WO2024025312A1 - 인터페론-베타 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주 - Google Patents

인터페론-베타 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주 Download PDF

Info

Publication number
WO2024025312A1
WO2024025312A1 PCT/KR2023/010767 KR2023010767W WO2024025312A1 WO 2024025312 A1 WO2024025312 A1 WO 2024025312A1 KR 2023010767 W KR2023010767 W KR 2023010767W WO 2024025312 A1 WO2024025312 A1 WO 2024025312A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
ifn
flgm
expression vector
recombinant expression
Prior art date
Application number
PCT/KR2023/010767
Other languages
English (en)
French (fr)
Inventor
이효진
전흥진
김세훈
서승범
장도협
Original Assignee
충남대학교 산학협력단
한국과학기술연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충남대학교 산학협력단, 한국과학기술연구원 filed Critical 충남대학교 산학협력단
Publication of WO2024025312A1 publication Critical patent/WO2024025312A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/55—IL-2
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/555—Interferons [IFN]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/36—Adaptation or attenuation of cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
    • C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/42—Salmonella
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Cancer is a disease that ultimately threatens life as the proliferation of cells does not stop, burrows into surrounding tissues and destroys normal cells. As the human body's regulatory ability decreases due to aging, it becomes more vulnerable to cancer. In an aging society, cancer has consistently ranked first among all causes of death for 10 years since 2007, exceeding twice the death rate from heart disease, which ranked second. .
  • the most effective response system to treat disease is to strengthen immunity, but since cancer cells are not foreign invaders, they avoid the body's immune response without triggering it. Certain viruses or bacteria infect cancer cells more than normal cells, and infected bacteria can become targets of attack by immune cells. Accordingly, anticancer treatment methods have been proposed that intentionally infect specific viruses or bacteria to stimulate the body's immune response to fight against cancer cells. Infectious bacteria such as Shigella, Vibriocherera, and pathogenic E. coli only penetrate the cells of the intestinal tract, but do not reach the liver and spleen, which are important organs that trigger immune responses. In contrast, Salmonella can invade the spleen and liver through lymph nodes and stimulate a systemic immune response. Specifically, Leschner et al. (J.
  • Salmonella is a representative bacteria that causes food poisoning and can cause sepsis due to infection, which can be life-threatening. Therefore, it is too pathogenic to be used directly for cancer treatment.
  • attenuated Salmonella not only has low survival and immune-inducing ability, but also has a risk of converting the attenuated strain to wild-type Salmonella due to mutation, causing sepsis.
  • most anti-cancer treatments using attenuated Salmonella have been stopped or put on hold in the first stage of the clinical process.
  • Interferon is one of the major cytokines that plays an important role in immunity and is known to have a strong anticancer effect.
  • Interferon-beta IFN- ⁇
  • IFN- ⁇ Interferon-beta
  • IFN- ⁇ Interferon-beta
  • IFN- ⁇ Interferon-beta
  • vesicular stomatitis virus which expresses IFN- ⁇
  • NSCLC non-small cell lung cancer
  • the present inventors proposed the flgM gene; IFN- ⁇ gene; and a recombinant expression vector containing the flhDC gene and an attenuated Salmonella strain transformed with the recombinant expression vector were prepared, and its excellent cancer treatment effect was confirmed, completing the present invention.
  • One aspect is the flgM gene; IFN- ⁇ gene; and a recombinant expression vector containing the flhDC gene, the flgM gene; IFN- ⁇ gene; and the flhDC gene is operably linked to an inducible promoter.
  • Another aspect is to provide an attenuated Salmonella strain transformed with the recombinant expression vector.
  • Another aspect is to provide a pharmaceutical composition for treating cancer containing the attenuated Salmonella strain as an active ingredient.
  • One aspect is the flgM gene; IFN- ⁇ gene; and a recombinant expression vector containing the flhDC gene, the flgM gene; IFN- ⁇ gene; and the flhDC gene is operably linked to an inducible promoter.
  • the present invention relates to a recombinant expression vector containing a gene encoding a fusion protein of flgM and IFN- ⁇ by linking the flgM gene and the IFN- ⁇ gene directly or through a linker.
  • flgM-IFN- ⁇ the fusion protein of flgM and IFN- ⁇ .
  • the term “flgM” refers to a protein or a gene encoding such a protein that inhibits the ⁇ factor responsible for recruiting the RNA polymerase required for late flagellar transcription in the bacterial type 3 secretion system.
  • the “type 3 secretion system” refers to a pathogenic substance delivery system developed in Gram-negative bacteria. This is a syringe-shaped device that injects pathogenic active proteins directly into the cytoplasm through the host's cell membrane (Mota LJ et al, Ann Med. (2005);37(4):234-249), and is a multi-protein complex structure.
  • the hook-basal body which is the basic structure capable of creating a flagellum in the cell membrane, is formed
  • the flgM protein remains in the cytoplasm, and class III genes, such as flagellin, are formed. It acts as an anti- ⁇ 28 factor that interferes with transcription of the subunit FliC or the stator protein MotAB.
  • the present invention prepares a recombinant expression vector containing the flgM gene and the IFN- ⁇ gene, a protein to be secreted, to secrete flgM through the type 3 secretion system of the strain and secrete IFN- ⁇ outside the strain. made possible.
  • the IFN- ⁇ genetic information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI).
  • the term “flhDC” is a main regulator of the flagellin operon gene and can regulate the expression of the flgM gene.
  • the recombinant expression vector additionally includes the flhDC gene along with the flgM gene and the IFN- ⁇ gene, thereby contributing to enhancing the expression or secretion ability of flgM-IFN- ⁇ .
  • the term “gene” should be considered in its broadest sense and may encode a structural protein or a regulatory protein.
  • the regulatory protein may include transcription factors, heat shock proteins, or proteins involved in DNA/RNA replication, transcription, and/or translation.
  • the term “genetic structure” refers to an assembly, functional unit, or construct containing the genetic information of a protein of interest, and can be interpreted in the broadest sense.
  • the genetic construct is intended to enhance secretion of flgM-IFN- ⁇ from an attenuated Salmonella strain, for example, the flgM gene, linker gene, and IFN- ⁇ gene are operably linked. It may refer to a DNA insert.
  • the term “vector” refers to a DNA preparation containing a base sequence encoding the target polynucleotide operably linked to a suitable control sequence to enable expression of the target polynucleotide in a suitable host.
  • the regulatory sequences may include a promoter capable of initiating transcription, an optional operator sequence to regulate such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences that regulate the termination of transcription and translation.
  • the vector After being transformed into a suitable host, the vector can replicate or function independently of the host genome and can be integrated into the genome itself.
  • the vector may be any that can replicate within the host cell.
  • the vector may be a plasmid, cosmid, virus, or bacteriophage in a natural or recombinant state.
  • the vector may include a selection marker for selecting host cells containing the vector.
  • the selection marker is used to select cells transformed with a vector, and markers that confer selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface proteins may be used.
  • the marker may be any one or more selection markers selected from the group consisting of ampicillin, neomycin, puromycin, hygromycin, and zeocin. .
  • the vector may include genes involved in replication and/or copy number control, such as an origin of replication and a promoter, and may include restriction enzyme sites, etc., but is not limited thereto. Additionally, appropriate restriction enzymes can be placed at the front and rear ends of the genetic construct of the present invention so that the genetic construct of the present invention can be introduced into a vector.
  • polynucleotide may be in the form of RNA or DNA, including cDNA and synthetic DNA.
  • DNA can be single-stranded or double-stranded. If single stranded, it may be the coding strand or the non-coding (antisense) strand, and the coding sequence may encode the same polypeptide, as a result of the degeneracy or redundancy of the genetic code. .
  • the polynucleotide may also include variants of the polynucleotides described herein, wherein the variants of the polynucleotide may be naturally occurring allelic variants of the polynucleotide or non-naturally occurring variants of the polynucleotide. You can.
  • An allelic variant is an alternate form of a polynucleotide that may have a substitution, deletion, or addition of one or more nucleotides that does not substantially alter the function of the polynucleotide being encoded. It is well known in the art that a single amino acid can be encoded by more than one nucleotide codon and that the polynucleotide can be easily modified to produce alternating polynucleotides encoding the same peptide.
  • the recombinant expression vector includes the flgM gene; IFN- ⁇ gene; and flhDC genes, it can contribute to increasing the expression or secretion amount of flgM-IFN- ⁇ .
  • the recombinant expression vector includes the flgM gene; And by additionally including the flhDC gene in addition to the IFN- ⁇ gene, the expression or secretion ability of flgM-IFN- ⁇ may be improved.
  • inducible promoter refers to a promoter capable of switching the operation of a linked gene by an inducer, for example, ara promoter, tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL ⁇ promoter, pR ⁇ promoter, rac5 Promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, T7 promoter, pBAD promoter, Tet promoter, trc promoter, pepT promoter, sulA promoter, pol 11(dinA) promoter, ruv promoter, uvrA promoter, uvrB promoter, uvrD promoter , umuDC promoter, lexA promoter, cea promoter, caa promoter, recN promoter, pagC promoter, hip promoter, ansB promoter or pflE promoter.
  • the promoter may be an ara promoter.
  • operably linked may refer to nucleotide sequences being linked on a single nucleic acid fragment such that one function is affected by the other.
  • the flgM gene; IFN- ⁇ gene; and flhDC genes may be regulated by the same inducible promoter.
  • the promoter may be an ara promoter.
  • the recombinant vector includes the flgM gene; IFN- ⁇ gene; As the expression of the flhDC gene is regulated by the same inducible promoter, the expression or secretion ability of flgM-IFN- ⁇ may be improved.
  • the recombinant expression vector includes the flgM gene consisting of the polynucleotide sequence of SEQ ID NO: 1, the IFN- ⁇ gene consisting of the polynucleotide sequence of SEQ ID NO: 3, and the flhDC gene consisting of the polynucleotide sequence of SEQ ID NO: 7 It may be.
  • the recombinant expression vector may include the polynucleotide sequence of SEQ ID NO: 6.
  • the recombinant expression vector may contain the polynucleotide sequence of SEQ ID NO: 3, thereby improving the expression or secretion ability of flgM-IFN- ⁇ .
  • the flgM gene and the IFN- ⁇ gene may be connected through a linker.
  • linker refers to a polypeptide chain or the gene encoding the same used to link a heterologous domain to a protein of interest.
  • the linker peptide may be 2 to 50 amino acids long, e.g., 2 to 40, 2 to 30, 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 50, It may be 5 to 40, 5 to 30, 5 to 20, 5 to 15, or 5 to 10 amino acids in length, but is not limited thereto.
  • the linker peptide is, for example, (G lS m ) n (l, m and n are each ⁇ 2), (G lS m ) n- Hp- (G lS m ) n (l, m and n is each ⁇ 1, H ⁇ 6), (G 4 S) a (EAAAK) b (G 4 S) a (a, b are integers from 1 to 4), (G 4 S) p (EAAAK) q ( p , q are integers from 1 to 4 ) , ( EAAAK) i is an integer from 1 to 4), KESGSVSSEQLAQFRSLD, EGKSSGSGSESKST, GSAGSAAGSGEF, (EAAAK) k (k is an integer from 1 to 5), CRRRRRREAEAC, GGGGGGGG, GGGGGG, AEAAAKEAAAAKA, PAPAP, VSQTSKLTRAETVFPDV, PLGLWA
  • the flgM gene and the IFN- ⁇ gene may be connected through a linker consisting of the polynucleotide sequence of SEQ ID NO: 4 or 5.
  • the flgM gene and the IFN- ⁇ gene are linked through a gene (SEQ ID NO: 5) encoding the GGSSHHHHHHSSGG linker peptide, thereby improving the expression or secretion ability of flgM-IFN- ⁇ . It could be.
  • Another aspect is to provide an attenuated Salmonella strain transformed with the recombinant expression vector.
  • the above attenuated Salmonella strain among the terminological elements mentioned, those that are the same as those already mentioned are as described above.
  • the term “transformation” refers to introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed within the host cell.
  • the polynucleotide may be introduced into the host cell in the form of an expression cassette, or may be introduced into the host cell in its own form and operably linked to the sequence required for expression in the host cell. It doesn't work.
  • the term "attenuated” refers to artificially weakening the toxicity of a living pathogen. It means mutating the genes involved in the essential metabolism of the pathogen to prevent it from causing disease in the body and stimulating only the immune system to induce immunity. .
  • the attenuated Salmonella strains include aroA, aroC, aroD, aroE, asd, Rpur, rcsB, htrA, ompR, ompF, ompC, galE, cya, crp, cyp, phoP, phoQ, rfaY, dksA, hupA, sipC, clpB, clpP, clpX, pab, nadA, pncB, pmi, rpsL, hemA, rfc, poxA, galU, cdt, pur, ssa, guaA, guaB,
  • the function of one or more genes selected from the group consisting of fliD, flgK, flgL, relA, and spoT may be lost.
  • the attenuated Salmonella strain has anticancer activity by targeting the tumor site and inducing an immune response. It was confirmed that the expression and secretion levels of flgM-IFN- ⁇ were significantly increased by transforming the attenuated Salmonella strain according to one embodiment with the recombinant expression vector, and through this, the agent containing the Salmonella strain was administered to the subject. In this case, it was confirmed that it exhibited excellent anticancer effect.
  • the attenuated Salmonella strain may be a Salmonella strain that has lost the functions of the aroA, aroD, asd, and galE genes, or may be a Salmonella strain that has lost the functions of the aroA, aroD, asd, rcsB, and galE genes.
  • the attenuated Salmonella strain that has lost the functions of the aroA, aroD, asd, rcsB, and galE genes is transformed with the recombinant expression vector according to one embodiment, the expression and secretion ability of flgM-IFN- ⁇ It was confirmed that this significantly increased.
  • the expression of the attenuated gene may be controlled by a second inducible promoter.
  • loss of function of a specific gene may be regulated by a second inducible promoter.
  • the attenuated Salmonella strain may further include a second inducible promoter in front of the attenuated gene, thereby switching the attenuation of the strain.
  • the attenuated Salmonella strain is injected into a subject in an attenuated state to target the tumor site, and then the expression of the attenuated gene is induced by operation of the second inducible promoter, resulting in high immune activity. This may make cancer treatment more effective.
