.
  • the agent comprises an anti-SIGLEClO antibody.
  • the agent comprises an anti-CD47 antibody.
  • suitable anti-CD47 antibodies include clones B6H12, 5F9, 8B6, and C3 (see, e.g., WO 2011/143624, incorporated by reference in its entirety).
  • the agent comprises a soluble CD47 polypeptide.
  • the agent comprises an anti- SIRPa antibody. In some embodiments, the agent comprises an anti-CD20 antibody (e.g., rituximab). In some embodiments, the agent comprises an anti-HER2/neu antibody (e.g., trastuzumab). In certain embodiments, the modified cell of the present disclosure is precomplexed with one or more agents.
  • the modified cells of the present disclosure that comprise a CAR are suitable for use as a cell-based therapy or therapies, such as in a method of treating cancer.
  • the modified cells of the present disclosure that comprise a CAR are suitable for use in a method of treating autoimmune disorders.
  • the modified cells of the present disclosure that comprise a CAR are suitable for use in a method of treating fibrosis.
  • an effective amount of the modified cells described in Section 5.5 can be combined with a pharmaceutically acceptable carrier to result in a pharmaceutical composition.
  • the cells provided herein comprise a genetic disruption of: (a) a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CTSH) gene; and/or (c) a sialic acid-binding Ig-like lectin 10 (SIGLEC10) gene.
  • the cells provided herein comprise genetic disruption of SIRPA.
  • the cells provided herein comprise genetic disruption of CISH.
  • the cells provided herein comprise genetic disruption of STGLEC10.
  • Tn specific embodiments, the cells provided herein comprise genetic disruption of SIRPA and CISH.
  • the cells provided herein comprise genetic disruption of SIRPA and SIGLEC10.
  • the cells provided herein comprise genetic disruption of SIGLEC10 and CISH. In still further embodiments, the cells provided herein comprise genetic disruption of SIGLEC10, CISH, and SIRPA.
  • the modified cell provided herein comprises a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2) that is integrated into (a) a SIRPA gene; (b) a CISH gene; and/or (c) a SIGLEC10 gene, and the modified cell comprises genetic disruption of the gene(s) in which the polynucleotide encoding the CAR is integrated.
  • treatment with modified cells of the present disclosure results in one, two, or more, or all of the following: (1) a reduction in severity, progression, spread, and/or frequency of one or more symptoms, (2) elimination of one or more symptoms and/or underlying cause, (3) prevention of the occurrence of one or more symptoms and/or their underlying cause, and (4) improvement or remediation of damage.
  • treatment includes therapeutic treatment as well as prophylactic, or suppressive measures for the condition, disease or disorder.
  • the modified cells of the present disclosure for use as cellbased therapy or therapies, such as in a method of treating cancer are autologous or allogeneic to the subject receiving administration of the modified cells.
  • the modified cells of the present disclosure for use as a cell-based therapies, such as in a method of treating cancer are autologous to the subject receiving administration of the modified cells.
  • the modified cells of the present disclosure for use as a cell-based therapies, such as in a method of treating cancer are allogeneic to the subject receiving administration of the modified cells.
  • the modified cells of the present disclosure for use as in a method of treating autoimmune disorders are autologous or allogeneic to the subject receiving administration of the modified cells. In some embodiments, the modified cells of the present disclosure for use as in a method of treating autoimmune disorders, are autologous to the subject receiving administration of the modified cells. In some embodiments, the modified cells of the present disclosure for use as in a method of treating autoimmune disorders, are allogeneic to the subject receiving administration of the modified cells.
  • the modified cells of the present disclosure for use as in a method of treating fibrosis are autologous or allogeneic to the subject receiving administration of the modified cells. In some embodiments, the modified cells of the present disclosure for use as in a method of treating fibrosis, are autologous to the subject receiving administration of the modified cells. In some embodiments, the modified cells of the present disclosure for use as in a method of treating fibrosis, are allogeneic to the subject receiving administration of the modified cells.
  • provided herein is a method of treating a disease or disorder comprising administering a pharmaceutical composition (such as a pharmaceutical composition described in Section 5.6).
  • a pharmaceutical composition such as a pharmaceutical composition described in Section 5.6
  • a method for treating cancer in a subject in need thereof comprising administering a pharmaceutical composition (such as a pharmaceutical composition described in Section 5.6).
  • a method for treating autoimmune disorders in a subject in need thereof comprising administering a pharmaceutical composition (such as a pharmaceutical composition described in Section 5.6).
  • provided herein is a method for treating fibrosis in a subject in need thereof, comprising administering a pharmaceutical composition (such as a pharmaceutical composition described in Section 5.6).
  • the subject is human.
  • an effective amount of the modified cells described in Section 5.5 can be combined with one or more agents.
  • the agent is capable of preventing or reducing interaction between CD47 and SIRPa (see, e.g., WO 2019/241403, incorporated by reference in its entirety).
  • the agent comprises an anti- CD47 antibody.
  • suitable anti-CD47 antibodies include clones B6H12, 5F9, 8B6, and C3 (see, e.g., WO 2011/143624, incorporated by reference in its entirety).
  • the agent comprises a soluble CD47 polypeptide.
  • the agent comprises an anti-SIRPa antibody.
  • the agent is capable of preventing or reducing interaction between CD24 and SIGLEC10 (see, e.g., WO 2019/241403, incorporated by reference in its entirety).
  • the agent comprises an anti-CD24 antibody.
  • the agent comprises an anti-STGLECl O antibody.
  • the agent comprises a soluble SIGLEC10 polypeptide.
  • the agent comprises an anti-CD20 antibody (e.g., rituximab).
  • the agent comprises an anti- HER2/neu antibody e.g., trastuzumab).
  • the modified cell of the present disclosure is precomplexed with one or more agents.
  • a method of engineering a modified cell comprising introducing into a cell (a) a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2), (b) a vector comprising a polynucleotide encoding a CAR (such as a vector described in Section 5.3), or (c) a CAR polypeptide (such as a polypeptide described in Section 5.4).
  • the method further comprises, selecting a cell for expression of the CAR.
