WO2024005564A1 - 전분화능 줄기세포 기반 근육염증 또는 염증을 동반한 근육질환의 예방 또는 치료용 약학적 조성물 - Google Patents

전분화능 줄기세포 기반 근육염증 또는 염증을 동반한 근육질환의 예방 또는 치료용 약학적 조성물 Download PDF

Info

Publication number
WO2024005564A1
WO2024005564A1 PCT/KR2023/009105 KR2023009105W WO2024005564A1 WO 2024005564 A1 WO2024005564 A1 WO 2024005564A1 KR 2023009105 W KR2023009105 W KR 2023009105W WO 2024005564 A1 WO2024005564 A1 WO 2024005564A1
Authority
WO
WIPO (PCT)
Prior art keywords
muscle
stem cells
msc
pharmaceutical composition
mesenchymal stem
Prior art date
Application number
PCT/KR2023/009105
Other languages
English (en)
French (fr)
Inventor
정형민
김시윤
유보경
백지은
김은영
홍기성
Original Assignee
건국대학교 글로컬산학협력단
주식회사 미래셀바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 건국대학교 글로컬산학협력단, 주식회사 미래셀바이오 filed Critical 건국대학교 글로컬산학협력단
Publication of WO2024005564A1 publication Critical patent/WO2024005564A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48—Reproductive organs
    • A61K35/54—Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A61K35/545—Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • C12N5/0668—Mesenchymal stem cells from other natural sources
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/02—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from embryonic cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2513/00—3D culture

