WO2023274387A1 - 靶向gd2的通用型car-t细胞及其制备方法和应用 - Google Patents
靶向gd2的通用型car-t细胞及其制备方法和应用 Download PDFInfo
- Publication number
- WO2023274387A1 WO2023274387A1 PCT/CN2022/103102 CN2022103102W WO2023274387A1 WO 2023274387 A1 WO2023274387 A1 WO 2023274387A1 CN 2022103102 W CN2022103102 W CN 2022103102W WO 2023274387 A1 WO2023274387 A1 WO 2023274387A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- immune effector
- cells
- hla
- seq
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001102—Receptors, cell surface antigens or cell surface determinants
- A61K39/001111—Immunoglobulin superfamily
- A61K39/001112—CD19 or B4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001102—Receptors, cell surface antigens or cell surface determinants
- A61K39/001116—Receptors for cytokines
- A61K39/001117—Receptors for tumor necrosis factors [TNF], e.g. lymphotoxin receptor [LTR] or CD30
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001102—Receptors, cell surface antigens or cell surface determinants
- A61K39/001124—CD20
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/31—Chimeric antigen receptors [CAR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/32—T-cell receptors [TCR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4256—Tumor associated carbohydrates
- A61K40/4258—Gangliosides, e.g. GM2, GD2 or GD3
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4261—Proteoglycans, e.g. glypican, brevican or CSPG4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/7051—T-cell receptor (TcR)-CD3 complex
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70517—CD8
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
- C07K16/3076—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells against structure-related tumour-associated moieties
- C07K16/3084—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells against structure-related tumour-associated moieties against tumour-associated gangliosides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0636—T lymphocytes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/50—Cellular immunotherapy characterised by the use of allogeneic cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2302—Interleukin-2 (IL-2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2305—Interleukin-5 (IL-5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/20—Cytokines; Chemokines
- C12N2501/23—Interleukins [IL]
- C12N2501/2307—Interleukin-7 (IL-7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/50—Cell markers; Cell surface determinants
- C12N2501/51—B7 molecules, e.g. CD80, CD86, CD28 (ligand), CD152 (ligand)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2501/00—Active agents used in cell culture processes, e.g. differentation
- C12N2501/50—Cell markers; Cell surface determinants
- C12N2501/515—CD3, T-cell receptor complex
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
Definitions
- This application relates to the field of biomedicine, in particular to a universal CAR-T cell targeting GD2 and its preparation method and application.
- Ganglioside GD2 is a glycolipid compound rich in sugar chains, which is an important part of the cell membrane of the nervous system and belongs to the group of ganglioside sphingolipids. GD2 antigen is expressed on the surface of neuroectodermal tumors, including neuroblastoma, melanoma, osteosarcoma, glioma and other tumors. Among them, neuroblastoma (neuroblastoma, NB) is an embryonal tumor of the postganglionic sympathetic nervous system and is the most common extracranial solid malignant tumor in children. The current treatment options are surgical resection, radiotherapy, and chemotherapy. NB has early onset, high degree of malignancy and poor prognosis.
- Diffuse intrinsic pontine glioma is a highly aggressive glioma that occurs in the brainstem. It usually occurs in children aged 5 to 9 years. The prognosis is extremely poor, and less than 10% of children survive more than 2 years.
- H3K27M mutation is currently a relatively cutting-edge research hotspot in the field of glioma.
- H3K27M-mutated diffuse midline gliomas mostly occur in children and occasionally in adults. The tumor often grows infiltratively and often invades the thalamus, medulla oblongata, and spinal cord, and the prognosis of patients is extremely poor. Therefore, it is urgent to find new treatment methods to reduce the mortality of related cancer patients.
- general-purpose CAR T cells are T cells isolated from healthy donors, and the prepared CAR-T cells have high expansion efficiency and strong vitality; at the same time, allogeneic general-purpose CAR-T cells can The off-the-shelf supply greatly reduces the preparation cost and shortens the preparation cycle.
- Universal CAR T cells are T cells isolated from healthy donors.
- the prepared CAR-T cells not only have high expansion efficiency and strong vitality, but also increase the positive rate of infection.
- universal CAR-T also faces graft-versus-host Problems with disease (GVHD) and immune rejection.
- GVHD graft-versus-host Problems with disease
- the CRISPR/Cas9 system is the most commonly used gene editing method, which can be used to generate T cells deficient in TCR and HLA class I molecules, and reduce the immune rejection immune response caused by allogeneic cell therapy.
