Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
  • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
  • A61K47/12—Carboxylic acids; Salts or anhydrides thereof
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
  • A61K47/36—Polysaccharides; Derivatives thereof, e.g. gums, starch, alginate, dextrin, hyaluronic acid, chitosan, inulin, agar or pectin
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
  • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
  • A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/0012—Galenical forms characterised by the site of application
  • A61K9/0053—Mouth and digestive tract, i.e. intraoral and peroral administration
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
  • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
  • A61K9/51—Nanocapsules; Nanoparticles
  • A61K9/5107—Excipients; Inactive ingredients
  • A61K9/5123—Organic compounds, e.g. fats, sugars
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
  • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
  • A61K9/51—Nanocapsules; Nanoparticles
  • A61K9/5107—Excipients; Inactive ingredients
  • A61K9/513—Organic macromolecular compounds; Dendrimers
  • A61K9/5161—Polysaccharides, e.g. alginate, chitosan, cellulose derivatives; Cyclodextrin
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
  • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
  • A61K9/51—Nanocapsules; Nanoparticles
  • A61K9/5107—Excipients; Inactive ingredients
  • A61K9/513—Organic macromolecular compounds; Dendrimers
  • A61K9/5169—Proteins, e.g. albumin, gelatin
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2217/00—Genetically modified animals
  • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
  • A01K2217/054—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function
  • A01K2217/056—Animals comprising random inserted nucleic acids (transgenic) inducing loss of function due to mutation of coding region of the transgene (dominant negative)
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2227/00—Animals characterised by species
  • A01K2227/10—Mammal
  • A01K2227/105—Murine
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
  • A01K2267/00—Animals characterised by purpose
  • A01K2267/03—Animal model, e.g. for test or diseases
  • A01K2267/035—Animal model for multifactorial diseases
  • A01K2267/0375—Animal model for cardiovascular diseases
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
  • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
  • A61K48/0041—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
  • A61K48/0075—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the delivery route, e.g. oral, subcutaneous
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/10—Dispersions; Emulsions
  • A61K9/107—Emulsions ; Emulsion preconcentrates; Micelles
  • A61K9/1075—Microemulsions or submicron emulsions; Preconcentrates or solids thereof; Micelles, e.g. made of phospholipids or block copolymers
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/10—Dispersions; Emulsions
  • A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
  • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K9/00—Medicinal preparations characterised by special physical form
  • A61K9/10—Dispersions; Emulsions
  • A61K9/127—Synthetic bilayered vehicles, e.g. liposomes or liposomes with cholesterol as the only non-phosphatidyl surfactant
  • A61K9/1271—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers
  • A61K9/1272—Non-conventional liposomes, e.g. PEGylated liposomes or liposomes coated or grafted with polymers comprising non-phosphatidyl surfactants as bilayer-forming substances, e.g. cationic lipids or non-phosphatidyl liposomes coated or grafted with polymers
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/11—Antisense
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/32—Chemical structure of the sugar
  • C12N2310/323—Chemical structure of the sugar modified ring structure
  • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/34—Spatial arrangement of the modifications
  • C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end