  • the attenuated Salmonella strain may have lost the function of the galE gene, and the loss of function of the galE gene may be switched by the tetRA promoter. Therefore, the attenuated Salmonella strain may be injected into an individual in an attenuated state to target the tumor site, and then the expression of the galE gene may be induced by doxycycline, thereby causing high immune activity of the Salmonella strain. there is.
  • the expression control of the attenuated gene of this attenuated Salmonella strain is expressed as “galE:tetRA”.
  • the attenuated Salmonella strain according to one embodiment may be the BRD509 asd rcsB galE:tetRA- strain, and it was confirmed that this attenuated Salmonella strain exhibits excellent flgM-IFN- ⁇ expression or secretion ability.
  • the attenuated Salmonella strain may be one deposited under the accession number KCTC15509BP.
  • Another aspect provides a pharmaceutical composition for preventing or treating cancer containing the attenuated Salmonella strain as an active ingredient.
  • the pharmaceutical composition among the terminological elements mentioned, those that are the same as those already mentioned are as described above.
  • Cancer a disease to be prevented or treated by the composition of the present invention, has aggressive characteristics in which cells divide and grow in defiance of normal growth limits, invasive characteristics that infiltrate surrounding tissues, and It is a general term for diseases caused by cells with metastatic characteristics that spread to other parts of the body.
  • the cancer may be, for example, a solid cancer, and preferably, if it is a tumor containing cancer tissue or cancer cells in which the cancer-targeting ability of the Salmonella strain can be exerted, the application can be extended without limitation.
  • the type of cancer includes any one selected from the group consisting of head and neck cancer, skin cancer, pancreatic cancer, colon cancer, colon cancer, stomach cancer, liver cancer, colon cancer, brain cancer, breast cancer, thyroid cancer, bladder cancer, esophageal cancer, uterine cancer, and lung cancer. It may apply, but is not limited thereto.
  • composition of the present invention can be prepared by methods known in the pharmaceutical field for use as a drug for preventing or treating cancer, and can be used as such or as a pharmaceutically acceptable carrier, forming agent, It can be used by mixing with a diluent, etc.
  • compositions may be determined in part depending on the particular composition being administered, as well as in part depending on the particular method used to administer the composition. Accordingly, suitable formulations of the compositions vary widely; for example, the compositions may be formulated for parenteral (i.e., intramuscular, intradermal, or subcutaneous) administration or nasopharyngeal (i.e., intranasal) administration. Generally, formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions.
  • non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers can include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles may include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Preservatives and other additives may also be present, such as antibacterial agents, antioxidants, chelating agents, and inert gases.
  • the dosage of the active ingredient according to the present invention can be appropriately selected depending on the absorption of the active ingredient in the body, the form of the preparation, the patient's age, gender and condition, the severity of symptoms, etc., and the administration may be done once a day. , may be administered in several divided doses.
  • the typical dosage is 0.001mg/kg ⁇ day to 10g/kg ⁇ day.
  • Another aspect provides a method for preventing or treating cancer, comprising administering to a subject an anti-cancer pharmaceutical composition containing the attenuated Salmonella strain as an active ingredient in an amount effective for preventing or treating cancer. do.
  • an anti-cancer pharmaceutical composition containing the attenuated Salmonella strain as an active ingredient in an amount effective for preventing or treating cancer. do.
  • the subject may be a mammal.
  • the mammal may be a human, dog, cat, cow, goat, or pig.
  • the administration may be administered through any common route as long as it can reach the target tissue.
  • it can be administered through routes such as eye drop administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, transdermal patch administration, oral administration, intranasal administration, intrapulmonary administration, and intrarectal administration.
  • routes such as eye drop administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, transdermal patch administration, oral administration, intranasal administration, intrapulmonary administration, and intrarectal administration.
  • it can be administered according to the purpose through a route of eye drop administration.
  • treatment or “treating” or “palliative” or “ameliorative” are used interchangeably herein. These terms refer to methods of obtaining advantageous or desired results, including but not limited to therapeutic benefits and/or prophylactic benefits.
  • Treatment benefit means any therapeutically significant improvement or effect on one or more diseases, conditions or symptoms under treatment.
  • the composition may be administered to a subject at risk of developing a particular disease, condition or condition or to a subject who reports one or more physiological symptoms of the disease, even if the disease, condition or condition has not yet manifested.
  • the term “effective amount” or “therapeutically effective amount” refers to an amount of agent sufficient to cause a beneficial or desired result.
  • the therapeutically effective amount may vary depending on one or more of the subject and condition being treated, the subject's weight and age, the severity of the condition, the mode of administration, etc., and can be easily determined by a person skilled in the art.
  • the term also applies to a capacity that will provide an image for detection by any of the imaging methods described herein.
  • the specific dosage may vary depending on one or more of the specific agent selected, the dosage regimen followed, whether it is administered in combination with other compounds, the timing of administration, the tissue being imaged, and the bodily delivery system carrying it.
  • the recombinant expression vector in the case of the attenuated Salmonella strain transformed with the recombinant expression vector, it was confirmed that the expression and secretion of flgM-IFN- ⁇ was significantly enhanced.
  • the recombinant expression vector according to one aspect, it was confirmed that when a preparation containing an attenuated Salmonella strain transformed with the recombinant expression vector was administered, it exhibited excellent anticancer effect and stability.
  • Figure 1 is a diagram schematically showing the tumor suppression process of IFN- ⁇ .
  • Figure 2 is a diagram schematically showing the extra-strain secretion process of flgM-IFN- ⁇ using a type 3 secretion system.
  • Figure 3 is a diagram briefly showing the secretion mechanism of flgM through the flagellum formation process in the type 3 secretion system.
  • Figure 4 is a diagram showing the cleavage map of the flgM-IFN- ⁇ -flhDC-pBAD18-asd+ plasmid.
  • Figure 5 shows the results of confirming the flgM-IFN- ⁇ protein secretion level of the strain according to one example through Western blot.
  • Figure 5 (a) is the result of Comparative Example 1
  • (b) is the result of Comparative Example 2.
  • Figure 6 shows the results of confirming the flgM-IFN- ⁇ protein secretion level of the strain according to one example through Western blot.
  • Figure 6 (a) is the result of Comparative Example 3, and (b) is the result of Example 1.
  • Figure 7 is a diagram schematically showing the processing process for a tumor mouse model of a strain according to an embodiment.
  • Figure 8 is a graph showing the change in tumor volume in mice when mice were treated with a strain according to an example (CTRL: control group, Bacteria: arabinose non-treated group, Induction: arabinose treated group).
  • Figure 9 is a graph showing the change in body weight of mice when mice are treated with a strain according to an example (CTRL: control group, Bacteria: arabinose untreated group, Induction: arabinose treated group).
  • Example 1 Preparation of plasmid for secretion of IFN- ⁇ and attenuated Salmonella strain transformed therewith
  • a genetic construct in which the flgM gene and the IFN- ⁇ gene were linked was prepared.
  • the flgM DNA sequence of wild-type Salmonella (flgM anti-sigma-28 factor FlgM [Salmonella enterica subsp. enterica serovar Typhimurium str. LT2] Gene ID: 1252690, Locus tagSTM1172 NC_003197.2 (1257036..1257341, complement))
  • DNA sequences obtained through codon optimization for IFN- ⁇ were linked through a linker to prepare a genetic construct.
  • a shine-Dalgarno sequence was inserted in front of the flgM gene.
  • a NheI site (GCTAGC) was inserted at the beginning, and a SacI site (GAGCTC) was inserted after the stop codon of IFN- ⁇ .
  • a genetic construct containing flgM, linker, and IFN- ⁇ was manufactured through Bionics Gene Synthesis Service, and the genetic construct was treated with 10 U each of NheI and SacI enzymes and reacted at 37°C for 2 hours. After electrophoresis, approximately 900bp DNA was confirmed using a gel extraction kit (Qiagen Co., Ltd.) to obtain flgM-linker-IFN- ⁇ insert DNA.
  • a PCR product containing the flhDC gene was obtained by PCR using the flhD-sac1-F and flhC-Sal1-r primers in Table 1 below using the genomic DNA of wild-type Salmonella LT2 as a template. .
  • Specific PCR conditions are as follows; 5 ⁇ l of 10x buffer, 10 ⁇ l of 5xQ solution, 7.5 ⁇ l of 2 mM dNTPs, 2.5 ⁇ l of 20 ⁇ M flhD-sac1-f primer, 2.5 ⁇ l of 20 ⁇ M flhC-Sal1-r primer, 1 ⁇ l of Taq polymerase, 2 ⁇ l of 10 ng/ ⁇ l genomic DNA, and water. 19.5 ⁇ l was mixed and PCR was performed using the Qiagen system at 95°C for 5 minutes, followed by 30 cycles of 94°C for 30 seconds, 49°C for 30 seconds, and 72°C for 1 minute, followed by 72°C for 10 minutes.
  • denomination sequence information sequence number flhD-SAC1-f gatcgatcgagctcaggaggtttgatcctatgggaacaatgcatacatccgagttgct 8 flhC-Sal1-r gatcgatcgtcgacttaaacagcctgttcgatctgttcatccagcagtt 9
  • each vector DNA was ligated with the flgM-linker-IFN- ⁇ insert DNA at 25°C for 30 minutes and transformed into DH5a competent cells. Thereafter, the transformed cells were spread on LB amp (ampicillin) solid medium and cultured at 37°C to select colonies with antibiotic resistance.
  • each vector DNA was ligated with the flhDC insert DNA for 30 minutes at 25°C, and then DH5a competent cells were transformed. Transformed cells were plated on LB amp solid medium and cultured at 37°C to select colonies with antibiotic resistance. Six candidate colonies were selected and reacted with 10U of SacI and SalI at 37°C for 1 hour, and then the formation of a band was confirmed through electrophoresis. Base sequence analysis of the candidate group was performed to confirm the insertion of the flhDC gene.
  • denomination sequence information sequence number flgM atgagcattgaccgtacctcacctttgaaacccgttagcactgtccagacgcgcgaaaccagcgacacgccggtacaaaaacgcgtcaggaaaaaacgtccgccgcgacgagcgccagcgtaacgttaagcgcgcgcaagcgaagctcatgcagccaggcgtcagcgacattaatatggaacgcgtcgaagcatta aaaacggctatccgtaacggtgagttaaaaatggatacgggaaaaatagcagactcgctcattcgcgaggcgcagagctacttacagagtaaaaaaaa One IFN- ⁇ 1 ATGATTAATTATAA
  • the plasmids of Example 1-2 were each transformed into attenuated Salmonella strains.
  • As the attenuated Salmonella strain BRD509 asd galE:tetRA- strain (#1317) or BRD509 asd rcsB galE:tetRA- strain (#1323) was used, and each strain was distributed from Chungnam National University. The genes and strain information of the transformed strain are shown in Table 3 below.
  • Example 1 Comparative Example 1 Comparative Example 2 Comparative Example 3 IFN- ⁇ gene IFN- ⁇ 2 IFN- ⁇ 1 IFN- ⁇ 1 IFN- ⁇ 2 linker gene linker2 linker1 linker1 linker2 strain #1323 #1317 #1323 #1317
  • the present inventors deposited the flgM-IFN- ⁇ -flhDC-pBAD18-asd+/ BRD509 asd rcsB galE:tetRA - strain according to an example to the Korea Research Institute of Bioscience and Biotechnology Biological Resources Center on July 18, 2023, accession number KCTC15509BP. was granted (S-flgM-mIFNb2-flhDC-pBAD18-ASD+/#1323).
  • the expression level of the protein was measured through Westet blot in the following manner.
  • a single colony of each transformed strain was inoculated into LB amp liquid medium and cultured with shaking at 37°C for 12 to 16 hours. Afterwards, it was diluted in fresh LB amp liquid medium to an OD600 of 0.05 and cultured with shaking at 37°C for 2 hours. Afterwards, when the OD600 was 0.4 to 0.6, the group treated with arabinose at 0.2% (w/v) (final) concentration was divided into the test group (+), and the untreated group was divided into the control group (-), which were The culture was shaken for an additional 5 hours at 37°C. Thereafter, the samples of the test group and control group were separated into whole cell culture, pellet, and supernatant.
  • the pellet and supernatant were separated from the entire cell culture by centrifugation at 8000 rpm. Additionally, the supernatant was again filtered through a 0.2 ⁇ m filter to completely remove bacteria, and concentrated using Pall's nanosep (OD010C35 3K omega).
  • Samples for Western blot were prepared by mixing 50 ⁇ l each of the total cell culture, pellet, and supernatant samples with SDS sample buffer. Each sample was denatured in a heating block at 100°C for 5 minutes, centrifuged at 13000 rpm at 4°C for 5 minutes, and electrophoresed on a 10% polyacrylamide gel. The gel was transferred using PVDF (polyvinylidene fluoride) to transfer proteins to a PVDF membrane, and the membrane was blocked for 1 hour at room temperature using blocking buffer. Afterwards, anti-his tag (SB194b, SouthernBiotech) was diluted 1/1000 as the primary antibody and reacted at 4°C for 16 hours.
  • PVDF polyvinylidene fluoride
  • Murine CT26 colon carcinoma cells were purchased from American Type Culture Collection. CT26 cells were cultured in DMEM (Dulbecco's modified Eagle's medium) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • a tumor mouse model was prepared by xenografting the CT26 colon carcinoma cells cultured in Experimental Example 2-1. Care, experimentation, and euthanasia of all animals were performed according to approved protocols.
  • the mouse used was a 6-week-old female mouse of approximately 20 g purchased from OrientBio.
  • CT26 tumor cells cultured in vitro were collected as in Experimental Example 2-1, and then suspended in 20 ⁇ l of PBS. 5 ⁇ 10 5 of the suspended cells were subcutaneously injected into the right back of the BALB/c mouse to xenograft tumor cells. Afterwards, when the size of the tumor reached 100 mm 3 (about 10-14 days after tumor cell xenograft), the strain according to one example was treated.
  • the tumor mouse model according to Experimental Example 2-2 i) a group treated with PBS as a control (control, ctrl), ii) a group not treated with arabinose after treatment with the strain of Example 1 (Bacteria) , and iii) After treatment with the strain of Example 1, the experiment was conducted by dividing into an arabinose-treated group (induction), and the strain of Example 1 was injected into PBS through the tail vein at a dose of about 1 ⁇ 10 7 CFU/mouse. administered (0 day).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Insects & Arthropods (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