  • the cell is a monocyte, a macrophage, or an induced pluripotent stem cell (iPSC).
  • the cell is an iPSC. In some embodiments, the method further comprises differentiating the iPSC into a monocyte or macrophage. In some embodiments, the method further comprises differentiating the iPSC into a monocyte. In some embodiments, the method further comprises differentiating the iPSC into a macrophage. In some embodiments, the cell is a macrophage. In some embodiments, the macrophage is derived from an iPSC. In some embodiments, the cell is a monocyte. In some embodiments, the monocyte is derived from an iPSC. In some embodiments, the method further comprises differentiating the monocyte into a macrophage.
  • the differentiation of the monocyte into a macrophage is performed in vitro, ex vivo, or in vivo.
  • the cell is a human cell.
  • the cells provided herein comprise a genetic disruption of: (a) a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acid-binding Ig-like lectin 10 (SIGLEC10) gene.
  • the cells provided herein comprise genetic disruption of SIRPA.
  • the cells provided herein comprise genetic disruption of CISH.
  • the cells provided herein comprise genetic disruption of SIGLEC10.
  • the cells provided herein comprise genetic disruption of SIRPA and CISH. In certain embodiments, the cells provided herein comprise genetic disruption of SIRPA and SIGLEC10. In further embodiments, the cells provided herein comprise genetic disruption of STGLEC10 and CTSH. Tn still further embodiments, the cells provided herein comprise genetic disruption of SIGLEC10, CISH, and SIRPA.
  • a method of engineering a modified cell comprising introducing into a cell a polynucleotide encoding a CAR (such as a polynucleotide described in Section 5.2).
  • the method further comprises, selecting a cell for expression of the CAR.
  • the cell is a monocyte, a macrophage, or an induced pluripotent stem cell (iPSC).
  • iPSC induced pluripotent stem cell
  • the cell is an iPSC.
  • the method further comprises differentiating the iPSC into a monocyte or macrophage.
  • the method further comprises differentiating the iPSC into a monocyte.
  • the method further comprises differentiating the iPSC into a macrophage.
  • the cell is a macrophage.
  • the macrophage is derived from an iPSC.
  • the cell is a monocyte.
  • the monocyte is derived from an iPSC.
  • the method further comprises differentiating the monocyte into a macrophage.
  • the differentiation of the monocyte into a macrophage is performed in vitro, ex vivo, or in vivo.
  • the cell is a human cell.
  • the cells provided herein comprise a genetic disruption of: (a) a signal regulatory protein alpha (SIRPA) gene, (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acid-binding Ig-like lectin 10 (SIGLEC10) gene (such as a modified cell described in Section 5.5).
  • the cells provided herein comprise genetic disruption of SIRPA.
  • the cells provided herein comprise genetic disruption of CISH.
  • the cells provided herein comprise genetic disruption of SIGLEC10.
  • the cells provided herein comprise genetic disruption of SIRPA and CISH.
  • the cells provided herein comprise genetic disruption of SIRPA and SIGLEC10. In further embodiments, the cells provided herein comprise genetic disruption of SIGLEC10 and CISH. In still further embodiments, the cells provided herein comprise genetic disruption of SIGLEC10, CISH, and SIRPA. In certain embodiments, the method comprises integrating a polynucleotide encoding the CAR (such as a polynucleotide described in Section 5.2) into a safe harbor locus, e g., an AAVS1 locus.
  • a polynucleotide encoding the CAR such as a polynucleotide described in Section 5.2
  • the method comprises integrating a polynucleotide encoding the CAR (such as a polynucleotide described in Section 5.4) into a target gene selected from the group consisting of a SIRPA gene, a CISH gene, and a SIGLEC10 gene, such that the target gene(s) is genetically disrupted.
  • a polynucleotide encoding the CAR such as a polynucleotide described in Section 5.4
  • a target gene selected from the group consisting of a SIRPA gene, a CISH gene, and a SIGLEC10 gene, such that the target gene(s) is genetically disrupted.
  • a method of engineering a modified cell comprising introducing into the cell a vector comprising a polynucleotide encoding a CAR (such as a vector described in Section 5.3.
  • the method further comprises, selecting a cell for expression of the CAR.
  • the cell is a monocyte, a macrophage, or an induced pluripotent stem cell (iPSC).
  • iPSC induced pluripotent stem cell
  • the cell is an iPSC.
  • the method further comprises differentiating the iPSC into a monocyte or macrophage.
  • the method further comprises differentiating the iPSC into a monocyte.
  • the method further comprises differentiating the iPSC into a macrophage.
  • the cell is a macrophage.
  • the macrophage is derived from an iPSC.
  • the cell is a monocyte.
  • the monocyte is derived from an iPSC.
  • the method further comprises differentiating the monocyte into a macrophage.
  • the differentiation of the monocyte into a macrophage is performed in vitro, ex vivo, or in vivo.
  • the cell is a human cell.
  • the cells provided herein comprise a genetic disruption of: (a) a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acidbinding Ig-like lectin 10 (SIGLEC10) gene (such as a modified cell described in Section 5.5).
  • the cells provided herein comprise genetic disruption of SIRPA.
  • the cells provided herein comprise genetic disruption of CISH.
  • the cells provided herein comprise genetic disruption of SIGLEC10.
  • the cells provided herein comprise genetic disruption of SIRPA and CISH.
  • the cells provided herein comprise genetic disruption of SIRPA and SIGLEC10. In further embodiments, the cells provided herein comprise genetic disruption of SIGLEC10 and CISH. In still further embodiments, the cells provided herein comprise genetic disruption of SIGLEC10, CISH, and SIRPA.
  • a method of engineering a modified cell comprising introducing into a cell a CAR polypeptide (such as a polypeptide described in Section 5.4). In some embodiments, the method further comprises, selecting a cell for expression of the CAR.
  • the cell is a monocyte, a macrophage, or an induced pluripotent stem cell (iPSC). Tn some embodiments, the cell is an iPSC Tn some embodiments, the method further comprises differentiating the iPSC into a monocyte or macrophage. In some embodiments, the method further comprises differentiating the iPSC into a monocyte.