Definitions

• the present disclosure relates to formulations for oral delivery of nucleic acids, such as therapeutic RNA (e.g., non-coding or coding RNA).
• nucleic acids such as therapeutic RNA (e.g., non-coding or coding RNA).
• the formulations enhance the oral bioavailability of such RNAs such that oral delivery, rather than delivery by, for example, injection allows for treatment of various diseases, in particular those marked by inflammation and/or fibrosis.
• a formulation for oral delivery of a nucleic acid comprising a nucleic acid, a cationic lipid, at least one casein protein, and a chitosan.
• the nucleic acid of the formulation comprises a ribonucleic acid (RNA), wherein the RNA is present in an amount ranging between 0.0001 and about 0.01% of the formulation by weight per volume.
• the at least one casein protein comprises at least an a-sl casein subunit that is present in an amount ranging between about 0.25 and about 7% of the formulation by weight per volume, the chitosan is present in an amount ranging between about 0.0001 and 4% of the formulation by weight per volume.
• a formulation for oral delivery of a nucleic acid comprising a plurality of artificial lipid micelles, a plurality of nucleic acids, wherein a portion of the nucleic acids are encapsulated within the artificial lipid micelles, and a coating on the artificial lipid micelles, wherein the coating comprises a mixture of casein proteins and chitosan polymers.
• the nucleic acid comprises a ribonucleic acid (RNA) and wherein the RNA is present in an amount ranging between about 0.00001 and about 0.05% of the formulation by weight per volume, the mixture of casein proteins and chitosan polymers comprises at least an a-sl casein subunit that is present in an amount ranging between about 0.5 and about 5% of the formulation by weight per volume, and wherein the chitosan is present in an amount ranging between about 0.001 and about 1% of the formulation by weight per volume.
• RNA ribonucleic acid
• the formulation further comprises an acid.
• the acid is present in an amount ranging between about 0.001 and about 1% of the formulation by volume and the acid is selected from acetic acid, citric acid, phosphoric acid and citric acid.
• the formulation further comprises acetic acid, wherein the acetic acid is present in an amount ranging between about 0.01 and about 1% of the formulation by weight per volume.
• the cationic lipid is present in an amount ranging from about 0.1 to about 5 microliters for each microgram of nucleic acid.
• the nucleic acid comprises a non-coding RNA, a coding RNA (e.g., mRNA), or a combination thereof.
• the chitosan is low molecular weight chitosan. In several embodiments, the low molecular weight chitosan ranges in mass from about 50 to about 190 kiloDaltons.
• the nucleic acid comprises a non-coding RNA or a coding RNA, wherein the RNA is present in an amount ranging from between about 0.001 and about 0.005% of the formulation by weight per volume, wherein the at least one casein protein comprises a mixture of an a-sl casein subunit, an a-s2 casein subunit, a b casein subunit, and a k casein subunit, wherein the casein subunits are present in an amount ranging between about 1 and 3% of the formulation by weight per volume, and wherein the chitosan is present in an amount ranging between about 0.01 and 0.1% of the formulation by weight per volume.
• the RNA is present in an amount ranging from between about 0.001 and about 0.005% of the formulation by weight per volume
• the at least one casein protein comprises a mixture of an a-sl casein subunit, an a-s2 casein subunit, a b casein subunit, and a k casein subunit, wherein
• the nucleic acid comprises a non-coding RNA or a coding RNA, wherein the RNA is present in an amount ranging from between about 0.0015 and about 0.004% of the formulation by weight per volume, wherein the mixture of casein subunits are present in an amount ranging between about 2 and 3% of the formulation by weight per volume, wherein the chitosan is present in an amount ranging between about 0.05 and 0.1% of the formulation by weight per volume, and wherein the cationic lipid is present in an amount ranging from about 1 to about 3 microliters for each microgram of nucleic acid.
• the nucleic acid comprises a non-coding RNA or a coding RNA, wherein the RNA is present in an amount ranging from between about 0.0015 and about 0.0035% of the formulation by weight per volume, wherein the mixture of casein subunits are present in an amount ranging between about 2.2 and 2.8% of the formulation by weight per volume, wherein the chitosan is present in an amount ranging between about 0.06 and 0.09% of the formulation by weight per volume, and wherein the cationic lipid is present in an amount ranging from about 1 to about 2 microliters for each microgram of nucleic acid.
• the RNA upon administration to a subject, the RNA reduces expression of one or more of IL1-B, IL-6, TGF beta, NLRP3, p21, and IL-4. In several embodiments, upon administration to a subject, the RNA reduces systolic blood pressure of the subject. In several embodiments, upon administration to a subject, the RNA reduces diastolic blood pressure of the subject. In several embodiments, upon administration to a subject, the RNA enhances muscular endurance, muscular resistance to fatigue, muscular strength and/or muscle contractility of at least one muscle of the subject. Depending on the embodiment the muscle may be skeletal muscle or cardiac muscle.
• the RNA upon administration to a subject, reduces the expression of brain natriuretic peptide.
• the RNA upon administration to a subject, reduces diastolic mitral inflow velocity to mitral annular tissue velocity (E/e’).
• the RNA upon administration to a subject, enhances glucose tolerance within the subject.
• the RNA upon administration to a subject, reduces obesity and/or subcutaneous adipose tissue per unit body mass of the subject.
• the RNA upon administration to a subject having had a myocardial infarction, reduces infarct size after the myocardial infarction.
• the RNA upon administration to a subject having had a myocardial infarction, reduces circulating cardiac troponin I concentration after the myocardial infarction.
• the formulation alleviates one or more symptoms of a disease associated with increased inflammation and/or fibrosis.
• the disease is selected from heart failure with preserved ejection fraction, myocardial infarction, muscular dystrophy, scleroderma, viral infection, and hypertrophic cardiomyopathy.
• the formulation comprises a nucleic acid having at least 90% sequence identity to one or more of SEQ ID NO: 1-25, 31, 32.
• the formulation comprises a nucleic acid that consists essentially of a sequence having at least 90% sequence identity to one or more of SEQ ID NO: 1-25, 31, 32.
• the formulation comprises one or more casein proteins having at least 80% sequence identity to one or more of SEQ ID NOs. 26-30.
• Also provided for herein is a method for treating a disease that is associated with inflammation and/or fibrosis, comprising administering to a subject having the disease that exhibits inflammation and/or fibrosis a therapeutically effective amount of a formulation disclosed herein. Additionally provided is the use of a formulation disclosed herein for the treatment of a disease associated with inflammation and/or fibrosis. Additionally provided is the use of a formulation disclosed herein for the manufacture of a medicament for the treatment of a disease associated with inflammation and/or fibrosis.
• the disease comprises heart failure with preserved ejection fraction, myocardial infarction, muscular dystrophy, scleroderma, viral infection, and/or hypertrophic cardiomyopathy .
• a method for manufacturing a formulation for oral delivery of a nucleic acid comprising encapsulating a nucleic acid in an artificial lipid micelle by contacting the nucleic acid with a solution comprising cationic lipids, thereby generating an artificial lipid micelle comprising the nucleic acid, coating the artificial lipid micelle comprising the nucleic acid with casein proteins by contacting the artificial lipid micelle comprising the nucleic acid with a solution comprising between 2 and 10% casein proteins, thereby generating a casein coated artificial lipid micelle comprising the nucleic acid, and exposing the casein coated artificial lipid micelle comprising the nucleic acid to a mixture of an acid and chitosan polymers, wherein the mixture of the acid and the chitosan polymers allows intercalation of the chitosan with the casein proteins and precipitation of casein-chitosan coated lipid micelles comprising the nucleic acid.
• the nucleic acid is contacted with the cationic lipids in a ratio of between about 0.5 to 2.0 pL of lipid solution for each microgram of nucleic acid.
• the method further comprise adding a liquid media to the nucleic acid and cationic lipid solution to a final volume of about 100 pL.
• the casein proteins are within a solution of 5% bovine casein solution and are added to the artificial lipid micelle comprising the nucleic acid at a volume ratio of 1:10.
• the mixture of the acid and the chitosan polymers comprises an acetic acid solution of between about 0.05 and 2% and a chitosan solution of between about 0.1% and 2%.
• a method of treating a disease associated with inflammation and/or fibrosis comprising administering to a subject an oral formulation comprising a nucleic acid, a cationic lipid, at least one casein protein, and a chitosan.
• the oral formulation is given on a daily basis.
• a single oral administration is effective to ameliorate or otherwise treat the disease associated with inflammation and/or fibrosis.
• the nucleic acid comprises a ribonucleic acid (RNA) and wherein the RNA is present in an amount ranging between about 0.00001 and 0.01% of the formulation by weight per volume, wherein the at least one casein protein comprises at least an a-sl casein subunit and is present in an amount ranging between about 0.5 and 5% of the formulation by weight per volume; and wherein the chitosan is present in an amount ranging between about 0.001 and 1% of the formulation by weight per volume.
• RNA ribonucleic acid
• nucleic acid comprising a nucleotide sequence of C GU CC G AU GGU AGU GGGUU AUC AG (SEQ ID NO: 12), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 30 nt long. Also provided is an isolated nucleic acid comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 30 nt long.
• the nucleic acid comprises at least one chemically-modified nucleotide.
• the nucleic acid comprises between 1-10 chemically-modified nucleotides. In some embodiments, the nucleic acid comprises at least one chemically-modified nucleotide within positions 1-12 and/or at least one chemically-modified nucleotide within positions 13-24 of the nucleotide sequence. In some embodiments, the chemically-modified nucleotide comprises a backbone modification. In some embodiments, the backbone modification comprises a backbone sugar modification. In some embodiments, the nucleic acid comprises the chemically-modified nucleotide at one or more of positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence.
• the chemically-modified nucleotide is a locked nucleic acid (LNA).
• the nucleotide sequence comprises the LNA at positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence.
• the nucleic acid is 24 nucleotides long.
• nucleic acid comprising a nucleotide sequence at least 95% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12), wherein the nucleic acid is RNA.
• nucleotide sequence is CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12).
• nucleic acid comprises at least one chemically-modified nucleotide. In some embodiments, the nucleic acid comprises between 1-10 chemically-modified nucleotides.
• the nucleic acid comprises at least one chemically-modified nucleotide within positions 1-12 and/or at least one chemically-modified nucleotide within positions 13-24 of the nucleotide sequence.
• the chemically-modified nucleotide comprises a backbone modification.
• the backbone modification is a backbone sugar modification.
• the nucleic acid further comprises the chemically-modified nucleotide at one or more of positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence.
• the chemically-modified nucleotide is a locked nucleic acid (LNA).
• the nucleotide sequence comprises the LNA at positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence.
• the nucleic acid is at most 30 nt long.
• nucleic acid consists of or consists essentially of the nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG.
• a nucleic acid consisting of a nucleotide sequence: CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 2), wherein the nucleic acid is RNA, wherein each of positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence is a LNA.
• composition comprising: any one of the isolated nucleic acids of the present disclosure; and a pharmaceutically acceptable excipient.
• the composition further comprises a transfection reagent.
• the transfection reagent comprises one or more of a liposome, an extracellular vesicle (EV), and a polyethylene glycol (PEG)-cationic lipid complex (PCLC).
• the transfection reagent comprises EV derived from cardiosphere-derived cells (CDC).
• the composition further comprises a casein phosphoprotein.
• the composition further comprises chitosan.
• the isolated nucleic acid is encapsulated in a casein-chitosan complex.
• the composition comprises casein micelles.
• a macrophage exposed to, or transfected with, any one of the nucleic acids of the present disclosure, wherein an anti-inflammatory activity of the macrophage is increased compared to a macrophage without the nucleic acid.
• the macrophage is in a subject.
• the macrophage is in culture.
• kits comprising: any one of the nucleic acids of the present disclosure; and a transfection reagent.
• the transfection reagent is one or more of a liposome, an extracellular vesicle (EV), and a polyethylene glycol (PEG)-cationic lipid complex (PCLC).
• the kit further comprises a pharmaceutically acceptable excipient.
• the kit further comprises a casein phosphoprotein.
• the kit further comprises chitosan.
• a method of treating a heart condition or symptom thereof comprising administering to a subject in need of treating a heart condition or symptom thereof a therapeutically effective amount of any one of the nucleic acids of the present disclosure or any one of the composition of the present disclosure, thereby treating the heart condition or symptom thereof.
• the heart condition comprises a symptom and/or sequelae of heart failure.
• the heart condition comprises hypertrophic cardiomyopathy.
• the heart condition comprises heart failure with preserved ejection fraction (HFpEF).
• the heart condition comprises a symptom or sequelae of an infectious disease.
• the infectious disease comprises a viral infection.
• the subject has the heart condition.
• the subject is at risk of developing the heart condition.
• the subject exhibits, before the administering, one or more of: hypertension, elevated E/e’ ratio by echocardiography, cardiac hypertrophy, myocardial fibrosis, obesity, wasting, reduced endurance, and elevated systemic inflammatory markers.
• a method treating a muscle disorder or symptom thereof comprising administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of any one of the nucleic acids of the present disclosure or any one of the compositions of the present disclosure, thereby treating the muscle disorder or symptom thereof.
• the muscle disorder comprises muscular dystrophy or a heart condition.
• the muscle disorder comprises Duchenne muscular dystrophy.
• the subject has the muscle disorder.
• the subject is at risk of developing the muscle disorder.
• the subject is genetically predisposed to developing the muscle disorder.
• the subject exhibits, before the administering, one or more of: reduced endurance, and reduced skeletal muscle function.
• the inflammatory condition comprises a symptom or sequelae of an infectious disease.
• the infectious disease comprises a viral infection.
• the inflammatory condition comprises a cytokine storm.
• the inflammatory condition is associated with immunotherapy (e.g., for cancer).
• the inflammatory condition is scleroderma, an autoimmune condition affecting the skin.
• the inflammatory condition is systemic sclerosis, an autoimmune condition resembling scleroderma but affecting not only the skin but also internal organs including the lung and the heart.
• a method of treating a fibrotic condition comprising administering to a subject in need of treating a fibrotic condition a therapeutically effective amount of any one of the nucleic acids of the present disclosure or any one of the compositions of the present disclosure, thereby treating the fibrotic condition.
• the fibrotic condition comprises a symptom or sequelae of an infectious disease.
• the infectious disease comprises a viral infection.
• the fibrotic condition is idiopathic pulmonary fibrosis.
• the fibrotic condition is cirrhosis of the liver.
• the therapeutically effective amount of the nucleic acid comprises from about 0.001 pg/g to about 100 pg/g.
• any one of the treatment methods of the present disclosure includes administering the therapeutically effective amount of the nucleic acid or the composition no more frequently than twice a week.
• the method includes administering the therapeutically effective amount of the nucleic acid or the composition intravenously, intramuscularly, intracardially, or orally.
• the therapeutically effective amount of the nucleic acid or the composition is administered orally.
• a method of promoting anti-inflammatory activity of macrophages comprising contacting any one of the nucleic acids of the present disclosure or any one of the compositions of the present disclosure with a population of macrophages, to thereby promote an anti-inflammatory activity of macrophages of the population.
• the contacting comprises administering to a subject in need of treating a condition characterized by inflammation or fibrosis an effective amount of the nucleic acid or the composition, to thereby promote an anti-inflammatory activity of macrophages in the subject.
• the macrophage is a human macrophage.
• FIGS. 1A-1B show various non-limiting schematics for oral formulations as provided for herein.
• FIG. 1A shows a non-limiting schematic in which a lipid is used to encapsulate a nucleic acid, such as a therapeutic nucleic acid, and the encapsulated nucleic acid is coated with a casein-chitosan complex, which allows for oral delivery
• FIG. IB shows alternative non-limiting schematics of alternative formulations for therapeutic nucleic acids, such as RNA (e.g., non-coding RNA or coding RNA).
• RNA e.g., non-coding RNA or coding RNA
• FIGS. 2A-2C show schematics and data related to oral formulations as provided for herein.
• FIGS. 2A 2B show various non-limiting schematics of non-coding RNAs (TY4 in 2A and piR-659/piREXl in 2B) and their encapsulation in lipid-casein- chitosan complexes according to embodiments disclosed herein.
• FIG. 2C shows data demonstrating that oral administration of piREXl (and a derivative thereof, U to A) are effective in reducing infarct mass and cardiac troponin levels (as compared to control).
• FIGS. 3A-3M show the therapeutic effects of administering TY4 in heart failure with preserved ejection fraction (HFpEF), according to some non-limiting embodiments of the present disclosure.
• FIG. 3A is a schematic diagram showing a protocol for measuring the therapeutic effect of TY4 in a model of HFpEF.