IFN-β 단백질의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주에 관한 것으로서, flgM 유전자; IFN-β 유전자; 및 flhDC 유전자를 포함하는 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주, 및 상기 약독화 살모넬라 균주를 유효성분으로 포함하는 암 치료용 약학적 조성물을 제공한다.

Description

인터페론-베타 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
인터페론-베타의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주에 관한 것이다. 본 특허출원은 2022년 07년 25일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2022-0092017호에 대하여 우선권을 주장하며, 상기 특허출원의 개시 사항은 본 명세서에 참조로서 삽입된다.
암은 세포의 증식 활동이 멈추지 않아 주변 조직으로 파고들어 정상세포를 파괴하는 것에 의해 결국에는 생명을 위협하는 질환이다. 노화에 의해 인체의 조절능력이 낮아짐에 따라 암에 취약해지게 되어, 고령화 사회에서 암은 2007년부터 10년째 전체 사망원인 중 부동의 1위를 차지하며 2위인 심장질환 사망률의 2배를 넘어섰다.
질병의 치료에 가장 효과적인 대응 체계는 면역력을 강화하는 것이나, 암세포는 외부 침입자가 아니기 때문에 인체의 면역반응을 유발하지 않고 회피한다. 특정 바이러스 또는 박테리아는 정상세포보다 암세포에 더 많이 감염되고, 감염된 박테리아가 면역세포의 공격대상이 될 수 있다. 이에 일부러 특정 바이러스 또는 박테리아를 감염시켜 인체 면역반응을 자극함으로써 암세포에 대항할 수 있도록 하는 항암치료 방법들이 제시되었다. 시겔라(Shigella), 콜레라균(Vibriocholera), 병원성 대장균(pathogenic E. coli)과 같은 감염성 세균들은 장관의 세포에 침투할 뿐, 면역반응을 일으키는 중요한 기관인 간과 비장에는 도달하지 못한다. 이와 대조적으로 살모넬라균은 림프절을 통하여 비장과 간에 침투하여 전신 면역반응을 자극시킬 수 있다. 구체적으로, Leschner 등(J. Mol. Med. 2010, 88, 763-773)은 CT26 종양을 갖는 마우스를 대상으로 형광을 나타내는 살모넬라균을 정맥주사로 감염시킨 후, 시간에 따른 감염 경로를 추적하였다. 그 결과 감염 직후에는 마우스의 혈액을 통해 전신이 감염된 것을 보여주었으며, 감염 20분 후에는 비장과 간에 살모넬라균이 축적되었으며, 24시간 후에는 종양 조직에만 살모넬라균이 집중적으로 축적되어 있음을 관측하였다.
하지만 살모넬라균은 식중독을 유발하는 대표적인 균으로 감염에 의해 패혈증을 유발하여 생명을 위협할 수 있으므로 직접적으로 암 치료에 사용하기에는 병원성이 너무 강하다. 미국 예일대학 연구팀은 살모넬라를 유전자 조작하면 종양을 공격하는 특성은 유지하면서 독성만 제거하여 약독화할 수 있으며, 상기 약독화된 살모넬라의 주입을 통해 면역 자극을 유도하여 종양을 억제할 수 있다고 발표하였다. 그러나 약독화된 살모넬라는 생존성이 낮고 면역유발능 역시 저하될 뿐 아니라 돌연변이로 인하여 약독화 균주가 야생형 살모넬라로 전환되어 패혈증을 일으킬 우려가 있다. 이에 더하여 연구개발자금의 부족 문제로 인하여 약독화된 살모넬라를 이용한 항암치료는 임상과정의 1단계에서 대부분 중단되거나 보류된 상태이다.
살모넬라와 같은 박테리아를 이용한 암 치료에 동반되어 발생할 수 있는 패혈증의 유발은 극복해야 할 매우 중요한 문제이며, 이에 더하여 면역반응의 자극 역시 활발하게 이루어질 수 있어야 한다. 이에 약독화 및 면역 활성화와 함께 항암치료에 도움이 되는 물질들을 추가로 발현 또는 억제시킬 수 있는 균주들을 개발하고, 이를 항암치료에 이용하고자 하는 연구들이 주를 이루고 있다. 등록특허 제10-0852687호는 약독화된 살모넬라 균주 내에 종양괴사인자 알파단백질 벡터를 형질도입한 종양괴사인자 알파를 발현하는 살모넬라 균주 및 이를 함유하는 항암 치료용 조성물에 대해 게시하였으며, 등록특허 제10-1750007호는 L-아스파라기나아제가 종양 사이트에서 선택적으로 발현될 수 있는 약독화 살모넬라 균주를 이용한 고형암 치료제에 대해 게시하였다.
인터페론(Interferon, IFN)은 면역에서 중요한 역할을 하는 주요 사이토카인(cytokine) 중 하나로서, 강력한 항암 효과가 있는 것으로 알려져 있다. 인터페론-베타(Interferon-beta, IFN-β)는 타입 1 인터페론으로, 종양 미세환경에서 p53과 상호작용하여 종양 성장을 직접적으로 억제할 수 있다고 알려져있다. 또한, 인터페론 처리된 호중구는 PD-L1을 상향조절(upregulate)하고, T-세포 증식을 억제하는 것으로 나타난다. 인터페론-β는 인터페론 수용체 타입 1인 IFNAR1 및 IFNAR2에 결합한 후, TYK2 및 JAK2를 통해 신호를 전달하고, 이후 차례로 STAT 패밀리 멤버 (STAT1, STAT2, STAT3 등)을 인산화하고, 다운스트림 기능을 활성화하여 항-종양 활성을 자극한다. 예를 들어, IFN-β를 발현하는 수포성 구내염 바이러스(vesicular stomatitis virus)는 비소세포폐암(NSCLC)의 쥐 모델에서 항종양 면역 반응을 강화하는 것으로 나타났다 (Kim Y, Lee D, Lee J, Lee S, Lawler S (2019) Role of tumor-associated neutrophils in regulation of tumor growth in lung cancer development: A mathematical model. PLoS ONE 14 (1): e0211041).
이에 본 발명자들은 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자를 포함하는 재조합 발현 벡터 및 상기 재조합 발현 벡터로 형질전환된 약독화 살모넬라 균주를 제조하고, 이의 우수한 암 치료 효과를 확인한 바, 본 발명을 완성하였다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
일 양상은 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자를 포함하는 재조합 발현 벡터로서, 상기 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자는 유도성 프로모터에 작동가능하게 연결된 것인, 재조합 발현 벡터를 제공하는 것이다.
다른 양상은 상기 재조합 발현 벡터로 형질전환된, 약독화 살모넬라 균주를 제공하는 것이다.
또 다른 양상은 상기 약독화 살모넬라 균주를 유효성분으로 포함하는 암 치료용 약학적 조성물을 제공하는 것이다.
일 양상은 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자를 포함하는 재조합 발현 벡터로서, 상기 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자는 유도성 프로모터에 작동가능하게 연결된 것인, 재조합 발현 벡터를 제공한다.
본 발명은 flgM 유전자 및 IFN-β 유전자가 직접 또는 링커를 통해 연결되어, flgM 및 IFN-β의 융합 단백질을 암호화하는 유전자를 포함하는 재조합 발현 벡터에 관한 것이다. 이하 본 명세서에서는 flgM 및 IFN-β의 융합단백질을 “flgM-IFN-β”라 한다.
본 명세서에서 용어,“flgM”은 박테리아의 3형 분비계에서 후기 편모 전사를 위해 필요한 RNA 중합효소를 동원하는 것을 담당하는 σ인자를 억제하는 단백질 또는 이러한 단백질을 암호화하는 유전자를 지칭한다.
상기 “3형 분비계”는 그람 음성균에 발달된 병원성 물질 전달 시스템을 의미한다. 이는 숙주의 세포막을 통과하여 직접 세포질로 병원성 활성 단백질을 주입하는 주사기 형태의 기구(Mota LJ et al, Ann Med.(2005);37(4):234-249)로서, 다중 단백질 복합 구조체이다. 상기 3형 분비계에서, 세포막에 편모를 만들 수 있는 기본 구조인 후크(hook)-기저체(basal body)가 형성되는 동안, flgM 단백질은 세포질 내에 남아있으며, class III 유전자, 예를 들어 플라젤린 서브유닛 FliC 또는 고정자(stator) 단백질 MotAB의 전사를 방해하는 항-σ28 인자로서 작용한다. 이후, 후크-기저체 구조 완성 후, 동시에 플라젤라 분비 시스템 내 기질 특이성의 변화가 일어나고, 이로 인해 flgM은 후크의 중앙통로를 통해 세포 밖으로 분비되고, 이후 세포 내에서는 σ28-의존적 전사가 시작된다. 3형 분비계에서의 편모 형성 과정을 통한 flgM의 분비기작은 도 3에 나타낸 바와 같다.
일 구체예에서, 본 발명은 flgM 유전자와 분비하고자 하는 단백질인 IFN-β 유전자를 포함하는 재조합 발현 벡터를 제조하여, 균주의 3형 분비계를 통한 flgM의 분비와 함께 IFN-β의 균주 외 분비를 가능하게 하였다. 상기 IFN-β 유전 정보는 NCBI (National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터 베이스로부터 수득할 수 있다.
본 명세서에서 용어, “flhDC”는 플라젤린 오페론 (operon) 유전자의 주된 조절자로 flgM 유전자의 발현을 조절할 수 있다. 일 실시예에 따르면, 상기 재조합 발현 벡터가 flgM 유전자 및 IFN-β 유전자와 함께 flhDC 유전자를 추가로 포함함으로써, flgM-IFN-β의 발현능 또는 분비능 증진에 기여할 수 있다.
본 명세서에서 용어, "유전자"는 최광의의 의미로 간주되어야 하며, 구조 단백질 또는 조절 단백질을 암호화할 수 있다. 이때, 조절 단백질은 전사인자, 열 충격단백질 또는 DNA/RNA 복제, 전사 및/또는 번역에 관여하는 단백질을 포함할 수 있다.
본 명세서에서 용어, "유전적 구조물"은 목적하는 단백질의 유전 정보를 포함하는 집합체, 기능적 단위체, 또는 컨스트럭트를 지칭하며, 이는 최광의로 해석될 수 있다. 상기 유전적 구조물은 본 발명의 목적상, 약독화된 살모넬라 균주로부터 flgM-IFN-β의 분비를 증진시키기 위한 것으로서, 예를 들어, flgM 유전자, 링커 유전자, 및 IFN-β 유전자가 작동가능하게 연결된 DNA 인서트를 지칭하는 것일 수 있다.
본 명세서에서 용어, “벡터”는 적합한 숙주 내에서 목적 폴리뉴클레오티드를 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 상기 목적 폴리뉴클레오티드를 코딩하는 염기서열을 함유하는 DNA 제조물을 의미한다. 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합 부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다. 상기 벡터는 숙주세포 내에서 복제 가능한 임의의 것일 수 있다. 예를 들어, 상기 벡터는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 또는 박테리오파지일 수 있다. 상기 벡터는 벡터를 함유하는 숙주 세포를 선택하기 위한 선택 마커를 포함할 수 있다. 선택 마커는 벡터로 형질전환된 세포를 선별하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 예를 들어, 상기 마커는 암피실린(ampicillin), 네오마이신(neomycin), 퓨로마이신(puromycin), 히그로마이신(hygromycin) 및 제오신(zeocin)으로 구성된 군으로부터 선택되는 어느 하나 이상의 선택 마커일 수 있다. 상기 벡터는 복제원점, 프로모터 등 복제 및/또는 카피수 조절에 관여하는 유전자를 포함할 수 있고, 제한효소 부위 등을 포함할 수 있으나 이에 제한되지 않는다. 또한, 본 발명의 유전적 구조물을 벡터에 도입할 수 있도록 본 발명의 유전적 구조물 전단과 후단에 적절한 제한효소를 배치할 수 있다.