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating muscle diseases accompanied by inflammation, which contains mesenchymal stem cells derived from human pluripotent stem cells as an active ingredient.
  • Rotator cuff tears are typically associated with fibrosis, muscle atrophy, and fatty infiltration within the muscle, commonly referred to as “fatty degeneration.”
  • Rotator cuff tear is a common shoulder disease whose incidence increases with aging and is accompanied by decreased shoulder function and pain.
  • various surgeries such as autografing or scaffold transplantation of the long biceps tendon (LBT) or subacromial bursa with preserved vasculature have been performed to treat RCT, and these surgical treatments relieve the condition and provide positive results. It is reported to indicate prognosis.
  • the inflammatory response that occurs in the lesion area induces fatty infiltration within the muscle tissue. It makes complete recovery impossible.
  • acute inflammation is considered an important factor that can cause chronic muscle dysfunction. Accordingly, there is a need to develop a treatment method that can achieve effective surgical treatment or improve the prognosis for rotator cuff tear disease.
  • the present inventors conducted extensive research on the development of a cell therapy using human embryonic stem cell-derived mesenchymal stem cells (hESC-MSC) at a level that can be applied clinically, and as a result, human pluripotent stem cells were developed. After confirming that derived mesenchymal stem cells can be applied to the treatment of rotator cuff tears, the present invention was completed.
  • hESC-MSC human embryonic stem cell-derived mesenchymal stem cells
  • the technical problem to be achieved by the present invention is to provide a pharmaceutical composition for the prevention or treatment of muscle inflammation and muscle diseases accompanied by inflammation, including mesenchymal stem cells (hESC-MSC, multipotent MSC: M-MSC) derived from human pluripotent stem cells. is to provide.
  • hESC-MSC mesenchymal stem cells
  • M-MSC multipotent MSC
  • the present invention provides a pharmaceutical composition for treating rotator cuff syndrome or muscle inflammation after rotator cuff tear and muscle disease accompanied by inflammation, including mesenchymal stem cells (M-MSC) derived from human pluripotent stem cells.
  • M-MSC mesenchymal stem cells
  • the present invention provides a pharmaceutical composition for preventing or treating muscle inflammation or muscle diseases accompanied by inflammation, comprising mesenchymal stem cells (M-MSC) derived from human pluripotent stem cells as an active ingredient. to provide.
  • M-MSC mesenchymal stem cells
  • the present invention provides a method for preventing or treating rotator cuff tear disease, which includes the step of locally administering to the affected area of muscle inflammation that occurs after rotator cuff tear or muscle disease accompanied by inflammation.
  • the pluripotent stem cells may be induced pluripotent stem cells (iPSC) or embryonic stem cells (ESC), but in the specific experiment of the present invention, embryonic stem cells By using the cells, mesenchymal stem cells were obtained and the effect of improving muscle inflammation or muscle diseases accompanied by inflammation in rotator cuff tears was confirmed.
  • iPSC induced pluripotent stem cells
  • ESC embryonic stem cells
  • the mesenchymal stem cells suppress the inflammatory response by downregulating the expression of TNF-a, IL-6, IL-1b, Cox2, and/or Ptges genes in muscle cells. can be reduced.
  • the mesenchymal stem cells can reduce fat infiltration into muscle tissue by downregulating the expression of Pparg and/or Myod genes in muscle cells.
  • the mesenchymal stem cells may improve muscle production by upregulating the expression of Myf5 and Cebpa genes in muscle cells.
  • the mesenchymal stem cells can suppress muscle fibrosis and atrophy and prevent histological changes in muscle.
  • the muscle may be a rotator cuff
  • the muscle disease accompanied by inflammation may be rotator cuff syndrome or rotator cuff rupture.
  • the mesenchymal stem cells (M-MSC) derived from human pluripotent stem cells can be obtained by performing the following steps:
  • the human pluripotent stem cell-derived mesenchymal stem cells (M-MSC) of the present invention inhibit muscle regeneration in damaged muscle tissue, fat infiltration and inflammatory response in damaged muscle tissue, and provide faster muscle function than adult stem cell-derived mesenchymal stem cells. It has the advantage of enabling recovery, and furthermore, the effect lasts for a relatively long time when administered locally within the muscle, so it can be provided as an effective cell therapy for the prevention and treatment of rotator cuff tears.
  • the present invention provides a mesenchymal stem cell (M-MSC) administration method that can most effectively treat rotator cuff tears and can be provided as a guide for clinical application.
  • Figure 1 shows the results of M-MSC transcriptome analysis compared to adult MSC.
  • Figure 1a shows the PCA (Principal component analysis) results of M-MSC, BM-MSC, and AD-MSC clusters. Dots of different colors represent the relative distance between cells. Each dot represents a respective model.
  • Figure 1b shows the correlation between M-MSC, BM-MSC, and AD-MSC cells. Cellular gene expression is indicated by dots, and its distribution is indicated by lines. Bivariate scatter plot with fitted line is shown below the diagonal, and correlation values and significance levels are shown above the diagonal (p ⁇ 0.01, ***).
  • BM-MSC and AD-MSC were indicated by NCBI GEO GSM numbers.
  • Figure 2 shows the results of comparing the characteristics of adult MSCs and M-MSCs, and shows the Gene Ontology (GO) network and Enrichment Pathway analysis results for M-MSCs:
  • FIG. 2A shows the results of differentially expressed genes (DEGs) upregulated in M-MSCs compared to BM-MSCs (FC > 4), and Figure 2B shows the DEGs downregulated in M-MSCs compared to BM-MSCs (FC ⁇ 0.25).
  • DEGs differentially expressed genes
  • Figure 2B shows the DEGs downregulated in M-MSCs compared to BM-MSCs (FC ⁇ 0.25).
  • Figure 2c shows the analysis result of DEGs (FC > 4) up-regulated in M-MSC compared to AD-MSC
  • Figure 2d shows the DEG down-regulated in M-MSC compared to AD-MSC (FC ⁇ 0.25) This is the analysis result.
  • Figure 4 shows the results of comparing gene expression of M-MSC with adult MSC for a specific GO.
  • the first quality threshold cluster (QTC) for GO:0043069 negative regulation of programmed cell death
  • B1 heatmap and B2 line graph and for WP2328 (Allograft Rejection (Homo sapiens)
  • the first QTC was shown as (B3) a heatmap and (B4) a line graph.
  • the color scale at the top indicates relative expression levels, with red, blue and white indicating upregulation, downregulation and unchanged, respectively.
  • FIG. 5 shows the results of MSC and mixed lymphocyte reaction (MLR) (R, responder splenocytes, S, stimulator splenocytes, *, mitomycin C treatment). Data are expressed as mean ⁇ SD, significance indicated *, p ⁇ 0.05, **, p ⁇ 0.01; ***, p ⁇ 0.001; ns, each marked as not significant.
  • MLR mixed lymphocyte reaction
  • FIG. 6 confirms the recovery of grip strength following MSC treatment after RCT induction.
  • A is a schematic diagram of the study. 7-week-old SD rats were randomly divided into 20 groups, and the cell injection group underwent surgery on the right shoulder and injected cells. Eight mice per group were sampled five times each and used in the experiment.
  • B shows the results of injecting M-MSC, BM-MSC, or control hDF cells into the RCT model and measuring grip strength after 24 hours, 72 hours, 7 days, 4 weeks, and 8 weeks. Data are presented as mean ⁇ SD. Significance is indicated: *, p ⁇ 0.05, **, p ⁇ 0.01; ***, indicated as p ⁇ 0.001.
  • Figure 7 shows H&E and MT after resection of muscle samples from hDF (control group), BM-MSC, and M-MSC administered groups at 24 hours, 72 hours, 7 days, 4 weeks, and 8 weeks after RCT induction for histopathological analysis. This is the result of dyeing.
  • Figure 7a is the H&E staining result of the supraspinatus muscle
  • Figure 7b is the H&E staining result of the infraspinatus muscle.
  • the scale bar is 100 ⁇ m.
  • Figure 7c is the result of Masson's trichrome staining of the supraspinatus muscle
  • Figure 7d is the result of Masson's trichrome staining of the infraspinatus muscle
  • the scale bar represents 100 ⁇ m. Areas of fibrosis were determined in blue and quantified in three random high power fields (HPF) per sample. Data are expressed as mean ⁇ SD, significance indicated *, p ⁇ 0.05, **, p ⁇ 0.01; ***, indicated as p ⁇ 0.001.
  • Figure 8 shows muscle samples collected from hDF (control group), BM-MSC, and M-MSC administration groups at 24 hours, 72 hours, 7 days, 4 weeks, and 8 weeks after RCT induction for inflammatory cell counting, stained with toluidine blue. This is the result of confirming mast cells.
  • A1 and A2 are results from the supraspinatus muscle
  • A3 and A4 are results from the infraspinatus muscle.
  • the scale bar represents 500 ⁇ m (50 ⁇ m for HPF). Data are expressed as mean ⁇ SD, significance indicated *, p ⁇ 0.05, **, p ⁇ 0.01; ***, indicated as p ⁇ 0.001.
  • Figure 9 shows muscle samples collected from hDF (control group), BM-MSC, and M-MSC administration groups at 24 hours, 72 hours, 7 days, 4 weeks, and 8 weeks after RCT induction for inflammatory cell counting using anti-CD68 antibody. This is the result of confirming dash cells through immunohistochemical staining.
  • B1 and B2 are results from the supraspinatus muscle
  • B3 and B4 are results from the infraspinatus muscle
  • the scale bar represents 100 ⁇ m.
  • Data are expressed as mean ⁇ SD, significance indicated *, p ⁇ 0.05, **, p ⁇ 0.01; ***, indicated as p ⁇ 0.001.
  • Figure 10 shows the results of confirming the expression levels of inflammation-related genes of TNF-a, IL-6, IL-1b, Cox2, and Ptges, adipogenic genes of Pparg and Myod1, and muscle production-related genes of Myf5 and Cebpa in the supraspinatus muscle.
  • Data are expressed as mean ⁇ SD, significance indicated *, p ⁇ 0.05, **, p ⁇ 0.01; ***, indicated as p ⁇ 0.001.
  • Figure 11 shows the expression levels of inflammation-related genes of TNF-a, IL-6, IL-1b, Cox2, and Ptges, adipogenic genes of Pparg and Myod1, and myogenic genes of Myf5 and Cebpa in the infraspinatus muscle. It is a result. Data are expressed as mean ⁇ SD, significance indicated *, p ⁇ 0.05, **, p ⁇ 0.01; ***, indicated as p ⁇ 0.001.
  • Figures 12a to 12c show the results of Antibody-Based Protein Microarray analysis.
  • Figures 13a and 13b show the results of tracking cells administered to mice through Dil staining.
  • Figure 13B all nuclei are shown in DAPI blue and DiI+ cells are shown in red.
  • the scale bar represents 100 ⁇ m.
  • the rotator cuff refers to four muscles (supraspinatus, infraspinatus, subscapularis, and teres minor) and tendons that connect the shoulder and arm, and performs the function of enabling rotation of the shoulder joint and maintaining stability.
  • Rotator cuff tears occur due to degenerative changes in the rotator cuff muscles or tendons, irritation or inflammation of the synovial membrane between the shoulder joint and the rotator cuff tendons, trauma, or excessive exercise.
  • Rotator cuff tears can be caused by inflammation, but no matter what the cause, they are ultimately accompanied by inflammation and cause chronic pain. At this time, inflammation can induce fatty infiltration within muscle tissue, causing irreversible changes in the tissue, and especially if acute inflammation occurs in the early stages of rotator cuff rupture, it can cause chronic muscle dysfunction.
  • MSCs Mesenchymal stem cells
  • BM-MSC Mesenchymal stem cells
  • AD-MSC adipose mesenchymal stem cells
  • bone marrow produces 500 times fewer MSCs than the same amount of fat tissue, so BM-MSCs are difficult to supply.
  • AD-MSCs can be obtained through a relatively less invasive method and have the advantage of being easier to handle than BM-MSCs.
  • M-MSC multipotent mesenchymal stem cells
  • the present inventors compared the transcriptomes of M-MSCs and adult MSCs (BM-MSCs and AD-MSCs) and found that genes related to inflammation suppression and wound healing were upregulated and caused an inflammatory response in M-MSCs compared to adult MSCs.
  • the gene was confirmed to be down-regulated.
  • M-MSCs showed an overall tendency to decrease the expression of genes related to allograft rejection compared to BM-MSCs and AD-MSCs, and a tendency to increase the expression of genes related to negative regulation of apoptosis.
  • M-MSC exhibited a significantly lower level of immune rejection than AD-MSC (see Example 1).
  • M-MSC as a cell therapy with reduced graft-versus-host disease (GVHD) side effects was confirmed, and M-MSC and BM-MSC, which showed low immunogenicity, were selected as candidate cells for RCT treatment.
  • GVHD graft-versus-host disease
  • the present inventors created an animal model in which rotator cuff tear disease was induced by cutting the skin on the outside of the right shoulder of a mouse and performing tendon dissection and partial muscle amputation surgery, and injected M-MSC or BM-MSC into the experimental animal at 3x10. 6 cells were injected. As a control group, 3x10 6 cells of HDF were injected.
  • the BM-MSC administration group recovered grip strength similar to that of the normal group after 8 weeks, but M- It was confirmed that the MSC administration group recovered grip strength to a level similar to that of the normal group after 7 days, showing that M-MSC can alleviate the symptoms of rotator cuff tear disease more effectively than BM-MSC (conducted) see example 2).
  • the present inventors confirmed the effect of M-MSC on the affected area of rotator cuff tear by observing morphological changes in the muscle. Specifically, after sacrificing the diseased animals, slices of muscle tissue were sliced and observed after staining with H&E or MT. As a result, in the hDF-administered group, severe fatty infiltration occurred 7 days after surgery, and from 72 hours until the end of the experiment at week 8. In contrast to the progression of fibrosis and muscle atrophy, slight atrophy of the muscles was observed 7 days after surgery in the M-MSC group, but no fibrosis or fatty infiltration was observed. In the case of the BM-MSC administration group, slight fat infiltration was confirmed by 4 weeks after surgery, and atrophy and fibrosis of muscle tissue progressed (see Example 3).
  • MSC administration prevents deformation and fibrosis of muscle tissue and reduces fatty infiltration within muscle tissue, and this effect was more evident in M-MSC than in BM-MSC through TB and IHC staining. This was re-confirmed by counting inflammatory cells within the body and checking the expression levels of inflammation-related cytokines and genes related to adipogenesis. Specifically, in the M-MSC and BM-MSC administered groups, significantly fewer macrophages and mast cells were identified in the damaged muscle tissue compared to the hDF administered group. A lower level of macrophages was confirmed in the M-MSC administered group compared to the BM-MSC administered group (see Example 4).
  • mRNA expression levels of inflammatory cytokines (TNf-alpha, IL-6, IL-1beta, Cox2, Ptges) mainly detected in RCT were quantified by RT-qPCR, and the results showed that in each experimental animal group, from day 7 to week 4. A significant difference in expression level could be confirmed.
  • the M-MSC-administered group tended to express lower levels of cytokines compared to the BM-MSC-administered group, and the expression levels of myogenicity known as Myf5 and MyoD, which are indirect indicators of muscle damage, were confirmed to be significantly reduced ( See Example 5).
  • M-MSC can be effectively and safely used to prevent histological changes in muscle by suppressing inflammation in muscle tissue and limiting fat infiltration within the tissue.
  • M-MSCs can contribute to restoration of function and rapid recovery in the early stages of muscle damage.
  • M-MSC as a cell therapy agent for controlling inflammation in muscles or for preventing or treating muscle diseases accompanied by inflammation, especially rotator cuff syndrome or rotator cuff tears.
  • M-MSCs administered locally into the muscle can remain in the muscle for up to 8 weeks and maintain their therapeutic effect (see Example 6).
  • M-MSC a cell therapy agent for the prevention or treatment of muscle inflammation and muscle diseases accompanied by inflammation
  • M-MSC is a mesenchymal stem cell derived from human pluripotent stem cells, and its production is 'pseudo-mesenchymal' as described in KR 10-2280509. It is the same as the manufacturing method for ‘stem cells’.
  • pseudo-mesenchymal stem cells were isolated from human pluripotent stem cells and cultured.
  • Human pluripotent stem cells were used that were passaged less than 70 times after establishing the cell line. After establishing the cell line, human pluripotent stem cells that had been passaged less than 70 times were maintained in a cell incubator at 37°C and 5% CO2.
  • Maintained cultured human pluripotent stem cells were isolated from the culture plate by simple enzyme treatment. And, through embryoid body formation, only cystic embryoid bodies were selected. Before attaching the cell-permeable 3D culture insert to a new culture plate (6 well plate), 2 ml of culture medium was first added to the new culture plate only for the first time during culture.
  • the cell-permeable three-dimensional culture insert was coupled to a culture plate containing 2 ml of culture medium. Afterwards, 2 ml of culture medium was additionally added into the cell-permeable three-dimensional culture insert, and the selected cystic embryoid bodies were loaded onto the combined cell-permeable three-dimensional culture insert. EGM-2MV was used as the culture medium placed in a new culture plate and the culture medium in the cell-permeable three-dimensional culture insert. Embryoids were cultured in a cell-permeable three-dimensional culture insert loaded with cystic embryoid bodies without changing the culture medium for two days.
  • the culture medium was removed, an additional 4 ml of culture medium was added only to the cell-permeable three-dimensional culture insert, and the culture medium was replaced every day to induce differentiation into similar mesenchymal stem cells.
  • Cell differentiation was performed for 5-7 days.
  • cluster-shaped cells that penetrated the cell-permeable 3-D culture insert and migrated down the cell-permeable 3-D culture insert were isolated.
  • multilayer clusters were mechanically removed.
  • monolayer-shaped colonies were cut into pieces less than 500 ⁇ m wide and 500 ⁇ m long using a micropipette tip, homogenized, and selectively cultured.
  • the single-layer cluster was uniformized to a size of 100 ⁇ m to 500 ⁇ m horizontally and vertically, and the pseudo-mesenchymal stem cells were cultured. After culturing for 5-7 days, only the pseudo-mesenchymal stem cells extending in the form of single cells were isolated from the colony and proliferated by subculture. Before single cell separation, clusters and epithelial cell-shaped cells that were not single cells were completely removed with a micropipette tip. The isolated single cells were transferred to a new culture plate and induced to proliferate through subculture. At this time, EGM-2MV was used as the culture medium.
  • the cell-permeable 3D culture insert was separated from the culture plate. After obtaining cluster-like mesenchymal stem cells that migrated down the separated cell-permeable 3D culture insert, multilayer-shaped clusters were mechanically removed and the size of monolayer-shaped clusters was equalized. M-MSCs were obtained through selective culture.
  • M-MSC as a cell therapeutic agent includes the steps of (a) subculturing human pluripotent stem cells no more than 70 times; (b) selecting cystic embryoid bodies among embryoid bodies derived from differentiation of the human pluripotent stem cells; (c) loading the cystic embryoid bodies onto the top of a cell-permeable three-dimensional culture insert and separating a population of mesenchymal stem cells that migrated to the bottom of the culture insert; and (d) isolating only a monolayer-type population among the populations of the separated mesenchymal stem cells. It is preferable that the mesenchymal mesenchymal cells are obtained by performing the following.