• FIG. 3B is a graph comparing systolic blood pressure (left panel) and diastolic blood pressure (right panel).
• FIG. 3C is a graph comparing treadmill exercise distances.
• FIG. 3D is a graph comparing the ratio of early diastolic mitral inflow velocity to mitral annular tissue velocity (E/e’).
• Fig. 3E is a graph comparing systemic brain natriuretic peptide (BNP) levels.
• BNP systemic brain natriuretic peptide
• FIG. 3F is a collection of graphs comparing systolic blood pressure (left panel) and diastolic blood pressure (right panel).
• FIG. 3G is a graphs comparing the ratio of early diastolic mitral inflow velocity to mitral annular tissue velocity (E/e’).
• FIG. 3H is a graph comparing treadmill exercise distances.
• FIG. 31 is a graph comparing systemic BNP levels.
• FIG. 3J is a graph comparing systolic blood pressure over time.
• FIG. 3K is a graph comparing diastolic blood pressure over time.
• FIG. 3L is a graph comparing E/e’ ratios over time.
• FIG. 3M is a graph comparing treadmill exercise distances over time.
• FIGS. 4A-4F show the therapeutic effects of administering TY4 in heart failure with preserved ejection fraction (HFpEF), according to some non-limiting embodiments of the present disclosure.
• the data of FIGS 4A-4E are from additional replicates of the corresponding data from FIG. 3 (e.g., greater sample size).
• FIG. 4A is a graph comparing systolic blood pressure in animals receiving control, vehicle, and oral formulations.
• FIG. 4B is a graph comparing diastolic blood pressure in animals receiving control, vehicle, and oral formulations.
• FIG. 4C is a graph comparing the ratio of early diastolic mitral inflow velocity to mitral annular tissue velocity (E/e’) in animals receiving control, vehicle, and oral formulations.
• FIG. 4D is a graph comparing is a graph comparing systemic brain natriuretic peptide (BNP) levels in animals receiving control, vehicle, and oral formulations.
• FIG. 4E is a graph comparing treadmill exercise distances in animals receiving control, vehicle, and oral formulations.
• FIG. 4F is a graph comparing the circulating blood glucose levels in animals receiving control, vehicle, and oral formulations.
• FIG. 4G shows cardiac size for animals receiving control, vehicle, and oral formulations.
• FIGS. 5A-5E show data related to efficacy of oral administration of therapeutic RNA in a model of myocardial infarction.
• FIG 5A shows data related to infarct size.
• FIG. 5B shows cardiac tissue sections from the various treatment groups.
• FIG. 5C shows data for circulating levels of cardiac troponin 48 hours post-injury.
• FIG. 5D shows additional data related to infarct mass, including a treatment group in which chitosan was not used in the oral formulation.
• FIG. 5E shows additional data related circulating cardiac troponin levels, including a treatment group in which chitosan was not used in the oral formulation.
• FIGS. 6A-6E show data related to oral formulations delivering therapeutic nucleic acids in a model of scleroderma.
• FIG. 6A shows data related to distance traveled on a treadmill in the indicated treatment groups.
• FIG. 6B shows data related to body weight.
• FIG. 6C shows data related to the ratio of heart weight to body weight, representing a heart index (HI).
• FIG. 6d shows data related to the ratio of lung weight to body weight, representing a pulmonary index (PI).
• FIG. 6E shows data related to lung weight for the indicated groups.
• FIGS. 7A-7D show additional data related to oral formulations delivering therapeutic nucleic acids in a model of scleroderma.
• FIG. 7A shows histology data related to cardiac fibrosis.
• FIG. 7B shows a summary of cardiac fibrosis data, tabulated by treatment group.
• FIG. 7C shows histology related to skin fibrosis.
• FIG. 7D shows a summary of skin fibrosis data, tabulated by treatment group.
• FIGS. 8A-8F shows additional data related to scleroderma.
• the data depicted show quantification of IL1-B (8A), IL-6 (8B), TGF beta (8C), NLRP3 (8D), p21 (8E), and IL-4 (8F).
• FIGS. 9A-9H show data related to oral formulations delivering therapeutic nucleic acids in a model of muscular dystrophy.
• FIG. 9A shows data related to transthoracic echocardiography to measure left ventricular ejection fraction (EF).
• FIG. 9B shows Masson’s trichrome micrographs and pooled data (right subpanel) showing that oral administration of a therapeutic nucleic acid results in less myocardial fibrosis than vehicle control mice.
• FIG. 9C shows data summarizing muscle function at baseline and after 8 weeks.
• FIG. 9D shows Masson’s trichrome micrographs and pooled data (right subpanel) showing that oral administration of a therapeutic nucleic acid results in less muscle fibrosis than vehicle control mice.
• Figure 9E shows data related to the myofiber count in control versus orally delivered therapeutic RNA.
• Figure 9F shows data related to the exercise capacity of orally treated animals versus control.
• Figure 9G shows data related to the cardiac function of orally treated animals versus control.
• Figure 9H shows data related to the muscle function of orally treated animals versus control.
• nucleic acid therapeutics offer the potential to treat diseases at a genetic level. Many conventional treatments generally induce therapeutic effects that are transient because they target proteins rather than underlying causes. In contrast, nucleic acid therapeutics have the potential for long-lasting (or even permanent, e.g., curative) effects via gene inhibition, addition, replacement, or editing. However, the successful use of nucleic acid therapeutics will hinge on delivery technologies that improve stability and/or bioavailability.
• the formulations provided for herein allow the enhanced delivery of nucleic acids to a subject.
• the nucleic acids comprise DNA.
• the nucleic acids comprise RNA.
• the nucleic acids comprise coding RNA (e.g., messenger RNA or mRNA).
• the nucleic acids comprise non-coding RNAs (ncRNA).
• mRNA can provide therapeutic effects by virtue of delivery of a sequence coding for a protein that yields a therapeutic effect. Depending on the embodiment, that could be a protein that replaces a non-functional protein.
• the coding RNA could encode a protein to which an immune response is desired (e.g., a viral protein), such as for the production of antibodies against that protein.
• ncRNA are known to exhibit positive therapeutic effects based on their ability to increase secretion of anti-inflammatory cytokines or decrease secretion of inflammatory cytokines. Certain ncRNA exhibit cardioprotective, anti-fibrotic, and/or anti-hypertrophic effects.
• ncRNA Prior to the disclosure provided herein, ncRNA were delivered to a subject in need thereof via a parenteral administration route, such as injection intramuscularly, subcutaneously, or via intravenous administration.
• parenteral administration route such as injection intramuscularly, subcutaneously, or via intravenous administration.
• formulations that allow for the oral delivery of ncRNA, or other therapeutic nucleic acids.
• the formulations protect the nucleic acid from the low acid environment of the upper/mid GI tract (e.g., the stomach) such that they reach the lower GI tract in an intact form and are absorbed in a form that allows their anti-inflammatory and/or anti-fibrotic effects to be realized.
• the formulations provided for herein allow the use of nucleic acids in treating conditions where inflammation and/or tissue injury are the main drivers of pathology.
• conditions treated using such formulations include, without limitation, inflammatory disease, muscular dystrophy, or cardiac injury.
• the formulations have cardioprotective effects when administered to a subject suffering from cardiac injury due to, without limitation, myocardial infarction and/or heart failure, among other maladies, such as scleroderma and/or muscular dystrophy.
• compositions of the present disclosure allow the successful delivery of nucleic acids, such as ncRNA, to the lower GI tract, where they are readily absorbed and can increase an anti-inflammatory activity of macrophages, e.g., by promoting secretion of interleukin 10 (IL-10) from macrophages.
• the compositions of the present disclosure allow the successful delivery of nucleic acids, such as ncRNA to the lower GI tract, where they are readily absorbed and can induce changes in expression of one or more gene products and/or epigenetic changes in macrophages that are exposed to the nucleic acids.
• conditions e.g., inflammatory disease, muscular dystrophy, or cardiac injury, treated by administration of formulations comprising nucleic acids of the present disclosure.
• nucleic acid or “oligonucleotide” refers to multiple nucleotides (e.g., molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymidine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)).
• a substituted pyrimidine e.g. cytosine (C), thymidine (T) or uracil (U)
• a substituted purine e.g. adenine (A) or guanine (G)
• polynucleosides i.e. a polynucleotide minus the phosphate
• Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymidine, inosine, 5- methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties.
• a nucleic acid can include any other suitable modifications.
• nucleic acid also encompasses nucleic acids with substitutions or modifications, such as in the bases and/or sugars.
• Polypeptide or nucleic acid molecules of the present disclosure may share a certain degree of sequence similarity or identity with the reference molecules (e.g., reference polypeptides or reference polynucleotides), for example, with art-described molecules (e.g., engineered or designed molecules or wild-type molecules).
• identity refers to a relationship between the sequences of two or more polypeptides or polynucleotides, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between them as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues.
• Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (e.g., “algorithms”). Identity of related peptides can be readily calculated by known methods. identity” as it applies to polypeptide or polynucleotide sequences is defined as the percentage of residues (amino acid residues or nucleic acid residues) in the candidate amino acid or nucleic acid sequence that are identical with the residues in the amino acid sequence or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Any suitable methods and computer programs for the alignment can be used.
• variants of a particular polynucleotide or polypeptide have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art.
• tools for alignment include those of the BLAST suite (Stephen F.
• FGSAA Fast Optimal Global Sequence Alignment Algorithm
• identity refers to the overall relatedness between polymeric molecules, for example, between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of the percent identity of two polynucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
• the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence.
• the nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
• the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
• the comparison of sequences and determination of percent identity between two sequences can be accomplished using a suitable mathematical algorithm.
• the percent identity between two nucleic acid sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects. Smith. D. W., ed., Academic Press. New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M.
• the percent identity between two nucleic acid sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
• the percent identity between two nucleic acid sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
• Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).
• base-pairing refers to the formation of hydrogen bonds between specific pairs of nucleotide bases (“complementary base pairs”). For example, two hydrogen bonds form between adenine (A) and uracil (U), and three hydrogen bonds form between guanine (G) and cytosine (C).
• A adenine
• U uracil
• C guanine
• One method of assessing the strength of bonding between two polynucleotides is by quantifying the percentage of bonds formed between the guanine and cytosine bases of the two polynucleotides (“GC content”).
• the GC content of bonding between two nucleic acids of a multimeric molecule is at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the GC content of bonding between two nucleic acids of a multimeric molecule (e.g., a multimeric mRNA molecule) is between 10% and 70%, about 20% to about 60%, or about 30% to about 60%.
• hybridization The formation of a nucleic acid duplex via bonding of complementary base pairs can also be referred to as “hybridization”.
• a region of complementarity can vary in size. In some embodiments, a region of complementarity ranges in length from about 2 base pairs to about 100 base pairs. In some embodiments, a region of complementarity ranges in length from about 5 base pairs to about 75 base pairs. In some embodiments, a region of complementarity ranges in length from about 10 base pairs to about 50 base pairs. In some embodiments, a region of complementarity ranges in length from about 20 base pairs to about 30 base pairs.
• isolated as used herein with reference to an isolated biomolecule, e.g., a nucleic acid, has the ordinary and customary meaning to one of ordinary skill in the art in view of the present disclosure.
• An isolated biomolecule e.g., an isolated nucleic acid, is generally in a non-natural environment, or in an environment that the biomolecule would otherwise not have been without human intervention of the biomolecule or its environment.
• an isolated biomolecule is not inside a cell or an organism.
• Extracellular vesicle or “EV” as used herein have their ordinary and customary meaning as understood by one of ordinary skill in the art, in view of the present disclosure.
• EVs include lipid bilayer structures generated by cells, and include exosomes, microvesicles, epididimosomes, argosomes, exosome-like vesicles, microparticles, promininosomes, prostasomes, dexosomes, texosomes, dex, tex, archeosomes and oncosomes.
• Casein micelles are colloidal particles that can include aggregates of one or more casein phosphoproteins (e.g., one or more, two or more, three or more, or all four of alpha si casein, alpha s2 casein, beta casein, and kappa casein).
• Subject refers to any vertebrate animal, including mammals and non-mammals. A subject can include primates, including humans, and non primate mammals, such as rodents, domestic animals or game animals.
• Non-primate mammals can include mouse, rat, hamster, rabbit, dog, fox, wolf, cat, horse, cow, pig, sheep, goat, camel, deer, buffalo, bison, etc.
• Non-mammals can include bird (e.g., chicken, ostrich, emu, pigeon), reptile (e.g., snake, lizard, turtle), amphibian (e.g., frog, salamander), fish (e.g., salmon, cod, pufferfish, tuna), etc.
• bird e.g., chicken, ostrich, emu, pigeon
• reptile e.g., snake, lizard, turtle
• amphibian e.g., frog, salamander
• fish e.g., salmon, cod, pufferfish, tuna
• administering can include any suitable routes of administering a therapeutic agent or composition as disclosed herein. Suitable routes of administration include, without limitation, oral, parenteral, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, cutaneous, injection or topical administration. Administration can be local or systemic.
• treat and “treatment” includes curing, improving, ameliorating, reducing the severity of, preventing, slowing the progression of, and/or delaying the appearance of a disease, condition and/or symptoms thereof.
• a treatment can be considered “effective,” or “therapeutically effective” as used herein, if one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response is induced e.g., by at least 2%, 3%, 4%, 5%, 10%, or more, following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and/or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate, e.g. exercise endurance.
• Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (e.g., progression of the disease is halted).
• Treatment includes any treatment of a disease or condition in an individual or an animal (some non-limiting examples include a human or an animal) and includes: (1) inhibiting the disease or condition, e.g., preventing a worsening of symptoms (e.g. pain or inflammation); or (2) relieving the severity of the disease or condition, e.g., causing regression of symptoms.
• An effective amount for the treatment of a disease or condition means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease or condition.
• Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response, (e.g. muscle function, mass or volume).
• a condition or desired response e.g. muscle function, mass or volume.
• One skilled in the art can monitor efficacy of administration and/or treatment by measuring any one of such parameters, or any combination of parameters.
• the term “effective amount” or “therapeutically effective amount” as used herein refers to the amount of a composition or an agent needed to alleviate at least one or more symptom of the disease or condition, and relates to a sufficient amount of therapeutic composition to provide the desired effect.
• the term “effective amount” or “therapeutically effective amount” can refer to an amount of a composition or therapeutic agent that is sufficient to provide a particular anti-inflammatory and/or cardioprotective effect when administered to a typical subject.
• an effective amount as used herein, in various contexts, can include an amount sufficient to delay the development of a symptom of the disease or condition, alter the course of a symptom disease or condition (for example but not limited to, slowing the progression of a symptom of the disease or condition), or reverse a symptom of the disease or condition.
• the therapeutically effective amount is administered in one or more doses of the therapeutic agent.
• the therapeutically effective amount is administered in a single administration, or over a period of time in a plurality of doses.
• physiologically compatible and “pharmaceutically acceptable” are employed interchangeably herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
• “about 5” provides express support for “5.”
• Numbers provided in ranges include overlapping ranges and integers in between; for example a range of 1-4 and 5-7 includes for example, 1-7, 1-6, 1-5, 2-5, 2-7, 4-7, 1, 2, 3, 4, 5, 6 and 7.
• compositions that are configured for oral administration and comprise a therapeutic nucleic acid (e.g., an RNA (coding or non-coding RNA) molecule encapsulated by the composition).
• the composition is a pharmaceutical composition.
• the composition includes pharmaceutically acceptable excipient.
• the composition is a cell-free composition, e.g., the composition is substantially free of cells such as CDC.
• the compositions is free of cell-derived materials, such as exosomes or cellular vesicles.
• the composition comprises an artificial vesicle (e.g., a vesicle formed from lipids, such as cationic lipids).
• Some non-limiting examples of materials which can serve as pharmaceuticahy-acceptable excipients include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcehulose, ethyl cellulose, microcry stahine cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol
• the composition includes a transfection reagent, e.g., to promote delivery of the nucleic acid to a target cellular target (in vitro or in vivo).
• a transfection reagent can be included in the composition.