- Universal CAR-T not only expands the recognition range of antigens, but also can change the immunosuppressive microenvironment through gene knockout, and is applied to the treatment of malignant hematological tumors and solid tumors.
- the purpose of the present invention is to prepare a general-purpose CAR-T cell targeting GD2, which recognizes tumor cell surface antigens and simultaneously knocks out the TCR and HLA-A genes on the cell surface, so as to improve the anti-tumor effect of CAR-T cells and prolong Cell survival time while reducing the multiple effects of immune rejection induced by allogeneic cell therapy.
- the present application provides an immune effector cell, wherein the function of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in the immune effector cell is inhibited in the cell, And the immune effector cells comprise a chimeric antigen receptor (CAR) targeting GD2.
- TCR T cell antigen receptor
- MHCI major histocompatibility complex
- CAR chimeric antigen receptor
- the CAR comprises a targeting moiety comprising an antibody heavy chain variable region (VH), the VH comprising heavy chain complementarity determining region 1 (HCDR1), heavy chain complementarity determining region 2 (HCDR2) and heavy chain complementarity determining region 3 (HCDR3), the HCDR1 comprises the amino acid sequence shown in SEQ ID NO:1.
- VH antibody heavy chain variable region
- HCDR1 heavy chain complementarity determining region 1
- HCDR2 heavy chain complementarity determining region 2
- HCDR3 heavy chain complementarity determining region 3
- the HCDR2 comprises the amino acid sequence shown in SEQ ID NO:2.
- the HCDR3 comprises the amino acid sequence shown in SEQ ID NO:3.
- the VH comprises: HCDR1 comprising the amino acid sequence shown in SEQ ID NO:1, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:2 and comprising the amino acid shown in SEQ ID NO:3 Sequence of HCDR3.
- the VH comprises heavy chain framework region 1 (HFR1), heavy chain framework region 2 (HFR2), heavy chain framework region 3 (HFR3) and heavy chain framework region 4 (HFR4), the HFR1 Comprising the amino acid sequence shown in SEQ ID NO:4.
- the HFR2 comprises the amino acid sequence shown in SEQ ID NO:5.
- the HFR3 comprises the amino acid sequence shown in SEQ ID NO:6.
- the HFR4 comprises the amino acid sequence shown in SEQ ID NO:7.
- the VH comprises HFR1, HFR2, HFR3 and HFR4, and the HFR1, HFR2, HFR3 and HFR4 are selected from:
- HFR1 comprising the amino acid sequence shown in SEQ ID NO: 4
- HFR2 comprising the amino acid sequence shown in SEQ ID NO: 5
- HFR3 comprising the amino acid sequence shown in SEQ ID NO: 6, comprising HFR3 shown in SEQ ID NO: 7 Amino acid sequence of HFR4.
- the VH comprises the amino acid sequence shown in SEQ ID NO:8.
- the targeting moiety comprises an antibody light chain variable region (VL) comprising light chain complementarity determining region 1 (LCDR1), light chain complementarity determining region 2 (LCDR2) and light chain complementarity determining region Determining region 3 (LCDR3), said LCDR1 comprises the amino acid sequence shown in SEQ ID NO:9.
- VL antibody light chain variable region
- LCDR1 light chain complementarity determining region 1
- LCDR2 light chain complementarity determining region 2
- LCDR3 light chain complementarity determining region Determining region 3
- the LCDR2 comprises the amino acid sequence shown in SEQ ID NO:10.
- the LCDR3 comprises the amino acid sequence shown in SEQ ID NO: 11.
- the VL comprises: LCDR1 comprising the amino acid sequence shown in SEQ ID NO:9, LCDR2 comprising the amino acid sequence shown in SEQ ID NO:10 and comprising the amino acid shown in SEQ ID NO:11 Serial LCDR3.
- said VL comprises light chain framework region 1 (LFR1), light chain framework region 2 (LFR2), light chain framework region 3 (LFR3) and light chain framework region 4 (LFR4), said LFR1 Comprising the amino acid sequence shown in SEQ ID NO:12.
- the LFR2 comprises the amino acid sequence shown in SEQ ID NO:13.
- the LFR3 comprises the amino acid sequence shown in SEQ ID NO:14.
- the LFR4 comprises the amino acid sequence shown in SEQ ID NO:15.