  • the cell therapy agent may be provided as a pharmaceutical composition for the prevention or treatment of the above-mentioned diseases.
  • cell therapy products are cells and tissues manufactured through isolation, culture, and special manipulation from an individual, and are medicines used for treatment, diagnosis, and prevention (US FDA regulations) to restore the function of cells or tissues. It refers to a medicine used for the purpose of treatment, diagnosis, and prevention through a series of actions such as in vitro proliferation and selection of living autologous, allogeneic, or xenogeneic cells or changing the biological characteristics of cells by other methods.
  • human pluripotent stem cells from which mesenchymal stem cells are derived are not limited as long as they are stem cells with pluripotency, and non-limiting examples of the pluripotent stem cells include embryonic stem cells (ESC) and/or It may be an induced pluripotent stem cell (iPSC).
  • ESC-MSC mesenchymal stem cells derived from embryonic stem cells were used.
  • embryonic stem cells are an example of pluripotent stem cells, and the present invention is not limited thereto and is not limited to this.
  • the term ESC-MSC can be used interchangeably with M-MSC.
  • the M-MSC of the present invention can be mixed with an appropriate carrier and provided as a pharmaceutical composition for the prevention or treatment of muscle inflammation or muscle disease accompanied by inflammation.
  • prevention refers to any action that inhibits or delays the occurrence, spread, or recurrence of inflammation in muscles by administering the composition of the present invention
  • treatment refers to the disease by administering the composition of the present invention. It refers to any action that improves or changes the symptoms to a beneficial effect.
  • “pharmaceutical composition” refers to a product prepared for the purpose of preventing or treating disease, and can be formulated and used in various forms according to conventional methods. For example, it can be formulated into oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, etc., and can be formulated and used in the form of external preparations, suppositories, and sterile injectable solutions. It can be formulated as:
  • each formulation may be prepared by additionally including pharmaceutically acceptable carriers such as buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, bases, excipients, lubricants, etc. known in the art. You can.
  • pharmaceutically acceptable carriers such as buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, bases, excipients, lubricants, etc. known in the art. You can.
  • the pharmaceutical composition of the present invention can be administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount refers to an amount that is sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment and does not cause side effects, and the effective dose level refers to the patient's health condition, It can be determined based on factors including severity, drug activity, sensitivity to the drug, method of administration, time of administration, route of administration and excretion rate, duration of treatment, drugs combined or used simultaneously, and other factors well known in the medical field.
  • the term “individual” may be a mammal such as a rat, livestock, mouse, or human, and may specifically be a pet dog, racehorse, human, etc. necessary to control inflammatory response in muscle tissue or inhibit fat cell infiltration, and is preferably It could be human.
  • the stem cells may be the patient's own or another person's own to whom the cell therapy agent will be administered.
  • formulations for injection include isotonic aqueous solutions or suspensions.
  • injectable formulations can be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents.
  • each component can be dissolved in saline or buffer solution and formulated for injection.
  • dosage forms for oral administration include, for example, ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, and wafers. These dosage forms contain diluents (e.g. lactose, dextrose) in addition to the active ingredient.
  • diluents e.g. lactose, dextrose
  • composition of the present invention may further contain auxiliaries such as preservatives, wetting agents, emulsification accelerators, salts or buffers for osmotic pressure adjustment, and other therapeutically useful substances, and may be formulated according to conventional methods. .
  • the pharmaceutical composition according to the present invention can be administered through various routes, including orally, transdermally, subcutaneously, intravenously, or intramuscularly.
  • the human embryonic stem cell-derived mesenchymal stem cell (M-MSC) administration route, patient's age, and gender may be appropriately selected depending on various factors such as body weight and patient severity, but preferably, 1 ⁇ 10 7 to 5 ⁇ 10 7 cells are administered per unit body weight (1 kg) of the individual administered at least once a day. It can be.
  • composition of the present invention can be administered in parallel with known compounds that can enhance the desired effect.
  • the total effective amount of M-MSC according to the present invention can be administered to the patient as a single dose, and a divided treatment method in which multiple doses are administered over a long period of time ( It can be administered by fractionated treatment protocol.
  • the pharmaceutical composition of the present invention may vary in the content of the active ingredient depending on the degree of the disease, but is generally administered at an effective dose of 1 ⁇ 10 7 to 5 ⁇ 10 7 cells per day for adults. It may be administered more than once and may be administered repeatedly once a day.
  • the pharmaceutical composition of the present invention may further include, in addition to M-MSC, as an active ingredient, known agents that promote muscle regeneration, suppress inflammatory reactions, and reduce fatty infiltration in tissues, and may be used to treat these diseases. It may be combined with other known treatments for treatment.
  • RNA-sequencing was performed to compare M-MCS with BM-MSC and AD-MSC. First, total RNA was extracted from M-MCS using GeneAll® RibospinTM (GeneAll, Seoul, Korea) according to the manufacturer's protocol, and then all RNA samples were determined to be of good quality. TruSeq Stranded mRNA Sample Preparation Guide, Part #15031047 Rev. Libraries were generated according to standard procedures using the TruSeq Stranded mRNA LT sample preparation kit (Illumina Inc., San Diego, CA, USA) according to E (Illumina Inc.).
  • the improved R-seq information was maintained with an average Q20 of 98% and an average Q30 of 95% or higher in the Phred quality score using BBDuk (BBtools).
  • BBtools BBDuk
  • the remaining information was mapped to the reference genome sequence (University of California Santa Cruz (UCSC) hg19, annotation RefSeq_2017_06_12) using Bowtie2 10.
  • Bedtools https://bedtools.readthedocs.io/en/latest/ was used for R-seq library calculations. Read mapping and expression quantification were performed separately for each sample.
  • the Pearson product-moment correlation coefficient rho and its significance level were calculated using the rcorr() function and chart.Correlation() function in the R statistical programming language, and the correlation was plotted using the R package.
  • the strength of correlation was determined as follows (Mukaka, MM, Statistics corner: A guide to appropriate use of correlation coefficient in medical research. Malawi Med J 2012, 24 (3), 69-71): 0.90 to 1.00, very high correlation; 0.70 to 0.90, high correlation; 0.50 to 0.70, moderate correlation; 0.30 to 0.50, low correlation; and 0.00 to 0.30, negligible correlation.
  • PCA principal component analysis
  • Principal components were calculated using the prcomp() function in the R statistical programming language and plotted using the autoplot()(pam) function in the R package.
  • Upregulated differentially expressed genes (DEGs) in M-MCS were selected based on fold changes (FC) that were four times higher than those in BM-MSCs or AD-MSCs, and downregulated DEGs were The choice was made based on FC, which is 0.25 times lower.
  • FC fold changes
  • Java script 1.8.0_162 Oracle Corporation, Santa Clara, CA, USA
  • ClueGo analysis on Gene Ontology (GO) for GO_BiologicalProcess-EBI-UniProt-GOA-ACAP-ARAP_08.05.2020_00h00:17972 Integrated The European Bioinformatics Institute, EMBL-EBI, Cambridgeshire, UK.
  • the pathway's restriction was set to p ⁇ 0.05, and GO terms were specified using GO tree spacing from a minimum of 4 to a maximum of 6.
  • the Kappa Score was set to 0.4 and the minimum number of GO genes was set to 3.
  • GO term GO 0043069 ‘negative regulation of programmed cell death’ (EMBL-EBI) and GO term WP2328 ‘Homo sapiens’ (WikiPathways).
  • EBL-EBI programmed cell death
  • WP2328 Homo sapiens
  • QTC Quality Threshold Clustering
  • MLR Mixed lymphocyte reaction
  • Splenocytes were isolated from mouse spleen by digesting with 10mL RPMI 1640 medium. Red blood cells were lysed with RBC lysis buffer (Roche, Germany) and then washed three times with RPMI 1640. Stimulator splenocytes (10 7 cells/mL) were treated with 10 ⁇ g/mL mitomycin C for 1 h at 37°C and then washed with RPMI 1640 medium containing FBS. Responder splenocytes from BALB/c mice and stimulator splenocytes from mice of a different strain were incubated with 10% FBS, 2mM glutamine, 100U/mL penicillin, 100 ⁇ g/mL streptomycin, and 1mM sodium pyruvate.
  • responder and stimulator cell population was seeded in triplicate in 96-wells at a concentration of 10 5 cells/100 ⁇ L/well. MSCs were also added to the MLR in equal numbers to obtain a final volume of 300 ⁇ L.
  • mitogen proliferation assay responder splenocytes were incubated with 5 ⁇ g/mL concanavalin A. After 5 days, proliferation of responding cells was measured using CCK assay.
  • a total of 160 7-week-old Sprague Dawley (SD) rats were purchased from ORIENT Bio Inc. (Gyeonggi, Korea), acclimatized for 1 week, and then used at 8 weeks of age (250 g). During the experiment, all rats were provided with tap water and pellets (Altromin, Germany) ad libitum. All animals were raised at a temperature of 22 ⁇ 2°C, humidity of 55 ⁇ 5%, and a 12-hour/12-hour light/dark cycle.
  • a lateral skin incision was made in the right shoulder to expose the supraspinatus and infraspinatus muscles, which insert into the greater tuberosity of the humerus.
  • the RCT model was produced by partially separating the supraspinatus and infraspinatus muscles and cutting the supraspinatus and infraspinatus muscles from the greater tubercle and infraspinatus muscles.
  • M-MSCs, BM-MSCs, and HDFs were injected into the supraspinatus and infraspinatus muscles at 3x10 6 cells per animal.
  • the incised skin was sutured with 6-0 nylon suture without further treatment of the tendon. Mice were raised in cages without activity restrictions, and each mouse was sacrificed by CO 2 gas inhalation at 24 hours, 72 hours, 7 days, 4 weeks, and 8 weeks after surgery.
  • M-MSC, BM-MSC, and hDF cells were attached to a 100 mm dish and cultured. When the density reached 90%, the medium was removed and washed with DPBS.
  • Cell TrackerTM CM-DiI dye (Thermo fisher, Waltham, MA, US) stock was prepared as recommended by the manufacturer, the stock was diluted to 1 ⁇ M in DPSB and added to cell culture dishes. This was followed by incubation at 37°C for 15 min and then an additional 15 min at 4°C. Afterwards, the staining solution was removed, washed twice with DPBS, and cells were separated using trypsin. The cell suspension was centrifuged to adjust to 3x10 6 cells, and 200 ⁇ l was prepared and injected during surgery. After sampling at 24 h, 72 h, 7 days, 4 weeks, and 8 weeks, paraffin sections were performed and labeled cells were monitored using a microscope (Eclipse Ti, Nikon, Tokyo, Japan).
  • a grip strength meter (Bio-GS3, BioSeb, Vitrolles, France) was used to evaluate the rat's forelimb grip strength.
  • the rat was guided to lift its tail and grasp the mesh attached to the digital force gauge.
  • the mesh has a 1 square inch grid and measures 3 x 4.75 square inches. The bars of the grid were 1/8 inch thick.
  • the mesh was oriented horizontally. Gently lift the mouse over the mesh by its tail and then lower it toward the mesh while keeping the tail, body, and forelimbs aligned and perpendicular to the mesh as the mouse reaches out to grasp the mesh.
  • the tension reading of the digital force gauge was defined as the grip strength before the rat released the net.
  • For each rat three consecutive tests were performed and the average maximum limb strength value (g) was obtained. Measurements were taken at 24 hours, 72 hours, 7 days, 4 weeks, and 8 weeks after surgery, and the values reaching normal measurement values were defined as percentages.
  • Primer sequences for amplification of GAPDH, IL-1b, IL-6, TNF-a, Cox2, Ngf, Ptges, Ppar-r, MyoD, Myf5, and cebpa are shown in Table 1 below. All primers were purchased from Macrogen (Seoul, Korea).
  • Total muscle tissue from RCT models treated with MMSCs, BM-MSCs, or hDFs was excised 72 hours after surgery for comparison with normal rats.
  • Protein (1300-1800 ⁇ g) was extracted from muscle tissue for semi-quantitative protein antibody array.
  • Rat L2 Antibody Array slides (RayBiotech Inc., Norcross, GA, USA) were dried at room temperature for 2 hours and incubated with 400 ⁇ L of blocking solution for 30 minutes at room temperature. After decanting the blocking buffer from each subarray, 400 ⁇ L of the diluted sample was added and incubated for 2 hours at room temperature. After decanting the samples, each array was washed three times with 800 ⁇ L of 1X Wash Buffer I with shaking for 5 minutes at room temperature.
  • the glass chip assembly was placed in the container and shaken twice while enough 1X Wash Buffer I was added to submerge the entire glass chip for 10 minutes. Advanced washing steps were repeated using 1X Wash Buffer II.
  • 1X biotin-Conjugated Anti-Cytokine antibody was prepared, incubated at room temperature for 2 hours while gently shaking, and washed with 150 ⁇ L of 1X Wash Buffer I at room temperature while shaking.
  • 1X Cy3-Conjugated Streptavidin stock solution was added and incubated for 2 hours at room temperature with gentle shaking, and washed twice with 1X Wash Buffer I for 10 minutes at room temperature. After washing, the slides were rinsed with deionized water using a plastic wash bottle and centrifuged at 1000 rpm for 3 minutes to remove water.
  • Slide scanning was performed using a GenePix 4100A scanner (Axon Instrument Inc., Foster City, CA, USA). Slides were completely dried before scanning and scanned within 24-48 hours. Slides were scanned with 10 ⁇ m resolution, optimal laser power, and PMT. After obtaining the scanned images, grids were created and quantified using GenePix Software (Axon Instrument Inc., Foster City, CA, USA). After analysis, data on protein information were annotated and quantile quantified using UniProt DB.
  • the genes upregulated in M-MCS compared to BM-MSC are the following common EMBL-EBI GO terms: (1) GO:0050919 'negative chemotaxis', ( 2) GO:0048762 ‘mesenchymal cell differentiation’, (3) GO:0042060 ‘wound healing’, (4) GO:0061041 ‘regulation of wound healing’, (5) GO:0021882 ‘regulation of transcription from RNA polymerase II promoter ', and (6) GO:1902292 'cell cycle DNA replication initiation. It was found that the genes upregulated in the M-MCS belong to GO, which suppresses inflammation and is involved in muscle tissue repair.
  • the genes upregulated in M-MCS compared to AD-MSC generally belong to GO downregulating inflammation as shown below: (10) GO: 0050922 ‘negative regulation of chemotaxis’, (11) GO:0060850 ‘regulation of transcription involved in cell fate commitment’, and (12) GO:0008330 ‘protein tyrosine/threonine phosphatase activity’.
  • genes downregulated in M-MCS compared to AD-MSC were identified with the following GO terms associated with inflammation and stress response: (13) GO:0097501 'stress response to metal ion', (14) GO:0006935 'chemotaxis', (15) GO:1902622 'regulation of neutrophil migration', and (16) GO:0045736 'negative regulation of cyclin-dependent protein serine /threonine kinase activity’.
  • M-MCS For GO: 0043069 (EMBL-EBI), which is associated with negative regulation of programmed cell death, M-MCS showed an overall trend of increased gene expression compared to BM-MSCs and AD-MSCs. At the same time, in the case of WP2328 (WikiPathways), a GO related to allograft rejection, M-MCS showed an overall decrease compared to adult MSC. From the above, it could be seen that compared to adult MSCs, M-MCS had a lower level of apoptosis and less rejection upon transplantation.
  • M-MSCs The results of a mixed lymphocyte reaction to confirm whether M-MSCs have lower immunogenicity than other adult MSCs are shown in Figure 5. All MSCs showed limited activity of responder splenocytes induced by stimulator splenocytes. M-MSCs showed a significantly lower level of immune rejection than AD-MSCs and a similar level of immunogenicity as the gold standard BM-MSCs.
  • M-MSC and BM-MSC with low immunogenicity were selected as candidates for RCT treatment.
  • H&E and MT staining were performed for histological analysis. Fatty infiltration, histological atrophy, and fibrosis were confirmed through H&E staining. In the supraspinatus muscle, histological atrophy was observed for up to 7 days in the M-MSC treated group, but no fibrosis or fatty infiltration was observed. In the BM-MSC administered group, fatty infiltration appeared slightly at 4 weeks, but was not evident overall. However, by week 4, histological atrophy and muscle fibrosis could be confirmed in the BM-MSC group. At 8 weeks, histological atrophy was not fully recovered. The hDF-administered group showed severe fatty infiltration starting from the 7th day, and fibrosis and muscle atrophy progressed from 72 hours to the 8th week ( Figure 7a).
  • the M-MSC administration group showed atrophy of the infraspinatus muscle by the 4th week, but fibrosis or fatty infiltration was confirmed on the 7th day, which suggests that the M-MSC administration group recovered sufficiently to approach the normal group from the 4th week.
  • fibrosis or muscle atrophy recovered after 7 days, similar to the M-MSC-administered group.
  • severe fat infiltration occurred from the 7th day to the 4th week.
  • muscle atrophy, fibrotic muscle, and fat infiltration were observed up to 8 weeks ( Figure 7b).
  • fibrosis was confirmed by 72 hours in the M-MSC administration group, similar to the results of the supraspinatus muscle, but decreased from the 7th day, showing recovery similar to the normal group after 4 weeks.
  • fibrosis significantly increased compared to the M-MSC administration group until the 7th day and decreased from the 4th week.
  • fibrosis continued until the 4th week, peaked on the 7th day, and decreased to a level similar to that of the normal group after 8 weeks ( Figures 7D (B3) and (B4)).
  • Example 4 Inflammatory cell counting based on TB and IHC staining
  • macrophage infiltration was confirmed by staining CD68.
  • macrophages showed significant differences from the normal group only at 72 hours in both the supraspinatus and infraspinatus muscles.
  • macrophages were detected even after 72 hours, and macrophage infiltration was confirmed even on the 7th day.
  • macrophages were hardly detected in the supraspinatus and infraspinatus muscles at 24 hours, but there was a clear difference after 72 hours.
  • Example 5 Analysis of gene expression levels related to inflammation, adipogenesis, and muscle production
  • M-MSC suppressed inflammation, fat infiltration, and muscle damage.
  • M-MSCs remain in the muscles for a long time, relieve inflammation and promote muscle recovery.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Rheumatology (AREA)
  • Reproductive Health (AREA)
  • Pain & Pain Management (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Hematology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