본 명세서에서 용어 “폴리뉴클레오타이드”는 RNA 또는 DNA의 형태일 수 있는데, 상기 DNA는 cDNA 및 합성 DNA를 포함한다. DNA는 단일 가닥이거나 이중 가닥일 수 있다. 만약 단일 가닥이라면, 이는 코딩 가닥 또는 비-코딩(안티센스) 가닥일 수 있고, 상기 코딩 서열은, 유전적 코드의 축퇴성(degeneracy) 또는 중복성(redundancy)의 결과로서, 동일한 폴리펩티드를 인코딩할 수 있다.
상기 폴리뉴클레오티드는 또한 본 명세서에 기술된 폴리뉴클레오티드의 변이체를 포함할 수 있으며, 상기 폴리뉴클레오티드의 변이체는 폴리뉴클레오티드의 자연적으로 발생하는 대립(allelic) 변이체 또는 폴리뉴클레오티드의 비-자연적으로 발생하는 변이체일 수 있다. 대립 변이체는, 인코딩(암호화)되는 폴리뉴클레오티드의 기능을 실질적으로 변경하지 않는, 하나 이상의 뉴클레오티드들의 치환, 결실, 또는 부가를 가질 수 있는 폴리염기서열의 교대(alternate) 형태이다. 단일 아미노산이 하나 이상의 뉴클레오티드 코돈에 의해 인코딩될 수 있고 상기 폴리뉴클레오티드가 동일한 펩티드를 암호화하는 교대 폴리뉴클레오티드를 제조하도록 용이하게 변형될 수 있음이 당업계에 잘 알려져 있다.
일 실시예에 따르면, 상기 재조합 발현 벡터가 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자를 모두 포함함으로써, flgM-IFN-β의 발현량 또는 분비량을 증진시키는데 기여할 수 있다. 예를 들어, 상기 재조합 발현 벡터는 flgM 유전자; 및 IFN-β 유전자에 더하여 flhDC 유전자를 추가로 포함함으로써, flgM-IFN-β의 발현능 또는 분비능이 증진된 것일 수 있다.
본 명세서에서 "유도성 프로모터"란 유도물질에 의해 연결된 유전자의 작동을 스위칭할 수 있는 프로모터로, 예를 들어 ara 프로모터, tac 프로모터, lac프로모터, lacUV5 프로모터, lpp 프로모터, pLλ프로모터, pRλ프로모터, rac5 프로모터, amp 프로모터, recA프로모터, SP6 프로모터, trp 프로모터, T7 프로모터, pBAD 프로모터, Tet 프로모터, trc 프로모터, pepT 프로모터, sulA 프로모터, pol 11(dinA) 프로모터, ruv 프로모터, uvrA 프로모터, uvrB 프로모터, uvrD 프로모터, umuDC 프로모터, lexA 프로모터, cea 프로모터, caa 프로모터, recN 프로모터, pagC 프로모터, hip 프로모터, ansB 프로모터 또는 pflE 프로모터 일 수 있다. 일 구체예에서, 상기 프로모터는 ara 프로모터 일 수 있다.
본 명세서에서 "작동 가능하게 연결된"은 하나의 기능이 다른 것에 의하여 영향을 받도록 단일 핵산 단편 상에서 뉴클레오티드 서열들이 연결된 것을 나타낼 수 있다.
일 구체예에서, 상기 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자는 동일한 유도성 프로모터에 의해 발현이 조절되는 것일 수 있다. 일 구체예에서, 상기 프로모터는 ara 프로모터 일 수 있다.
일 실시예에 따르면, 상기 재조합 벡터는 상기 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자가 동일한 유도성 프로모터에 의해 발현이 조절됨에 따라, flgM-IFN-β의 발현능 또는 분비능이 증진된 것일 수 있다.
일 구체예에서, 상기 재조합 발현 벡터는 서열번호 1의 폴리뉴클레오티드 서열로 이루어지는 flgM 유전자, 서열번호 3의 폴리뉴클레오티드 서열로 이루어지는 IFN-β 유전자, 및 서열번호 7의 폴리뉴클레오티드 서열로 이루어지는 flhDC 유전자를 포함하는 것일 수 있다. 일 구체예에서, 상기 재조합 발현 벡터는 서열번호 6의 폴리뉴클레오티드 서열을 포함하는 것일 수 있다. 일 실시예에 따르면, 상기 재조합 발현 벡터는 서열번호 3의 폴리뉴클레오티드 서열을 포함함으로써, flgM-IFN-β의 발현능 또는 분비능이 증진된 것일 수 있다.
일 구체예에서, 상기 flgM 유전자 및 IFN-β 유전자는 링커를 통하여 연결될 수 있다.
본 명세서에서 용어,“링커”란 관심있는 단백질에 이종성 도메인(domain)을 연결하는 데 사용된 폴리펩티드 사슬 또는 이를 암호화하는 유전자를 지칭한다. 상기 링커 펩티드는 2 내지 50개의 아미노산 길이, 예를 들어, 2 내지 40개, 2 내지 30개, 2 내지 20개, 2 내지 15개, 2 내지 10개, 2 내지 5개, 5 내지 50개, 5 내지 40개, 5 내지 30개, 5 내지 20개, 5 내지 15개, 또는 5 내지 10개의 아미노산 길이일 수 있으나, 이에 제한되는 것은 아니다. 상기 링커 펩티드는 예를 들어, (GlSm)n(l, m 및 n은 각각 ≥ 2), (GlSm)n-Hp-(GlSm)n (l, m 및 n은 각각 ≥ 1, H ≥ 6), (G4S)a(EAAAK)b(G4S)a(a, b는 1 내지 4의 정수), (G4S)p(EAAAK)q(p, q는 1 내지 4의 정수), (EAAAK)x(G4S)y(x, y는 1 내지 4의 정수), A(EAAAK)4ALEA(EAAAK)4A, (GSSGGS)i(i는 1 내지 4의 정수), KESGSVSSEQLAQFRSLD, EGKSSGSGSESKST, GSAGSAAGSGEF, (EAAAK)k(k는 1 내지 5의 정수), CRRRRRREAEAC, GGGGGGGG, GGGGGG, AEAAAKEAAAAKA, PAPAP, VSQTSKLTRAETVFPDV, PLGLWA, TRHRQPRGWE, AGNRVRRSVG, RRRRRRRR, GGSSHHHHHHSSGG, GGSSHHHHHHSSGGLVPRGSH, 및 GSSGGSGSSGGSGGGDEADGSRGSQKAGVDE로 구성되는 군으로부터 선택되는 어느 하나일 수 있으나, 이에 제한되는 것은 아니다. 일 구체예에서, 상기 링커 펩티드는 GGSSHHHHHHSSGG, 또는 GGSSHHHHHHSSGGLVPRGSH 일 수 있다.
일 구체예에서, 상기 flgM 유전자 및 IFN-β 유전자는 서열번호 4 또는 5의 폴리뉴클레오티드 서열로 이루어지는 링커를 통해 연결된 것일 수 있다.
일 실시예에 따른 재조합 발현 벡터는, 상기 flgM 유전자 및 IFN-β 유전자가 상기 GGSSHHHHHHSSGG 링커 펩티드를 암호화하는 유전자 (서열번호 5)를 통해 연결됨으로써, flgM-IFN-β의 발현능 또는 분비능이 증진된 것일 수 있다.
다른 양상은, 상기 재조합 발현 벡터로 형질전환된 약독화 살모넬라 균주를 제공하는 것이다. 상기 약독화 살모넬라 균주에서, 언급된 용어 요소 중 이미 언급된 것과 동일한 것은 상기한 바와 같다.
본 명세서에서 용어, "형질전환"은 목적 단백질을 암호화하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 암호화하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 예를 들어, 상기 폴리뉴클레오티드는 발현 카세트의 형태로 숙주세포에 도입될 수 있으며 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
본 명세서에서 용어, "약독화"는 살아있는 병원체의 독성을 인위적으로 약하게 한 것으로, 병원체의 필수 대사에 관여하는 유전자를 변이시켜 체내에서 질병을 일으키지 못하고 면역 체계만을 자극하여 면역성을 유도하는 것을 의미한다. 살모넬라의 약독화 초래 유전자는 당업계에 잘 알려져 있으며, 예를 들어, 상기 약독화 살모넬라 균주는 aroA, aroC, aroD, aroE, asd, Rpur, rcsB, htrA, ompR, ompF, ompC, galE, cya, crp, cyp, phoP, phoQ, rfaY, dksA, hupA, sipC, clpB, clpP, clpX, pab, nadA, pncB, pmi, rpsL, hemA, rfc, poxA, galU, cdt, pur, ssa, guaA, guaB, fliD, flgK, flgL, relA, 및 spoT로 구성된 군으로부터 선택되는 하나 이상의 유전자의 기능이 상실된 것일 수 있다. 생체 내 적용 시 야생형으로의 환원을 방지하고, 독성을 더욱 약화시키기 위하여 상기 유전자 중 둘 이상의 유전자 기능을 상실시킬 수 있다.
상기 약독화 살모넬라 균주는 종양 부위에 표적화되어 면역 반응을 유도하는 것에 의해 항암 활성을 갖는다. 일 실시예에 따른 약독화 살모넬라 균주는 상기 재조합 발현 벡터로 형질전환됨으로써, flgM-IFN-β의 발현 및 분비 수준이 현저히 증진되었음을 확인하였으며, 이를 통해 상기 살모넬라 균주를 포함하는 제제를 개체에 투여한 경우, 우수한 항암 효과를 나타냄을 확인하였다.
일 구체예에 따른 상기 약독화 살모넬라 균주는 aroA, aroD, asd, 및 galE 유전자의 기능이 상실된 살모넬라 균주이거나, 또는 aroA, aroD, asd, rcsB, 및 galE 유전자의 기능이 상실된 살모넬라 균주일 수 있다. 일 실시예에 따르면, 상기 aroA, aroD, asd, rcsB, 및 galE 유전자의 기능이 상실된 약독화 살모넬라 균주에 일 실시예에 따른 재조합 발현 벡터를 형질전환 시킨 경우, flgM-IFN-β의 발현 및 분비능이 현저히 증가함을 확인하였다.
일 구체예에 따른 약독화 살모넬라 균주는, 약독화 유전자가 제2 유도성 프로모터에 의해 발현이 조절되는 것일 수 있다. 즉, 특정 유전자의 기능 상실이 제2 유도성 프로모터에 의해 조절되는 것일 수 있다. 구체적으로, 상기 약독화 살모넬라 균주는 약독화 유전자 앞에 제2 유도성 프로모터를 추가로 포함하여 균주의 약독화가 스위칭되는 것일 수 있다. 예를 들어, 상기 약독화 살모넬라 균주를 약독화된 상태로 개체 내에 주입하여 종양 부위에 표적화시킨 후, 상기 제2 유도성 프로모터의 작동에 의해 약독화 유전자의 발현을 유도하여, 높은 면역활성을 유발하여 암 치료가 더욱 효과적으로 이루어지는 것일 수 있다.
일 구체예에서, 상기 약독화 살모넬라 균주는 galE의 유전자의 기능이 상실된 것일 수 있으며, 상기 galE 유전자의 기능 상실은 tetRA 프로모터에 의해 스위칭되는 것일 수 있다. 따라서, 상기 약독화 살모넬라 균주를 약독화된 상태로 개체 내에 주입하여 종양 부위에 표적화시킨 후, 독시사이클린(doxycycline)에 의해 상기 galE 유전자의 발현을 유도하여, 살모넬라 균주의 높은 면역 활성을 유발하는 것일 수 있다. 본 명세서에서, 이와 같은 약독화 살모넬라 균주의 약독화 유전자의 발현 조절을 “galE:tetRA”로 표현하였다.
일 실시예에 따른 약독화 살모넬라 균주는 BRD509 asd rcsB galE:tetRA- 균주일 수 있으며, 이러한 약독화 살모넬라 균주는 우수한 flgM-IFN-β의 발현 또는 분비능을 나타냄을 확인하였다.
일 구체예에서, 상기 약독화 살모넬라 균주는 수탁번호 KCTC15509BP로 수탁된 것일 수 있다.
또 다른 양상은, 상기 약독화 살모넬라 균주를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물을 제공한다. 상기 약학적 조성물에서, 언급된 용어 요소 중 이미 언급된 것과 동일한 것은 상기한 바와 같다.
본 발명의 조성물에 의한 예방 또는 치료 대상 질병인 "암 (cancer)" 은 세포가 정상적인 성장 한계를 무시하고 분열 및 성장하는 공격적 (aggressive) 특성, 주위 조직에 침투하는 침투적 (invasive) 특성 및 체내의 다른 부위로 퍼지는 전이적 (metastatic) 특성을 갖는 세포에 의한 질병을 총칭하는 의미이다. 상기 암은 예를 들어, 고형암일 수 있으며, 바람직하게는 살모넬라 균주의 암 표적화능이 발휘될 수 있는 암 조직 또는 암 세포를 포함하는 종양이라면, 비제한적으로 확장 적용될 수 있다. 예를 들어 상기 암의 종류로는 두경부암, 피부암, 췌장암, 대장암, 결장암, 위암, 간암, 대장암, 뇌암, 유방암, 갑상선암, 방광암, 식도암, 자궁암, 및 폐암으로 구성된 군으로부터 선택되는 어느 하나에 해당할 수 있으나, 이에 제한되는 것 아니다.