  • the method further comprises differentiating the iPSC into a macrophage.
  • the cell is a macrophage.
  • the macrophage is derived from an iPSC.
  • the cell is a monocyte.
  • the monocyte is derived from an iPSC.
  • the method further comprises differentiating the monocyte into a macrophage.
  • the differentiation of the monocyte into a macrophage is performed in vitro, ex vivo, or in vivo.
  • the cell is a human cell.
  • the cells provided herein comprise a genetic disruption of: (a) a signal regulatory protein alpha (SIRPA) gene; (b) a cytokine inducible SH2 containing protein (CISH) gene; and/or (c) a sialic acid-binding Ig-like lectin 10 (SIGLEC10) gene (such as a modified cell described in Section 5.5).
  • the cells provided herein comprise genetic disruption of SIRPA.
  • the cells provided herein comprise genetic disruption of CISH.
  • the cells provided herein comprise genetic disruption of SIGLEC10.
  • the cells provided herein comprise genetic disruption of SIRPA and CISH.
  • the cells provided herein comprise genetic disruption of SIRPA and SIGLEC10. In further embodiments, the cells provided herein comprise genetic disruption of SIGLEC10 and CISH. In still further embodiments, the cells provided herein comprise genetic disruption of SIGLEC10, CISH, and SIRPA.
  • any assay known in the art for measuring cytokine secretion from a cell can be used.
  • Non-limiting examples include immunoassays (e.g., enzyme-linked immunosorbent assay (ELISA), or radioimmunoprecipitation assay (RIP)), and cell-based in vitro bioassays, and may depend on the type of cytokine seeking detection.
  • the cytokine of interest can be immobilized to a microtiter plate, and a test sample (e.g., a cell culture supernatant sample from a cultured macrophage) can be added to the wells of the plate.
  • test sample contains a detectable amount of the cytokine
  • detection can be achieved using a detection antibody (e.g., anti-human/mouse/rabbit IgG, IgM, IgA, or IgE HRP conjugate, anti- human/mouse/rabbit Fc HRP conjugate).
  • a detection antibody e.g., anti-human/mouse/rabbit IgG, IgM, IgA, or IgE HRP conjugate, anti- human/mouse/rabbit Fc HRP conjugate.
  • One exemplary assay for measuring secretion of a cytokine involves measuring the cytokine by ELISA after culturing a cell (e.g., a macrophage) for about 24 hours in the presence of a target antigen. Other conventional methods can also be employed as suitable.
  • Any assay known in the art for measuring phagocytosis can be used.
  • Non-limiting examples include flow cytometry quantification of phagocytosis, and fluorescent microscopy that employs a pH-sensitive dye.
  • the phagocytosis assay could be performed with bacterial particles or a stably transformed cell line.
  • an exemplary assays involves measuring phagocytosis by co-incubation of a macrophage (e.g., a macrophage expressing a CAR) labeled with a fluorescent reporter (e.g., RFP) and a target cell expressing a target antigen that is labeled with a different fluorescent reporter (e.g., GFP) for a suitable period of time (e.g., about four hours), and measuring the amount of double positive cells (RFP+ and GFP+) by flow cytometry.
  • a macrophage e.g., a macrophage expressing a CAR
  • a fluorescent reporter e.g., RFP
  • GFP fluorescent reporter
  • Phagocytosis Index was calculated as follows:
  • Any assay known in the art for measuring promoter activity in a cell can be used.
  • Non-limiting examples include measuring expression of a reporter gene (e.g., luciferase, or any fluorescence protein, such as GFP, RFP, or YFP) from the promoter of the gene of interest, including fluorescence proteins.
  • a reporter gene e.g., luciferase, or any fluorescence protein, such as GFP, RFP, or YFP
  • an in vitro luciferase activity can be used assayed to determine promoter activity in transiently transfected human THP-1 cells.
  • a ubiquitous/constitutively active promoter such as the cytomegalovirus (CMV) basic promoter, can be used as a promoter control, and PGL3-p47-86 can be used as a basal activity control.
  • CMV cytomegalovirus
  • Other conventional methods can also be employed as suitable.
  • a representative non- myeloid reference cell may be, for example, a human intestinal epithelial cell (e.g., Caco-2), a cervix epithelioid carcinoma cell (e.g., HeLa), a human embryonic kidney cell 293 (e.g., HEK- 293 or 293T), a T lymphocyte (e.g., Jurkat), or a mouse osteoblast (e.g., Oct-1).
  • a human intestinal epithelial cell e.g., Caco-2
  • a cervix epithelioid carcinoma cell e.g., HeLa
  • a human embryonic kidney cell 293 e.g., HEK- 293 or 293T
  • T lymphocyte e.g., Jurkat
  • mouse osteoblast e.g., Oct-1
  • a polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen recognition moiety, a hinge domain, a transmembrane domain, and an intracellular domain comprising:
  • polynucleotide of embodiment A2, wherein the myeloid-specific promoter is a native macrophage or a native monocyte promoter.
  • polynucleotide of embodiment A2, wherein the myeloid-specific promoter is a synthetic promoter.
  • polynucleotide of embodiment A4, wherein the synthetic promoter is selected from the group consisting of synthetic promoter-146 (SP146), synthetic promoter-107 (SP107), and synthetic promoter-60 (SP60).
  • A6 The polynucleotide of embodiment Al, wherein the promoter is selected from the group consisting of a EFla, CD36, CD68, SP60, SP107, SP146, CAG, PGK, T7 and CMV promoter.
  • A7 The polynucleotide of any one of embodiments Al to A6, wherein the antigen recognition moiety comprises a scFv antigen recognition moiety.
  • A8 The polynucleotide of embodiment A7, wherein the scFv antigen recognition moiety recognizes a tumor antigen or fragment thereof.
  • A9 The polynucleotide of embodiment A8, wherein the tumor antigen is selected from the group consisting of HER2/neu, PSMA, Claudinl8, CD20, CD5, mesothelin, GD2, and CD 19.
  • polynucleotide of embodiment Al l, wherein the increase in activity comprises an increase in secretion of a pro-inflammatory cytokine.