본 발명은 인간 전분화능 줄기세포 유래 중간엽줄기세포를 유효성분으로 포함하는 회전근개증후군 또는 회전근개 파열의 예방 및 치료용 약학적 조성물 등에 관한 것으로서, 본 발명의 인간 전분화능 줄기세포 유래 중간엽줄기세포는 성체 줄기세포 유래 중간엽줄기세포보다 손상된 근육 조직에서 염증을 억제하고 조직 내의 지방 침윤을 제한하여 근육의 조직학적 변화를 예방하여 근육의 초기 손상단계에서 기능의 복구와 빠른 회복이 가능하게 하고, 근육 내에 국소 투여 시 비교적 장기 효과가 지속되어 면역원성이 매우 낮아 안전한 장점이 있는 바, 염증이 원인 또는 증상이 되는 다양한 근육질환의 치료를 위한 세포치료제로 유용하게 적용될 수 있다. 또한, 본 발명은 가장 효과적으로 회전근개 파열을 치료할 수 있는 중간엽줄기세포 투여방법을 제공하여 임상 적용에 가이드로 제공될 수 있다.

Description

전분화능 줄기세포 기반 근육염증 또는 염증을 동반한 근육질환의 예방 또는 치료용 약학적 조성물
본 발명은 인간 전분화능 줄기세포 유래 중간엽줄기세포를 유효성분으로 포함하는 염증을 동반하는 근육 질환의 예방 또는 치료용 약학적 조성물 등에 관한 것이다.
회전근개 파열(Rotator cuff tears, RCT)은 일반적으로 섬유증, 근육 위축, 및 일반적으로 "지방 변성(fatty degeneration)"이라 불리는 근육 내 지방 침윤과 관련이 있다. 회전근개 파열은 노화에 따라 발생율이 증가하는 흔한 어깨 질환으로 어깨의 기능 감소와 통증을 수반한다. 최근, RCT 치료를 위해 LBT(long biceps tendon) 또는 혈관구조가 보존된 subacromial bursa의 자가 이식(autografing) 또는 스캐폴드 이식 등의 다양한 수술이 수행되고 있으며, 이러한 수술적 치료는 병증을 완화하고 긍정적인 예후를 나타내는 것으로 보고되고 있다. 그러나, 수술 후 약 10~30%의 환자에서 불완전한 근육 재생, 유착낭염, 신경 손상 및 이로 인한 신경증, 및 감염 등의 부작용이 발생하여, 수술적 치료에도 불구하고 일부 환자는 완전한 치유가 되지 않고 통증을 수반한 근육 질환으로 고통받고 있다. 특히, 병변부의 지방 변성(fatty degeneration)은 비가역적으로 발생하며 근육이 짧아지게 되어 근 섬유의 90%까지 손상시킬 수 있다. 상술한 수술 후 회전근개의 재파열율을 7~57%로 보고되었다. 근육의 재파열은 추가적인 지방 침윤과 근육의 섬유화를 야기하고 이는 조직의 재생을 방해하여 지속적인 통증과 어깨 기능을 개선시킬 수 없으며, 특히 병변부에 발생하는 염증반응은 근육 조직 내에 지방 침윤을 유도하여 완전한 회복이 불가능하게 한다. 즉, 초기 부상으로 인한 RCT에서 급성 염증은 만성 근육 기능 장애를 유발할 수 있는 중요한 요인으로 여겨진다. 이에, 회전근개 파열 질환에 있어 효과적인 외과적 치료 달성 내지는 보다 예후를 향상시킬 수 있는 치료방법 개발이 요구되고 있다.
본 발명자들은 임상에 적용할 수 있는 수준의 인간 배아줄기세포 유래 중간엽줄기세포(human embryonic stem cell-derived mesenchymal stem cell. hESC-MSC)를 이용한 세포치료제 개발에 예의 연구한 결과 인간 전분화능 줄기세포 유래 중간엽줄기세포를 회전근개 파열의 치료에 적용할 수 있음을 확인하고 본 발명을 완성하였다.
본 발명이 이루고자 하는 기술적 과제는 인간 전분화능 줄기세포 유래 중간엽줄기세포(hESC-MSC, multipotent MSC: M-MSC)를 포함하는 근육 염증과 염증을 동반한 근육 질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또한, 본 발명은 인간 전분화능 줄기세포 유래 중간엽줄기세포(M-MSC)를 포함하는 회전근개 증후군 또는 회전근개 파열 후 근육 염증과 염증을 동반한 근육 질환의 치료용 약학적 조성물을 제공하는 것을 목적으로 한다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당해 기술분야의 통상의 기술자에게 명확하게 이해될 수 있을 것이다.
상기 과제를 해결하기 위하여, 본 발명은 인간 전분화능 줄기세포로 유래 중간엽 줄기세포(M-MSC)를 유효성분으로 포함하는, 근육 염증 또는 염증을 동반한 근육 질환 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명은 상기 인간 전분화능 줄기세포 유래 중간엽 줄기세포(M-MSC)를 회전근개 증후군및 회전근개 파열의 예방 또는 치료를 위한 세포치료제로 제공될 수 있다.
또한 본 발명은 회전근개 파열 후 발생되는 근육 염증 또는 염증을 동반한 근육 질환의 환부에 국소 투여하는 단계를 포함하는 회전근개 파열 질환 예방 또는 치료 방법을 제공한다.
본 발명의 일 구현예로서, 상기 전분화능 줄기세포는 역분화 유도 만능 줄기세포(induced pluripotent stem cell, iPSC)일 수 있으며, 배아줄기세포(ESC)일 수 있으나, 본 발명의 구체적 실험에서는 배아줄기세포를 이용하여 중간엽줄기세포를 수득하여 이의 회전근개 파열에서 근육 염증 또는 염증을 동반하는 근육질환의 개선 효과를 확인하였다
본 발명의 다른 구현예로서, 상기 약학적 조성물 또는 세포치료제는 인체를 대상으로 투여되는 경우 1회 투여 시 인간 전분화능 줄기세포 유래 중간엽줄기세포(M-MSC)가 kg 당 1 Х 106 내지 1 Х 108개, 바람직하게는 1 Х 107 내지 5 Х 107개, 더욱 바람직하게는 약 2 Х 107 개 투여되도록 인간 전분화능 줄기세포 유래 중간엽줄기세포를 포함할 수 있다.
본 발명의 다른 구현예로서, 상기 중간엽줄기세포(M-MSC)는 근육 세포에서 TNF-a, IL-6, IL-1b, Cox2, 및/또는 Ptges 유전자의 발현을 하향 조절하여 염증 반응을 감소시킬 수 있다.
본 발명의 또 다른 구현예로서, 상기 중간엽줄기세포(M-MSC)는 근육 세포에서 Pparg 및/또는 Myod 유전자의 발현을 하향 조절하여 근육 조직에 지방 침윤을 감소시킬 수 있다.
본 발명의 또 다른 구현예로서, 상기 중간엽줄기세포(M-MSC)는 근육 세포에서 Myf5 및 Cebpa 유전자의 발현을 상향 조절하여 근육 생성을 향상시키는 것일 수 있다.
본 발명의 또 다른 구현예로서, 상기 중간엽줄기세포(M-MSC)는 근육의 섬유화 및 위축을 억제할 수 있으며 근육의 조직학적 변화를 예방할 수 있다.
본 발명의 또 다른 구현예로서, 상기 근육은 회전근개일 수 있으며, 상기 염증을 동반한 근육 질환은 회전근개 증후군 내지는 회전근개 파열일 수 있다.
또한, 본 발명은 회전근개 파열 후 근육 염증 또는 염증을 동반한 근육 질환 예방 또는 치료용 세포치료제 제작을 위한 인간 전분화능 줄기세포 유래 중간엽 줄기세포(M-MSC)의 용도를 제공한다.
본 발명의 일 구현예로서, 상기 인간 전분화능 줄기세포 유래 중간엽 줄기세포(M-MSC)는 하기 단계를 수행하여 수득될 수 있다:
(a) 인간 전분화능 줄기세포를 70회 이하, 바람직하게는 40~60회 계대 배양하는 단계;
(b) 상기 인간 전분화능 줄기세포를 분화 유도한 배상체 중 낭성 배상체를 선별하는 단계;
(c) 상기 낭성 배상체를 세포투과성 3차원 배양삽입체의 상부에 로딩하고 상기 배양삽입체의 하부로 이동한 중간엽 줄기세포의 군집을 분리하는 단계; 및
(d) 상기 분리된 중간엽 줄기세포의 군집 중 단층 형태의 군집만을 분리하는 단계.
본 발명의 인간 전분화능 줄기세포 유래 중간엽줄기세포(M-MSC)는 성체 줄기세포 유래 중간엽줄기세포보다 손상된 근육 조직에서 근육의 재생과 조직 내 지방 침윤 및 염증 반응을 억제하여 근육의 빠른 기능 회복이 가능하게 하는 장점이 있고, 나아가 근육 내에 국소 투여 시 비교적 장기간 효과가 지속되는 바, 회전근개 파열의 예방 및 치료에 효과적인 세포치료제로 제공될 수 있다. 또한, 본 발명은 가장 효과적으로 회전근개 파열을 치료할 수 있는 중간엽줄기세포(M-MSC) 투여방법을 제공하여 임상 적용에 가이드로 제공될 수 있다.
도 1은 adult MSC와 비교한 M-MSC 전사체 분석 결과이다. 구체적으로, 도 1a는 M-MSC, BM-MSC, 및 AD-MSC 클러스터의 PCA(Principal component analysis) 결과이다. 서로 다른 색상의 점(dot)은 세포 간의 상대적 거리를 나타내고. 각 점은 각각의 모델을 나타낸다. 도 1b는 M-MSC, BM-MSC, 및 AD-MSC 세포 상호간의 상관관계를 나타낸 것이다. 세포의 유전자 발현은 점으로 표시하였으며, 그 분포는 선으로 표시되었다. 적합선이 있는 이변량 산점도(Bivariate scatter plot)는 대각선 아래쪽에 표시되고 상관관계 값과 유의 수준은 대각선 위쪽에 표시되었다 (p < 0.01, ***). BM-MSC 및 AD-MSC는 NCBI GEO GSM 번호로 표시하였다.
도 2는 adult MSC와 M-MSC의 특성을 비교한 결과로서, M-MSC에 대한 Gene Ontology (GO) 네트워크 및 Enrichment Pathway 분석 결과이다:
도 2a는 BM-MSC에 비해 M-MSC에서 상향 조절된 차등 발현 유전자(DEG)(FC > 4) 결과이고, 도 2b는 BM-MSC에 비해 M-MSC에서 하향 조절된 DEG(FC < 0.25) 분석 결과이고, 도 2c는 AD-MSC와 비교하여 M-MSC에서 상향 조절된 DEG( FC > 4) 분석 결과이고, 도 2d는 AD-MSC와 비교하여 M-MSC에서 하향 조절된 DEG(FC < 0.25) 분석 결과이다.
도 3은 도 2에서 확인된 DEG의 GO에 대한 유전자 백분율을 나타낸 것이다. 구체적으로, 도 3a는 BM-MSC에 비해 M-MSC에서 상향 조절된 DEG로 FC는 4 이상인 것이고, 도 3b는 BM-MSC에 비해 M-MSC에서 하향 조절된 DEG로 FC는 0.25 미만인 것이고, 도 3c는 AD-MSC에 비해 M-MSC에서 상향 조절된 DEG로 FC는 4 이상인 것이고, 도 3d는 AD-MSC에 비해 M-MSC에서 하향 조절된 DEG로 FC는 0.25 미만인 것이다(*, p < 0.05; **, p < 0.01; ***, p < 0.001).
도 4는 특정 GO에 대하여 M-MSC의 유전자 발현을 adult MSC와 비교한 결과이다. 구체적으로, GO:0043069(negative regulation of programmed cell death)에 대한 첫 번째 QTC(quality threshold cluster)는 (B1) 히트맵 및 (B2) 선 그래프로 표시되었으며, WP2328(Allograft Rejection (Homo sapiens))에 대한 첫 번째 QTC는 표시는 (B3) 히트맵 및 (B4) 선 그래프로 표시되었다. 상단의 색상 눈금은 상대적인 발현 수준을 나타내며 빨간색, 파란색 및 흰색은 각각 상향 조절, 하향 조절 및 변경되지 않음을 나타낸다.
도 5는 MSC와 혼합 림프구 반응(MLR) 결과이다(R, responder 비장세포, S, stimulator 비장세포, *, mitomycin C 처리). 데이터는 평균 ± SD로 표시되며 유의성은 *, p < 0.05, **, p < 0.01; ***, p < 0.001; ns, 각각 중요하지 않음으로 표시되었다.
도 6은 RCT 유도 후 MSC 처리에 따른 악력 회복을 확인한 것이다. 구체적으로 (A)는 연구의 개략도로, 7주령 SD 쥐를 무작위로 20개 군으로 나누고 세포주입군은 오른쪽 어깨에 수술하고 세포를 주입하였다. 5회씩 그룹당 8마리의 마우스를 샘플링하여 실험에 사용하였다. (B)는 M-MSC, BM-MSC 또는 대조군 hDF 세포를 RCT 모델에 주입하고 24시간, 72시간, 7일, 4주, 8주 경과 후 악력을 측정한 결과로, 데이터는 평균 ± SD로 표시되며 유의성은 *, p < 0.05, **, p < 0.01; ***, p < 0.001로 표시되었다.
도 7은 조직병리학적 분석을 위해 RCT 유도 후 24시간, 72시간, 7일, 4주 및 8주에 hDF(대조군), BM-MSC 및 M-MSC 투여군에서 근육 샘플을 절제한 후 H&E 및 MT 염색한 결과이다. 도 7a는 극상근의 H&E 염색 결과이고, 도 7b는 극하근의 H&E 염색 결과로, 눈금 막대는 100 ㎛이다. 도 7c는 극상근의 Masson's trichrome의 염색 결과이고, 도 7d는 극하근의 Masson's trichrome 염색 결과이며, 눈금 막대는 100 ㎛를 나타낸다. 섬유증 영역은 파란색으로 결정되었으며 샘플당 3개의 무작위 고출력 필드(HPF)에서 정량화되었다. 데이터는 평균 ± SD로 표시되며 유의성은 *, p < 0.05, **, p < 0.01; ***, p < 0.001로 표시되었다.
도 8은 염증 세포 계수를 위해 RCT 유도 후 24시간, 72시간, 7일, 4주 및 8주에 hDF(대조군), BM-MSC 및 M-MSC 투여군에서 채취한 근육 샘플을 toluidine blue로 염색하여 비만세포를 확인한 결과이다. A1 및 A2는 극상근에서의 결과이고, A3 및 A4는 극하근에서의 결과로 눈금 막대는 500 ㎛(HPF의 경우 50 ㎛)를 나타낸다. 데이터는 평균 ± SD로 표시되며 유의성은 *, p < 0.05, **, p < 0.01; ***, p < 0.001로 표시되었다.
도 9는 염증 세포 계수를 위해 RCT 유도 후 24시간, 72시간, 7일, 4주 및 8주에 hDF(대조군), BM-MSC 및 M-MSC 투여군에서 채취한 근육 샘플을 항-CD68 항체로 면역조직화학적 염색하여 대시세포를 확인한 결과이다. B1 및 B2는 극상근에서의 결과이고, B3 및 B4는 극하근에서의 결과로 눈금 막대는 100 ㎛를 나타낸다. 데이터는 평균 ± SD로 표시되며 유의성은 *, p < 0.05, **, p < 0.01; ***, p < 0.001로 표시되었다.
도 10은 극상근에서 TNF-a, IL-6, IL-1b, Cox2, 및 Ptges의 염증 관련 유전자 발현 수준과 Pparg 및 Myod1의 지방 생성 유전자와, Myf5 및 Cebpa의 근육 생성 관련 유전자 발현 수준을 확인한 결과이다. 데이터는 평균 ± SD로 표시되며 유의성은 *, p < 0.05, **, p < 0.01; ***, p < 0.001로 표시되었다.
도 11은 극하근에서 TNF-a, IL-6, IL-1b, Cox2, 및 Ptges의 염증 관련 유전자 발현 수준과 Pparg 및 Myod1의 지방 생성 유전자와, Myf5 및 Cebpa의 근육 생성 관련 유전자 발현 수준을 확인한 결과이다. 데이터는 평균 ± SD로 표시되며 유의성은 *, p < 0.05, **, p < 0.01; ***, p < 0.001로 표시되었다.
도 12a 내지 도 12c는 Antibody-Based Protein Microarray 분석 결과이다.
도 13a 내지 도 13b는 Dil 염색을 통해 마우스에 투여된 세포를 추적한 결과이다. 도 13b에서 모든 핵은 DAPI 파란색으로 표시되고 DiI+ 세포는 빨간색으로 표시된다. 눈금 막대는 100 ㎛을 나타낸다.
회전근개는 어깨와 팔을 연결하는 4개의 근육(극상근, 극하근, 견갑하근, 소원근) 및 힘줄을 일컬으며, 어깨 관절의 회전운동을 가능하게 하고 안정성을 유지하는 기능을 수행한다. 회전근개 파열은 회전근개 근육이나 힘줄의 퇴행성변화, 어깨 관절과 회전근개 힘줄 사이의 활막의 자극이나 염증, 외상이나 무리한 운동 등으로 발생한다. 회전근개 파열은 염증이 원인이 될 수 있으나, 어떠한 원인에 의해 발생하였던지 궁극적으로 염증을 동반하고 만성적 통증을 유발한다. 이때 염증은 근육 조직 내의 지방 침윤을 유도하여 조직의 비가역전 변화를 유발할 수 있고, 특히 회전근개 파열 초기에 급성 염증이 발생하는 경우 만성 근육 기능의 장애를 초래할 수 있다.