• Suitable transfection reagents include, without limitation, a liposome, extracellular vesicle (EV), and a polyethylene glycol (PEG) -cationic lipid complex (PCLC).
• a cationic lipid is used.
• the transfection reagent includes DharmaFECT® or Lipofectamine®.
• the transfection reagent comprises DharmaFECT®.
• the nucleic acid of the present disclosure is formulated with the transfection reagent in the composition so as to promote cellular uptake and/or pharmacokinetics of the nucleic acid.
• Liposomes are artificially-prepared vesicles which may primarily be composed of a lipid bilayer (or spherical monolayer oriented such that the hydrophobic tails of the lipids are positioned within the sphere) and may be used as a delivery vehicle for the administration of pharmaceutical formulations.
• Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV), which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV), which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV), which may be between 50 and 500 nm in diameter.
• MLV multilamellar vesicle
• SUV small unicellular vesicle
• LUV large unilamellar vesicle
• Liposome design may include, without limitation, opsonins or ligands in order to improve the attachment of liposomes to target tissue/cells, or to activate events such as, but not limited to, endocytosis.
• Liposomes may contain a low or a high pH in order to improve the delivery of the cargo, e.g., a nucleic acid of the present disclosure.
• the composition includes, without limitation, liposomes such as those formed from l,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), l,2-dilinoleyloxy-3- dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]- dioxolane (DLin-KC2-DMA), and MC3 and liposomes such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).
• the composition includes a cationic lipid.
• Any suitable cationic lipid may be used in the present compositions. Suitable cationic lipids include, without limitation, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2- DMA, DODMA and amino alcohol lipids.
• the composition includes a cationic lipid complex, e.g., a polyethylene glycol (PEG)-cationic lipid complex (PCLC).
• the cationic lipid is PEGylated, e.g., 2 kDa PEG (“PEG2000”). Any suitable option can be used to PEGylate the cationic lipid.
• PCLC is formed by exposing a mixture of PEG and the cationic lipid to one or more freeze/thaw cycles, e.g., 1, 2, 3, 4, 5 or more freeze/thaw cycles.
• a freeze/thaw cycle includes freezing the mixture with liquid nitrogen (e.g., around -190 °C) for about 5 minutes, and thawing at about 60 °C for about 5 minutes.
• a nucleic acid of the present disclosure can be mixed with the PCLC to generate a complex of the nucleic acid and the PCLC.
• the composition includes casein, e.g., a casein micelle. In some embodiments, the composition includes chitosan. In some embodiments, the composition includes casein and chitosan. In some embodiments, the composition includes a casein-chitosan complex. In some embodiments, the isolated nucleic acid in the composition is encapsulated in a casein-chitosan complex. In some embodiments, the composition includes one or more of phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein.
• the composition includes two or more, three or more, or all four phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein.
• the phosphoproteins may be present in the composition at any suitable concentration (relative to each other, and relative to the total volume of the composition), and in some embodiments, is present in an amount suitable for forming casein micelles.
• the casein phosphoproteins are collectively present in the composition at about 8 % (weight by volume).
• the casein phosphoproteins can be those from any suitable animal, e.g., mammal such as, but not limited to, human, non-human primate, cow, pig, horse, camel, goat, and sheep.
• the casein phosphoproteins are bovine alpha si casein, alpha s2 casein, beta casein, and kappa casein.
• Suitable casein formulations with EV are provided in, e.g., Aminzadeh et al., J Extracell Vesicles. 2021 Jan;10(3):el2045, the entirety of which is incorporated herein by reference.
• a composition, e.g., pharmaceutical composition, of the present disclosure formulated with casein, as provided herein is suitable for oral administration to the subject.
• a composition for enhancing the oral bioavailability of a therapeutic nucleic acid of the present disclosure comprises at least two phosphoproteins selected from alpha si casein, alpha s2 casein, beta casein, and kappa casein, where the phosphoproteins are present in an amount between about 5% to about 10% (weight by volume) of the composition, in a physiologically compatible excipient.
• the composition includes the alpha si casein in an amount between about 0% to about 50% (e.g., about 10% to about 45%, about 20% to about 40%, about 25% to about 40%, about including 30% to about 40%) (by weight), the alpha s2 casein in an amount between about 0% to about 20% (e.g., about 5% to about 15%, about 7% to about 12%, including about 8% to about 12%) (by weight), the beta casein in an amount between about 0% to about 50% (e.g., about 10% to about 45%, about 20% to about 40%, about 25% to about 40%, about including 30% to about 40%) (by weight), and the kappa casein in an amount between about 0% to about 20% (e.g., about 5% to about 18%, about 8% to about 18%, including about 10% to about 15%) (by weight) of the phosphoprotein mass in the composition.
• the alpha si casein in an amount between about 0% to about 50% (e.g., about 10% to about 45%, about 20% to about 40%,
• compositions can provide for enhanced oral bioavailability of therapeutic nucleic acids, such as non-coding RNA.
• the therapeutic nucleic acid comprises RNA, such as, but not limited to mRNA and non-coding RNA (e.g., miRNA, IncRNA).
• the payload is a synthetic molecule, e.g., a small molecule or drug.
• the formulations provided for herein are in the form of lipid-bound vesicles, e.g., micelles or liposomes, and can therefore include any suitable number of particles.
• the amount of micelles is in a range of about 10 6 to about 10 10 particles, e.g., about 2 x 10 6 to about 10 10 particles, about 5 xlO 6 to about 10 10 particles, about 10 7 to about 5 x 10 9 particles, about 2 xlO 7 to about 5 x 10 9 particles, about 5 xlO 7 to about 5 x 10 9 particles, including about 1 xlO 8 to about 2 x 10 9 particles.
• the amount of micelles (e.g., casein-chitosan coated micelles) in the population is about 10 6 , about 2 x 10 6 , about 5 x 10 6 , about 10 7 , about 2 x 10 7 , about 5 x 10 7 , about 10 8 , about 2 x 10 8 , about 5 x 10 8 , about 10 9 , about 2 x 10 9 , about 5 x 10 9 , or about 10 10 particles, or an amount in between any two of the preceding values.
• the composition comprises casein-chitosan coated lipid micelles, where the casein phosphoproteins are present in the composition in suitable amounts (e.g., suitable total amount of phosphoprotein mass in the composition, suitable proportions of phosphoproteins relative to each other).
• the composition includes two, three, or all four phosphoproteins selected from alpha si casein, alpha s2 casein, beta casein, and kappa casein.
• the amount of a phosphoprotein in the composition depends on the amount of one or more other phosphoprotein present in the composition.
• alpha si casein is a phosphoprotein associated with the gene name CSN1S1.
• the alpha si casein can be a CSN1S1 phosphoprotein from any suitable mammal.
• the alpha si casein is bovine (Gene ID: 282208), porcine (Gene ID: 445514), equine (Gene ID: 100033982), ovine (Gene ID: 443382), caprine (Gene ID: 100750242), cameline (Gene ID: 105090954), or human (Gene ID: 1446).
• the alpha si casein is a non-human alpha si casein.
• the alpha si casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 26.
• the composition includes any suitable amount of alpha si casein.
• the composition includes the alpha si casein in an amount, by weight, between about 0% to about 50%, e.g., between about 5% to about 50%, between about 10% to about 50%, between about 15% to about 45%, between about 20% to about 45%, including between about 25% to about 40%, of the phosphoprotein mass in the composition.
• the composition includes the alpha si casein in an amount, by weight, of about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or an amount within a range defined by any two of the preceding values.
• the alpha s2 casein is a phosphoprotein associated with the gene name CSN1S2.
• the alpha s2 casein can be a CSN1S2 phosphoprotein from any suitable mammal.
• the alpha s2 casein is bovine (Gene ID: 282209), porcine (Gene ID: 445515), equine (Gene ID: 100327035), ovine (Gene ID: 443383), caprine (Gene ID: 100861229), or cameline (Gene ID: 105090951).
• the alpha s2 casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 27.
• the composition can include any suitable amount of alpha s2 casein.
• the composition includes the alpha s2 casein in an amount, by weight, between about 0% to about 20%, e.g., between about 2% to about 18%, between about 3% to about 18%, between about 4% to about 17%, between about 5% to about 16%, including between about 5% to about 15%, of the phosphoprotein mass in the composition.
• the composition includes the alpha s2 casein in an amount, by weight, of about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, 20%, or an amount within a range defined by any two of the preceding values.
• the beta casein is a phosphoprotein associated with the gene name CSN2.
• the beta casein can be a CSN2 phosphoprotein from any suitable mammal.
• the beta casein is bovine (Gene ID: 281099), porcine (Gene ID: 404088), equine (Gene ID: 100033903), ovine (Gene ID: 443391), caprine (Gene ID: 100860784), cameline (Gene ID: 105080412), or human (Gene ID: 1447).
• the beta casein is a non-human beta casein.
• the beta casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 28 or 29.
• the composition can include any suitable amount of beta casein.
• the composition includes the beta casein in an amount, by weight, between about 0% to about 50%, e.g., between about 5% to about 50%, between about 10% to about 50%, between about 15% to about 45%, between about 20% to about 45%, including between about 25% to about 40%, of the phosphoprotein mass in the composition.
• the composition includes the beta casein in an amount, by weight, of about 0%, 5%, 10%, 15%, 20%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, or an amount within a range defined by any two of the preceding values.
• the kappa casein is a phosphoprotein associated with the gene name CSN3.
• the beta casein can be a CSN3 phosphoprotein from any suitable mammal.
• the kappa casein is bovine (Gene ID: 281728), porcine (Gene ID: 445511), equine (Gene ID: 100033983), ovine (Gene ID: 443394), caprine (Gene ID: 100861231), cameline (Gene IDs: 105080408 or 105090949), or human (Gene ID: 1448).
• the kappa casein is a non-human kappa casein.
• the kappa casein is a polypeptide having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or about 100% identical to the sequence set forth in SEQ ID NO: 30.
• the composition can include any suitable amount of kappa casein.
• the composition includes the kappa casein in an amount, by weight, between about 0% to about 20%, e.g., between about 2% to about 18%, between about 3% to about 18%, between about 4% to about 17%, between about 5% to about 16%, including between about 5% to about 15%, of the phosphoprotein mass in the composition.
• the composition includes the kappa casein in an amount, by weight, of about 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 18%, 20%, or an amount within a range defined by any two of the preceding values.
• caseins from different species are used, in some embodiments.
• one or more human casein is used in combination with one or more bovine casein.
• Ratios of caseins are used in some embodiments, for example a 3: 1:3:1 ratio of alpha SI casei alpha s2 casei beta casei kappa casein. Different ratios may be used in some embodiments, for example 4: 1:4:1, 2: 1:2:1, or 1:1: 1:1. Ratios may also be used between any two given caseins in a composition, ranging from 1:1, 2:1, 3:1, 4:1, 5:1, 10:1, 1:5, 1:4, 1:3, 1:2, etc.
• any suitable total amount of the phosphoproteins may be present in the composition.
• the phosphoproteins are present in an amount between 5% to about 10%, e.g., about 6% to about 10%, about 6% to about 9%, including about 6% to about 8%, (weight by volume) of the composition.
• the phosphoproteins are present in an amount of about 5%, 6%, 7%, 8%, 9%, 10%, or an amount within a range defined by any two of the preceding values, (weight by volume) of the composition.
• one or more of the casein phosphoproteins are non human casein phosphoproteins.
• the exosomes and at least one of the casein phosphoproteins are from different species.
• the exosomes are human exosomes, and one or more of the casein phosphoproteins are non-human casein phosphoproteins.
• the exosomes are human exosomes, and one or more of the casein phosphoproteins are bovine (or ovine, porcine, caprine, cameline, or equine) casein phosphoproteins.
• the composition includes micellar structures formed by at least a portion of the casein phosphoproteins.
• the casein micelles are substantially spherical.
• a casein micelle in the composition has an average diameter (as measured per micelle) of about 40 nm, about 50 nm, about 60 nm, about 70 nm, about80 nm, about 90 nm, about 100 nm, about 110 nm, about 120 nm, about 130 nm, about 150 nm, about 200 nm, about 250 nm, about 300 nm, about 350 nm, about 400 nm, about 450 nm, about 500 nm or more, or an average diameter within a range defined by any two of the preceding values.
• a casein micelle in the composition has an average diameter (as measured per micelle) in a range from about 40 nm to about 500 nm, e.g., from about 40 nm to about 400 nm, from about 50 nm to about 300 nm, from about 60 nm to about 250 nm, from about 70 nm to about 250 nm, from about 80 nm to about 200 nm, including from about 90 nm to about 150 nm.
• the casein micelles of the present composition are generally not precipitated or in gel form.
• the composition includes one or more colloidal minerals (e.g., minerals in suspension).
• a complex e.g., two or more minerals are used as a colloidal mineral complex.
• the colloidal mineral complex can include any suitable mineral compounds and/or their salts.
• the colloidal mineral complex includes, without limitation, one or more of calcium, magnesium, inorganic phosphate, citrate, sodium, potassium, and chloride, or their respective salts.
• the colloidal mineral complex is present in an amount between about 2% and about 15%, e.g., about 2% to about 12%, about 5% to about 10%, about 5% to about 9%, including about 6% to about 9% (by weight) of the phosphoprotein mass in the composition. In some embodiments, the colloidal mineral complex is present in an amount of about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15% or an amount within a range defined by any two of the preceding percentages.
• the present composition generally includes a physiologically compatible excipient, such as but not limited to water or a buffer.
• a physiologically compatible excipient is an excipient that does not substantially interfere with the protective properties of the casein phosphoproteins (e.g., does not substantially interfere with the micellar structures formed by the casein phosphoproteins and/or their protective properties).
• Suitable physiologically compatible excipients include, but are not limited to, saline, aqueous buffer solutions, solvents and/or dispersion media.
• the physiologically compatible excipient is phosphate buffered saline (PBS).
• materials which can serve as physiologically compatible excipients include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl o
• the physiologically compatible excipient is a beverage. In some embodiments, the physiologically compatible excipient is a liquid infant formula. In some embodiments, the excipient inhibits the degradation of the active agent, e.g., the nucleic acid containing micelles.
• the composition contains casein micelles that include the following (by weight): about 30-40% (e.g., about 36%) alpha SI casein, about 5-15% (e.g., about 10%) alpha s2 casein, about 30-40% (e.g., about 34%) beta casein, about 5-15% (e.g., about 12%) kappa casein, and about 7% colloidal mineral complex (including phosphate, calcium, magnesium and citrate) in phosphate-buffered saline, where the total amount of casein phosphoproteins is about 8% of the composition, weight by volume.
• casein micelles that include the following (by weight): about 30-40% (e.g., about 36%) alpha SI casein, about 5-15% (e.g., about 10%) alpha s2 casein, about 30-40% (e.g., about 34%) beta casein, about 5-15% (e.g., about 12%) kappa casein, and about 7% colloidal mineral complex (including phosphat
• the method in general includes combining: a therapeutic nucleic acid, at least two phosphoproteins selected from alpha si casein, alpha s2 casein, beta casein, and kappa casein; and a physiologically compatible excipient, under conditions sufficient to form micelles comprising the at least two phosphoproteins in the composition.
• the components of the composition may be combined using any suitable option.
• the casein phosphoproteins are first combined with the physiologically compatible excipient to make a casein composition, and then, the nucleic acid is combined with the casein composition to generate the composition for enhanced oral bioavailability of the nucleic acid. Any suitable option may be used to generate the casein composition. Suitable methods of providing a composition with casein phosphoproteins are described, e.g., in European Pat. No. 2732710B1, the entire disclosure of which is incorporated herein by reference.
• one or more components of the composition are preserved and can be reconstituted into a composition for orally administering the nucleic acid to a subject.
• the casein phosphoproteins of the composition are preserved, and are reconstituted into the composition for orally administering the nucleic acid to a subject.
• the nucleic acids are preserved, and are reconstituted into a composition (e.g., a composition with casein phosphoproteins and a physiologically compatible excipient) for orally administering to a subject.
• “Preserved” as used herein can describe a state in which the functional activity of the nucleic acids (whether alone, or integrated into the compositions provided for herein), as described herein, is retained for at least a defined period under standard storage conditions.
• the preserved nucleic acid retains 10% or more, e.g., 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, or about 100% of the functional activity when reconstituted after storage compared to the functional activity before being preserved.
• the nucleic acids are preserved and stored under standard storage conditions for 1 day or more, e.g., 2 days or more, 5 days or more, 2 weeks or more, one month or more, 3 months or more, 6 months or more, 1 year or more, 3 years or more, 5 years or more, including 10 years or more.
• the nucleic acids e.g., encapsulated in casein-chitosan coated micelles
• the nucleic acids are preserved and stored under standard storage conditions for a period of 1 day to 5 years, e.g., 5 days to 3 years, 10 days to 2 years, one month to 1 year, including 3 months to 6 months.
• the nucleic acids are stored under any suitable standard storage conditions.