  • polynucleotide of embodiment A13, wherein the increase in secretion of the pro- inflammatory cytokine is about 25-fold.
  • polynucleotide of embodiment A13, wherein the increase in secretion of the pro- inflammatory cytokine is about 50-fold.
  • polynucleotide of embodiment A13, wherein the increase in secretion of the pro- inflammatory cytokine is about 75-fold.
  • polynucleotide of embodiment A13, wherein the increase in secretion of the pro- inflammatory cytokine is about 100-fold.
  • polynucleotide of embodiment A13, wherein the increase in secretion of the pro- inflammatory cytokine is more than about 100-fold.
  • A19 The polynucleotide of embodiment A12, wherein the pro-inflammatory cytokine is selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-loc/CCL3, IL-10, IL-ip, IFNy, IL-6, TNFA, and CCL20, or a combination thereof.
  • polynucleotide of embodiment Al 9, wherein the increase in secretion of the pro- inflammatory cytokine comprises a composite score of two of more cytokines.
  • A22 The polynucleotide of any one of embodiments A12 to A21, wherein the secretion of the pro-inflammatory cytokine is measured by ELISA after culturing the macrophage for 24 hours in the presence of a target antigen.
  • polynucleotide of any one of embodiments Al 1 to A22, wherein the increase in activity comprises an increase in macrophage phagocytosis.
  • polynucleotide of embodiment A23, wherein the increase in macrophage phagocytosis is about 10% to about 50%.
  • A30 The polynucleotide of any one of embodiments A23 to A29, wherein phagocytosis is measured by flow cytometry after about four hours of co-incubation of a macrophage expressing the CAR and a target cell expressing a target antigen.
  • A31 The polynucleotide of any one of embodiments Al to A30, wherein the transmembrane domain is selected from the group consisting of IL-1R1, VEGFR2, ZFNyRl, CSF3R, CSF2R, SLAMF7, DECTIN-1, DECTIN-3, TLR4, CSF1R, CD8, CD28, MINCLE, MDL1, BDCA2, DAP12, CDllb, CD86, and CD40.
  • A32 The polynucleotide of any one of embodiments Al to A31, wherein the intracellular domain increases activity of a CAR in a macrophage relative to the CAR having an intracellular domain consisting of a CD3 ⁇ intracellular signaling domain.
  • polynucleotide of embodiment A32, wherein the increase in activity comprises an increase in secretion of a pro-inflammatory cytokine.
  • polynucleotide of embodiment A33, wherein the increase in secretion of the pro- inflammatory cytokine is about 10-fold to about 100-fold.
  • polynucleotide of embodiment A33, wherein the increase in secretion of the pro- inflammatory cytokine is about 25-fold.
  • polynucleotide of embodiment A33, wherein the increase in secretion of the pro- inflammatory cytokine is about 50-fold.
  • polynucleotide of embodiment A33, wherein the increase in secretion of the pro- inflammatory cytokine is about 75-fold.
  • polynucleotide of embodiment A33, wherein the increase in secretion of the pro- inflammatory cytokine is about 100-fold.
  • polynucleotide of embodiment A33, wherein the increase in secretion of the pro- inflammatory cytokine is more than about 100-fold.
  • polynucleotide of embodiment A33, wherein the pro-inflammatory cytokine is selected from the group consisting of CXCL10, CCL1, CCL2, CCL22, MIP-loc/CCL3, IL-10, IL-ip, TFNy, IL-6, TNFA, and CCL20, or a combination thereof.
  • polynucleotide of embodiment A33, wherein the pro-inflammatory cytokine comprises MIP-la/CCL3.
  • A42 The polynucleotide of embodiment A40, wherein the increase in secretion of the pro- inflammatory cytokine comprises a composite score of two of more pro-inflammatory cytokines.
  • A43 The polynucleotide of any one of embodiments A33 to A42, wherein the secretion of the pro-inflammatory cytokine is measured by ELISA after culturing the macrophage for 24 hours in the presence of a target antigen.
  • polynucleotide of any one of embodiments A32 to A43, wherein the increase in activity comprises an increase in macrophage phagocytosis.
  • polynucleotide of embodiment A44, wherein the increase in macrophage phagocytosis is about 10% to about 50%.
  • A51 The polynucleotide of any one of embodiments A44 to A50, wherein phagocytosis is measured by flow cytometry after about four hours of co-incubation of a macrophage expressing the CAR and a target cell expressing a target antigen.
  • A52 The polynucleotide of any one of embodiments Al to A51, wherein the one or more nonlymphoid intracellular signaling domains are selected from the group consisting of BALI, CD86/B7-2, Loxlc, TM4, MEGF10, SCARF1, CD93, DAP12, SLAMF7, IFNyR2, 2B4/CD244, DECTIN-1, CD206, DECTIN-3, CLEC2, and CD80/B7-1.
  • A53 A polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises
  • transmembrane domain wherein the transmembrane domain is selected from the group consisting of (i) a CD8 transmembrane domain;
  • a first intracellular signaling domain wherein the first intracellular signaling domain is selected from the group consisting of
  • a second intracellular domain comprising a CD3 ⁇ intracellular signaling domain, wherein the polynucleotide is operatively linked to a promoter.
  • polynucleotide of embodiment A53 wherein the polynucleotide encodes for a hinge domain comprising an amino acid sequence of SEQ ID NO: 1.
  • transmembrane domain comprises a SLAMF7 transmembrane domain.
  • A59 The polynucleotide of embodiment A58, wherein the first intracellular signaling domain comprises a CD86 intracellular signaling domain.
  • A60 The polynucleotide of embodiment A54, wherein the transmembrane domain comprises a CD86 transmembrane domain.
  • the first intracellular signaling domain comprises a 2B4 intracellular signaling domain.
  • transmembrane domain comprises a DECTIN- 1 transmembrane domain.
  • polynucleotide of embodiment A53 wherein the polynucleotide encodes for a hinge domain comprising an amino acid sequence of SEQ ID NO:4.
  • transmembrane domain comprises a SLAMF7 transmembrane domain.