중간엽 줄기세포(MSC)는 그 유래에 따라 작용과 기능에 차이가 있으나, 그 유래와 무관하게 면역 반응과 염증을 조절하는 것으로 알려져 있으며, 특히 면역반응과 염증을 조절하기 위하여 비교적 안전한 골수 유래 중간엽 줄기세포(BM-MSC)와 지방 중간엽 줄기세포(AD-MSC)가 세포치료제로 적용되고 있다. 그러나, 골수는 동일한 양의 지방 조직에 비하여 500배 더 적은 MSC를 생성하여 BM-MSC는 수급에 어려움이 있다. AD-MSC는 비교적 덜 침습적인 방법을 통해 수득할 수 있고 BM-MSC보다 다루기 쉬운 장점이 있다. 그러나, BM-MSC 및 AD-MSC와 같은 성체 MSC는 균일한 세포 군집 확보에 어려움이 있고 기증자에 따른 세포 특성에 차이가 있는 문제가 있다. 한편, 인간 전분화능 줄기세포 유래 다능성 중간엽줄기세포(multipotent-MSC, M-MSC)는 기증자와 무관하게 일관적인 세포주를 형성할 수 있으며, 그 수급에 어려움이 없다는 장점이 있다.
본 발명자들은 M-MSC와 성체 MSC(BM-MSC 및 AD-MSC)의 전사체를 비교하여 M-MSC가 성체 MSC와 비교하여 염증 억제 및 상처 치유와 관련된 유전자가 상향 조절되고 염증반응을 야기하는 유전자는 하향 조절됨을 확인하였다. 또한, M-MSC는 BM-MSC 및 AD-MSC와 비교하여 동종이식 거부와 관련된 유전자 발현의 전반적인 감소 경향을 나타내며, 세포사멸 음성 조절 관련 유전자 발현의 증가 경향을 나타냄을 확인하였다. 또한, 혼합된 림프구와 MSC를 반응시킨 결과 M-MSC는 AD-MSC보다 현저하게 낮은 수준의 면역 거부 반응을 나타냄을 확인하였다(실시예 1 참조). 상기로부터 M-MSC가 graft-versus-host disease (GVHD) 부작용이 감소된 세포치료제로서의 가능성을 확인하고, 낮은 면역원성을 나타낸 M-MSC와 BM-MSC를 RCT 치료 후보 세포로 선정하였다.
이어서, 본 발명자들은 마우스의 오른쪽 어깨 외측의 피부를 절개하고 힘줄 박리 및 근육의 부분적 절단 수술을 통해 회전근개 파열 질환을 유도한 동물 모델을 제작하고 상기 실험동물에 M-MSC 또는 BM-MSC를 3x106 cell개 주입하였다. 대조군으로는 HDF을 3x106 cell개 주입하였다. 상기 수술 이후 24시간, 72시간, 7일, 4주, 8주 경과 시 각 실험동물의 악력을 측정한 결과, BM-MSC 투여군은 8주 후에 정상군과 유사한 수준의 악력을 회복하였으나, M-MSC 투여군은 7일 경과 시에 정상군과 유사한 수준으로 악력을 회복함을 확인하여, M-MSC가 BM-MSC보다 회전근개 파열 질환에 있어 효과적으로 그 증상을 완화시킬 수 있음을 알 수 있었다(실시예 2 참조).
본 발명자들은 상기 M-MSC의 회전근개 파열 환부에서 작용을 근육의 형태학적 변화 관찰을 통해 확인하였다. 구체적으로 상기 질환 동물을 희생 후 근육 조직의 절편을 슬라이드화하고 H&E 또는 MT 염색 후 관찰한 결과 hDF 투여군은 수술 7일 경과 시부터 심각한 지방 침윤이 발생하고 72시간 경과 시부터 실험 종료시인 8주차까지 섬유증과 근육 위축이 진행되는 것과 대조적으로 M-MSC 투여군의 수술 7일 경과 시 근육의 미소한 위축은 관찰되었으나 섬유증이나 지방침윤은 나타나지 않았다. BM-MSC 투여군의 경우 수술 후 4주차까지 약간의 지방 침윤을 확인할 수 있었으며 근육 조직의 위축과 섬유화가 진행되었다(실시예 3 참조).
MSC 투여가 hDF 투여와 비교하여 근육 조직의 변형과 섬유화를 예방하고 근 조직 내의 지방 침윤을 감소시키며, 이러한 효과는 BM-MSC 보다 M-MSC에서 보다 극명하게 나타남은 TB 및 IHC 염색을 통해 근육 조직 내의 염증세포 계수와 염증 관련 사이토카인와 지방 생성 관련 유전자의 발현 수준 확인을 통해 재확인되었다. 구체적으로 M-MSC 투여군과 BM-MSC 투여군의 경우 hDF 투여군과 비교하여 손상된 근육 조직에서 유의하게 적은 수의 대식세포와 비만세포를 확인할 수 있었다. M-MSC 투여군은 대식세포의 수준에 있어 BM-MSC 투여군과 비교하여 낮은 수준의 대식세포를 확인할 수 있었다(실시예 4 참조).
또한, RCT에서 주로 검출되는 염증성 사이토카인(TNf-alpha, IL-6, IL-1beta, Cox2, Ptges)의 mRNA 발현 수준을 RT-qPCR로 정량한 결과 각 실험 동물군에 있어 7일차부터 4주차까지 유의한 발현 수준에 차이를 확인할 수 있었다. M-MSC 투여군은 BM-MSC 투여군과 비교하여 보다 낮은 수준의 사이토카인 발현 경향을 나타내었으며, 근육 손상에 대한 간접적인 지표인 Myf5 및 MyoD로 알려진 myogenicity의 발현 수준이 유의하게 감소함을 확인하였다(실시예 5 참조).
상기 결과를 통해 본 발명자들은 M-MSC가 근육 조직에서 염증을 억제하고 조직 내의 지방 침윤을 제한하여 근육의 조직학적 변화를 예방하는데 효과적이고 안전하게 이용될 수 있음을 확인하였다. M-MSC는 근육의 손상 초기 단계에서 그 기능의 복구와 빠른 회복에 기여할 수 있다.
이에, 본 발명자들은 M-MSC를 근육에 발생한 염증을 조절하거나, 염증을 동반하는 근육질환, 특히 회전근개 증후군 내지는 회전근개 파열의 예방 또는 치료를 위한 세포치료제로서 제안한다.
나아가, 근육 내에 국소 투여된 M-MSC는 최대 8주까지 근육 내에 잔존하여 그 치료 효과를 유지할 수 있다(실시예 6 참조).
본 발명에서 근육 염증 및 염증을 동반하는 근육질환의 예방 또는 치료를 위한 세포치료제로서 M-MSC는 인간 전분화능 줄기세포 유래의 중간엽 줄기세포로서 그 제조는 KR 10-2280509에 기재된 '유사 중간엽줄기세포'의 제조방법과 동일하다.
보다 구체적으로, 인간 전분화능 줄기세포로부터 유사 중간엽 줄기세포를 분리하고 배양하였다. 인간 전분화능 줄기세포는 세포주 확립 후 70회 이하 계대 배양된 것을 이용하였다. 세포주 확립 후 70회 이하 계대 배양된, 인간 전분화능 줄기세포를 37℃, 5% CO2 세포배양기에서 유지배양을 진행하였다. 유지배양된 인간 전분화능 줄기세포는 단순 효소처리에 의해 배양 플레이트로부터 분리하였다. 그리고, 배상체 형성을 통해, 낭성(Cystic) 배상체만 선별하였다. 세포투과성 3차원 배양삽입체를 새로운 배양 플레이트(6 well plate)에 결합시키기 전, 배양시 최초 1회에 한하여, 새로운 배양플레이트에 먼저 2ml의 배양액을 넣었다. 그리고, 2ml의 배양액을 포함한 배양 플레이트에 세포투과성 3차원 배양삽입체를 결합시켰다. 그 후, 세포투과성 3차원 배양삽입체 내에 2ml의 배양액을 추가로 넣고, 선별된 낭성 배상체를 결합된 세포 투과성 3차원 배양삽입체 위에 로딩하였다. 새로운 배양 플레 이트에 넣은 배양액과 세포투과성 3차원 배양삽입체 내의 배양액은 EGM-2MV를 사용하였다. 낭성 배상체가 로딩된 세포투과성 3차원 배양삽입체 내의 배양액을 이틀동안 교체하지 않고 배상체를 배양하였다. 이후, 배양액을 제거하고, 세포투과성 3차원 배양삽입체 내에만 4ml의 배양액을 추가로 넣고, 매일 배양액을 교체하여 유사 중간엽 줄기세포로의 분화를 유도하였다. 5-7일 동안 세포분화를 진행하였다. 상기 분리된 유사 중간엽 줄기세포에 있어서, 세포투과성 3차원 배양삽입체를 투과하여 세포투과성 3차원 배양삽입체의 아래로 이동한, 군집 형태의 세포를 분리하였다. 분리된 군집 중 다층(Multilayer) 형태의 군집은 기계적(mechanically)으로 제거하였다. 분리된 군집 중 단층(Monolayer) 형태의 군집만을 마이크로 파이펫 팁을 이용하여 가로 500μm 이하, 세로 500μm 이하의 크기로 잘라 균일화하여 선택적으로 배양하였다. 보다 바람직하게, 단층 형태의 군집은 가로와 세로 각각 100μm ~ 500μm의 크기로 균일화하여 유사 중간엽 줄기세포를 배양하였다. 5-7일 동안 배양 후, 군집으로부터 단일세포 형태로 뻗어 나오는 유사 중간엽 줄기세포만을 분리하고, 계대 배양하여 증식시켰다. 단일세포 분리 전, 단일세포 형태가 아닌 군집 및 상피세포 모양의 세포들은 마이크로 파이펫 팁으로 완전히 제거하였다. 분리된 단일세포는 새로운 배양 플레이트로 옮겨 계대 배양을 통해 증식을 유도하였다. 이때, 배양 배지는 EGM-2MV를 사용하였다. 군집 형태의 유사 중간엽 줄기세포가 세포투과성 3차원 배양삽입체 아래로 이동하면, 세포투과성 3차원 배양삽입체를 배양 플레이트로부터 분리하였다. 분리된 세포투과성 3차원 배양삽입체의 아래로 이동한 군집 형태의 유사 중간엽 줄기세포를 수득한 후 다층(Multilayer) 형태의 군집은 기계적으로 제거하고, 단층(Monolayer) 형태의 군집의 크기를 균일화하여 선택적 배양하여 M-MSC를 수득하였다.
이에, 본 발명에서 제공되는 세포 치료제로서 M-MSC는 (a) 인간 전분화능 줄기세포를 70회 이하 계대 배양하는 단계; (b) 상기 인간 전분화능 줄기세포를 분화 유도한 배상체 중 낭성 배상체를 선별하는 단계; (c) 상기 낭성 배상체를 세포투과성 3차원 배양삽입체의 상부에 로딩하고 상기 배양삽입체의 하부로 이동한 중간엽 줄기세포의 군집을 분리하는 단계; 및 (d) 상기 분리된 중간엽 줄기세포의 군집 중 단층 형태의 군집만을 분리하는 단계;를 수행하여 수득되는 중간엽중길세포인 것이 바람직하다.
본 발명에서 세포치료제는 상술한 질환의 예방 또는 치료를 위한 약학적 조성물로 제공될 수 있다.
본 발명에서 "세포치료제"는 개체로부터 분리, 배양 및 특수한 조작을 통해 제조된 세포 및 조직으로 치료, 진단 및 예방의 목적으로 사용되는 의약품(미국 FDA규정)으로서, 세포 혹은 조직의 기능을 복원시키기 위하여 살아있는 자가, 동종, 또는 이종 세포를 체외에서 증식 선별하거나 다른 방법으로 세포의 생물학적 특성을 변화시키는 등의 일련의 행위를 통하여 치료, 진단 및 예방의 목적으로 사용되는 의약품을 의미한다.
본 발명에서 중간엽줄기세포의 유래가 되는 인간 전분화능 줄기세포는 전분화능(pluripotency)을 가지는 줄기세포라면 제한되지 아니하며, 그 비제한적 예로 상기 전분화능 줄기세포는 배아줄기세포(ESC) 및/또는 유도만능 줄기세포(iPSC)일 수 있다. 본 발명의 구체적인 실험에서는 배아줄기세포 유래의 중간엽줄기세포(ESC-MSC)를 이용하였으며, 본 명세서에서 배아줄기세포는 전분화능 줄기세포의 일 예시로서 본 발명은 이에 제한되지 아니하고, 본 명세서에서 용어 ESC-MSC는 M-MSC와 혼용될 수 있다.
또한, 본 발명의 M-MSC는 적당한 담체와 혼합되어 근육 염증 또는 염증을 동반한 근육 질환의 예방 또는 치료를 위한 약학적 조성물로 제공될 수 있다.
본 발명에서 용어, "예방"은 본 발명의 조성물의 투여로 근육에서 염증의 발생, 확산 또는 재발을 억제시키거나 지연시키는 모든 행위를 의미하고, "치료"는 본 발명의 조성물의 투여로 상기 질환의 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에서 "약학적 조성물"은 질병의 예방 또는 치료를 목적으로 제조된 것을 의미하며, 각각 통상의 방법에 따라 다양한 형태로 제형화하여 사용될 수 있다. 예컨대, 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽 등의 경구형 제형으로 제형화할 수 있고, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있으나, 국소 투여에 용이하도록 주사제로 제형화될 수 있다.
또한, 각각의 제형에 따라 약학적으로 허용가능한 담체, 예컨대 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제, 기제, 부형제, 윤활제 등 당업계에 공지된 담체를 추가로 포함하여 제조할 수 있다.
한편, 본 발명의 약학적 조성물은 약학적으로 유효한 양으로 투여할 수 있다. 본 발명의 용어 "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분하며 부작용을 일으키지 않을 정도의 양을 의미하며, 유효용량 수준은 환자의 건강상태, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 방법, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에서 용어, “개체”는 쥐, 가축, 생쥐, 인간 등 포유류일 수 있으며, 구체적으로 근육조직 내의 염증반응 조절 또는 지방 세포 침윤을 억제할 필요한 반려견, 경주마, 인간 등일 수 있으며, 바람직하게는 인간일 수 있다. 본 발명의 M-MSC를 세포치료제로 인간에 투여하는 경우 상기 줄기세포는 세포치료제를 투여하게 될 환자 자신의 것이나 타인 유래의 것일 수 있다.
대표적인 것은 주사용 제형으로 등장성 수용액 또는 현탁액이 바람직하다. 주사용 제형은 적합한 분산제 또는 습윤제 및 현탁화제를 사용하여 당업계에 공지된 기술에 따라 제조할 수 있다. 예를 들면, 각 성분을 식염수 또는 완충액에 용해시켜 주사용으로 제형화 될 수 있다. 또한, 경구 투여용 제형으로는 예를들면 섭취형 정제, 협측 정제, 트로키, 캡슐, 엘릭시르, 서스펜션, 시럽 및 웨이퍼 등이 있는데, 이들 제형은 유효성분 이외에 희석제(예: 락토즈, 덱스트로즈, 수크로즈, 만니톨, 솔비톨, 셀룰로즈 및/또는 글리신)와 활탁제(예: 실리카, 탈크, 스테아르산 및 그의 마그네슘 또는 칼슘염 및/또는 폴리에틸렌 글리콜)를 포함할 수 있다. 상기 정제는 마그네슘 알루미늄 실리케이트, 전분페이스트, 젤라틴, 트라가칸스, 메틸셀룰로즈, 나트륨 카복시메틸셀룰로즈 및/또는 폴리비닐피롤리딘과 같은 결합제를 포함할 수 있으며, 경우에 따라 전분, 한천, 알긴산 또는 그의 나트륨 염과 같은 붕해제, 흡수제, 착색제, 향미제 및/또는 감미제를 추가로 포함할 수 있다. 상기 제형은 통상적인 혼합, 과립화 또는 코팅 방법에 의해 제조될 수 있다.
또한, 본 발명의 약학적 조성물은 방부제, 수화제, 유화 촉진제, 삼투압 조절을 위한 염 또는 완충제와 같은 보조제와 기타 치료적으로 유용한 물질을 추가로 포함할 수 있으며, 통상적인 방법에 따라 제제화 될 수 있다.
본 발명에 따른 약학적 조성물은 경구, 경피, 피하, 정맥 또는 근육을 포함한 여러 경로를 통해 투여될 수 있으며, 인간 배아줄기세포 유래 중간엽줄기세포(M-MSC)투여 경로, 환자의 연령, 성별, 체중 및 환자의 중증도 등의 여러 인자에 따라 적절히 선택될 수 있으나, 바람직하게는 1일 1회 이상으로 투여되는 개체의 단위 체중(1kg)당 1 × 107 내지 5 × 107 개의 세포가 투여될 수 있다.
또한, 본 발명의 조성물은 목적하는 효과를 상승시킬 수 있는 공지의 화합물과도 병행하여 투여할 수 있다
본 발명의 약학적 조성물에 있어서, 본 발명에 따른 M-MSC의 총 유효량은 단일 투여량(single dose)으로 환자에게 투여될 수 있으며, 다중 투여량(multiple dose)이 장기간 투여되는 분할 치료 방법(fractionated treatment protocol)에 의해 투여될 수 있다. 본 발명의 약학적 조성물은 질환의 정도에 따라 유효성분의 함량을 달리할 수 있으나, 통상적으로 성인을 기준으로 1회 투여 시 1 × 107 내지 5 × 107 개 세포의 유효용량으로 하루에 1회 이상 투여될 수 있으며, 1일 1회 반복 투여될 수 있다.
또한, 본 발명의 약학적 조성물은 유효성분으로서 M-MSC 이외에 공지된 근육의 재생을촉진하거나 염증반응을 억제하고 조직 내의 지방 침윤을 감소시키는 공지의 제제를 추가로 포함할 수 있고, 이들 질환의 치료를 위해 공지된 다른 치료와 병용될 수 있다.
이하에서, 첨부된 도면을 참조하여 실시예들을 상세하게 설명한다. 그러나, 실시예들 에는 다양한 변경이 가해질 수 있어서 특허출원의 권리 범위가 이러한 실시예들에 의해 제한되거나 한정되는 것은 아니다. 실시예들에 대한 모든 변경, 균등물 내지 대체물이 권리 범위에 포함되는 것으로 이해되어야 한다.