- the VL comprises LFR1, LFR2, LFR3 and LFR4, and the LFR1, LFR2, LFR3 and LFR4 are selected from:
- LFR1 comprising the amino acid sequence shown in SEQ ID NO:12
- LFR2 comprising the amino acid sequence shown in SEQ ID NO:14, comprising LFR3 of the amino acid sequence shown in SEQ ID NO:14, comprising the LFR3 shown in SEQ ID NO:15 Amino acid sequence of LFR4.
- the VL comprises the amino acid sequence shown in SEQ ID NO: 16.
- the targeting moiety comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:8, and the VL comprises the amino acid sequence shown in SEQ ID NO:16.
- the targeting moiety comprises a full length antibody, Fab, single chain variable fragment (scFv) or single domain antibody (VHH).
- the targeting moiety comprises a scFv.
- the targeting moiety comprises a linker polypeptide between VH and VL.
- linker polypeptide comprises the amino acid sequence shown in SEQ ID NO: 17 or SEQ ID NO: 18.
- the targeting moiety comprises the amino acid sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20.
- the CAR includes a transmembrane domain comprising a transmembrane domain derived from one or more proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e) , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4, CD244, Fc ⁇ RI ⁇ , BTLA, CD30, GITR, HVEM , DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L (CD154), TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
- proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e) , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC
- transmembrane domain comprises a transmembrane domain derived from CD8A.
- transmembrane domain comprises the amino acid sequence shown in any one of SEQ ID NO:29 to SEQ ID NO:77.
- the CAR includes an intracellular co-stimulatory signaling domain comprising an intracellular co-stimulatory protein derived from one or more proteins selected from the group consisting of: Signal transduction domain: CD28, 4-1BB (CD137), CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
- Signal transduction domain CD28, 4-1BB (CD137), CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4,
- the intracellular costimulatory signaling domain is derived from a costimulatory signaling domain of 4-1BB.
- the intracellular co-stimulatory signaling domain comprises the amino acid sequence shown in any one of SEQ ID NO:78 to SEQ ID NO:110.
- the CAR includes an intracellular signaling domain comprising an intracellular signaling structure derived from one or more proteins selected from the group consisting of Domains: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef, DAP10, DAP-12 and contains at least one ITAM domain.
- CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b proteins selected from the group consisting of Domains: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef,
- the intracellular signaling domain comprises a signaling domain derived from CD3 ⁇ .
- said intracellular signal transduction domain comprises any of SEQ ID NO:94, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:111 to SEQ ID NO:121 The amino acid sequence shown in item.
- the CAR includes a hinge region between the targeting moiety and the transmembrane domain, the hinge region comprising a hinge region derived from one or more proteins selected from the group consisting of: CD28, IgG1 , IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
- proteins selected from the group consisting of: CD28, IgG1 , IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
- the hinge region comprises a hinge region derived from CD8A.
- the hinge region comprises the amino acid sequence shown in any one of SEQ ID NO: 122 to SEQ ID NO: 143.
- the non-targeting portion of the chimeric antigen receptor comprises the transmembrane domain of the CD8A molecule, the hinge region of CD8A, the intracellular co-stimulatory signaling domain of 4-1BB, and the CD3 ⁇ intracellular signaling structure area.
- the non-targeting portion of the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID NO:21.
- the chimeric antigen receptor further comprises a signal peptide fragment, and the C-terminus of the signal peptide fragment is connected to the N-terminus of the targeting moiety.
- the signal peptide fragment comprises a CD8A signal peptide fragment.
- the signal peptide fragment comprises the amino acid sequence shown in SEQ ID NO:22.
- the chimeric antigen receptor comprises the amino acid sequence shown in SEQ ID NO:23.
- the immune effector cells include human cells.
- the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
- NK cells natural killer cells
- macrophages include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
- it includes autologous or non-autologous immune effector cells.
- the immune effector cells include modified immune effector cells, wherein the modification includes down-regulation of the expression and/or activity of one or more genes associated with immune rejection.
- the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
- the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the unmodified corresponding cells.
- the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
- the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
- the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
- the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
- the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
- the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
- the modification includes: gene knockout, gene mutation and/or gene silencing.
- the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
- the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
- the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
- said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
- said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
- the modification further comprises administering to the immune effector cells sgRNA targeting the exon portion of the TRAC gene.
- the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:144 to SEQ ID NO:158.