본 발명의 조성물은 암의 예방 또는 치료용 약제로 이용하기 위하여, 약제학적 분야에서 공지의 방법에 의하여 제조될 수 있으며, 그 자체 또는 약학적으로 허용되는 담체(carrier), 부형제(forming agent), 희석제 등과 혼합하여 사용될 수 있다.
본 명세서에서 “약학적으로 허용 가능한 담체”는 투여되는 특정 조성물에 따라 부분적으로 결정될 뿐만 아니라, 조성물을 투여하는 데 사용되는 특정 방법에 따라 부분적으로 결정될 수 있다. 따라서, 상기 조성물의 적합한 제형이 매우 다양하며, 예를 들어, 조성물은 비경구(즉, 근육내, 피내, 또는 피하) 투여 또는 비인두(즉, 비강내) 투여를 위해 제형화될 수 있다. 일반적으로, 비경구 투여용 제형은 멸균 수성 또는 비수성 용액, 현탁액 및 유화액을 포함한다. 비수성 용매의 예시는 프로필렌 글리콜, 폴리에틸렌 글리콜, 올리브유와 같은 식물유, 및 올레산에틸과 같은 주사용 유기 에스테르이다. 수성 담체는 염수 및 완충된 매질을 비롯하여 물, 알코올/수성 용액, 유화액 또는 현탁액을 포함할 수 있다. 비경구용 비히클은 염화나트륨 용액, 링거 덱스트로스(Ringer's dextrose), 덱스트로스와 염화나트륨, 락테이트화 링거(lactated Ringer's), 또는 고정유를 포함할 수 있다. 방부제 및 기타 첨가물은 또한 예를 들어, 항균제, 항산화제, 킬레이트제, 및 불활성 가스 등으로 존재할 수 있다.
본 발명에 따른 유효성분의 투여량은 체내에서 활성성분의 흡수도, 제제의 형태, 환자의 연령, 성별 및 상태, 증상의 정도 등에 따라 적절히 선택될 수 있으며, 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 일반적인 투여량은 0.001mg/kg·일~10g/kg·일이다.
또 다른 양상은, 상기 약독화 살모넬라 균주를 유효성분으로 포함하는 항암용 약학적 조성물을 암을 예방 또는 치료하기에 유효한 양으로 개체에 투여하는 단계를 포함하는, 암을 예방 또는 치료하는 방법을 제공한다. 상기 암을 예방 또는 치료하는 방법에서, 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상기한 바와 같다.
상기 개체는 포유동물일 수 있다. 상기 포유동물은 사람, 개, 고양이, 소, 염소, 또는 돼지일 수 있다.
상기 투여는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여도 투여될 수 있다. 예를 들어 점안 투여, 복강내 투여, 정맥내 투여, 근육내 투여, 피하 투여, 피내 투여, 경피 패치투여, 경구 투여, 비내 투여, 폐내 투여, 직장내 투여 등의 경로를 통해 투여될 수 있고, 구체적으로 점안 투여의 경로 등을 통해 목적하는 바에 따라 투여될 수 있다.
본 명세서에서 용어, "치료" 또는 "치료하는" 또는 "완화하는" 또는 "개선하는"은 상호교환가능하게 사용된다. 이들 용어는 치료 이익 및/또는 예방 이익을 포함하나 이들에 한정되지 않는 유리한 또는 요망되는 결과를 수득하는 방법을 지칭한다. 치료 이익은 치료 하의 하나 이상의 질병, 질환 또는 증상의 임의의 치료적으로 유의미한 개선 또는 그에 대한 효과를 의미한다. 예방 이익에 있어서, 조성물은 특정 질병, 질환 또는 증상이 발생할 위험이 있는 대상체에게 또는 질병, 질환 또는 증상이 아직 나타나지 않을지라도, 질병의 하나 이상의 생리학적 증상을 보고하는 대상체에게 투여될 수 있다.
본 명세서에서 용어, "유효량" 또는 "치료적 유효량"은 유리한 또는 요망되는 결과를 야기하기에 충분한 작용제의 양을 지칭한다. 치료적 유효량은 치료되는 대상체 및 병태, 대상체의 체중 및 연령, 병태의 중증도, 투여 방식 등 중 하나 이상에 따라 달라질 수 있으며, 이는 당업자에 의해 용이하게 결정될 수 있다. 또한, 상기 용어는 본원에 기술된 영상화 방법 중 임의의 것에 의한 검출을 위한 이미지를 제공할 용량에 적용된다. 특정 용량은 선택된 특정 작용제, 뒤따르는 투여 요법, 그것이 다른 화합물과 병용하여 투여되는지 여부, 투여 시기, 영상화되는 조직 및 그것을 운반하는 신체 전달 시스템 중 하나 이상에 따라 달라질 수 있다.
일 양상에 따른 재조합 발현 벡터에 따르면, 상기 재조합 발현 벡터로 형질전환된 약독화 살모넬라 균주의 경우, flgM-IFN-β의 발현 및 분비가 현저하게 증진됨을 확인하였다.
또한, 일 양상에 따른 재조합 발현 벡터에 따르면, 상기 재조합 발현 벡터로 형질전환된 약독화 살모넬라 균주를 포함하는 제제를 투여한 경우, 우수한 항암 효과 및 안정성을 나타냄을 확인하였다.
도 1은 IFN-β의 종양 억제 과정을 개략적으로 나타낸 도이다.
도 2는 3형 분비계를 이용한 flgM-IFN-β의 균주 외 분비 과정을 개략적으로 나타낸 도이다.
도 3은 3형 분비계 내에서 편모 형성 과정을 통한 flgM의 분비 기작을 간략하게 나타낸 도이다.
도 4는 flgM-IFN-β-flhDC-pBAD18-asd+ 플라스미드의 개열지도를 나타낸 도이다.
도 5는 일 실시예에 따른 균주의 flgM-IFN-β 단백질 분비 수준을 웨스턴 블랏을 통해 확인한 결과이다. 도 5의 (a)는 비교예 1의 결과이며, (b)는 비교예 2의 결과이다.
도 6은 일 실시예에 따른 균주의 flgM-IFN-β 단백질 분비 수준을 웨스턴 블랏을 통해 확인한 결과이다. 도 6의 (a)는 비교예 3의 결과이며, (b)는 실시예 1의 결과이다.
도 7은 일 실시예에 따른 균주의 종양 마우스 모델에 대한 처리 과정을 개략적으로 나타낸 도이다.
도 8은 일 실시예에 따른 균주를 마우스에 처리한 경우, 마우스 내 종양 부피 변화를 나타낸 그래프이다 (CTRL: 대조군, Bacteria: 아라비노스 비처리군, Induction: 아라비노스 처리군).
도 9는 일 실시예에 따른 균주를 마우스에 처리한 경우, 마우스의 체중 변화를 나타낸 그래프이다 (CTRL: 대조군, Bacteria: 아라비노스 비처리군, Induction: 아라비노스 처리군).
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
실시예 1. IFN-β 분비를 위한 플라스미드 및 이로 형질전환된 약독화 살모넬라 균주의 제조
1-1. Insert DNA의 제조
IFN-β 분비를 위한 플라스미드 제조를 위하여, flgM 유전자 및 IFN-β 유전자가 연결된 유전적 구조물을 제조하였다.
구체적으로, 야생형 살모넬라의 flgM DNA 서열(flgM anti-sigma-28 factor FlgM [Salmonella enterica subsp. enterica serovar Typhimurium str. LT2] Gene ID: 1252690, Locus tagSTM1172 NC_003197.2 (1257036..1257341, complement))과, IFN-β에 대한 코돈 최적화를 통해 수득한 DNA 서열을 링커를 통해 연결시켜 유전적 구조물을 제조하였다. 상기 flgM 유전자의 발현을 높이기 위해, flgM 유전자 앞에 샤인-달가노(shine dalgarno) 서열을 삽입하였다. 또한, 클로닝을 위해 맨 앞에는 NheⅠ site(GCTAGC)를 삽입하고, IFN-β의 종결 코돈 뒤에는 SacⅠ site(GAGCTC)를 삽입하였다. ㈜바이오닉스 유전자 합성 서비스를 통하여 flgM, linker, 및 IFN-β를 포함하는 유전적 구조물을 제조하였으며, 상기 유전적 구조물에 NheⅠ 및 SacⅠ 효소를 각각 10U 처리하여 37℃에서 2시간 동안 반응시켰다. 이후, 이를 전기영동한 뒤, Gel extraction kit((주)Qiagen)로 약 900bp DNA를 확인하여 flgM-linker-IFN-β insert DNA를 수득하였다.
이후, flhDC insert DNA를 수득하기 위해, 야생형 살모넬라 LT2의 genomic DNA를 주형으로 하기 표 1의 flhD-sac1-F 및 flhC-Sal1-r 프라이머를 이용하여 PCR에 의해 flhDC 유전자가 포함된 PCR 산물을 얻었다. 구체적인 PCR 조건은 다음과 같다; 10x buffer 5μl, 5xQ solution 10 μl, 2 mM dNTPs 7.5 μl, 20 μM flhD-sac1-f 프라이머 2.5μl, 20μM flhC-Sal1-r 프라이머 2.5 μl, Taq polymerase 1 μl, 10 ng/μl genomic DNA2 μl 및 물 19.5 μl을 혼합하여 Qiagen system을 사용하여, 95℃ 5분과, 30회의 94℃ 30초, 49℃ 30초, 72℃ 1분 반복과 그 후에 72℃ 10분의 조건에서 PCR을 진행하였다. PCR purification kit로 정제한 PCR fragment 1μg과 sacI과 SalI을 각각 10U를 37℃에서 2시간 반응시키고, 상기 반응 산물을 PCR purification kit로 정제하여 flhDC insert DNA (서열번호 7)를 제조하였다.
명명 서열 정보 서열번호
flhD-SAC1-f gatcgatcgagctcaggaggtttgatcctatgggaacaatgcatacatccgagttgct 8
flhC-Sal1-r gatcgatcgtcgacttaaacagcctgttcgatctgttcatccagcagtt 9
1-2. 플라스미드의 제조
이후, pBAD18 asd+ 플라스미드를 벡터로 사용하여, NheⅠ 및 SacⅠ 효소 각각 10U를 37℃에서 2시간 반응시킨 후, 상기 반응 산물을 PCR purification kit로 정제하여 각각의 벡터 DNA를 얻었다. 상기 플라스미드 내에 삽입된 asd 유전자는 서열번호 10의 염기서열로 이루어질 수 있다. 이후, 각 벡터 DNA를 상기 flgM-linker-IFN-β insert DNA와 25℃에서 30분간 ligation시키고, DH5a 컴피턴트 세포에 형질전환시켰다. 이후, 상기 형질전환된 세포를 LB amp(ampicillin) 고체 배지에 도말하고 37℃에서 배양하여 항생제 내성을 갖는 콜로니를 선별하였다. 선별된 콜로니의 후보군 6개를 선별하여 NheⅠ 및 SacⅠ 각각 10 U와 37℃에서 1시간 반응시킨 후 전기영동을 통해 약 900bp 밴드의 생성을 확인하였다. 또한, 상기 플라스미드에 대해 해당 후보군의 염기서열 분석을 실시하여, 상기 flgM, linker, 및 IFN-β유전자의 삽입을 확인하였다.
상기 플라스미드 각각 1μg을 SacⅠ 및 SalⅠ 10U와 37℃에서 2시간 반응시킨 후, 상기 반응산물을 PCR purification kit로 정제하여 벡터 DNA를 완성하였다. 이후, 각 벡터 DNA를 상기 flhDC insert DNA와 25℃에서 30분 ligation 시킨 후 DH5a 컴피턴트 세포를 형질전환 시켰다. 형질전환된 세포를 LB amp 고체 배지에 도말하고 37℃에서 배양하여 항생제 내성을 갖는 콜로니를 선별하였다. 선별된 콜로니의 후보군 6개를 선별하여 SacⅠ 및 SalⅠ 10U와 37℃에서 1시간 반응시킨 후 전기영동을 통해 밴드의 생성을 확인하였다. 해당 후보군의 염기서열 분석을 실시하여, flhDC 유전자의 삽입을 확인하였다.
이를 통하여, 일 실시예 및 비교예에 따른 flgM-IFN-β-flhDC-pBAD18-asd+ 플라스미드를 제조하였다.
한편, 본 실시예에서 주요한 구조물의 유전 정보는 하기 표 2에 나타낸 바와 같다.
명명 서열 정보 서열번호
flgM atgagcattgaccgtacctcacctttgaaacccgttagcactgtccagacgcgcgaaaccagcgacacgccggtacaaaaaacgcgtcaggaaaaaacgtccgccgcgacgagcgccagcgtaacgttaagcgacgcgcaagcgaagctcatgcagccaggcgtcagcgacattaatatggaacgcgtcgaagcattaaaaacggctatccgtaacggtgagttaaaaatggatacgggaaaaatagcagactcgctcattcgcgaggcgcagagctacttacagagtaaaaaa 1