• a standard storage condition includes a temperature of 25 °C or lower, e.g., 20 °C or lower, 15 °C or lower, 10 °C or lower, 5 °C or lower, 0 °C or lower, -10 °C or lower, -20 °C or lower, -30 °C or lower, -40 °C or lower, -50 °C or lower, -60 °C or lower, -70 °C or lower, including -80 °C or lower.
• a standard storage condition has a temperature in the range of -90 °C to -80 °C, -80 °C to -70 °C, -70 °C to -60 °C, -60 °C to -50 °C, -50 °C to -40 °C, -40 °C to , -30 °C, -30 °C to -20 °C, -20 °C to -10 °C, -10 °C to -5 °C, -5 °C to 0 °C, 0 °C to 5 °C, 5 °C to 10 °C, 10 °C to 15 °C, 15 °C to 20 °C, 20 °C to 25 °C, 25 °C to 30 °C, or 30 °C to 35 °C.
• a standard storage condition is at room temperature and standard atmospheric pressure.
• the nucleic acids are preserved in any suitable manner.
• they are frozen.
• Means for freezing exosomes are described in, e.g., Bosch et al., Sci Rep. 2016 Nov 8;6:36162.
• they are lyophilized.
• Means for lyophilizing exosomes are described in, e.g., PCT Publication No. W02018070939.
• the nucleic acids e.g., encapsulated in casein- chitosan coated micelles
• the exosomes are reconstituted into a physiologically acceptable excipient, such as water or a buffer solution.
• compositions of the present disclosure find use in a variety of situations where systemic delivery of therapeutic nucleic acids (e.g., coding or non-coding RNAs) is desired, e.g., to treat a disorder or disease that can be treated by systemic delivery of therapeutic nucleic acids.
• therapeutic nucleic acids e.g., coding or non-coding RNAs
• methods that include orally administering to a subject any of the compositions as described herein.
• the subject has or is at risk of developing a myodegenerative disorder, and the composition comprises therapeutic nucleic acids, to thereby treat the myodegenerative disorder.
• the subject is human.
• compositions of the present disclosure can provide for enhanced bioavailability of the therapeutic nucleic acids when the composition is administered orally.
• the bioavailability is enhanced compared to a suitable control composition, e.g., a composition that does not include the casein phosphoproteins, the chitosan polymers, and/or the casein-chitosan complex.
• the oral bioavailability of the therapeutic nucleic acids in the composition is enhanced by about 2 fold, about 3 fold, about 4 fold, about 5 fold, about 6 fold, about 7 fold, about 8 fold, about 9 fold, about 10 fold, about 11 fold, about 12 fold, about 13 fold, about 14 fold, about 15 fold, about 16 fold, about 17 fold, about 18 fold, about 19 fold, about 20 fold, about 25 fold, about 30 fold, about 40 fold, about 50 fold, about 60 fold, about 70 fold, about 80 fold, about 90 fold, about 100 fold, about 200 fold, about 300 fold, about 400 fold, about 500 fold, about 1,000 fold, about 2,000 fold, about 5,000 fold, about 10,000 fold or more, or enhanced by a fold amount within a range defined by any two of the preceding values, compared to the oral bioavailability of a control composition
• the enhanced oral bioavailability includes increased representation of different species within a class of payload molecules (e.g., unique nucleic acid sequences among all nucleic acid sequences).
• substantially all species within a class of payload molecules are bioavailable.
• at least about 50%, e.g., at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, including at least about 99% of species within a class of payload molecules are bioavailable.
• the payload molecules are exosomal nucleic acids.
• the payload molecules are ruRNA, ncRNA, IncRNA, or miRNA.
• the payload molecules are proteins.
• the payload molecules are small molecules.
• payload molecules are synthetic payloads, e.g., synthetic nucleic acids, proteins, or small molecules.
• the enhanced oral bioavailability is achieved by the composition within about 1 week, within about 5 days, within about 3 days, within about 1 day, within about 18 hours, within about 12 hours, within about 10 hours, within about 8 hours, within about 6 hours, within about 5 hours, within about 4 hours, within about 3 hours, within about 2 hours, within about 1 hour, within about 30 minutes, within about 15 minutes, or within any interval of time in a range defined by any two of the preceding values after oral administration.
• the chitosan is low molecular weight chitosan. In several embodiments, the chitosan ranges from about ranges in mass from about 50 to about 190 kiloDaltons. In some embodiments, higher molecular weight chitosan is used. In several embodiments, the chitosan is present in an amount ranging from about 0.001 to about 0.1% of the formulation by weight per volume. In several embodiments, the chitosan is present in an amount ranging from about 0.01 to about 0.1% of the formulation by weight per volume. In several embodiments, the chitosan is present in an amount ranging from about 0.05 to about 0.1% of the formulation by weight per volume.
• the formulation is generated based on ratios of the various components of the formulation.
• is the ratio of casein to RNA to chitosan ranges from about 1000:1:25 to about 500:1:15 (%w/v).
• the ratio of casein to RNA ranges from about 500:1 to about 1000:1.
• the ratio of RNA to chitosan ranges from about 1:10 to about 1:50.
• these ratios are employed with a volume of liposome that ranges from about 0.5 to about 3 microliters for each microgram of RNA used.
• Ratios may also be used between any two given components of a composition, ranging from 1:1, 2:1, 3:1, 4:1, 5:1, 10:1, 50:1, 100:1, 1000:1, 1:1000, 1:500, 1:100, 1:50, 1:5, 1:4, 1:3, 1:2, etc.
• the composition includes extracellular vesicles (EV), e.g., exosomes.
• the extracellular vesicles (EV) can be those from any suitable source, e.g., EV derived from cardiosphere-derived cells (CDC), or from fibroblasts.
• Suitable EV, such as CDC-derived EV, are provided in, e.g., U.S. Application Publication Nos. 20080267921, 20160158291 and 20160160181; Smith et al., Circulation. 2007. 115:896-908; Aminzadeh, M. A. et al. Stem Cell Reports 10, 942-955 (2016); and (2004) et al., Stem Cell Reports.
• the EVs are those isolated from serum- free media conditioned by human CDCs in culture.
• the composition includes EV and liposomes and/or PCLC as transfection reagents.
• the composition is substantially free of CDC-derived EV.
• EVs e.g., exosomes, disclosed herein can vary in size, depending on the embodiment. Depending on the embodiment, the size of the EVs ranges in diameter from about 15 nm to about 95 nm in diameter, including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 95 nm, and overlapping ranges thereof.
• EVs are larger (e.g., those ranging from about 140 to about 210 nm, including about 140 nm to about 150 nm, about 150 nm to about 160 run, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, 190 nm to about 200 nm, about 200 nm to about 210 nm, and overlapping ranges thereof).
• the EV diameter is in a range of about 15 nm to about 200 nm in diameter, including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 100 nm, about 100 nm to about 110 nm, about 110 nm to about 120 nm, about 120 nm to about 130 nm, about 130 nm to about 140 nm, about 140 nm to about 150 nm, about 150 nm to about 160 nm, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, about 190 nm, about 190
• the EVs that are generated from the original cellular body are 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000, 5,000, or 10,000 times smaller in at least one dimension (e.g., diameter) than the original cellular body.
• the composition containing the EV and nucleic acid of the present disclosure can be prepared using any suitable option.
• loading the nucleic acid into the EV includes: formulating the nucleic acid with liposomes and/or PCLC, e.g., as provided above, to generate a nucleic acid-liposome mixture; combining the nucleic acid-liposome mixture with the EV; and enriching for EV associated with exosome markers to generate a population of EV enriched for the nucleic acid.
• Combining the nucleic acid- liposome mixture with the EV can be done using any suitable option.
• the nucleic acid-liposome mixture is combined with the EV at 37 °C with shaking for about 30 minutes or more.
• Enriching to generate a population of EV enriched for the nucleic acid can be done using any suitable option.
• enriching for EV associated with exosome markers includes immunoprecipitating EV associated with exosome markers using antibodies specific to an exosome marker.
• the exosome marker is one or more of CD9, CD63 and CD81.
• enriching for EV associated with exosome markers includes immunoprecipitating EV associated with all the exosome markers, CD9, CD63 and CD81.
• the size distribution of the population of EV enriched for the nucleic acid is substantially unimodal.
• the population of EV enriched for the nucleic acid has an average diameter of about 50-180 nm, e.g., 60-170 nm, 70-160 nm, 80-150 nm, 90-140 nm, 100-130 nm, or about 110-130 nm.
• nucleic acid therapeutics offer the potential to treat diseases at a genetic level. Because conventional treatments generally target proteins, rather than the underlying genetic cause, the induced therapeutic effects may be transient. In contrast, nucleic acid therapeutics have the potential for long-lasting (or even permanent, e.g., curative) effects via gene inhibition, addition, replacement, or editing. As disclosed herein, the successful use of nucleic acid therapeutics will hinge on delivery technologies that improve stability and/or bioavailability.
• the formulations provided for herein allow the enhanced delivery of nucleic acids to a subject.
• the nucleic acids comprise DNA.
• the nucleic acids comprise RNA.
• the nucleic acids comprise coding RNA (e.g., messenger RNA or mRNA).
• the nucleic acids comprise non-coding RNAs (ncRNA).
• mRNA can provide therapeutic effects by virtue of delivery of a sequence coding for a protein that yields a therapeutic effect. Depending on the embodiment, that could be a protein that replaces a non-functional protein.
• the coding RNA could encode a protein to which an immune response is desired (e.g., a viral protein), such as for the production of antibodies against that protein.
• ncRNA are known to exhibit positive therapeutic effects based on their ability to increase secretion of anti-inflammatory cytokines or decrease secretion of inflammatory cytokines. Certain ncRNA exhibit cardioprotective, anti-fibrotic, and/or anti-hypertrophic effects.
• Non-coding RNAs are increasingly recognized as bioactive.
• Extracellular vesicles (EVs) derived from progenitor cells contain plentiful and diverse ncRNAs; cardiosphere-derived cells, for example, secrete EVs rich in small Y RNAs.
• Nucleic acids that exhibit therapeutic effects can be delivered using the formulations provided for herein.
• ncRNAs that suppress hypertrophic, inflammatory and fibrotic gene families in isolated macrophages, restore cardiac function and exercise endurance, and/or reduce serum biomarkers of heart failure and inflammation can be used according to embodiments disclosed herein.
• ncRNA that antagonize upregulation of ERK/Map Kinase, fibrotic and inflammatory signaling in tissues can be used. Any ncRNA that exhibits positive effects against pathological processes as diverse as ischemia (myocardial infarction), myodegeneration (Duchenne muscular dystrophy) and autoimmunity (scleroderma) or exhibit other positive disease-modifying bioactivity can be used according to embodiments disclosed herein.
• Table 1 includes non-limiting example of such ncRNA to use as a therapeutic to treat diseases associated with inflammation and/or fibrosis. Table 1
• nucleic acid that includes a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12), or a variant thereof.
• the nucleic acid is RNA.
• nucleic acid includes a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%, 99% identical to CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12), or to any of the nucleic acid sequences provided for herein.
• the nucleic acid includes a nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12) with a sequence variation at up to 1, 2, 3, 4, or 5 positions in the nucleotide sequence.
• a “position” within a nucleotide sequence or nucleic acid is defined relative to the 5’ end of the nucleotide sequence or nucleic acid.
• the nucleotide sequence of the nucleic acid is CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12), or a sequence variant thereof.
• the nucleic acid can be any suitable length. In some embodiments, the nucleic acid is 24 nucleotides (nt) long.
• the nucleic acid is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nt long, or longer. In some embodiments, the nucleic acid is at most 30 nt long. In some embodiments, the nucleic acid is 16-30 nt long, or 24-30 nt long.
• a nucleic acid of the present disclosure can be single stranded or double stranded (e.g., RNA/DNA hybrid). In some embodiments, the nucleic acid is single stranded.
• An isolated nucleic acid of the present disclosure in some embodiments includes one or more chemically-modified nucleotides, e.g., nucleotides with a modified backbone.
• the chemical modification(s) is one that substantially preserves or enhances the therapeutic potency of the nucleic acid. Any suitable number of nucleotides of the nucleic acid can be chemically modified.
• the nucleic acid includes 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more chemically-modified nucleotides.
• the nucleic acid includes 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-15, 1-20, 1-25, or 1-30 chemically-modified nucleotides. In some embodiments, the nucleic acid includes 1-10 chemically-modified nucleotides. In some embodiments, the nucleic acid includes 8 chemically-modified nucleotides. In some embodiments, the nucleic acid includes 6 chemically-modified nucleotides.
• the chemically modified nucleotides can be distributed along the isolated nucleic acid in any suitable manner.
• the nucleic acid includes at least one chemically-modified nucleotide within the first half of the nucleic acid, e.g., the 5’ half of the nucleic acid.
• the nucleic acid includes at least one chemically- modified nucleotide within the second half of the nucleic acid, e.g., the 3’ half of the nucleic acid.
• the nucleic acid includes at least one chemically-modified nucleotide within the first half of the nucleic acid, e.g., the 5’ half of the nucleic acid, and at least one chemically-modified nucleotide within the second half of the nucleic acid, e.g., the 3’ half of the nucleic acid.
• the nucleic acid includes one or more chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 5’ end of the nucleic acid.
• the nucleic acid includes one or more chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 3’ end of the nucleic acid. In some embodiments, no two chemically-modified nucleotides are adjacent each other in the nucleic acid. In some embodiments, the nucleic acid includes 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 5’ end of the nucleic acid.
• the nucleic acid includes 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 3’ end of the nucleic acid. In some embodiments, the nucleic acid includes the same number of chemically-modified nucleotides in the 5’ half and 3’half of the nucleic acid. In some embodiments, the nucleic acid includes 3 chemically-modified nucleotides within 5 nucleotides from the 5’ end of the nucleic acid and/or 3 chemically-modified nucleotides within 5 nucleotides from the 3’ end of the nucleic acid.
• the chemically-modified nucleotides are within the nucleotide sequence of CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12), or sequence variant thereof, or other nucleic acid sequence provided for herein.
• the nucleic acid includes at least one chemically-modified nucleotide within the first half of the nucleotide sequence, e.g., the 5’ half of the nucleotide sequence.
• the nucleic acid includes at least one chemically-modified nucleotide within positions 1-12 of the nucleotide sequence.
• the nucleic acid includes at least one chemically-modified nucleotide within the second half of the nucleotide sequence, e.g., the 3’ half of the nucleotide sequence. In some embodiments, the nucleic acid includes at least one chemically-modified nucleotide within positions 13-24 of the nucleotide sequence. In some embodiments, the nucleic acid includes at least one chemically-modified nucleotide within positions 1-12 of the nucleotide sequence, and at least one chemically- modified nucleotide within positions 13-24 of the nucleotide sequence.
• the nucleic acid includes one or more chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 5’ end of the nucleotide sequence. In some embodiments, the nucleic acid includes one or more chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 3’ end of the nucleotide sequence. In some embodiments, no two chemically-modified nucleotides are adjacent each other in the nucleotide sequence.
• the nucleic acid includes 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 5’ end of the nucleotide sequence. In some embodiments, the nucleic acid includes 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 3’ end of the nucleotide sequence. In some embodiments, the nucleic acid includes the same number of chemically-modified nucleotides in the 5’ half and 3 ’half of the nucleotide sequence.
• the nucleic acid includes 3 chemically-modified nucleotides within 5 nucleotides from the 5’ end of the nucleotide sequence and/or 3 chemically-modified nucleotides within 5 nucleotides from the 3’ end of the nucleotide sequence. In some embodiments, the nucleic acid includes a different number of chemically-modified nucleotides in the 5’ half and 3 ’half of the nucleotide sequence. In some embodiments, the nucleic acid includes a greater number of chemically-modified nucleotides in the 3’ half than in the 5 ’half of the nucleotide sequence.
• the nucleic acid includes 3 chemically-modified nucleotides within 5 nucleotides from the 5’ end of the nucleotide sequence and/or 3, 4, or 5 chemically-modified nucleotides within 5 nucleotides from the 3’ end of the nucleotide sequence.
• the isolated nucleic acid includes a chemically- modified nucleotide at one or more of positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence. In some embodiments, the isolated nucleic acid includes a chemically-modified nucleotide at positions 1, 3, 5, 20, 22 and 24 of the nucleotide sequence. In some embodiments, the isolated nucleic acid has the nucleotide sequence CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12), or a sequence variant thereof, where one or more of positions 1, 3, 5, 20, 22, and 24 are chemically modified.
• the chemically-modified nucleotide(s) increases in vitro and/or in vivo stability of the nucleic acid. In some embodiments, the chemically-modified nucleotide(s) increases therapeutic potency of the nucleic acid, e.g., for treating an inflammatory condition, cardiac injury, or muscular dystrophy.
• the isolated nucleic acid in some embodiments includes one type, or two or more different types of chemically-modified nucleotides.
• the chemically-modified nucleotide has a methylene bridge connecting the 2’-0 atom and the 4’- C atom of the nucleotide sugar ring to lock the conformation (Locked Nucleic Acid (LNA)).
• the isolated nucleic acid includes the nucleotide sequence CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12), or a sequence variant thereof, where one or more of positions 1, 3, 5, 20, 22, and 24 are LNA.
• the isolated nucleic acid has the nucleotide sequence CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 12), or a sequence variant thereof, where one or more of positions 1, 3, 5, 20, 22, and 24 are LNA.