  • A69 The polynucleotide of any one of embodiments A53 to A68, wherein the promoter is a constitutive promoter.
  • polynucleotide of embodiment A69 wherein the constitutive promoter is a EFla promoter, a CAG promoter, or a T7 promoter.
  • A71 The polynucleotide of any one of embodiments A53 to A68, wherein the promoter is a myeloid-specific promoter.
  • A72 The polynucleotide of embodiment A71 , wherein the myeloid-specific promoter is a native macrophage promoter or a native monocyte promoter.
  • polynucleotide of embodiment A73, wherein the synthetic promoter is selected from the group consisting of synthetic promoter-146 (SP146), synthetic promoter-107 (SP107), and synthetic promoter-60 (SP60).
  • A76 The polynucleotide of any one of embodiments A53 to A75, wherein the antigen recognition moiety comprises a scFv antigen recognition moiety.
  • A78 The polynucleotide of embodiment A77, wherein the tumor antigen is selected from your group consisting of HER2/neu, PSMA, Claudinl8, CD20, CD5, mesothelin, GD2, and CD 19.
  • a vector comprising the polynucleotide of any one of embodiments Al to A78.
  • A80 The vector of embodiment A79, wherein the vector comprises DNA or RNA.
  • A81 The vector of embodiment A79 or A80, wherein the vector is a plasmid vector.
  • the vector of embodiment A82, wherein the viral vector is selected from the group consisting of an adenoviral vector, a lentiviral vector, and a retroviral vector.
  • a polypeptide comprising:
  • transmembrane domain polypeptide wherein the transmembrane domain is selected from the group consisting of
  • a first intracellular signaling domain polypeptide wherein the first intracellular signaling domain is selected from the group consisting of:
  • polypeptide of embodiment A85, wherein the hinge domain has an amino acid sequence of SEQ ID NO: 1.
  • transmembrane domain polypeptide comprises a CD8 transmembrane domain polypeptide.
  • polypeptide of embodiment A87, wherein the CD8 transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO: 1 1 .
  • polypeptide of embodiment A87 or A88, wherein the first intracellular signaling domain polypeptide comprises a CD86 intracellular signaling domain polypeptide comprises a CD86 intracellular signaling domain polypeptide.
  • polypeptide of embodiment A89, wherein the CD86 intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO:40.
  • A91 The polypeptide of embodiment A87 or A88, wherein the first intracellular signaling domain polypeptide comprises a Loxlc intracellular signaling domain polypeptide.
  • A92 The polypeptide of embodiment A91, wherein the Loxl c intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO:41.
  • transmembrane domain polypeptide comprises a SLAMF7 transmembrane domain polypeptide.
  • polypeptide of embodiment A93, wherein the SLAMF7 transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO: 12.
  • polypeptide of embodiment A93 or A94, wherein the first intracellular signaling domain polypeptide comprises a CD86 intracellular signaling domain polypeptide.
  • polypeptide of embodiment A95, wherein the CD86 intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO:40.
  • transmembrane domain polypeptide comprises a CD86 transmembrane domain polypeptide.
  • polypeptide of embodiment A97 or A98, wherein the first intracellular signaling domain polypeptide comprises a 2B4 intracellular signaling domain polypeptide.
  • polypeptide of embodiment A99, wherein the 2B4 intracellular signaling domain polypeptide has an amino acid sequence of SEQ ID NO:42.
  • transmembrane domain polypeptide comprises a DECTIN- 1 transmembrane domain polypeptide.
  • polypeptide of embodiment A101, wherein the DECTIN-1 transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO: 14.
  • polypeptide of embodiment A85, wherein the hinge domain polypeptide comprises SEQ ID NO:4.
  • polypeptide of embodiment Al 06 the SLAMF7 transmembrane domain polypeptide has an amino acid sequence of SEQ ID NO: 12.
  • polypeptide of embodiment A106 or A107, wherein the first intracellular signaling domain polypeptide comprises a CD86 intracellular signaling domain polypeptide comprises a CD86 intracellular signaling domain polypeptide.
  • Al 10 The polypeptide of any one of embodiments to A85 to A109, wherein the antigen recognition moiety polypeptide comprises a scFv antigen recognition moiety polypeptide.
  • A120 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 104.
  • A121 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:105.
  • A122 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:106.
  • A123 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:107.
  • A124 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:108.
  • A126 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:111.
  • A127 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:112. Al 28. A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:113.
  • A129 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:114.
  • A131 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:116.
  • Al 32 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:117.
  • A135. A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:120.
  • A138 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 126.
  • AMO A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 128.
  • A141 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 129.
  • A142 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 130.
  • A143 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO:131.
  • A144 A polypeptide having an amino acid sequence comprising or consisting of SEQ ID NO: 132.
  • a modified cell wherein the modified cell comprises the polynucleotide of any one of embodiments Al to A78, the vector of any one of embodiments A79 to A84, or the polypeptide of any one of embodiments A85 to A144, and wherein the modified cell is a monocyte, a macrophage, or an induced pluripotent stem cell (iPSC).
  • the modified cell comprises the polynucleotide of any one of embodiments Al to A78, the vector of any one of embodiments A79 to A84, or the polypeptide of any one of embodiments A85 to A144, and wherein the modified cell is a monocyte, a macrophage, or an induced pluripotent stem cell (iPSC).
  • iPSC induced pluripotent stem cell
  • A147 The modified cell of embodiment A145, wherein the modified cell is a macrophage.
  • A148 The modified cell of embodiment A145, wherein the modified cell is a monocyte.
  • modified cell of embodiment A147 or A148, wherein the modified cell is derived from an iPSC.
  • A151 The modified cell of any one of embodiments A145 to Al 50, comprising a genetic disruption of:
  • SIRPA signal regulatory protein alpha
  • CISH cytokine inducible SH2 containing protein
  • A154 The modified cell of any one of embodiments A151 to A153, wherein the modified cell comprises genetic disruption of SIGLEC10.
  • A160 The modified cell of embodiment A158, wherein the agent comprises an anti-SIGLEClO antibody.
  • a pharmaceutical composition comprising the modified cell of any one of embodiments A147 to A150.