- the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
- the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:159 to SEQ ID NO:199.
- said modification further comprises administering a Cas enzyme to said cells.
- the Cas enzyme comprises a Cas9 protein.
- the antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:200 to SEQ ID NO:203.
- the immune effector cells are HLA-B homozygous cells.
- HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
- the immune effector cells are HLA-A homozygous or heterozygous cells.
- HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
- the present application provides a method for preparing immune effector cells, which includes: introducing into the immune effector cells a polynucleotide sequence encoding the aforementioned GD2-targeting CAR or a polynucleotide comprising the aforementioned GD2-targeting CAR Before/after the carrier of the sequence, the immune effector cells are modified, and the modification includes down-regulation of the expression and/or activity of one or more genes related to immune rejection.
- the vector is an expression vector.
- the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors and retroviral vectors.
- the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
- the expression and/or activity of the TRAC gene and the HLA-A gene in said immune effector cells are down-regulated compared to the expression and/or activity of the corresponding genes in corresponding cells without said modification.
- the expression and/or activity of the CIITA gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
- the expression and/or activity of the B2M gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
- the expression and/or activity of the TRAC gene and the HLA-A gene of the immune effector cells is down-regulated compared to corresponding wild-type cells.
- the expression and/or activity of the CIITA gene is not downregulated compared to corresponding wild-type cells.
- the expression and/or activity of the B2M gene is not down-regulated compared to corresponding wild-type cells.
- the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
- the modification includes: gene knockout, gene mutation and/or gene silencing.
- the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
- the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
- the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
- said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
- said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
- the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the TRAC gene.
- the sgRNA targeting the exon portion of the TRAC gene comprises the nucleotide sequence shown in any one of SEQ ID NO:144 to SEQ ID NO:158.
- the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
- the sgRNA targeting the exon portion of the HLA-A gene comprises the nucleotide sequence shown in any one of SEQ ID NO:159 to SEQ ID NO:199.
- said modification further comprises administering a Cas enzyme to said cells.
- the Cas enzyme comprises a Cas9 protein.
- the antisense RNA comprises the nucleotide sequence shown in any one of SEQ ID NO:200 to SEQ ID NO:203.
- the immune effector cells comprise human cells.
- the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
- NK cells natural killer cells
- macrophages include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
- the immune effector cells comprise autologous or non-autologous immune effector cells.
- the cells are homozygous for HLA-B.
- HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
- the cells are HLA-A homozygous or heterozygous cells.
- HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
- the present application provides the application of the aforementioned immune effector cells in the preparation of CAR-T cells.
- the present application provides a pharmaceutical composition, which comprises the aforementioned immune effector cells, and optionally a pharmaceutically acceptable carrier.
- the present application provides the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition, which are used for treating diseases or conditions related to the expression of GD2.
- the disease or disorder associated with the expression of GD2 comprises a disease or disorder associated with up-regulated expression of GD2.
- GD2 comprises cancer
- the cancer comprises a GD2 positive tumor.
- the cancer comprises: neuroblastoma, melanoma, retinoblastoma, small cell lung cancer, Ewing sarcoma, medulloblastoma, soft tissue sarcoma, osteosarcoma, or glioma.
- the present application provides the use of the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition in the preparation of medicines for treating diseases or conditions related to the expression of GD2.
- the disease or disorder associated with the expression of GD2 comprises a disease or disorder associated with up-regulation of the expression of GD2.
- GD2 comprises cancer
- the cancer comprises a GD2 positive tumor.
- the cancer comprises: neuroblastoma, melanoma, retinoblastoma, small cell lung cancer, Ewing sarcoma, medulloblastoma, soft tissue sarcoma, osteosarcoma, or glioma.
- the present application provides a method for preventing or treating a disease or disorder related to the expression of GD2, which includes administering an effective amount of the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition to a subject in need .
- the disease or disorder associated with the expression of GD2 comprises a disease or disorder associated with up-regulated expression of GD2.
- GD2 comprises cancer
- the cancer comprises a GD2 positive tumor.
- the cancer comprises: neuroblastoma, melanoma, retinoblastoma, small cell lung cancer, Ewing sarcoma, medulloblastoma, soft tissue sarcoma, osteosarcoma, or glioma.
- Figure 1 shows the anti-GD2 CAR gene lentiviral expression vector described in this application
- Figure 2 shows the construction strategy of anti-GD2 UCAR-T cells described in this application.