• the isolated nucleic acid includes the nucleotide sequence CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 2), or a sequence variant thereof, where positions 1, 3, 5, 20, 22, and 24 are LNA.
• the isolated nucleic acid has the nucleotide sequence CGUCCGAUGGUAGUGGGUUAUCAG (SEQ ID NO: 2), where positions 1, 3, 5, 20, 22, and 24 are LNA.
• the isolated nucleic acid in some embodiments, can include any suitable chemical modification.
• the chemical modification is a backbone modification, e.g., modification of the sugar/phosphate backbone.
• the chemical modification is a backbone sugar modification.
• the chemically modified nucleotide includes a LNA.
• the chemical modification includes the introduction of a phosphorothioate group as linker between nucleotides.
• Suitable backbone modifications of the chemically-modified nucleotides include, without limitation, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.
• the chemical modification is a base modification.
• the nucleic acids of the present disclosure can be prepared using any suitable option. Suitable options include, without limitation, chemical synthesis, enzymatic production and/or biological production. In some embodiments, the nucleic acids are prepare using chemical synthesis. Any suitable option for chemical synthesis of nucleic acids can be used. Suitable options include, without limitation, phosphodiester, phosphotriester, phosphoramidite, phosphite-triester, and solid phase synthesis approaches. In some embodiments, preparing the nucleic acids includes in vitro transcription. In some embodiments, the nucleic acids are prepared using recombinant DNA technology. In some embodiments, the nucleic acids are prepared by chemically modifying an unmodified nucleic acid having a nucleotide sequence of interest.
• treatment methods comprise oral formulations that carry nucleic acids (e.g., RNA) as a therapeutic payload.
• Conditions that may be treated by the treatment methods include, but are not limited to, those diseases associated with, for example, inflammation and/or fibrosis. Conditions include, without limitation, heart conditions, muscular disorders, myocardial infarction, cardiac disorders, myocardial alterations, muscular dystrophy, fibrotic disease, inflammatory disease, viral infection, scleroderma, heart failure with preserved ejection fraction, sepsis and/or wound healing.
• the conditions treated by the present treatment methods are a symptom and/or sequelae of an infection.
• the infection is a viral infection, e.g., a respiratory virus infection, such as COVID-19, infections due to other coronaviruses, or other viral pathogens (e.g., flu, H1N1, Hepatitis C, HIV, etc.).
• a treatment method includes a method of treating a muscle disorder (or muscle condition) or symptom thereof, the method including orally administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of one or more of the compositions containing a nucleic acid of the present disclosure.
• the muscle disorder can be, without limitation, a skeletal muscle disorder or a cardiac muscle disorder.
• the muscle disorder includes muscular dystrophy, e.g., Duchenne muscular dystrophy.
• the subject has muscular dystrophy, or is at risk of developing muscular dystrophy.
• the subject is genetically predisposed to developing muscular dystrophy, e.g., Duchenne muscular dystrophy.
• the subject has one or more mutations in a dystrophin gene that predisposes the subject to developing muscular dystrophy, e.g., Duchenne muscular dystrophy.
• a treatment method includes a method of treating a heart condition or symptom thereof, the method including orally administering to a subject in need of treating a heart condition or symptom thereof a therapeutically effective amount of the one or more of the compositions containing a nucleic acid of the present disclosure.
• the subject is a human subject.
• the subject is a non-human subject, e.g., a non-human mammal.
• the heart condition includes a symptom and/or sequelae of heart failure or myocardial infarction.
• the heart condition includes hypertrophic cardiomyopathy.
• the heart condition includes heart failure with preserved ejection fraction (HFpEF).
• the subject is at risk of developing the heart condition. In some embodiments, the subject is at risk of developing the heart condition based on one or more of the subject’s family history, genetic predisposition, life style, and medical history. In some embodiments, the subject has a mutation in cardiac troponin I that predisposes the subject to developing hypertrophic cardiomyopathy (HCM). In some embodiments, the subject has one or more comorbidities for the heart condition. In some embodiments, the one or more comorbidities includes obesity and hypertension. In some embodiments, the subject has, or is diagnosed with, the heart condition.
• HCM hypertrophic cardiomyopathy
• the subject exhibits one or more of: hypertension, elevated E/e’ ratio, cardiac hypertrophy, myocardial fibrosis, obesity, wasting, reduced endurance, and elevated systemic inflammatory markers.
• the subject has hypertension, and administering the therapeutically effective amount of the nucleic acid (or composition thereof) reduces the subject’s blood pressure.
• a subject having hypertension has a resting blood pressure of over 130/90 mmHg. In some embodiments, a subject having hypertension has a resting blood pressure of over 140/90 mmHg.
• administering the therapeutically effective amount of the nucleic acid (or composition thereof) reduces the subject’s systolic blood pressure or diastolic blood pressure.
• the subject’s blood pressure is reduced by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30% or more, or by a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the nucleic acid (or composition thereof).
• the subject s blood pressure (systolic or diastolic blood pressure) is reduced at least to a level that is deemed no longer to be hypertensive after administering the therapeutically effective amount of the nucleic acid (or composition thereof).
• the subject has an elevated E/e’ ratio, and administering the therapeutically effective amount of the nucleic acid (or composition thereof) reduces the E/e’ ratio.
• the subject’s E/e’ ratio is reduced by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or more, or by a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the nucleic acid (or composition thereof).
• the subject’s E/e’ ratio is reduced at least to a level that is deemed no longer to be clinically relevant after administering the therapeutically effective amount of the nucleic acid (or composition thereof).
• the subject has cardiac hypertrophy, and oral administration of the therapeutically effective amount of a composition comprising a nucleic acid reduces cardiac hypertrophy.
• Cardiac hypertrophy can be measured using any suitable option.
• cardiac hypertrophy is measured using echocardiography.
• a subject having cardiac hypertrophy has an increased diastolic interventricular septal wall diameter (IVSd) and/or left ventricular posterior wall diameter (LVPWd), as measured by echocardiography, and administering the therapeutically effective amount of the nucleic acid (or composition thereof) reduces the IVSd and/or LVPWd.
• IVFSd interventricular septal wall diameter
• LVPWd left ventricular posterior wall diameter
• the subject’s IVSd or LVPWd is reduced by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30% or more, or by a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the nucleic acid (or composition thereof). In some embodiment, the subject’s IVSd or LVPWd is reduced at least to a level that is deemed no longer to be hypertrophic after administering the therapeutically effective amount of the composition comprising a nucleic acid.
• the subject has myocardial fibrosis, and orally administering the therapeutically effective amount of a composition comprising a therapeutic nucleic acid as provided for herein prevents or reduced fibrosis.
• “Fibrosis” as used herein can include any remodeling (e.g., pathological remodeling) of the myocardium, such as, but not limited to, deposition of fibrotic and/or fatty tissue, replacement of muscle tissue with fibrotic and/or fatty tissue, etc.
• Cardiac fibrosis is monitored using any suitable means, such as biopsy, ultrasonography or MRI.
• orally administering a composition comprising a therapeutic nucleic acid as provided for herein eliminates or retards the development of myocardial fibrosis and/or muscle fibrosis.
• the subject exhibits wasting or weight loss, and orally administering a composition comprising a therapeutic nucleic acid as provided for herein retards or prevents the wasting.
• the subject exhibits body weight loss of at most about 20%, 15%, 10%, 5%, 3% or less, or a percentage in a range defined by any two of the preceding values, after administering the therapeutically effective amount of the nucleic acid (or composition thereof).
• the subject s body weight recovers to, or is maintained at substantially the pre-treatment level after orally administering a composition comprising a therapeutic nucleic acid as provided for herein.
• the subject exhibits reduced endurance, e.g., exercise endurance, and orally administering a composition comprising a therapeutic nucleic acid as provided for herein retards or prevents the decline in endurance.
• the subject exhibits a decline in endurance of at most about 20%, 15%, 10%, 5%, 3% or less, or a percentage in a range defined by any two of the preceding values, after orally administering a composition comprising a therapeutic nucleic acid as provided for herein.
• the subject’s exercise endurance recovers to, or is maintained at substantially the pre-treatment level after orally administering a composition comprising a therapeutic nucleic acid as provided for herein.
• the subject exhibits an improvement in endurance of at least about 5%, 10%, 15%, 20%, 25%, 30% 35%, 40%, 50% or more, or a percentage in a range defined by any two of the preceding values, after orally administering a composition comprising a therapeutic nucleic acid as provided for herein.
• the improvement in endurance after orally administering a composition comprising a therapeutic nucleic acid as provided for herein is sustained over the duration of treatment.
• the improvement in endurance after orally administering a composition comprising a therapeutic nucleic acid as provided for herein is sustained across multiple doses of administration.
• the subject exhibits elevated levels of systemic inflammatory markers, e.g., in the peripheral blood.
• the systemic inflammatory marker includes one or more of IL-6 and brain natriuretic peptide (BNP).
• BNP brain natriuretic peptide
• the level of the systemic inflammatory marker is reduced by at least about 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or more, or by a percentage in a range defined by any two of the preceding values, after orally administering a composition comprising a therapeutic nucleic acid as provided for herein.
• the subject’s systemic inflammatory marker is reduced at least to a level that is deemed no longer to be elevated after orally administering a composition comprising a therapeutic nucleic acid as provided for herein.
• the therapeutic effect of administering the nucleic acid is independent of the subject’s obesity.
• orally administering a composition comprising a therapeutic nucleic acid as provided for herein does not affect the subject’s weight.
• the subject exhibits reduced skeletal muscle function, e.g., the amount of force or torque exerted by a skeletal muscle group.
• the subject exhibits reduced skeletal muscle function and orally administering a composition comprising a therapeutic nucleic acid as provided for herein retards the development of reduced skeletal muscle function, prevents deterioration of skeletal muscle function, or enhances skeletal muscle function.
• the subject s skeletal muscle function recovers to, or is maintained at substantially the pre-treatment level after orally administering a composition comprising a therapeutic nucleic acid as provided for herein.
• the subject exhibits an improvement in skeletal muscle function of at least about 5%, 10%, 15%, 20%, 25%, 30% 35%, 40%, 50% or more, or a percentage in a range defined by any two of the preceding values, after orally administering a composition comprising a therapeutic nucleic acid as provided for herein.
• any of the therapeutic effects of orally administering a composition comprising a therapeutic nucleic acid as provided for herein is sustained over the duration of treatment. In some embodiments, any of the therapeutic effects of orally administering a composition comprising a therapeutic nucleic acid as provided for herein is sustained across multiple doses of administration is sustained across multiple doses of administration. In some embodiments, any of the therapeutic effects of orally administering a composition comprising a therapeutic nucleic acid as provided for herein is not transient over the duration of treatment.
• a treatment method of the present disclosure treats any one or more of a variety of inflammatory conditions.
• the inflammatory condition is a chronic condition.
• the inflammatory condition is one that is responsive to the anti-inflammatory effect of IL-10.
• the inflammatory condition includes an autoimmune disease, graft-versus-host disease (GVHD) or an immune response to an organ transplant.
• the inflammatory condition includes viral infection, sepsis, arthritis (rheumatoid arthritis, juvenile rheumatoid arthritis, psoriatic arthritis), multiple sclerosis, pemphigus, and type 1 diabetes (also referred to as insulin-dependent diabetes mellitus (IDDM)).
• IDDM insulin-dependent diabetes mellitus
• the inflammatory condition includes Behcet's disease, polymyositis/dermatomyositis, autoimmune cytopenias, autoimmune myocarditis, primary liver cirrhosis, Goodpasture's syndrome, autoimmune meningitis, Sjogren's syndrome, systemic lupus erythematosus, Addison's disease, alopecia greata, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, insulin-dependent diabetes mellitus, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scle
• the inflammation is related to a bone marrow transplantation. In some embodiments, the inflammation is related to allograft rejection following tissue transplantation. In some embodiments, the autoimmune disease is a cardiac autoimmune disease, e.g., autoimmune myocarditis.
• a treatment method of the present disclosure treats symptoms and/or sequelae of any one or more of a variety of infectious diseases.
• a heart condition or inflammatory condition treated by the nucleic acids of the present disclosure includes a symptom and/or sequelae of an infectious disease.
• the infectious disease is associated with myocardial injury.
• the heart condition includes acute myocarditis associated with the infectious disease.
• the inflammatory condition includes a cytokine storm, or hyperinflammation, associate with the infectious disease.
• the inflammatory condition includes acute lung injury or acute respiratory distress syndrome (ARDS).
• the infectious disease is an infection by, without limitation, one or more of the following pathogens: viruses (including but not limited to coronavirus, human immunodeficiency vims, herpes simplex virus, papilloma vims, parainfluenza vims, influenza vims, hepatitis vims, Coxsackie Vims, herpes zoster vims, measles vims, mumps vims, rubella, rabies vims, hemorrhagic viral fevers, H1N1, and the like), prions, parasites, fungi, mold, yeast and bacteria (both gram-positive and gram negative).
• viruses including but not limited to coronavirus, human immunodeficiency vims, herpes simplex virus, papilloma vims, parainfluenza vims, influenza vims, hepatitis vims, Coxsackie Vims, herpes zoster vim
• pathogens include, without limitation, Candida albicans, Aspergillus niger, Escherichia coli ( E . coli), Pseudomonas aeruginosa ( P . aeruginosa), and Staphylococcus aureus ( S . aureus), Group A streptococci, S. pneumoniae, Mycobacterium tuberculosis, Campylobacter jejuni, Salmonella, Shigella, and a variety of drug resistant bacteria.
• the inflammation is subsequent to or concurrent with an infection by a vims, e.g., a DNA or RNA vims.
• the vims is an RNA vims, e.g., a single or double- stranded vims.
• the RNA vims is a positive sense, single- stranded RNA vims.
• the vims belongs to the Nidovirales order.
• the vims belongs to the Coronaviridae family.
• the vims belongs to the alphacoronavims, betacoronavims, gammacoronavims or deltacoronavims genus.
• the alphacoronavims is, without limitation, human coronavims 229E, human coronavirus NL63 or transmissible gastroenteritis vims (TGEV).
• the betacoronavims is, without limitation, Severe Acute Respiratory Syndrome Coronavims (SARS-CoV), SARS-CoV-2 (COVID-19), Middle Eastern Respiratory Syndrome Coronavims (MERS-CoV), human coronavims HKU1, or human coronavims OC43.
• the gammacoronavims is infectious bronchitis vims (IBV).
• the nucleic acid can be administered to the subject at any suitable amount (e.g., the amount within the oral formulations as provided for herein).
• the therapeutically effective amount of the nucleic acid includes about 0.01 pg, 0.02 pg, 0.05 pg, 0.1 pg, 0.2 pg, 0.5 pg, 1 pg, 2 pg, 3 pg, 4 pg, 5 pg, 6 pg, 7 pg, 8 pg, 9 pg, 10 pg, 15 pg, 20 pg, 25 pg, 30 pg, 40 pg, 50 pg, 75 pg, 100 pg, 125 pg, 150 pg, 175 pg, 200 pg, 250 pg, 300 pg, 400 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 mg, 2 mg, 3 mg, 4
• the therapeutically effective amount of the nucleic acid includes about 0.001 pg/g, 0.002 pg/g, 0.005 pg/g, 0.01 pg/g, 0.02 pg/g, 0.05 pg/g, 0.1 pg/g, 0.15 pg/g, 0.2 pg/g, 0.5 pg/g, 1 pg/g, 2 pg/g, 3 pg/g, 4 pg/g, 5 pg/g, 6 pg/g, 7 pg/g, 8 pg/g, 9 pg/g, 10 pg/g, 15 pg/g, 20 pg/g, 25 pg/g, 30 pg/g, 35 pg/g, 40 pg/g, 45 pg/g, 50 pg/g, 60 pg/g, 70 pg/g, 80 pg/g, 90 pg/g,
• the nucleic acid or composition can be administered to the subject at any suitable dosing schedule.
• the therapeutically effective amount of the nucleic acid or the composition is administered to the subject no more frequently than twice a week, once a week, once every two weeks, once every month, once every two months, once every three months, once every four months or longer, or at a frequency in a range defined by any two of the preceding values.
• the nucleic acid is administered to the subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or more times.
• the nucleic acid is administered to the subject at regular intervals.
• formulations are disclosed herein that can be administered using any suitable route, several embodiments of the formulations provided are unexpectedly suitable for oral delivery.
• administration can be local or systemic.
• administration is parenteral. Suitable option for administration include, without limitation, intravenous, intramuscular, subcutaneous, intra-arterial, intraperitoneal, or oral administration.
• the nucleic acid or composition is administered intravenously.
• the nucleic acid or composition is administered by infusion. According to preferred embodiments, the composition is administered orally. Kits
• kits that include a nucleic acid-containing composition of the present disclosure.
• the present kit in some embodiments finds use in treating a muscle disorder, a heart condition or an inflammatory condition (e.g., associated with a viral infection), as provided herein.
• a kit can include the nucleic acid of the present disclosure and a transfection reagent.
• the transfections reagent can be any suitable transfection reagent, as provided herein.