  • Al 62 A method of treating a cancer, comprising administering the pharmaceutical composition of embodiment A161.
  • Al 63 A method of engineering a modified cell, comprising introducing into the cell the polynucleotide of any one of embodiments Al to A78, the vector of any one of embodiments A79 to A84, or the polypeptide of any one of embodiments A85 to A144. wherein the cell is a monocyte, a macrophage, or an induced pluripotent stem cell (iPSC).
  • iPSC induced pluripotent stem cell
  • A167 The method of embodiment A165 or A166, wherein the cell is derived from an iPSC.
  • A168 The method of any one of embodiments A163 to A167, wherein the cell is a human cell.
  • a cytokine inducible SH2 containing protein (CISH) gene (b) a cytokine inducible SH2 containing protein (CISH) gene
  • A170 The method of embodiment A169, wherein the modified cell comprises genetic disruption of SIRPA.
  • A172 The method of any one of embodiments A169 to A171, wherein the modified cell comprises genetic disruption of SIGLEC10.
  • phrases such as “at least one of’ or “one or more of’ may occur followed by a conjunctive list of elements or features.
  • the term “and/or” may also occur in a list of two or more elements or features. Unless otherwise implicitly or explicitly contradicted by the context in which it used, such a phrase is intended to mean any of the listed elements or features individually or any of the recited elements or features in combination with any of the other recited elements or features
  • the phrases “at least one of A and B;” “one or more of A and B;” and “A and/or B” are each intended to mean “A alone, B alone, or A and B together.”
  • a similar interpretation is also intended for lists including three or more items.
  • the phrases “at least one of A, B, and C;” “one or more of A, B, and C;” and “A, B, and/or C” are each intended to mean “A alone, B alone, C alone, A and B together, A and C together, B and C together, or A and B and C together.”
  • Use of the term “based on,” above and in the claims is intended to mean, “based at least in part on,” such that an unrecited feature or element is also permissible.
  • FIG. 1 A exemplary phagocytosis assay
  • FIG. IB exemplary cytokine secretion assay
  • THP-1 monocytes were transduced with lentivirus encoding (1) a CAR, (2) red fluorescence protein (RFP), for detection, and (3) a puromycin resistance gene, for selection. Following transduction, CAR positive cells were enriched by culturing with puromycin. After 2- 3 weeks, when the population was 95% RFP positive, macrophage activity was evaluated.
  • RFP red fluorescence protein
  • 60,000 stably transduced THP-1 monocytes were seeded per well in a 96-well adherent plate and differentiated into macrophages with 1 nM phorbol 12- myri state- 13 -acetate (PMA) for 48 hours. After washing PMA out with complete media, 6,000 CD19 + target cells were added to each well. The plate was centrifuged for 30 seconds at 300 x g and incubated for 4 hours at 37 °C. Supernatant was harvested, then adherent cells were released from the plate using pre-warmed 0.25% Trypsin for 8 minutes and added to the supernatant. Cells were fixed using 37 °C BD Cytofix for 10 minutes, followed by resuspension in staining buffer. Phagocytosis Index (PI) was calculated as follows:
  • tissue culture treated 96-well plates were coated overnight at 4 °C with a recombinant target antigen that corresponded with the CAR antigen recognition moiety.
  • a CAR expressing an scFv that recognized CD19 the tissue culture plates were coated with CD19.
  • the wells were then washed to remove excess antigen before 200,000 stably transduced THP-1 cells were seeded per well and incubated for a further 24h at 37 °C.
  • the 96-well plate was then centrifuged to pellet the cells and the supernatants was removed for cytokine analysis. Cytokine levels were measured by ELISA assay.
  • each raw data value was normalized to the top cytokine producing construct for each tested cytokine in each experiment.
  • the following formula was used: (test CAR top CAR) x 100.
  • the normalized values for each cytokine in the panel were added together to create the index.
  • monocytes/macrophages expressing a CAR can be evaluated for macrophage activity using an exemplary phagocytosis assay (FIG. 1A) and/or an exemplary cytokine secretion assay (FIG. IB).
  • EXAMPLE 2 Screening promoters for myeloid specific CAR expression
  • CAR expression can be enhanced in monocytes/macrophages by use of certain promoters, such as a myeloid specific promoter.
  • a 1 st generation CD3 ⁇ CAR was placed under the control of several promoters expected to have enhanced expression in myeloid cells. These CARs were engineered into THP1 cells and stable clones were selected, as described in Example 1. CAR expression was measured by flow cytometry using an anti-idiotype PE antibody (FIG. 2A) against the CAR scFv.
  • CARs under the control of the macrophage-specific synthetic promoters SP107 and SP146 exhibited robust expression, relative to the constitutively active promoters EFla (long or short) and CMV (FIG. 2B). Expression of the CARs under the control of the macrophage-specific synthetic promoters SP107 and SP146 was also enhanced relative to CARs under the control of proteins that are highly expressed in macrophages, such as promoters from CD36 or CD68 (FIG. 2B).
  • TM CD8 transmembrane
  • FIG. 3 the CD8 transmembrane (TM) of a 1 st generation CD3C, CAR was substituted with a series of TM domains from receptors associated with macrophage activity.
  • FIG. 4 The effect of these CARs on phagocytosis (FIG. 3) and cytokine production (FIG. 4) was measured in stably transfected THP1 cells, as described in Example 1, and normalized to the parent construct.
  • transmembrane domains can enhance macrophage activity, either by increasing cytokine secretion and/or phagocytosis.
  • This example demonstrates that macrophage activity can be enhanced by complementing an IT AM containing intracellular domain, such as a CD3 ⁇ intracellular domain, with an additional intracellular domain from a non-lymphoid intracellular signaling domain.
  • an IT AM containing intracellular domain such as a CD3 ⁇ intracellular domain
  • CD3 ⁇ intracellular signaling domain of a 1 st generation CD3 ⁇ CAR was complimented with a series of additional IC domains from receptors associated with macrophage activity.
  • the effect of these CARs on phagocytosis and cytokine production was measured in stably transfected THP1 cells, as described in Example 1, and normalized to the parent construct.