IFN-β1 ATGATTAATTATAAACAGCTGCAGCTGCAGGAACGTACCAATATTCGTAAATGTCAGGAACTGCTGGAACAGCTGAATGGTAAAATTAATCTGACCTATCGTGCAGATTTTAAAATTCCGATGGAAATGACCGAAAAAATGCAGAAAAGCTATACCGCATTTGCCATTCAGGAAATGCTGCAGAATGTTTTTCTGGTTTTTCGTAATAATTTTAGCAGCACCGGTTGGAATGAAACCATTGTTGTTCGTCTGCTGGATGAACTGCATCAGCAGACCGTTTTTCTGAAAACCGTTCTGGAAGAAAAACAGGAAGAACGTCTGACCTGGGAAATGAGCAGCACCGCACTGCATCTGAAAAGCTATTATTGGCGTGTTCAGCGTTATCTGAAACTGATGAAATATAATAGCTATGCCTGGATGGTGGTTCGTGCAGAAATTTTTCGTAATTTTCTGATTATTCGTCGTCTGACCCGTAATTTTCAGAATTAG 2
IFN-β2 ATGATTAACTATAAGCAGCTGCAGCTGCAGGAACGTACTAACATCCGTAAATGCCAGGAACTTCTTGAACAGCTGAACGGTAAAATCAACCTGACCTACCGTGCGGACTTCAAAATCCCCATGGAAATGACGGAAAAAATGCAGAAATCTTACACCGCGTTCGCGATCCAGGAAATGCTGCAGAACGTTTTCCTGGTTTTCCGTAACAACTTCTCTTCTACCGGTTGGAACGAAACCATCGTTGTTCGTCTGCTGGACGAACTGCACCAGCAGACCGTTTTCCTGAAAACCGTTCTGGAAGAAAAACAGGAAGAACGTCTGACCTGGGAAATGTCTAGCACCGCGCTGCACCTGAAATCTTACTACTGGCGTGTTCAGCGTTACCTGAAACTGATGAAATACAACTCTTACGCGTGGATGGTTGTTCGTGCGGAAATCTTCCGTAACTTCCTGATCATCCGTCGTCTGACCCGTAACTTCCAGAACTAA 3
linker1 GGCGGCAGCAGCCATCACCATCACCATCACAGCAGCGGCGGCTTAGTTCCGCGCGGTAGCCAT 4
linker2 ggcggcagcagccatcaccatcaccatcacagcagcggcggc 5
flhDC AGGAGGTTTGATCCTatgggaacaatgcatacatccgagttgctaaaacacatttatgacatcaatttgtcatatttactccttgcacagcgtttgatcgtccaggacaaagcatctgcgatgttccgcctcggtatcaacgaagagatggcaaacacactgggcgcgttgaccctgccgcagatggtcaaactggcggagacgaaccagttagtttgtcatttccggtttgacgatcatcagacgatcacccgtttgactcaggattcgcgcgtcgatgacttacagcagattcacacaggtatcatgctttcaacgcgtctgctcaatgaagtggacgatacggcgcgtaagaaaagggcatgaaagggcatgataatgagtgaaaaaagcattgttcaggaagctcgcgatatccagttggcgatggagttgattaatcttggcgctcgtctacaaatgctggaaagcgaaacacagctcagccgtggtcgcctcatcaggctgtacaaagaattacgcggtagcccgccgcctaaagggatgctgccattttcgacagactggtttatgacctgggagcaaaatattcatgcctccatgttctgcaacgcctggcaatttttactgaagaccggcttatgcagcggtgtggatgcggtgattaaagcttatcggctttatcttgagcagtgtccgcaaccgcctgaagggccgttgttggcgctgactcgcgcatggacgctggtgcgttttgttgaaagtgggttgcttgaattgtcgagctgtaactgctgcggtgggaactttattacccatgcgcatcagcccgtaggcagctttgcgtgtagtttatgccagccgccatcccgcgcagtaaaaagacgtaaactttcccgagatgctgccgatattattccacaactgctggatgaacagatcgaacaggctgtttaa 7
1-3. flgM-IFN-β를 분비하는 약독화 살모넬라 균주 제조
상기 실시예 1-2의 플라스미드를 각각 약독화 살모넬라 균주에 대해 형질전환시켰다. 상기 약독화 살모넬라 균주로는: BRD509 asd galE:tetRA- 균주(#1317) 또는 BRD509 asd rcsB galE:tetRA- 균주(#1323)를 사용하였으며, 각각의 균주는 충남대학교로부터 분양받았다. 이와 같이 형질전환된 균주의 유전자 및 균주의 정보는 하기 표 3에 나타낸 바와 같다.
실시예 1 비교예 1 비교예 2 비교예 3
IFN-β 유전자 IFN-β2 IFN-β1 IFN-β1 IFN-β2
linker 유전자 linker2 linker1 linker1 linker2
균주 #1323 #1317 #1323 #1317
본 발명자들은 일 실시예에 따른 flgM-IFN-β-flhDC-pBAD18-asd+/BRD509 asd rcsB galE:tetRA - 균주를 한국생명공학연구원 생물자원센터에 2023년 7월 18일자로 기탁하고, 수탁번호 KCTC15509BP를 부여받았다 (S-flgM-mIFNb2-flhDC-pBAD18-ASD+/#1323).
실험예 1. 단백질 발현 및 분비능 확인
일 실시예에 따른 재조합 발현 벡터로 형질전환된 약독화 살모넬라 균주의 flgM-IFN-β의 발현 및 분비능을 확인하기 위해, 하기와 같은 방법으로 단백질의 발현량을 웨스텃 블랏을 통해 측정하였다.
구체적으로, 상기 형질전환된 각 균주의 단일 콜로니를 LB amp 액체배지에 접종한 후 37℃에서 12~16시간 진탕배양하였다. 이후 신선한 LB amp 액체배지에 OD600이 0.05가 되도록 희석한 후 37℃에서 2시간 진탕배양하였다. 이후, OD600이 0.4 내지 0.6 일 때, 아라비노스를 0.2%(w/v) (최종) 농도로 처리한 군을 시험군(+)으로, 처리하지 않은 군을 대조군(-)으로 구분하였으며, 이를 37℃에서 5시간 추가로 진탕배양하였다. 이후, 상기 시험군 및 대조군의 시료를 전체 세포 배양액(whole cell), 펠렛(pellet) 및 상층액(supernatant)로 분리하였다. 상기 펠렛 및 상층액은 상기 전체 세포 배양액을 8000 rpm으로 원심분리하여 분리한 것이다. 또한, 상기 상층액은 다시 0.2μm 필터로 여과하여 균을 완전히 제거하고, pall사의 nanosep(OD010C35 3K omega)를 이용하여 농축하였다.
상기 전체 세포 배양액, 펠렛 및 상층액 시료 각각 50μl를 SDS 샘플 버퍼와 혼합하여 웨스턴 블랏을 위한 샘플을 제조하였다. 각각의 샘플을 100℃ 히팅 블록(heating block)에 5분간 변성시킨 후, 5분간 13000rpm, 4℃에서 원심분리 하고 10% 폴리아크릴아마이드 겔에 전기영동 하였다. 상기 겔은 PVDF (polyvinylidene fluoride)를 이용해 트랜스퍼하여 PVDF 멤브레인으로 단백질을 이동시켰으며, 상기 멤브레인을 blocking buffer를 사용하여 실온에서 1시간동안 blocking하였다. 이후, 1차 항체로 anti-his tag(SB194b, SouthernBiotech)를 1/1000으로 희석하여 4℃에서 16시간 반응시켰다. 이후 상기 멤브레인을 TBST(Tris-buffered saline with 0.1% Tween-20)로 10분 간격으로 3회 세척한 후, mouse anti-mouse-IgG (#7076s, Cell signaling, Danvers, MA, USA) 2차 항체와 상온에서 1시간동안 반응시켰다. 반응 후 TBST로 10분 간격으로 3회 세척한 후, ECL 버퍼를 이용해 X-ray 필름에 감광한 후, 현상하여 각각의 단백질 발현량을 확인하였다. 그 결과를 도 5 및 6에 나타내었다. 도 5 및 6의 2, 4, 및 6 레인은 아라비노스(최종 농도 0.2%(w/v))를 처리한 시험군이며, 1, 3, 및 5 레인은 아라비노스를 처리하지 않은 대조군이다. 또한, 도 5 및 6의 1 및 2 레인은 whole cell, 3 및 4 레인은 펠렛, 및 5 및 6 레인은 상층액에 대한 결과이다.
그 결과, 도 5 및 6에 나타낸 바와 같이, 일 실시예의 따른 균주의 경우, 균주를 제거한 상층액에서도 상기 단백질의 분비를 확인할 수 있었다. 또한, 일 실시예에 따른 균주는 높은 수준으로 flgM-IFN-β를 발현할 뿐만 아니라, 이를 높은 수준으로 균주 외로 분비함을 확인하였다 (도 6의 (b)).
실험예 2. 항종양 효과 확인
일 실시예에 따른 균주의 항암 효과를 확인하기 위해, 다음과 같이 실험을 수행하였다.
2-1. 종양 세포주 제조
뮤린(murine) CT26 결장 암종 세포를 American Type Culture Collection에서 구입하였다. 10% 소태아혈청(fetal bovine serum, FBS) 및 1% 페니실린-스트렙토마이신을 포함하는 DMEM(Dulbecco's modified Eagle's medium)에서 CT26 세포를 배양하였다.
2-2. 종양세포 이종이식된 마우스 모델 제조
상기 실험예 2-1에서 배양된 CT26 결장암종 세포를 이종이식하여 종양 마우스 모델을 제조하였다. 승인된 프로토콜에 따라 모든 동물에 대한 관리 및 실험, 안락사를 수행하였다. 사용된 마우스는 오리엔트 바이오 (OrientBio)에서 구입한 20g 내외 6 주 암컷 마우스이다.
구체적으로, 상기 실험예 2-1과 같이 시험관 내 배양된 CT26 종양세포를 수집한 후, 이를 20㎕ PBS에 현탁시켰다. 상기 현탁된 세포 5×105개를 상기 BALB/c 마우스의 우측 등에 피하 주사하여 종양세포를 이종 이식하였다. 이후, 종양의 크기가 100mm3에 도달하였을 때(종양세포 이종이식 후 약 10-14일째) 일 실시예에 따른 균주를 처리하였다
2-3. 항종양 효과 확인
일 실시예에 따른 균주의 항암 효과 및 안정성을 확인하기 위해, 하기와 같이 실험을 수행하였다.
구체적으로, 상기 실험예 2-2에 따른 종양 마우스 모델에 대해, ⅰ) 대조군(control, ctrl)으로서 PBS를 처리한 군, ⅱ) 실시예 1의 균주 처리 후 아라비노스 비처리한 군 (Bacteria), 및 ⅲ) 실시예 1의 균주 처리 후 아라비노스 처리한 군 (induction)으로 나누어 실험을 수행했으며, 상기 실시예 1의 균주를 PBS에 약 1×107 CFU/마우스의 용량으로 꼬리 정맥을 통해 투여(0 day)하였다. ⅲ) (아라비노스 처리군)에 대해서는, 균주 주입 후 3일 후부터 IFN-β의 발현 유도를 위하여, L-arabinose를 80mg/마우스로 매일 복강(intraperitoneal, i.p.)에 투여하였다 (induction). 종양의 크기는 이틀에 한번 측정하였고, 몸무게는 이틀에 한번씩 측정하였다. 종양의 부피는 ‘종양 부피(mm3) = (종양 길이 × 종양 높이 × 종양 폭)/2’으로 계산하였다. 모든 동물 실험은 충남대학교의 동물실험 윤리위원회에 의해 승인되었고, 지침에 따라 종양 부피가 1,500mm3 이상인 마우스는 희생시켰다.
그 결과, 도 8에 나타낸 바와 같이, 아라비노스 유도군에서 종양 크기가 현저히 감소하였음을 확인하였는 바, 일 실시예에 따른 약독화 살모넬라 균주의 우수한 항암 효과를 확인하였다. 또한, 도 9에 나타낸 바와 같이, 아라비노스 유도군에서도 마우스의 체중에 변화가 나타나지 않았는 바, 본 발명에 따른 균주를 포함하는 제제의 안정성을 확인하였다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
[수탁번호]
기탁기관명 : 한국생명공학연구원 생물자원센터(KCTC)
수탁번호 : KCTC15509BP
수탁일자 : 20230718
Figure PCTKR2023010767-appb-img-000001