• the kit includes a pharmaceutically acceptable excipient, as provided herein.
• the kit includes casein and/or chitosan.
• Kits can include one or more containers (e.g., vials, ampoules, test tubes, flasks or bottles) for holding one or more components of the kits.
• the kits may further include instructions for using the kit to treat a condition (e.g., HCM, HFpEF, muscular dystrophy, scleroderma, and/or an inflammatory condition associated with a viral infection).
• a condition e.g., HCM, HFpEF, muscular dystrophy, scleroderma, and/or an inflammatory condition associated with a viral infection.
• the information and instructions may be in the form of words, pictures, or both, and the like.
• compositions comprising a therapeutic nucleic acid, such as a coding or non-coding RNA, the compositions being formulated for oral administration.
• these compositions are formulated, by way of example, according to the general schematic of Figure 1A.
• Figure IB shows alternative embodiments.
• Figure 1A depicts a non-limiting embodiment in which a nucleic acid (such as RNA, in particular a non-coding RNA with therapeutic effects upon administration) is encapsulated in an artificial lipid micelle.
• a nucleic acid such as RNA, in particular a non-coding RNA with therapeutic effects upon administration
• an artificial lipid micelle is suitable for optional IV delivery.
• the artificial micelle is coated with casein protein.
• the casein-coated micelle is subsequently exposed to an acidic solution and chitosan, which results in a casein-chitosan coated micelle.
• the casein-chitosan coated micelle allows for oral delivery of the nucleic acid with increased bioavailability of the nucleic acid due to the casein-chitosan coated micelle imparting acid resistance to the composition, allowing it to pass through the acidic environment of the stomach with limited degradation.
• Figures 2A-2B show two examples of RNAs that were encapsulated in this fashion.
• Figure 2A shows the composition comprising a TY4 RNA.
• Figure 2B shows the composition of comprising a piR-659 (also referred to as piREXl).
• Figure 2C shows sample data (from a myocardial infarction model) that demonstrates that encapsulated piREXl RNA delivered orally (as well as piREXl with a nucleic acid modification) significantly reduced infarct size as compared to animals receiving vehicle.
• the circulating concentration of cardiac troponin I was significantly reduced when therapeutic piREXl RNA was delivery orally, according to compositions provided for herein.
• This non-limiting example shows the therapeutic effect of a therapeutic nucleic acid, here the non-limiting example is TY4, in particular orally administered TY4, in a model of heart failure with preserved ejection fraction (HFpEF).
• a therapeutic nucleic acid here the non-limiting example is TY4, in particular orally administered TY4, in a model of heart failure with preserved ejection fraction (HFpEF).
• TY4 was tested in mice with HFpEF, with oral administration investigated as well.
• This “two-hit” model incorporates two comorbidities commonly associated with human HFpEF (obesity and hypertension) and reproduces nitric oxide signaling abnormalities seen in heart tissue from HFpEF patients.
• Fig. 3A depicts the experimental protocol. Mice were either observed without intervention (WT) or fed a high-fat diet (HFD) and L-NAME-supplemented water. Within 5 weeks, the HFD/L-NAME mice become obese and hypertensive, with diastolic dysfunction but normal EF (by baseline echos). The HFpEF mice were then randomly assigned to receive twice-weekly r.o. injection (“IV Inj.”) or oral dose (“Oral”) of vehicle or TY4. TY4 was administered at 0.15 pg/g per injection or per oral administration.
• IV Inj. twice-weekly r.o. injection
• Oral oral dose
• TY4 was first combined with liposomes to form a TY4-liposome complex, which was then encapsulated in a casein-chitosan complex as provided for herein.
• mice Pre-infusion/pre-oral administration and at various time points later, mice underwent blood pressure measurements, treadmill testing, echocardiography, and/or blood draws for circulating biomarkers. The only differences among groups at baseline were those associated with disease (hypertension, low exercise tolerance, elevated E/e’ ratios in HFpEF vs WT).
• Figs. 3A-3C TY4 administered intravenously reverses disease progression in HFpEF mice.
• Fig. 3A schematic study design. At study endpoint animals which received TY4 intravenously had lower systolic (SBP) and diastolic blood pressure (DBP) (Fig. 3B), improved exercise tolerance (Fig. 3C) and diastolic function (E/e’, Fig. 3D), and reduced levels of a serum biomarker of heart failure (BNP; Fig. 3E).
• SBP systolic
• DBP diastolic blood pressure
• Fig. 3C improved exercise tolerance
• E/e diastolic function
• BNP serum biomarker of heart failure
• Fig. 3F systolic and diastolic
• Fig. 3G reduced E/e’ ratios
• Fig. 3H increased exercise tolerance
• Fig. 31 reduced BNP levels
• Fig. 31 Blood pressure, exercise tolerance and E/e’ ratios were comparable to WT levels (non-HFpEF animals) in animals treated orally with TY4.
• Figs. 3F-3I TY4 administered orally reverses disease progression in HFpEF mice. The experimental protocol is shown in Fig. 3A.
• orally administering therapeutically effective amounts of a therapeutic nucleic acid, such as a non-coding RNA similar in function to TY4 to a subject having HFpEF treats the HFpEF (or one or more symptoms thereof, including without limitation, inflammation and/or fibrosis).
• repeated oral administration of a nucleic acid, such as a non-coding RNA to a subject having HFpEF treats the HFpEF (or one or more symptoms thereof).
• intravenously or orally administering therapeutically effective amounts of TY4 to a subject having HFpEF reduces or alleviates one or more symptoms of HFpEF.
• intravenously or orally administering therapeutically effective amounts of TY4 to a subject having HFpEF reduces or alleviates one or more of impaired exercise endurance, elevated blood pressure, elevated E/e’ ratio, and systemic inflammation, due to the HFpEF.
• FIG. 4A shows data related to systolic blood pressure after delivery of a non limiting embodiment of a therapeutic nucleic acid, TY4 RNA in this example.
• the oral administration of a therapeutic RNA in a casein-chitosan coated micelle results in reduced systolic blood pressure, as compared to vehicle controls (and untreated).
• Figure 4B shows the coordinate reduction in diastolic blood pressure with oral administration of the therapeutic RNA.
• Figure 4C shows the reduction in the E/e’ ratio after oral administration of a therapeutic RNA.
• Figure 4D shows the reduction in brain natriuretic peptide as compared to vehicle controls.
• Figure 4E represents the recovery in endurance, in fact to modestly greater than control levels, after oral delivery of the therapeutic RNA.
• Figure 4F shows new data beyond that of Example 2. Animals were evaluated for circulating blood glucose concentrations. As shown in Figure 4F, treatment with vehicle alone results in elevated blood glucose concentration as compared to control. Oral administration of a nucleic acid-containing composition according to embodiments disclosed herein results in significant reductions in circulating blood glucose levels, which can be related to the obesity associated with HFpEF.
• Figure 4G shows fat accumulation in the vehicle-treated mouse. As shown with the mouse on the far right, which received oral administration of the therapeutic nucleic acid, there is a reduction in fat accumulation.
• compositions and methods provided for herein when administered orally, can effectively reduce inflammation and/or fibrosis that are the result of, or a symptom of a disease.
• This non-limiting example shows a study design to test different formulations for in vivo delivery of a therapeutic nucleic acid, a non-limiting example of which is TY4 and/or derivatives thereof (Fig. IB).
• PCLC PEG-cationic lipid complexes
• PEG2000 polyethylene glycol
• Dharmafect Complexes are formed using five freeze/thaw cycles (liquid nitrogen/60°C) as adapted from previous preparations. A single freeze-thaw cycle involves freezing the mixture for 5 min at -190°C (liquid nitrogen) followed by thawing for 5 at 60°C.
• Complexes of TY4 (and/or a derivative thereof) with PCLC are made by admixing appropriate concentrations of TY4 (and/or a derivative thereof) with 5 pi of PCLC to a final volume of IOOmI.
• the therapeutic nucleic acid such as TY4 (and/or a derivative thereof) is formulated as a complex with PCLC.
• a pharmaceutical composition of a therapeutic nucleic acid for example, TY4 (and/or a derivative thereof) includes TY4 (and/or a derivative thereof) and PCLC.
• PEG shielding of a therapeutic nucleic acid promotes oral uptake of the nucleic acid, such as an RNA, particularly a non-coding RNA, yielding therapeutic effects.
• This non-limiting example shows formulation of CDC-EV with casein for oral administrations.
• Unaltered CDC-EVs can be taken up when given orally. Casein, the dominant protein in breast milk, can enhance the uptake and bioactivity of ingested CDC- EVs, altering gene expression in blood cells and enhancing muscle function in mdx mice.
• the therapeutic compound comprises a therapeutic nucleic acid (non-limiting examples include TY4 and/or a derivative thereof) is administered as is, or mixed with 8% casein solution in phosphate-buffered saline (PBS).
• PBS phosphate-buffered saline
• Each therapeutic compound formulation, or the mixture of casein solution and each therapeutic compound formulation is fed to HFpEF mice by oral gavage after 18 hours of only-food fasting, and is compared to feeding PBS alone or 8% casein solution alone after 18 hours of only-food fasting.
• RNA extraction is quantified by measuring therapeutic compound levels in whole blood by qPCR, using RNA isolation methods. Measured PCR cycles are compared against standards created by spiking known levels of TY4 into mouse blood. TY4 is derived from a human- specific sequence, so background levels in mice are below the limit of reliable PCR detection. Selection for further characterization is based upon measured levels of TY4 in blood.
• a formulation (whether with or without casein) can be considered to provide oral delivery if TY4 is detected by 2 amplification cycles [Ct] of control or earlier by qPCR. In some embodiments, a formulation provides detection at >3 Ct lower than the nearest competitor by qPCR. A formulation may be further tested for in vivo bioactivity.
• therapeutic nucleic acids including non-coding RNA, such as TY4 (and/or a derivative thereof) (in liposomes or CDC-EV) is formulated with casein.
• a pharmaceutical composition of TY4 (and/or a derivative thereof) includes TY4 (and/or a derivative thereof) in liposomes or CDC-EV, and casein.
• a pharmaceutical composition of TY4 (and/or a derivative thereof) includes TY4 (and/or a derivative thereof) in liposomes or CDC-EV, and 8% casein.
• a formulation of TY4 (and/or a derivative thereof) (in liposomes or CDC-EV) and casein, e.g., 8% casein, promotes oral uptake of TY4 (and/or a derivative thereof).
• This non-limiting example shows oral formulations comprising therapeutic nucleic acids encapsulated in lipid micelles and coated with a casein-chitosan complex ameliorate symptoms of myocardial infarction.
• mice were given either vehicle or an IV composition made up of a lipid-encapsulated therapeutic RNA, or oral composition comprising a therapeutic RNA encapsulated in a lipid micelle and coated with casein-chitosan, as provided for herein.
• IV composition made up of a lipid-encapsulated therapeutic RNA
• oral composition comprising a therapeutic RNA encapsulated in a lipid micelle and coated with casein-chitosan, as provided for herein.
• the non-limiting example of a nucleic acid payload use here was TY4.
• Hearts were excised 48 hours post-MI and infarct size (IS) quantified histologically.
• Figure 5A shows pooled data related to infarct size. As shown, both IV and oral compositions resulted in reduced infarct size. Notably, the oral delivery of TY4 shows an enhanced reduction of infarct size. Representative left ventricular sections for each group are shown in Figure 5B, with the orally-treated group showing markedly less infarct scarring. As a marker of cardiac injury, Figure 5C shows that orally administered TY4 yielded a significant decrease as compared to control. Taken together, the data for histology and troponin I are mutually-reinforcing in showing the cardioprotective efficacy of orally delivered therapeutic nucleic acids, such as the non-coding RNA TY4.
• Figure 5D shows IV injection of TY4 (or a scrambled version thereof) or orally administered TY4 housed in compositions according to embodiments disclosed herein (e.g., micelles coated with casein-chitosan).
• An additional group here includes oral TY4 encapsulated in a micelle that is coated with casein alone (no chitosan).
• the data of Figure 5D reinforce the findings discussed above with respect to oral delivery of a therapeutic RNA, but also demonstrate that, according to preferred embodiments, a lipid micelle is coated with both casein and chitosan.
• test group on the right of Figure 5D is the RNA-encapsulated micelles coated with casein only. Infarct size for that group was notably increased, indicative of a reduced bioavailability of the TY4, believed to be due to less robust protection for the composition in the low-acid environment of the stomach.
• Figure 5E shows less of a drop off in efficacy, as related to measuring cardiac troponin I, though the casein-only formulation appears to at least trend towards elevated concentrations (less therapeutic effect).
• these data support the cardioprotective efficacy of orally delivered therapeutic nucleic acids, such as the non-coding RNA TY4, using a casein- chitosan coating, as provided for herein in several embodiments.
• This non-limiting example shows oral formulations comprising therapeutic nucleic acids encapsulated in lipid micelles and coated with a casein-chitosan complex improve symptoms of scleroderma.
• Scleroderma is an autoimmune disorder marked by progressive skin thickening and fibrosis of skin, heart and lung.
• An animal model of scleroderma was used in which mice were injected with bleomycin intradermally over the course of 3 weeks. Animals were then treated with compositions configured for oral delivery of therapeutic RNA molecules, as provided for herein.
• This experiment uses a non-limiting example RNA, TY4, which is encapsulated in a lipid micelle coated with casein-chitosan and delivered orally. Oral delivery (in the same delivery composition) of a scrambled RNA sequence was used as a control.
• Figure 6A shows data related to endurance testing on a treadmill. As shown, oral delivery of the therapeutic RNA resulted in full return of endurance to that of untreated control mice, PBS control and scrambled RNA sequence controls each showed significant reductions in endurance.
• Figure 6B shows that oral delivery of the therapeutic RNA allowed mice to maintain body weight such that it was not significantly different from control.
• Figure 6C shows a heart index (HI) that relates the heart weight to the body weight of the mice in each group. As expected from the reduction in body weight with the non- therapeutic groups, these groups exhibited an elevated HI. Also, an increase in heart weight (e.g., due to fibrosis) could also account for an aspect of the increased HI.
• HI heart index
• PI pulmonary index
• Figure 6E shows the lung weight data alone, which corresponds to the PI data.
• Figure 7A shows histology data related to fibrosis.
• the top row shows representative tissue stains with dashed boxes corresponding to the enlarged view provided in the second row.
• the orally delivered therapeutic RNA shows a far reduced fibrosis of the tissue.
• Figure 7B shows the quantification of fibrosis for each group, indicating that oral delivery of the therapeutic RNA results in significantly reduced cardiac fibrosis.
• Figures 7C and 7D relate to fibrosis of the skin.
• Figure 7C show histology data related to the skin with the upper left showing control skin, upper right showing vehicle control, lower left showing the scrambled RNA, and lower right showing the orally delivered TY4 RNA.
• cytokines were equivalent to or showed only modest increases in expression when the orally delivered therapeutic RNA was administered. These data thus support the efficacy of oral delivery of a therapeutic RNA to reduce fibrosis and/or inflammatory conditions, such as those secondary or symptomatic of scleroderma.
• This non-limiting example shows oral formulations comprising therapeutic nucleic acids encapsulated in lipid micelles and coated with a casein-chitosan complex improve symptoms of muscular dystrophy.
• FIG. 9A transthoracic echocardiography on lightly anesthetized mdx mice was performed to measure left ventricular ejection fraction (EF). At baseline, no differences were detected between groups. After 8 weeks, mdx receiving the orally administered example of a therapeutic RNA, TY4, had higher EF relative to vehicle control, which declined during the study period. As shown in Figure 9B, Masson’s trichrome micrographs and pooled data (right subpanel) show mdx mice receiving orally administered TY4 had less myocardial fibrosis than vehicle control mice.
• EF left ventricular ejection fraction
• compositions to deliver therapeutic RNA via an oral administration result in increased bioavailability of the RNA, which in turn leads to enhanced therapeutic outcomes for diseases hallmarked by inflammation and/or fibrosis, such as muscular dystrophy.
• any methods disclosed herein need not be performed in the order recited.
• the methods disclosed herein include certain actions taken by a practitioner; however, they can also include any third-party instruction of those actions, either expressly or by implication.
• actions such as “administering to a subject in need of treating a heart condition or symptom thereof a therapeutically effective amount of the nucleic acid” include “instructing the administration of an effective amount of the nucleic acid to a subject.”
• features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.
• ranges disclosed herein also encompass any and all overlap, sub ranges, and combinations thereof.
• Language such as “up to,” “at least,” “greater than,” “less than,” “between,” and the like includes the number recited. Numbers preceded by a term such as “about” or “approximately” include the recited numbers. For example, “about 90%” includes “90%.” In some embodiments, at least 95% identical includes 96%, 97%, 98%, 99%, and 100% identical to the reference sequence.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Public Health (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Medicinal Chemistry (AREA)
• Veterinary Medicine (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Epidemiology (AREA)
• Organic Chemistry (AREA)
• Genetics & Genomics (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Biotechnology (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Cardiology (AREA)
• General Engineering & Computer Science (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Heart & Thoracic Surgery (AREA)
• Inorganic Chemistry (AREA)
• Microbiology (AREA)
• Plant Pathology (AREA)
• Physiology (AREA)
• Nutrition Science (AREA)
• Optics & Photonics (AREA)
• Nanotechnology (AREA)
• Neurology (AREA)
• Orthopedic Medicine & Surgery (AREA)
• Physical Education & Sports Medicine (AREA)
• Hospice & Palliative Care (AREA)
• Urology & Nephrology (AREA)