- Figure 3A-3D shows the phenotype detection results of anti-GD2 UCAR-T cells described in this application (knockout efficiency, transfection efficiency, amplification factor, memory T cell ratio);
- Figure 4 shows the results of killing target cells by anti-GD2 UCAR-T cells described in the present application
- Figures 5A-5C show the detection results of cytokine secretion in the co-culture of anti-GD2 UCAR-T cells and target cells described in the present application;
- Figure 6 shows the anti-tumor effect of the anti-GD2 UCAR-T cells described in the application in vivo;
- Figure 7 shows the in vivo half-life detection results of anti-GD2 UCAR-T cells described in the present application.
- Figures 8A-8B show the results of in vivo rejection of anti-GD2 UCAR-T cells described in the present application.
- Figure 9 shows the off-target analysis of anti-GD2 UCAR-T cells described in this application.
- Figure 10 shows the chromosomal translocation analysis of anti-GD2 UCAR-T cells described in the present application
- Figure 11 shows the karyotype analysis of anti-GD2 UCAR-T cells described in the present application.
- Figure 12 shows the analysis of Cas9 residues in anti-GD2 UCAR-T cells described in this application.
- FIG. 13 shows the results of Sanger sequencing of the TRAC gene in this application after Sg9RNA editing
- Figure 14 shows the results of TA clone detection of the TRAC gene in this application after Sg9RNA editing
- Figure 15 shows the results of flow cytometry detection of the TRAC gene in the present application after Sg9RNA editing
- Figure 16 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg2RNA editing
- Figure 17 shows the results of Sanger sequencing of the HLA-A02 gene in this application after Sg5RNA editing
- Figure 18 shows the results of Sanger sequencing of the HLA-A11 gene in this application after Sg21RNA editing
- FIG 19 shows the results of Sanger sequencing of the HLA-A11 gene in this application after Rsg2RNA editing
- Figures 20A-20B show the results of simultaneous knockout of HLA-A02 and TRAC in the modified immune effector cells of the present application
- Figures 21A-21B show the protein levels of HLA-A02 and TRAC in the modified immune effector cells of the present application
- Figure 22 shows the mRNA levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application
- Figures 23A-23B show the protein levels of B2M and CIITA in the modified immune effector cells of the present application
- Figures 24A-24D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application;
- Figures 25A-25B show the knockout situation of TRAC and HLA-A mRNA levels in the modified immune effector cells of the present application
- FIGS 26A-26B show the protein levels of CD69 and CD137 in the modified immune effector cells of the present application
- Figure 27 shows the co-cultivation of the modified immune effector cells and NK cells of the present application
- Figure 28 shows the level of IFN- ⁇ expressed by the modified immune effector cells of the present application.
- Figures 29A-29D show the protein levels of TRAC, HLA-A, B2M and CIITA in the modified immune effector cells of the present application;
- Figure 30 shows the infection efficiency of the modified immune effector cells of the present application to CAR
- Figure 31 shows the amplification factor of the modified immune effector cells of the present application
- Figure 32 shows the killing effect of the modified immune effector cells of the present application on CD19 positive target cells
- Figure 33 shows the dosing regimen for administering the modified immune effector cells of the present application
- Figure 34 shows the killing effect of the modified immune effector cells of the present application on tumors in mice.
- chimeric antigen receptor generally refers to a group of polypeptides, usually two in the simplest embodiment, which, when in immune effector cells, provide cellular (usually cancer cells) and generate intracellular signals.
- the CAR comprises at least one extracellular antigen-binding domain (such as a VHH, scFv, or portion thereof), a transmembrane domain, and a cytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain”). ”) comprising a functional signaling domain derived from a stimulatory molecule and/or a co-stimulatory molecule as defined below.
- the set of polypeptides are in the same polypeptide chain (eg, comprising chimeric fusion proteins). In some embodiments, the set of polypeptides is discontinuous from each other, eg, in different polypeptide chains. In some aspects, the set of polypeptides includes a dimerization switch that, in the presence of a dimerization molecule, can couple the polypeptides to each other, eg, can couple an antigen binding domain to an intracellular signaling domain. In one aspect, the stimulatory molecule of the CAR is the zeta chain associated with the T cell receptor complex. In one aspect, the cytoplasmic signaling domain comprises a primary signaling domain (e.g., the primary signaling domain of CD3-zeta).