Claims (10)

  1. flgM 유전자; IFN-β 유전자; 및 flhDC 유전자를 포함하는 재조합 발현 벡터로서, 상기 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자는 유도성 프로모터에 작동가능하게 연결된 것인, 재조합 발현 벡터.
  2. 청구항 1에 있어서, 상기 flgM 유전자; IFN-β 유전자; 및 flhDC 유전자는 동일 유도성 프로모터에 의해 발현이 조절되는 것인, 재조합 발현 벡터.
  3. 청구항 1에 있어서, 상기 재조합 발현 벡터는 서열번호 1의 폴리뉴클레오티드 서열로 이루어지는 flgM 유전자, 서열번호 3의 폴리뉴클레오티드 서열로 이루어지는 IFN-β 유전자 및 서열번호 7의 폴리뉴클레오티드 서열로 이루어지는 flhDC 유전자를 포함하는 것인, 재조합 발현 벡터.
  4. 청구항 1에 있어서, 상기 flgM 유전자 및 상기 IFN-β 유전자는 링커를 통하여 연결된 것인, 재조합 발현 벡터.
  5. 청구항 4에 있어서, 상기 링커는 서열번호 5의 폴리뉴클레오티드 서열로 이루어지는 것인, 재조합 발현 벡터.
  6. 청구항 1의 재조합 발현 벡터로 형질전환된, 약독화 살모넬라 균주.
  7. 청구항 6에 있어서, 상기 약독화 살모넬라 균주는 aroA, aroD, asd, rcsB 및 galE의 유전자의 기능이 상실된 것인, 약독화 살모넬라 균주.
  8. 청구항 6에 있어서, 상기 약독화 살모넬라 균주는 IFN-β 단백질에 대한 분비능이 향상된 것인, 약독화 살모넬라 균주.
  9. 청구항 6에 있어서, 상기 약독화 살모넬라 균주는 수탁번호 KCTC15509BP로 수탁된 것인, 약독화 살모넬라 균주.
  10. 청구항 6의 약독화 살모넬라 균주를 유효성분으로 포함하는 암 치료용 약학적 조성물.
PCT/KR2023/010767 2022-07-25 2023-07-25 인터페론-베타 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주 WO2024025312A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220092017 2022-07-25
KR10-2022-0092017 2022-07-25