실시예에서 사용한 용어는 단지 설명을 목적으로 사용된 것으로, 한정하려는 의도로 해석되어서는 안된다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 명세서에서, "포함하다" 또는 "가지다" 등의 용어는 명세서 상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.
다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 실시예가 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.
또한, 첨부 도면을 참조하여 설명함에 있어, 도면 부호에 관계없이 동일한 구성 요소는 동일한 참조부호를 부여하고 이에 대한 중복되는 설명은 생략하기로 한다. 실시예를 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 실시예의 요지를 불필요하게 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.
[실험 재료 및 방법]
1. M-MSC의 RNA 분석
M-MCS를 BM-MSC 및 AD-MSC와 비교하기 위하여 RNA 시퀀싱(RNA-sequencing, R-seq)을 수행하였다. 먼저 GeneAll® Ribospin™(GeneAll, Seoul, Korea)을 사용하여 제조업체의 프로토콜에 따라 M-MCS에서 total RNA를 추출한 다음 모든 RNA 샘플을 우수한 품질로 결정하였다. TruSeq Stranded mRNA 샘플 준비 가이드, 파트 #15031047 Rev. E(Illumina Inc.)에 따라 TruSeq Stranded mRNA LT 샘플 준비 키트(Illumina Inc., San Diego, CA, USA)를 사용하여 표준 절차에 따라 라이브러리를 생성하였다. 라이브러리는 시퀀서 NovaSeq(Illumina Inc.)에서 NovaSeq 6000 시스템 사용자 가이드 문서 #1000000019358 v02(Illumina Inc.)에 따라 NovaSeq 6000 S4(Illumina Inc.)에서 시퀀싱하였다. 5개 생물학적 샘플의 M-MCS에 대한 R-seq 데이터 세트를 구축하였다.
개선된 R-seq 정보는 BBDuk(BBtools)를 사용하여 Phred 품질 점수에서 평균 Q20 98% 및 평균 Q30 95% 이상의 값으로 유지되었다. 나머지 정보는 Bowtie2 10을 사용하여 참조 게놈 서열(University of California Santa Cruz(UCSC) hg19, annotation RefSeq_2017_06_12)에 매핑되었다. R-seq 라이브러리 계산은 Bedtools(https://bedtools.readthedocs.io/en/latest/)를 사용하였다. 리드 매핑(Read mapping) 및 발현 정량화는 각 샘플에 대해 별도로 수행되었다.
NCBI GEO(National Center for Biotechnology Information Gene Expression Omnibus), BM-MSC의 전사체 데이터(GEO 번호: GSE166327의 GSM5068578 및 GSM5068579; GSE4의 GSM2934991 및 GSM2934992: GSE109181의 GE48) GSE159137)에서 GSM4820187 및 GSM4820190을 얻었다. 그리고, 각 MSC의 유전자 발현 수준을 R 4.0.3(The R Foundation for Statistical Computing c/o Institute for Statistics and Mathematics, Vienna, Austria)을 사용하여 분위수 정규화하였다.
2. AD MSC와 M-MSC의 전사체 비교 분석
피어슨 r 상관계수(Pearson product-moment correlation coefficient rho) 및 이의 유의 수준은 R 통계 프로그래밍 언어에서 rcorr() 함수와 chart.Correlation() 함수를 사용하여 계산되었으며 상관도는 R 패키지를 사용하여 플롯하였다. 연관성의 강도는 다음과 같이 결정하였다(Mukaka, M. M., Statistics corner: A guide to appropriate use of correlation coefficient in medical research. Malawi Med J 2012, 24 (3), 69-71): 0.90에서 1.00, 매우 높은 상관관계; 0.70 ~ 0.90, 높은 상관관계; 0.50 ~ 0.70, 중간 정도의 상관관계; 0.30 ~ 0.50, 낮은 상관관계; 및 0.00 ~ 0.30, 무시할 수 있는 상관 관계. 또한, 주성분 분석(principal component analysis, PCA)을 수행하여 M-MCS, BM-MSC 및 AD-MSC 간의 다차원적 변동을 시각화하고 정량화하였다. R 통계 프로그래밍 언어에 있는 prcomp() 함수를 사용하여 주성분을 계산하고 R 패키지의 autoplot()(pam) 함수를 사용하여 플로팅하였다.
M-MCS에서 상향 조절된 차등 발현 유전자(Upregulated differentially expressed genes, DEG)는 BM-MSC 또는 AD-MSC보다 4배 더 높은 배수 변화(fold changes, FC)를 기반으로 선택하였고, 하향 조절된 DEG는 0.25배 더 낮은 FC를 기반으로 선택하였다. 선택된 DEG에 대해, Java script 1.8.0_162(Oracle Corporation, Santa Clara, CA, USA) 12. ClueGo 분석은 GO_BiologicalProcess-EBI-UniProt-GOA-ACAP-ARAP_08.05.2020_00h00: 17972에 대한 Gene Ontology (GO)에 통합하였다(The European Bioinformatics Institute, EMBL-EBI, Cambridgeshire, UK). 경로의 제한(pathway's restriction)은 p<0.05로 설정되었으며 최소 4에서 최대 6까지의 GO 트리 간격을 사용하여 GO term을 지정하였다. 연관성 점수(Kappa Score)는 0.4로 설정하고 GO의 최소 유전자 수는 3으로 설정하였다.
특정 GO에 대한 추가 분석은 GO term GO: 0043069 '계획된 세포 사멸의 음성 조절(negative regulation of programmed cell death)'(EMBL-EBI) 및 GO 용어 WP2328 '동종 이식 거부(Homo sapiens)'(WikiPathways)으로 수행하였다. 특정 GO과 관련하여 M-MCS의 유전자는 BM-MSC 또는 AD-MSC에 대해서 log2-FC로 변환하였다. 이어서, 품질 임계값 클러스터링(Quality Threshold Clustering, QTC)은 피어슨 연관 매트릭스으로 클러스터 직경 0.5에서 각 클러스터당 최소 5개 유전자에 TIGR MultiExperiment Viewer(MeV) 4.9.0(TM4 Software Suite, USA)을 사용하여 적용하였다.
3. M-MCS, BM-MSC, 및 AD-MSC의 혼합 림프구 반응(Mixed lymphocyte reaction, MLR)
비장세포는 10mL RPMI 1640 배지로 분해하여 마우스 비장에서 분리하였다. 적혈구를 RBC 용해 완충액(Roche, Germany)으로 용해한 후 RPMI 1640으로 3회 세척하였다. 자극기 비장세포(107 cells/mL)를 37°C에서 1시간 동안 10μg/mL 미토마이신 C로 처리한 다음 FBS 함유 RPMI 1640 배지로 세척하였다. BALB/c 마우스의 responder 비장세포와 상이한 strain의 마우스에 stimulator 비장세포를 10% FBS, 2mM 글루타민(glutamine), 100U/mL 페니실린(penicillin) 및 100μg/mL 스트렙토마이신(streptomycin), 1mM 피루브산나트륨(sodium pyruvate), 20mM HEPES 및 50uM 2-메르캅토에탄올(2-mercaptoethanol)를 함유하는 RPMI 1640에 재현탁하였다. 각 responder 및 stimulator 세포 집단은 96-웰에서 105cells/100μL/well의 농도로 삼중으로 시딩하였다. MSC는 또한 300μL 최종 부피를 얻기 위해 동일한 수만큼 MLR에 추가하였다. 미토겐(mitogen) 증식 분석에서 responder 비장세포를 5㎍/mL 콘카나발린 A(concanavalin A)와 함께 인큐베이션하였다. 5일 후, 반응 세포의 증식을 CCK 분석을 통해 측정하였다.
4. 회전근개 파열(Rotator cuff tear, RCT) 마우스 모델
모든 동물 실험은 식품의약품안전처로부터 실험실용 동물관리 인증을 받은 건국대학교 동물실험실 운영위원회(IACUC 승인번호 KU20008)의 관련 지침 및 규정에 따라 수행하였다.
총 160마리의 7주령 Sprague Dawley(SD) 쥐를 ORIENT Bio Inc.(경기, 한국)에서 구입하고, 1주일 동안 적응시킨 후 8주령(250g)에 사용하였다. 실험기간 동안 모든 쥐에게 수돗물과 펠렛(Altromin, Lage, Germany)을 임의로 제공하였다. 모든 동물은 22 ± 2°C의 온도와 55 ± 5%의 습도 및 12시간/12시간의 명암 주기로 생육하였다.
RCT 모델은 이전의 연구 방법 따라 일부 수정을 통해 제작하였다 (Lee, Y. S.; Kim, J. Y.; Kim, K. I.; Ki, S. Y.; Chung, S. W., Effect of Fatty Acid-Binding Protein 4 Inhibition on Rotator Cuff Muscle Quality: Histological, Biomechanical, and Biomolecular Analysis. Am J Sports Med 2019, 47 (13), 3089-3099). 구체적으로, 122마리의 쥐를 무작위로 20개 그룹(M-MSC, BM-MSC, 대조군, 각 시간에 대해 정상; n = 8)으로 나누고 Isoflurane으로 마취한 후 힘줄을 박리하였다. 오른쪽 어깨에서 외측 피부 절개를 하여 상완골의 대결절로 삽입되는 극상근(supraspinatus muscles)과 극하근(infraspinatus muscles)을 노출시켰다. RCT 모델은 극상근과 극하근을 부분적으로 분리하고 대결절과 극하근에서 극상근과 극하근을 절단하여 제작하였다. 수술 후 M-MSC, BM-MSC 및 HDF를 극상근 및 극하근에 동물당 3x106 cells로 주입하였다. 힘줄에는 더 이상의 처치 없이 절개한 피부를 6-0 나일론 봉합사로 봉합하였다. 마우스는 활동 제한 없이 케이지에서 사육하였고, 수술 후 24시간, 72시간, 7일, 4주, 8주에 각각의 쥐를 CO2 가스 흡입시켜 희생하였다.
5. Dil 염색을 이용한 생체 내 세포 장기 추적
M-MSC, BM-MSC, hDF 세포를 100mm 접시에 부착하여 배양한 후 밀도가 90%가 되면 배지를 제거하고 DPBS로 세척하였다. Cell Tracker™ CM-DiI 염료(Thermo fisher, Waltham, MA, US) 스톡을 제조업체에서 권장하는 대로 준비하고, 스톡을 DPSB에 1 μM으로 희석여고 세포 배양 접시에 첨가하였다. 이어서, 37°C에서 15분 동안 배양한 다음 4°C에서 15분 동안 추가 배양하였다. 이후 염색 용액을 제거하고 DPBS로 2회 세척한 후 트립신을 이용하여 세포를 분리하였다. 세포 현탁액을 원심분리하여 3x106 세포로 조정하고 수술 시 200 ㎕를 준비하여 주입하였다. 24시간, 72시간, 7일, 4주 및 8주에 샘플링한 후 파라핀 절편을 수행하고 표지된 세포를 현미경(Eclipse Ti, Nikon, Tokyo, Japan)을 사용하여 모니터링하였다.
6. 그립 강도 측정
쥐의 앞다리 악력을 평가하기 위해 악력 측정기(Bio-GS3, BioSeb, Vitrolles, France)를 사용하였다. 쥐의 꼬리를 들어 올려 digital force gauge에 부착된 메쉬를 잡도록 유도하였다. 메쉬는 1 제곱인치 격자 그리드(grid)가 있으며 3 × 4.75 제곱인치 크기이다. 그리드의 막대는 1/8 인치 두께였습니다. 메쉬는 수평으로 배향되었다. 꼬리를 잡고 그물망 위로 마우스를 부드럽게 들어올린 다음 꼬리, 몸, 앞다리를 일직선으로 유지하면서 망사를 잡기 위해 손을 뻗었을 때 꼬리, 몸, 앞다리가 망에 수직으로 유지되는 동안 망사 쪽으로 낮추었다. digital force gauge의 장력 판독값은 쥐가 그물을 풀기 전의 그립 강도로 정의하였다. 각 쥐에 대해 3회의 연속 테스트를 수행하고 평균 최대 사지 근력 값(g)을 얻었다. 수술 후 24시간, 72시간, 7일, 4주, 8주에 측정하였으며, 정상 측정값에 도달한 값을 백분율로 정의하였다.
7. 생체 내에서 근육의 생리적 상태 모니터링 : RT-qPCR 분석
GeneAll® Ribospin™ (GeneAll, Seoul, Korea)을 이용하여 극상근과 극하근에서 Total RNA를 추출하였다. 그런 다음 AccuPower® RT PreMix(Bioneer, 대전, 한국)를 사용하여 추출된 total RNA를 주형으로 사용하여 첫 번째 가닥 cDNA를 합성하였다. 제조업체의 프로토콜에 따라. 생성된 cDNA는 AccuPower® 2X GreenStar™ qPCR Master Mix(Bioneer, 대전, 한국)를 사용하여 qPCR을 수행하였다. GAPDH, IL-1b, IL-6, TNF-a, Cox2, Ngf, Ptges, Ppar-r, MyoD, Myf5 및 cebpa의 증폭에 대한 프라이머 서열은 하기 표 1과 같다. 모든 프라이머는 마크로젠(서울, 한국)에서 구입하였다. 각 샘플의 주기 임계값(Ct) 값은 내부 대조군으로서 GAPDH의 값으로 정규화되었다(ΔCt = Cttarget 유전자 - CtGAPDH). 비교 대상 유전자 발현의 상대적 배수 변화는 비교 2-ΔΔCt 방법(ΔΔCt = ΔCtM-MSC - ΔCtcontrol)으로 결정하였다.
Gene Forward Reverse
GAPDH tgccactcagaagactgtgg ttcagctctgggatgacctt
Tnf-a tcgtagcaaaccaccaagca cccttgaagagaacctgggagta
IL-6 tgatggatgcttccaaactg gagcattggaagttggggta
IL-1b cttgtcgagaatgggcagtct tgtgccacggttttcttatgg
Cox2 acgcctgagtttctgacaaga taagttggtgggctgtcaatc
Ptges gtggaagtagggtgccatgt cagtctttggaggagccaag
Pparg cggtttcagaagtgccttgc ccgccaacagcttctcctt
Myod1 ccagagctgatctttgagtgg cctgttacacccgagatctga
Myf5 aatgcaatccgctacattgag agggcagtagatgctgtcaaa
Cebpa ggccaagaagtcggtggata ccaaggagctctcaggcag
8. 항체 기반 단백질 마이크로어레이