  • exemplary CARs having an anti-CD19 scFv antigen recognition moiety can be expressed in a monocyte, which is differentiated into a macrophage, and macrophage activity can be evaluated by measuring phagocytosis and/or cytokine section.
  • THP-1 monocytes were transduced with lentivirus encoding (1) a CAR, (2) red fluorescence protein (RFP), for detection, and (3) a puromycin resistance gene, for selection.
  • exemplary CARs are illustrated in FIG. 7.
  • CAR positive cells were enriched by culturing with puromycin. After 2-3 weeks, when the population was 95% RFP positive, CAR activity was evaluated as described above in Example 1.
  • the results from measuring phagocytic index (PI), and/or cytokine secretion are represented in Table 10.
  • HD Hinge Domain
  • TM Transmembrane Domain
  • IC Intracellular Domain
  • iPSCs can be genetically disrupted using CRISPR/MAD7, and successfully differentiated into a monocyte.
  • iPSCs were contacted with MAD7 and sgRNA targeting exon 2 of SIRPA (5’
  • Exemplary clones indicated an insertion (C > CT) within the target exon (Table 11).
  • SIRPA KO iPSCs were subsequently differentiated to monocytes.
  • WT TCI 133
  • SIRPA KO monocytes were harvested at Day 17 (left) and Day 20 (right) of the differentiation protocol, and lysed for protein.
  • Western blotting confirmed the absence of SIRPA expression in SIRPA KO clone 1 on Day 17 and Day 20 (FIG. 8)
  • Vinculin served as the housekeeping gene
  • TCI 133 cells served as wild-type control cells that expressed SIRPA.
  • the D17 and D20 iPSC-derived monocytes were further differentiated to iPSC- derived macrophages by treating the monocytes with 100 ng/ml macrophage colony-stimulating factor (M-CSF; also known as colony stimulating factor 1 “CSF1”) for 10 days.
  • M-CSF macrophage colony-stimulating factor
  • Flow cytometry confirmed loss of SIRPa expression in SIRPA KO iPSC-derived macrophages using an antibody that detected cell surface expression of SIRPa (FIG. 1 IB; Cell Signaling Technologies, CST) or intracellular expression (FIG. 11C; Abeam). Isotype controls were used as a negative control to determine background caused by nonspecific antibody binding (FIG. 11 A).
  • iPSCs can be genetically modified using CRISPR/MAD7, and successfully differentiated into a monocyte or a macrophage.
  • EXAMPLE 7 SIRPA KO monocytes have increased killing
  • SIRPA KO monocyte (“SIRPa mo” or “SIRPa KO mo”) derived from SIRPA KO iPSCs or wild-type control monocytes derived from the TC-113 iPSC-cell line (“TCI 133 mo”) were combined with Raji target cells at a 10: 1 effector to target ratio.
  • Anti-CD20 (rituximab) antibody was added (0.3 pg/mL or 0.5 pg/mL) and the amount of target cell survival was measured over time (FIG. 12A and FIG. 12B).
  • EXAMPLE 8 SIRPA KO macrophages have increased killing
  • SIRPa SIRPA KO macrophages
  • TCI 133 wild-type control macrophages derived from the TC-113 iPSC-cell line
  • Anti-CD20 (rituximab) antibody was added (0.1 pg/mL or 0.3 pg/mL) and the amount of target cell survival was measured over time (FIG. 13 A).
  • SIRPA KO macrophages derived from SIRPA KO iPSCs have increased killing of Raji cells in comparison to wild-type control macrophages derived from the TC-113 iPSC-cell line upon the addition of 0.1 pg/mL or 0.3 pg/mL rituximab.
  • SIRPa SIRPA KO macrophages
  • TCI 133 TC-113 iPSC-cell line
  • Anti-HER2/neu (trastuzumab) antibody was added (10 pg/mL) and the amount of target cell survival was measured over time (FIG. 13B).
  • SIRPA KO macrophages derived from SIRPA KO iPSCs could exhibit similar efficacy results at lower effector to target ratios
  • SIRPA KO macrophages derived from SIRPA KO iPSCs or wild-type control macrophages derived from the TC-113 iPSC-cell line (“TCI 133 ”) were combined with Raji target cells at a 3:1 effector to target ratio (FIG. 14A) or a 1 : 1 effector to target ratio (FIG. 14B).
  • this example demonstrates that SIRPA KO macrophages derived from SIRPA KO iPSCs have increased killing relative to macrophages expressing SIRPA derived from wild-type iPSCs. Further, this example demonstrates that SIRPA KO macrophages exhibit efficient target cell killing at lower effector to target ratio.
  • EXAMPLE 9 iMACs pre-complexed with rituximab kill Raji cells in vivo
  • mice were evaluated using the protocols describe in Table 14. Briefly, in one experimental group iMac cells were administered on days 1 and 4, along with treatment of anti-CD47 to disrupt the SIRPA/CD47 signaling pathway (Group 3). Two other experimental groups (Groups 4 and 5) involved iMAC cells precomplexed with rituximab prior to administration, followed by anti-CD47 administration. A schema of pre-complexing is provided in FIG. 15A. Vehicle control (Group 1), anti-CD47 alone (Group 2), and rituximab (RTX) alone (Group 6) were used as controls.
  • RTX rituximab
  • the rituximab alone group was administered at a higher dose (75 pg/dose) relative to the predicted dose of rituximab in the precomplexed iMAC cells ( ⁇ 5 pg), and administration occurred for a longer period of time (administered on days 1, 8, and 15) relative to the precomplexed iMAC cells (day 1 only or days 1, 4, and 7).
  • RTX rituximab
  • QOD every other day
  • *predicted RTX injected in precomplexed samples 5 lig
  • mice treated with iMACs pre-complexed with rituximab for three days showed improved effector activity (Group 5), relative to Mice treated with iMACs pre-complexed with rituximab for one day (Group 4) (FIG. 15B, diamond and upside-down triangle, respectively).