- the cytoplasmic signaling domain further comprises one or more functional signaling domains derived from at least one co-stimulatory molecule as defined below.
- the co-stimulatory molecule may be selected from 4-1BB (ie CD137), CD27, ICOS and/or CD28.
- a CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling domain derived from a stimulatory molecule.
- the CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising a functional signaling structure derived from a co-stimulatory molecule domains and functional signaling domains derived from stimulatory molecules.
- the CAR comprises a chimeric fusion protein that may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising functions derived from one or more co-stimulatory molecules Sexual signaling domains and functional signaling domains derived from stimulatory molecules.
- the CAR comprises a chimeric fusion protein which may comprise an extracellular antigen recognition domain, a transmembrane domain and an intracellular signaling domain comprising at least two co-stimulatory domains derived from one or more co-stimulatory domains.
- the CAR comprises an optional leader sequence at the amino terminus (N-ter) of the CAR fusion protein.
- the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen recognition domain, wherein the leader sequence is optionally cleaved from the antigen recognition domain (e.g., VHH) during cellular processing and localizes the CAR to the cell membrane.
- the antigen recognition domain e.g., VHH
- GD2 disialoganglioside
- GD2 pubchem:6450346
- GD2 is densely, homogeneously and almost ubiquitously expressed on neuroblastoma. In normal tissues, GD2 expression is largely restricted to skin melanocytes, and peripheral pain fibers to myelin. In the CNS, GD2 appears to be an embryonic antigen, but is found to be dimly expressed in scattered oligodendrocytes and in the posterior pituitary. This makes GD2 very suitable for targeted anti-tumor therapy.
- a chimeric antigen receptor targeting GD2 has been described with an antigen-binding domain based on scFv14g2a (WO 2013/040371 and Yvon et al. (2009, Clin Cancer Res 15:5852-5860)), and an antigen-binding fragment targeting GD2 has also been described in International Patent Application Publication WO2004/055056, each of which is incorporated herein by reference in its entirety.
- antibody is generally used in the broadest sense and specifically covers monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments as long as they show the desired biological activity (Miller et al (2003) Jour. of Immunology 170:4854-4861).
- Antibodies can be murine, human, humanized, chimeric, or derived from other species.
- a full-length antibody typically refers to an antibody consisting of two “full-length antibody heavy chains” and two “full-length antibody light chains”.
- a “full-length antibody heavy chain” is generally a polypeptide consisting, in the N-terminal to C-terminal direction, of an antibody heavy chain variable domain (VH), an antibody constant heavy chain domain 1 (CH1), an antibody hinge region (HR) , antibody heavy chain constant domain 2 (CH2), and antibody heavy chain constant domain 3 (CH3), abbreviated as VH-CH1-HR-CH2-CH3; and in the case of antibodies of the IgE subclass, optionally It also includes the antibody heavy chain constant domain 4 (CH4).
- VH antibody heavy chain variable domain
- CH1 antibody constant heavy chain domain 1
- HR antibody hinge region
- CH2 antibody heavy chain constant domain 2
- CH3 antibody heavy chain constant domain 3
- a "full-length antibody heavy chain” is a polypeptide consisting of VH, CH1, HR, CH2 and CH3 in an N-terminal to C-terminal direction.
- a “full-length antibody light chain” is generally a polypeptide consisting of an antibody light chain variable domain (VL) and an antibody light chain constant domain (CL) in the N-terminal to C-terminal direction, abbreviated as VL-CL.
- the antibody light chain constant domain (CL) may be kappa (kappa) or lambda (lambda).
- the two full-length antibody chains are linked together by an inter-polypeptide disulfide bond between the CL domain and the CH1 domain and between the hinge region of the full-length antibody heavy chain.
- Typical examples of full-length antibodies are natural antibodies such as IgG (eg, IgGl and IgG2), IgM, IgA, IgD, and IgE).
- antigen-binding fragment generally refers to a portion of an antibody molecule that contains the antigen responsible for the specificity between the antibody and the antigen. combined amino acids.
- the portion of an antigen that is specifically recognized and bound by an antibody is called an "epitope" as described above.
- An antigen binding domain will typically comprise an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH); however, it need not comprise both.
- Fd fragments for example, have two VH regions and typically retain some antigen-binding function of the full antigen-binding domain.