MMSC, BM-MSC 또는 hDF로 처리된 RCT 모델의 전체 근육 조직을 정상 쥐와 비교하기 위해 수술 후 72시간에 절제하였다. 반정량적 단백질 항체 어레이(semi-quantitative protein antibody array)를 위하여 근육 조직에서 단백질(1300~1800μg)을 추출하였다. Rat L2 Antibody Array 슬라이드(RayBiotech Inc., Norcross, GA, USA)를 실온에서 2시간 동안 건조시키고 400μL의 차단 용액과 함께 실온에서 30분 동안 배양하였다. 각 서브 어레이로부터 차단 완충액을 따라낸 후, 희석된 샘플 400μL를 첨가하고 실온에서 2시간 동안 인큐베이션하였다. 샘플을 따라낸 후, 각 어레이를 800 μL의 1X 세척 완충액 I로 실온에서 5분 동안 흔들면서 3회 세척하였다. 유리 칩 어셈블리를 용기에 넣고 두 번 흔들면서 전체 유리 칩을 10분 동안 잠기도록 충분한 1X 세척 완충액 I을 첨가하였다. 1X 세척 완충액 II를 사용한 고급 세척 단계를 반복하였다. 1X biotin-Conjugated Anti-Cytokine 항체를 준비하여 상온에서 2시간 동안 부드럽게 흔들어 주면서 인큐베이션하고 150 μL의 1X 세척 완충액 I으로 흔들어주면서 실온에서 세척하였다. 1X Cy3-Conjugated Streptavidin 스톡 용액을 첨가하고 부드럽게 흔들면서 실온에서 2시간 동안 인큐베이션하고, 실온에서 10분 동안 1X 세척 완충액 I로 두 번 세척하였다. 세척 후 슬라이드는 플라스틱 세척병을 사용하여 탈이온수로 헹구고 1000rpm에서 3분 동안 원심분리하여 물을 제거하였다.
슬라이드 스캐닝은 GenePix 4100A 스캐너(Axon Instrument Inc., Foster City, CA, USA)를 사용하여 수행하였다. 슬라이드는 스캔 전에 완전히 건조되었고 24-48시간 이내에 스캔하였다. 슬라이드는 10μm 해상도, 최적의 레이저 출력 및 PMT로 스캔되었다. 스캔한 이미지를 얻은 후 GenePix Software(Axon Instrument Inc., Foster City, CA, USA)로 격자를 만들고 정량화하였다. 분석 후 단백질 정보에 대한 데이터는 UniProt DB를 이용하여 주석을 달고 변위치(quantile) 정량화하였다.
9. 생체 내 근육의 조직병리학적 분석
조직병리학적 변화를 평가하기 위해 각 랫트의 극상근과 극하근을 새로 절제하여 10% 중성 완충 포르말린(neutral buffered formalin)으로 24시간 동안 고정하였다. 조직은 일반적인 조직 기술을 사용하여 처리되고 파라핀에 포매하였다. 파라핀이 포함된 표본을 5μm 두께의 섹션으로 절단하고 각 섹션을 접착 현미경 슬라이드(Marienfeld, Lauda-K
Figure PCTKR2023009105-appb-img-000001
nigshofen, Germany)로 옮겼다. 탈파라핀화된 근육 절편은 헤마톡실린 및 에오신(hematoxylin and eosin, H&E), 마손의 트크롬(masson's trchrome, MT), 톨루이딘 블루(Toluidine blue)로 염색하였다. 또한, 항-CD68 항체(Abcam, Cambridge, UK)를 사용하여 면역조직화학적 염색을 수행하였다. 그런 다음 모든 염색된 섹션을 광학 현미경(Eclipse Ti, Nikon, Tokyo, Japan)으로 검사하여 비만 세포(mast cell) 침윤 및 CD68 양성 대식세포(macrophage) 침윤을 포함한 조직학적 변화를 평가하였다. 동물 당 3개의 섹션이 조직학적 검사에 사용되었다.
10. 통계 분석
qPCR의 데이터는 평균 ± SEM으로 표시하였고, qPCR 데이터 외의 데이터는 평균 ± SD로 나타내었다. 모든 통계 분석은 GraphPad Prism(v.5, GraphPad software., San Diego, CA, USA)을 사용하여 수행하였다. P 값이 0.05 미만일 때 통계적으로 유의한 것으로 판단하였다.
[실험 결과]
실시예 1. M-MSC의 전사체와 및 M-MSC와 혼합 림프구 반응
M-MSC, BM-MSC 및 AD-MSC의 샘플에 대하여 M-MSC를 기준으로 설정하여 PCA를 수행하였다(도 1(A)). BM-MSC와 AD-MSC의 샘플은 배치 다양성으로 인해 서로 교차하는 경향이 있는 반면 M-MSC는 세포주 일관성으로 단일 클러스터를 생성하였다. 한편, M-MSC는 도 1B와 같이 전반적으로 BM-MSC와 유의한 상관관계를 확인할 수 있었다(correlation efficient, r = 0.42 ± 0.05). 그러나 M-MSC와 AD-MSC 사이에는 거의 상관관계가 없었다(r = 0.25 ± 0.02).
adult MSC와 비교한 M-MCS의 특성은 DEG 분석을 통해서도 확인할 수 있었다(도 2 및 도 3).
도 2(a) 및 도 3(A)에서 BM-MSC와 비교하여 M-MCS에서 상향 조절된 유전자는 다음과 같은 일반적인 EMBL-EBI GO term이다: (1) GO:0050919 'negative chemotaxis', (2) GO:0048762 'mesenchymal cell differentiation', (3) GO:0042060 'wound healing', (4) GO:0061041 'regulation of wound healing', (5) GO:0021882 'regulation of transcription from RNA polymerase II promoter', 및 (6) GO:1902292 'cell cycle DNA replication initiation. 상기 M-MCS에서 상향 조절된 유전자는 염증을 억제하고 근육 조직 복구에 관여하는 GO에 속함을 알 수 있었다.
BM-MSC와 비교하여 M-MCS에서 하향 조절된 유전자에는 (7) GO:0006342 'chromatin silencing', (8) GO:0016458 'gene silencing', 및 (9) GO:0097501 'stress response to metal ion'과 같은 일반적인 GO term이 포함되었다(도 2(b) 및 도 3(B)).
또한, 도 2(c) 및 도 3(C)에서 볼 수 있듯이 AD-MSC와 비교하여 M-MCS에서 상향 조절된 유전자는 일반적으로 아래와 같이 염증을 하향 조절하는 GO에 속한다: (10) GO:0050922 'negative regulation of chemotaxis', (11) GO:0060850 'regulation of transcription involved in cell fate commitment', and (12) GO:0008330 'protein tyrosine/threonine phosphatase activity'.
마지막으로, 도 2(d) 및 도 3(D)에서 볼 수 있듯이 AD-MSC와 비교하여 M-MCS에서 하향 조절된 유전자는 다음의 염증과 스트레스 반응과 관련된 GO term으로 확인되었다: (13) GO:0097501 'stress response to metal ion', (14) GO:0006935 'chemotaxis', (15) GO:1902622 'regulation of neutrophil migration', and (16) GO:0045736 'negative regulation of cyclin-dependent protein serine/threonine kinase activity'.
결과적으로 BM-MSC 및 AD-MSC와 비교하여 염증 관련 현상을 하향 조절하는 GO 관련 유전자는 M-MCS에서 상향 조절되고 동시에 염증 세포 관련 경로 및 스트레스 반응 GO 관련 유전자는 하향 조절됨을 알 수 있다.
한편, 이식을 위한 세포 치료제로서 적용 가능성을 확인하기 위하여 특정 GO에 대하여 M-MCS의 특성을 adult-MSC과 비교하여 분석한 결과는 도 4와 같다.
계획된 세포사멸의 음성 조절과 관련된 GO: 0043069(EMBL-EBI)에 대하여 M-MCS는 BM-MSC 및 AD-MSC와 비교하여 유전자 발현의 전반적인 증가 추세를 나타내었다. 동시에 동종이식 거부반응 관련 GO인 WP2328(WikiPathways)의 경우 M-MCS가 성체 MSC에 비해 전반적으로 감소하는 것으로 나타났다. 상기로부터, 성체 MSC와 비교하여 M-MCS는 이식 시 세포사멸 수준이 낮고 거부 반응이 적음을 알 수 있었다.
M-MSC가 다른 성체 MSC에 비해 낮은 면역원성을 갖는지 확인하기 위해 혼합 림프구 반응을 수행한 결과는 도 5에 나타내었다. 모든 MSC는 stimulator 비장세포에 의해 유도된 responder 비장세포의 제한된 활성을 나타내었다. M-MSC는 AD-MSC보다 현저하게 낮은 수준의 면역 거부 반응을 나타내었고, gold standard BM-MSC과 유사한 수준의 면역원성을 나타내었다.
NGS 및 MLR의 결과에 기초하여 면역원성이 낮은 M-MSC 및 BM-MSC를 RCT 치료 후보로 설정하였다.
실시예 2. RCT 마우스 모델에서 악력 테스트 결과
투여된 각 MSC가 RCT 유도 마우스에 미치는 효과를 확인하고자 투여시간 및 투여세포를 달리한 실험 동물의 악력을 비교하였다. 모든 값은 정상 그룹의 값에 대한 백분율로 표시하였다. 수술 24시간 후와 72시간 후에는 모든 실험동물에 유의한 차이를 확인할 수 없었으나 7일째부터 MSC를 투여한 동물에서 HDF를 투여한 동물보다 빠른 근육 회복을 확인할 수 있었다. M-MSC 투여군은 BM-MSC 투여군보다 유의한 차이를 나타내었다(도 6). M-MSC 투여군은 7일 째에 정상군과 유사한 수준으로 회복하였으나, BM-MSC는 8주 후에 정상군과 유사한 수준으로 회복되었다. 상기 결과로부터 M-MSC가 BM-MSC보다 현저하게 빠르게 근육 회복 효과를 나타냄을 알 수 있었다.
실시예 3. RCT 마우스 모델의 근육에 대한 H&E 및 MT 염색을 통한 형태학적 분석
조직학적 분석을 위하여 H&E 및 MT 염색을 수행하였다. 지방 침윤, 조직학적 위축 및 섬유증은 H&E 염색을 통해 확인되었다. 극상근에서는 M-MSC 투여군에서 최대 7일까지 조직학적 위축이 관찰되었지만 섬유증이나 지방 침윤은 관찰되지 않았다. BM-MSC 투여군에서 지방 침윤은 4주에 약간 나타났지만 전반적으로 분명하지 않았다. 그러나 4주차까지는 BM-MSC 투여군에서 조직학적 위축과 근섬유화를 확인할 수 있었다. 8주차에는 조직학적 위축이 완전히 회복되지 않았다. hDF 투여군은 7일째부터 심각한 지방 침윤을 보였고, 72시간부터 8주차까지 섬유증과 근육 위축이 진행됨을 확인할 수 있었다(도 7a).
M-MSC 투여군은 4주차까지 극하근의 위축을 보였으나 7일째에는 섬유화 또는 지방침윤이 확인되었으며, 이는 M-MSC 투여군이 4주차부터 정상군에 접근할 수 있을 정도로 충분히 회복되었음을 시사한다. BM-MSC 투여군은 M-MSC 투여군과 유사하게 7일 후에 섬유증 또는 근육 위축이 회복되었다. 그러나 7일차부터 4주차까지는 심각한 지방침윤이 진행되었다. HDF 투여군의 경우 8주까지 근위축, 섬유성근육, 지방침윤이 관찰되었다(도 7b).
섬유증은 MT 염색으로 확인하였다. 극상근에서는 M-MSC군과 BM-MSC군이 정상군에 비해 유의한 차이를 보이며 72시간까지 전체 섬유화 면적의 약 20%를 차지하였다. 그러나, 최종적으로 섬유증 면적이 감소되어 거의 동일한 값으로 회복되었다. 이와 대조적으로, hDFs 군에서는 8주까지 상당한 범위의 섬유증이 확인되었다(도 7c (B1) 및 (B2)).
견갑하근에서는 M-MSC 투여군은 극상근의 결과와 유사하게 72시간까지 섬유증이 확인되었으나 7일째부터 감소하여 4주 후 정상군과 유사한 회복을 보였다. BM-MSC 투여군의 경우 7일째까지 M-MSC 투여군에 비해 섬유증이 유의하게 증가하고 4주차부터 감소하였다. hDF 투여군의 경우 4주차까지 섬유증이 지속되었으며, 7일 차에 섬유증이 최대였고, 8주 후에 정상군과 유사한 수준으로 감소하였다(도 7d (B3) 및 (B4)).
상기 H&E 및 MT 염색 결과로부터 RCT 모델에 M-MSC 투여 시 감소된 근육 위축, 섬유증 및 지방 침윤을 확인할 수 있었다.
실시예 4. TB 및 IHC 염색을 기반으로 한 염증 세포 계수
비만 세포 침윤은 TB 염색을 통해 확인되었다. M-MSC 투여군의 경우 극상근에서 보통 5개 미만의 비만세포가 발견되었으나 정상군과 유의한 차이는 없었다. 극하근에서는 24시간 째에 10개 미만의 비만세포가 발견되었으며 정상군과 약간 다른 양상을 보였다. 그러나 72시간 후에는 정상 그룹과 거의 또는 전혀 유의한 차이가 없었다. BM-MSC 투여군의 경우 정상군과 유의한 차이 없이 극상근에서 M-MSC와 유사한 수의 비만세포가 발견되었다. 72시간까지 극하근의 염증은 정상군과 유의한 차이가 없었고 비만세포가 확인되었다. HDF 투여군의 경우 7일까지 정상군에 비해 유의하게 많은 비만세포가 확인되어 수술 후 초기 단계의 실험동물에 영향을 미쳤다(도 8).
다음으로, CD68을 염색하여 대식세포 침윤을 확인하였다. M-MSC 투여군에서 대식세포는 극상근과 극하근 모두 72시간에서만 정상군과 유의한 차이를 보였다. HDF 투여군과 BM-MSC 투여군의 경우 72시간 후에도 대식세포가 검출되었고, 7일차에도 대식세포의 침윤이 확인되었다. 3개 실험 동물군 모두에서 24시간 째에는 극상근 및 극하근에서 대식세포가 거의 검출되지 않았으나, 72 시간 경과 후부터 극명한 차이를 나타내었다. 72시간 째에 모든 실험 동물의 극상근 및 극하근에서 대식세포의 증가를 확인하였으나 M-MSC 투여군은 다른 실험 동물군과 비교하여 보다 낮은 수준의 대식세포를 확인하였고, 각 실험 동물의 근육에서 대식세포 수는 8주차에 수렴하는 것으로 확인되었다(도 9).
상기로부터, M-MSC 투여군은 다른 그룹과 비교하여 보다 적은 수준의 염증반응을 나타냄을 알 수 있었다.
실시예 5. 염증, 지방 생성 및 근육 생성과 관련된 유전자 발현 수준 분석
행동 및 조직학적 평가를 기반으로 한 결과는 염증, 지방 생성 및 근육 합성과 관련된 9개의 대표적인 유전자의 RT-qPCR을 통해 정량화되었다.
극상근에서 TNF-a, IL-6, IL-1b, Cox2, 및 Ptges를 포함한 염증 유전자의 mRNA 발현은 7일까지 M-MSC 투여군에서 유의하게 감소하였다(도 10 (A1~A5)). 극하근에서 염증 유전자의 발현은 최대 4주까지 확립되었고, hDF 및 BM-MSC 투여군에 비해 M-MSC 투여군에서 유의한 발현 감소를 확인하여, M-MSC가 RCT에서 염증 반응을 빠르게 감소시킴을 알 수 있었다(도 11 (B1~B5)).
adipogenic 유전자의 발현에는 유의한 차이가 없었으나, Pparg의 농도는 72시간째 극상근과 극하근 모두에서 유의하게 감소하였다. 극상근에서는 Myod1에 차이가 없었으나 4주차부터 8주차까지 극하근에서는 유의한 차이가 있었다(도 10 (A6-A7), 도 11 (B6-B7)). myogenic 조절자인 Myf5의 mRNA 발현은 초기부터 후기까지 계속해서 유의하게 감소하였고, Cebpa의 경우 초기 7일까지 유의한 감소를 확인하였다(도 10 (A8-A9), 도 11 (B8-B9)). 상기 결과는 항체 어레이 결과와 일치한다(도 12).
상기 결과로부터, M-MSC는 염증, 지방 침윤 및 근육 손상을 억제함을 알 수 있었다.
실시예 6. 생체 내 MSC의 장기 추적
Cell Tracker™ CM-DiI 염료를 사용하여 각 세포를 염색한 후 수술 중 근육에 주입하고, 수술 후 세포 지속 시간과 근육에 대한 영향을 모니터링하였다(도 13b). 4주까지 3종 세포군 모두 근육에 남아있는 것을 확인하였다. 세포 수는 M-MSC, BM-MSC, hDF 순으로 남아 있었다. M-MSC와 BM-MSC는 최대 8주까지 근육내 관찰되었다(도 13a).
상기 결과로부터, M-MSC가 근육에 오랫동안 남아 있으면서 염증을 완화하고 근육 회복을 촉진함을 알 수 있다.
이상과 같이 실시예들이 비록 한정된 도면에 의해 설명되었으나, 해당 기술분야에서 통상의 지식을 가진 자라면 상기를 기초로 다양한 기술적 수정 및 변형을 적용할 수 있다. 예를 들어, 설명된 기술들이 설명된 방법과 다른 순서로 수행되거나, 및/또는 설명된 시스템, 구조, 장치, 회로 등의 구성요소들이 설명된 방법과 다른 형태로 결합 또는 조합되거나, 다른 구성요소 또는 균등물에 의하여 대치되거나 치환되더라도 적절한 결과가 달성될 수 있다.
그러므로, 다른 구현들, 다른 실시예들 및 특허청구범위와 균등한 것들도 후술하는 청구범위의 범위에 속한다.