  • mice treated with iMACs pre-complexed with rituximab exhibited improved effector activity relative to mice treated with anti-CD47 alone (Group 2) or mice treated with iMAC and anti-CD47, but not precomplexed with rituximab (Group 3) (FIG. 15B, square and triangle, respectively).
  • mice treated with iMACs pre-complexed with rituximab for three days showed similar effector activity as mice treated with prolonged high dose rituximab (Group 6), even though the rituximab dose was estimated to be approximately 15 fold lower than the rituximab alone group and treatment occurred for a shorter duration (FIG. 1 B, open circle).
  • anti-CD19 CAR encoding constructs with a red fluorescent protein (RFP) downstream of the CAR were knocked into the AAVS1 safe harbor loci in iPSC.
  • the iPSC pools were enriched by flow sorting CAR positive cells and then differentiated into iMACs.
  • knock-in of the CAR resulted in high expression (e.g., >90%) of RFP in the iMAC cells (see also, Table 15).
  • the anti-CD19 expression was highly expressed in CAR31 -CAR34. Similar results were observed in a separate independent experiment for exemplary CAR31 and CAR32 (FIG. 18A-FIG. 18B; see also Table 16)
  • CAR function was tested against CD 19+ Raji cells over 96 hours, at a. 5:1 E:T ratio, with or without lug/mL of Rituximab (anti-CD20 (FIG. 17A and FIG. 17B, respectfully).
  • CAR31, CAR33, and CAR34 which did not contain CD8 transmembrane domains, functioned better in this assay.
  • Similar results were observed in a separate independent experiment for exemplary CAR31 and CAR32, which slowed down tumor growth, relative to wild-type iMAC cells without a CAR construct (FIG. 18A-FIG. 18B)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Toxicology (AREA)
  • Hematology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

La présente invention concerne, en partie, des procédés et des compositions pour générer des monocytes, des macrophages et/ou des précurseurs de ceux-ci (tels qu'une cellule souche pluripotente induite), comprenant (i) un récepteur antigénique chimérique (CAR); (ii) un polynucléotide codant pour un CAR; (iii) un polypeptide CAR; et/ou (iv) un vecteur comprenant un polynucléotide codant pour un CAR. La présente invention concerne également des méthodes de traitement d'un cancer à l'aide de cellules exprimant le CAR. Dans certains modes de réalisation, les cellules exprimant le CAR comprennent une interruption génétique d'un gène S1RPA, d'un gène CISH et/ou d'un gène SIGLEC10.
PCT/US2023/071207 2022-07-29 2023-07-28 Procédés et compositions pour générer des récepteurs antigéniques chimériques monocytes/macrophages WO2024026455A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263393710P 2022-07-29 2022-07-29
US63/393,710 2022-07-29
US202263430316P 2022-12-05 2022-12-05
US63/430,316 2022-12-05

Publications (2)

Publication Number Publication Date
WO2024026455A2 true WO2024026455A2 (fr) 2024-02-01
WO2024026455A3 WO2024026455A3 (fr) 2024-04-18

Family

ID=89707381

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/071207 WO2024026455A2 (fr) 2022-07-29 2023-07-28 Procédés et compositions pour générer des récepteurs antigéniques chimériques monocytes/macrophages

Country Status (1)

Country Link
WO (1) WO2024026455A2 (fr)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105384825B (zh) * 2015-08-11 2018-06-01 南京传奇生物科技有限公司 一种基于单域抗体的双特异性嵌合抗原受体及其应用
JP7114490B2 (ja) * 2016-06-24 2022-08-08 アイセル・ジーン・セラピューティクス・エルエルシー キメラ抗体受容体（ＣＡＲｓ）の構成およびその使用方法
CN111683962A (zh) * 2017-11-10 2020-09-18 美国政府(由卫生和人类服务部的部长所代表) 靶向肿瘤抗原的嵌合抗原受体

Also Published As

Publication number Publication date
WO2024026455A3 (fr) 2024-04-18

Similar Documents

Publication Publication Date Title
US11952408B2 (en) HPV-specific binding molecules
US20210246423A1 (en) Methods for improving the efficacy and expansion of immune cells
CN114144430B (zh) Cd7-car-t细胞及其制备和应用
CN111566124A (zh) 制备表达嵌合抗原受体的细胞的方法
KR20230069042A (ko) 원형 rna 조성물 및 방법
CN112638402A (zh) 与增强葡萄糖输入的反式代谢分子组合的嵌合受体及其治疗用途
AU2020265679A1 (en) Chimeric receptors and methods of use thereof
WO2020191316A1 (fr) Thérapies par cellules car-t à efficacité améliorée
CN112888786A (zh) 与调节细胞内乳酸浓度的反式代谢分子组合的嵌合受体多肽及其治疗用途
KR20180073691A (ko) 자가면역 질환 및 암을 치료하기 위한 조성물 및 방법
CN116234558A (zh) 条件性地表达重组受体的工程化t细胞、相关多核苷酸和方法
WO2023081526A1 (fr) Compositions de nanoparticules lipidiques pour l'administration de polynucléotides circulaires
US20220218750A1 (en) Cells expressing a chimeric receptor from a modified cd247 locus, related polynucleotides and methods
EP4257617A1 (fr) Protéine de liaison à l'antigène ciblant cd70 et son utilisation
CN116802203A (zh) 从经修饰的恒定cd3免疫球蛋白超家族链基因座表达嵌合受体的细胞、相关多核苷酸和方法
WO2024026455A2 (fr) Procédés et compositions pour générer des récepteurs antigéniques chimériques monocytes/macrophages
JP2023552724A (ja) キメラ受容体及びその使用方法
US20240052049A1 (en) Circular rna encoding chimeric antigen receptors targeting bcma
WO2024076927A2 (fr) Nouveaux récepteurs antigéniques chimériques anti-mésothéline et cellules immunitaires modifiées
Fellermeier Bifunctional immunostimulatory fusion proteins for therapeutic applications
TW202309091A (zh) 嵌合受體及其使用方法
TW202307210A (zh) Ｃｄ１９和ｃｄ２２嵌合抗原受體及其用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23847592

Country of ref document: EP

Kind code of ref document: A2