Priority Applications (7)

Applications Claiming Priority (2)

Publications (1)

Family

ID=84690648

Family Applications (2)

Family Applications After (1)

Country Status (8)

Cited By (5)

Families Citing this family (2)

Citations (5)

Family Cites Families (4)

• 2022
  • 2022-06-30 WO PCT/US2022/035870 patent/WO2023278802A1/en not_active Ceased
  • 2022-06-30 JP JP2023581003A patent/JP2024525512A/ja active Pending
  • 2022-06-30 CN CN202280059708.7A patent/CN117916249A/zh active Pending
  • 2022-06-30 KR KR1020247003755A patent/KR20240028486A/ko active Pending
  • 2022-06-30 US US18/571,924 patent/US20250025487A1/en active Pending
  • 2022-06-30 CA CA3223495A patent/CA3223495A1/en active Pending
  • 2022-06-30 EP EP22834283.8A patent/EP4363434A4/en active Pending
  • 2022-06-30 CA CA3223686A patent/CA3223686A1/en active Pending
  • 2022-06-30 EP EP22834280.4A patent/EP4362954A1/en active Pending
  • 2022-06-30 US US18/572,067 patent/US20240285668A1/en active Pending
  • 2022-06-30 JP JP2023581043A patent/JP2024527340A/ja active Pending
  • 2022-06-30 AU AU2022303384A patent/AU2022303384A1/en active Pending
  • 2022-06-30 AU AU2022303330A patent/AU2022303330A1/en active Pending
  • 2022-06-30 WO PCT/US2022/035866 patent/WO2023278799A1/en not_active Ceased
  • 2022-06-30 CN CN202280059718.0A patent/CN117897162A/zh active Pending
  • 2022-06-30 KR KR1020247003744A patent/KR20240027814A/ko active Pending

Patent Citations (5)

Non-Patent Citations (3)

Also Published As

Similar Documents

Legal Events