Claims (11)

  1. 인간 전분화능 줄기세포로 유래 중간엽줄기세포를 유효성분으로 포함하는, 근육 염증 또는 염증을 동반한 근육 질환의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 인간 전분화능 줄기세포 유래 중간엽 줄기세포는 하기 단계를 수행하여 수득되는 것인, 약학적 조성물:
    (a) 인간 전분화능 줄기세포를 70회 이하 계대 배양하는 단계;
    (b) 상기 인간 전분화능 줄기세포를 분화 유도한 배상체 중 낭성 배상체를 선별하는 단계;
    (c) 상기 낭성 배상체를 세포투과성 3차원 배양삽입체의 상부에 로딩하고 상기 배양삽입체의 하부로 이동한 중간엽 줄기세포의 군집을 분리하는 단계; 및
    (d) 상기 분리된 중간엽 줄기세포의 군집 중 단층 형태의 군집만을 분리하는 단계.
  3. 제1항에 있어서,
    상기 조성물은 인간 전분화능 줄기세포 유래 중간엽줄기세포를 1 × 107 내지 5 × 107개/kg 포함하는 것인, 약학적 조성물.
  4. 제1항에 있어서,
    상기 조성물은 근육 세포에서 TNF-a, IL-6, IL-1b, Cox2, 및/또는 Ptges 유전자의 발현을 하향 조절하여 염증 반응을 감소시키는 것인, 약학적 조성물.
  5. 제1항에 있어서,
    상기 조성물은 근육 세포에서 Pparg 및/또는 Myod 유전자의 발현을 하향 조절하여 근육 조직에 지방 침윤을 감소시키는 것인, 약학적 조성물.
  6. 제1항에 있어서,
    상기 조성물은 근육 세포에서 Myf5 및 Cebpa 유전자의 발현을 상향 조절하여 근육 생성을 향상시키는 것인, 약학적 조성물.
  7. 제1항에 있어서,
    상기 조성물은 근육의 섬유화 및 위축을 억제 또는 예방하는 것인, 약학적 조성물.
  8. 제1항에 있어서,
    상기 근육은 회전증후군 또는 회전근개인 것인, 약학적 조성물.
  9. 제1항에 있어서,
    상기 염증을 동반한 근육 질환은 회전근개 파열인 것인, 약학적 조성물.
  10. 개체의 극상근 및 극하근에 인간 전분화능 줄기세포 유래 중간엽줄기세포를 투여하는 단계를 포함하는, 회전근개 파열의 치료 방법으로서,
    상기 개체는 인간을 제외한 포유동물인, 방법.
  11. 제10항에 있어서,
    상기 방법은 인간 전분화능 줄기세포 유래 중간엽줄기세포를 개체의 단위 체중(1kg)당 1 × 107 내지 5 × 107개를 1회 이상 투여하는 것인, 방법.
PCT/KR2023/009105 2022-06-29 2023-06-29 전분화능 줄기세포 기반 근육염증 또는 염증을 동반한 근육질환의 예방 또는 치료용 약학적 조성물 WO2024005564A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220079737A KR20240002487A (ko) 2022-06-29 2022-06-29 전분화능 줄기세포 기반 근육염증 또는 염증을 동반한 근육질환의 예방 또는 치료용 약학적 조성물
KR10-2022-0079737 2022-06-29

Publications (1)

Publication Number Publication Date
WO2024005564A1 true WO2024005564A1 (ko) 2024-01-04

Family

ID=89381154

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/009105 WO2024005564A1 (ko) 2022-06-29 2023-06-29 전분화능 줄기세포 기반 근육염증 또는 염증을 동반한 근육질환의 예방 또는 치료용 약학적 조성물

Country Status (2)

Country Link
KR (1) KR20240002487A (ko)
WO (1) WO2024005564A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130259843A1 (en) * 2010-05-27 2013-10-03 Georg Duda Skeletal muscle regeneration using mesenchymal system cells
CN109477072A (zh) * 2016-05-16 2019-03-15 埃克森蒂姆生物技术公司 间充质干细胞及其用于治疗肌肉损伤和肌肉相关疾病的用途
KR102192307B1 (ko) * 2020-06-30 2020-12-18 주식회사 미래셀바이오 유사 중간엽 줄기세포의 제조방법 및 이로부터 제조된 유사 중간엽 줄기세포
KR20220015637A (ko) * 2020-07-31 2022-02-08 서울대학교병원 근골격계 질환의 진단용 조성물, 근골격계 질환의 예방 또는 치료용 조성물 및 이의 용도
KR102391020B1 (ko) * 2019-04-30 2022-04-26 주식회사 파이안바이오테크놀로지 분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102280509B1 (ko) 2020-09-04 2021-07-22 건국대학교 글로컬산학협력단 전분화능 줄기세포 기반 자가면역성 및 염증성 피부질환 예방 또는 치료용 조성물 및 이의 제조방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130259843A1 (en) * 2010-05-27 2013-10-03 Georg Duda Skeletal muscle regeneration using mesenchymal system cells
CN109477072A (zh) * 2016-05-16 2019-03-15 埃克森蒂姆生物技术公司 间充质干细胞及其用于治疗肌肉损伤和肌肉相关疾病的用途
KR102391020B1 (ko) * 2019-04-30 2022-04-26 주식회사 파이안바이오테크놀로지 분리된 미토콘드리아를 유효성분으로 포함하는 근염 예방 또는 치료용 약학 조성물
KR102192307B1 (ko) * 2020-06-30 2020-12-18 주식회사 미래셀바이오 유사 중간엽 줄기세포의 제조방법 및 이로부터 제조된 유사 중간엽 줄기세포
KR20220015637A (ko) * 2020-07-31 2022-02-08 서울대학교병원 근골격계 질환의 진단용 조성물, 근골격계 질환의 예방 또는 치료용 조성물 및 이의 용도

Also Published As

Publication number Publication date
KR20240002487A (ko) 2024-01-05

Similar Documents

Publication Publication Date Title
Zhao et al. Novel therapeutic strategy for stroke in rats by bone marrow stromal cells and ex vivo HGF gene transfer with HSV-1 vector
Yelin-Bekerman et al. Hypocretin neuron-specific transcriptome profiling identifies the sleep modulator Kcnh4a
Zhang et al. Characterization of Lgr5+ progenitor cell transcriptomes after neomycin injury in the neonatal mouse cochlea
Hong et al. Stem cell aging in the skeletal muscle: The importance of communication
Calenda et al. Whole genome microarray of the major pelvic ganglion after cavernous nerve injury: new insights into molecular profile changes after nerve injury
Lackie et al. Modulation of hippocampal neuronal resilience during aging by the Hsp70/Hsp90 co‐chaperone STI1
Yin et al. Protective effects of CXCR3/HO‑1 gene‑modified BMMSCs on damaged intestinal epithelial cells: Role of the p38‑MAPK signaling pathway
WO2024005564A1 (ko) 전분화능 줄기세포 기반 근육염증 또는 염증을 동반한 근육질환의 예방 또는 치료용 약학적 조성물
Bhat et al. Attenuated transcriptional response to pro-inflammatory cytokines in schizophrenia hiPSC-derived neural progenitor cells
Mo et al. Prolactin affects the disappearance of ALV-J viremia in vivo and inhibits viral infection
Duan et al. CKLF1 aggravates neointimal hyperplasia by inhibiting apoptosis of vascular smooth muscle cells through PI3K/AKT/NF-κB signaling
Xiong et al. MicroRNA339 targeting PDXK improves motor dysfunction and promotes neurite growth in the remote cortex subjected to spinal cord transection
WO2023106615A1 (ko) 전분화능 줄기세포 기반 혈관성 인지장애 및 치매 예방 또는 치료용 조성물
WO2015056970A1 (ko) 프로그래뉼린 억제제를 유효성분으로 함유하는 골다공증 예방 또는 치료용 조성물
Ciechanowicz et al. Angiotensin 1–7 stimulates proliferation of lung bronchoalveolar progenitors-implications for SARS-CoV-2 infection. Cells. 2022; 11 (13)
WO2023243971A1 (ko) 키나아제 저해제를 유효성분으로 포함하는 탈수초성 질환 예방 또는 치료용 약학적 조성물
WO2018088821A1 (ko) 히스톤 탈아세틸화 저해제 및 프라이밍 인자를 유효성분으로 포함하는 줄기세포 활성 촉진용 조성물
WO2017176054A1 (ko) 줄기세포 배양용 배지조성물 및 그를 이용한 줄기세포 배양방법
Horvath et al. Cognitive rejuvenation in old rats by hippocampal oskm gene therapy
WO2015080376A1 (ko) 태반의 융모막 또는 와튼제대교질 유래 간엽줄기세포로부터 신경세포 및 유모세포를 분화시키는 방법
Jiang et al. Human‐like adrenal features in Chinese tree shrews revealed by multi-omics analysis of adrenal cell populations and steroid synthesis.
WO2022086276A1 (ko) 특정 유전자의 발현이 증가 또는 감소된 줄기세포를 유효성분으로 포함하는 류마티스 관절염 예방 또는 치료용 약학적 조성물
WO2024063484A1 (ko) CBFβ 발현 혈관평활근세포 또는 이의 배양액을 유효성분으로 포함하는 노인성 질환 예방 또는 치료용 약학 조성물
Chen et al. Profiling human hypothalamic neurons reveals a candidate combination drug therapy for weight loss
WO2021010745A2 (ko) 에티오나마이드를 이용한 줄기세포의 효능 강화방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23831922

Country of ref document: EP

Kind code of ref document: A1