Publications (1)

Publication Number Publication Date
WO2024025312A1 true WO2024025312A1 (ko) 2024-02-01

Family

ID=89706863

Family Applications (5)

Application Number Title Priority Date Filing Date
PCT/KR2023/010735 WO2024025297A1 (ko) 2022-07-25 2023-07-25 인터루킨-21의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
PCT/KR2023/010767 WO2024025312A1 (ko) 2022-07-25 2023-07-25 인터페론-베타 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
PCT/KR2023/010771 WO2024025315A1 (ko) 2022-07-25 2023-07-25 Vc1 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
PCT/KR2023/010736 WO2024025298A1 (ko) 2022-07-25 2023-07-25 인터루킨-12의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
PCT/KR2023/010732 WO2024025296A1 (ko) 2022-07-25 2023-07-25 클로로톡신의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/010735 WO2024025297A1 (ko) 2022-07-25 2023-07-25 인터루킨-21의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주

Family Applications After (3)

Application Number Title Priority Date Filing Date
PCT/KR2023/010771 WO2024025315A1 (ko) 2022-07-25 2023-07-25 Vc1 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
PCT/KR2023/010736 WO2024025298A1 (ko) 2022-07-25 2023-07-25 인터루킨-12의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
PCT/KR2023/010732 WO2024025296A1 (ko) 2022-07-25 2023-07-25 클로로톡신의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주

Country Status (2)

Country Link
KR (10) KR20240015030A (ko)
WO (5) WO2024025297A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150225466A1 (en) * 2012-05-30 2015-08-13 University Of Utah Research Foundation Compositions and methods for peptide expression and purification using a type iii secretion system
KR20160039495A (ko) * 2014-10-01 2016-04-11 전남대학교산학협력단 박테리아를 이용한 고형암 치료제
US20170151342A1 (en) * 2007-09-21 2017-06-01 The Regents Of The University Of California Targeted interferons demonstrate potent apoptotic and anti-tumor activities

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5891680A (en) * 1995-02-08 1999-04-06 Whitehead Institute For Biomedical Research Bioactive fusion proteins comprising the p35 and p40 subunits of IL-12
US6024961A (en) * 1997-11-14 2000-02-15 Washington University Recombinant avirulent immunogenic S typhi having rpos positive phenotype
EP2377549A1 (en) * 2002-06-07 2011-10-19 ZymoGenetics, Inc. Use of IL-21 for treating viral infections
EP2531206B1 (en) * 2010-02-04 2017-05-31 Morphotek, Inc. Chlorotoxin polypeptides and conjugates and uses thereof
KR102246740B1 (ko) * 2019-01-07 2021-04-30 충남대학교산학협력단 신규 살모넬라 균주 및 이를 포함하는 항암 면역증강용 약학 조성물
KR102224855B1 (ko) * 2020-03-20 2021-03-08 충남대학교산학협력단 인디루빈을 생합성 분비하는 항암 살모넬라 및 이를 포함하는 항암 조성물
KR20210123556A (ko) * 2020-04-03 2021-10-14 충남대학교산학협력단 필라멘트 성장 조절로 면역반응을 유도하는 항암 살모넬라 및 이를 포함하는 항암 조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170151342A1 (en) * 2007-09-21 2017-06-01 The Regents Of The University Of California Targeted interferons demonstrate potent apoptotic and anti-tumor activities
US20150225466A1 (en) * 2012-05-30 2015-08-13 University Of Utah Research Foundation Compositions and methods for peptide expression and purification using a type iii secretion system
KR20160039495A (ko) * 2014-10-01 2016-04-11 전남대학교산학협력단 박테리아를 이용한 고형암 치료제

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
H. M. SINGER, ERHARDT M., STEINER A. M., ZHANG M.-M., YOSHIKAMI D., BULAJ G., OLIVERA B. M., HUGHES K. T.: "Selective Purification of Recombinant Neuroactive Peptides Using the Flagellar Type III Secretion System", MBIO, vol. 3, no. 3, 29 May 2012 (2012-05-29), pages e00115-1 - e00115-12, XP055253180, DOI: 10.1128/mBio.00115-12 *
HEEL THOMAS, VOGEL GEORG F., LAMMIRATO ANDREA, SCHNEIDER RAINER, AUER BERNHARD: "FlgM as a Secretion Moiety for the Development of an Inducible Type III Secretion System", PLOS ONE, PUBLIC LIBRARY OF SCIENCE, US, vol. 8, no. 3, 12 March 2013 (2013-03-12), US , pages e59034, XP093132646, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0059034 *

Also Published As

Publication number Publication date
WO2024025296A1 (ko) 2024-02-01
KR20240015032A (ko) 2024-02-02
WO2024025297A1 (ko) 2024-02-01
KR20240015037A (ko) 2024-02-02
WO2024025315A1 (ko) 2024-02-01
KR20240015035A (ko) 2024-02-02
KR20240015033A (ko) 2024-02-02
KR20240015038A (ko) 2024-02-02
KR20240015036A (ko) 2024-02-02
KR20240015030A (ko) 2024-02-02
KR20240015031A (ko) 2024-02-02
KR20240015034A (ko) 2024-02-02
WO2024025298A1 (ko) 2024-02-01
KR20240015039A (ko) 2024-02-02

Similar Documents

Publication Publication Date Title
EP0216786B1 (en) Purification, production and use of tumor necrosis factors
JP5710262B2 (ja) ポックスウイルス腫瘍細胞崩壊性ベクター
Pearson et al. Lethal effect of phenothiazine neuroleptics on the pathogenic protozoan Leishmania donovani
WO2019080537A1 (zh) 包含溶瘤病毒和car-nk细胞的治疗剂及应用、药盒、治疗肿瘤和/或癌症的方法
HU218598B (hu) Eljárás interleukin-10-et tartalmazó, tumorok kezelésére szolgáló gyógyszerkészítmények előállítására
WO2019139229A1 (en) Microorganism for delivering drug for treatment of gastrointestinal disease, which expresses and secretes p8 protein, and pharmaceutical composition for preventing or treating gastrointestinal disease, which includes the same
CN116042723A (zh) 表达免疫系统-刺激分子的溶瘤性单纯疱疹病毒载体
EP2826856B1 (en) Genetically stable oncolytic RNA virus, method of manufacturing and use thereof
Derubertis et al. Cytokine-secreting herpes viral mutants effectively treat tumor in a murine metastatic colorectal liver model by oncolytic and T-cell-dependent mechanisms
WO2024025312A1 (ko) 인터페론-베타 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
WO2024025299A1 (ko) 카탈레이스 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 대장균 균주
EP3129037B1 (en) Poxviral oncolytic vectors
WO2022182206A1 (ko) 항암 바이러스 및 이의 용도
WO2024019378A1 (ko) 코난토킨-g의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
WO2024019377A1 (ko) 멜리틴 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
US20220362340A1 (en) Compositions and uses thereof for treating irradiation-induced intestinal damage
KR20150082827A (ko) glmS 기반의 숙주 벡터 시스템
KR102555172B1 (ko) Gm-csf의 분비를 위한 유전자 구조물 및 이에 의해 형질전환된 항암 재조합 균주
WO2021086085A1 (ko) 종양 표적화 살모넬라 갈리나룸 균주 및 이의 용도
WO2022231043A1 (ko) 약독화 살모넬라 갈리나룸 균주 및 이의 용도
WO2024106866A1 (ko) 암의 치료용 면역증강 살모넬라 균주 및 이의 용도
WO2022119384A1 (ko) 결핵의 예방 또는 치료용 약학적 조성물
WO2020153734A1 (ko) 다람쥐 섬유종 바이러스 및 리오바이러스를 포함하는 암 예방 또는 치료용 약학적 조성물
WO2024005250A1 (ko) Cd55 및 cd59를 동시 발현하는 항암 바이러스

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23846970

Country of ref document: EP

Kind code of ref document: A1