- antigen-binding fragments of antibodies include (1) Fab fragments, monovalent fragments having VL, VH, constant light chain (CL) and CH1 domains; (2) F(ab') 2 fragments, having two Bivalent fragment of two Fab fragments connected by sulfur bridge; (3) Fd fragment with two VH and CH1 domains; (4) Fv fragment with VL and VH domains of antibody single arm, (5) dAb fragment (Ward et al., "Binding Activities of a Repertoire of Single Immunoglobulin Variable Domains Secreted From Escherichia coli," Nature 341:544-546 (1989), which is hereby incorporated by reference in its entirety), which has a VH domain; (6) Isolated Complementarity Determining Regions (CDRs); (7) Single-chain Fv (scFv), for example derived from a scFv-library.
- Fab fragments monovalent fragments having VL, VH, constant light chain (CL) and CH1 domains
- the two domains VL and VH of the Fv fragment are encoded by separate genes, they can be joined using recombinant methods by a synthetic linker that allows it to be produced as a single protein in which the VL and VH regions pair to form a monovalent molecule chain (termed single-chain Fv (scFv)) (see, e.g., Huston et al., "Protein Engineering of Antibody Binding Sites: Recovery of Specific Activity in an Anti-Digoxin Single-Chain Fv Analogue Produced in Escherichia coli," Proc.
- scFv single-chain Fv
- VHH relates to variable antigens from heavy chain antibodies of the family Camelidae (camel, dromedary, llama, alpaca, etc.) Binding domain (see Nguyen VK et al., 2000, The EMBO Journal, 19, 921-930; Muyldermans S., 2001, J Biotechnol., 74, 277-302 and review Vanlandschoot P. et al., 2011, Antiviral Research 92 , 389-407). VHHs may also be referred to as Nanobodies (Nb) and/or Single Domain Antibodies. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the function of the fragments is evaluated in the same manner as intact antibodies.
- single domain antibody or “VHH” generally refers to a class of antibodies that lack the light chain of the antibody and only have the variable region of the heavy chain.
- the single domain antibody can be from a Bactrian camel, a dromedary, an alpaca, a llama, a nurse shark, a great star shark, or a ray (for example, see Kang Xiaozhen et al., Acta Biological Engineering, 2018, 34( 12): 1974-1984).
- single domain antibodies can be from alpacas.
- Single domain antibodies can be composed of a heavy chain variable region (VH).
- heavy chain variable region generally refers to the amino-terminal domain of the heavy chain of an antigen-binding fragment.
- the heavy chain variable region can be further divided into hypervariable regions called complementarity determining regions (CDRs), which are interspersed in more conserved regions known as the framework regions (FRs).
- CDRs complementarity determining regions
- FRs framework regions
- Each heavy chain variable region may consist of three CDRs and four FR regions, which may be arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.
- the heavy chain variable region contains the binding domain that interacts with the antigen.
- single-chain variable fragment or “scFv” has its plain and conventional meaning and may include, but is not limited to, for example, a heavy chain (VH) chain comprising an immunoglobulin variable region and a light chain (VL ) Fusion proteins of variable regions linked to each other with a short linker peptide.
- linkers may comprise glycine (for flexibility) and hydrophilic amino acids such as serine or threonine (for solubility). The linker may connect the N-terminus of VH to the C-terminus of VL, or may connect the C-terminus of VH to the N-terminus of VL.
- the ligand binding domain present on the CAR is a single chain variable fragment (scFv).
- the CAR of the present application can be constructed in a VH-VL or VL-VH configuration with variations in the linker, hinge, transmembrane domain, co-stimulatory domain and/or transduction domain, and the CAR still maintains its efficacy.
- the scFv domain present on the CAR is specific for GD2 present on tumor cells.
- the CAR of the present application may contain linker residues between the individual domains added for proper spacing and conformation of the molecule, for example a linker comprising an amino acid sequence that connects the VH and VL domains and provides interaction with the two sub-binding domains.
- the function of the compatible spacer is such that the resulting polypeptide retains the same specific binding affinity for the same target molecule as an antibody comprising the same light and heavy chain variable regions.
- the CAR of the present application may comprise one, two, three, four or five or more linkers.
- the linker is about 1 to about 25 amino acids, about 5 to about 20 amino acids, or about 10 to about 20 amino acids, or any intervening length of amino acids in length.
- linkers include glycine polymers; glycine-serine polymers; glycine-alanine polymers; alanine-serine polymers; other flexible linkers known in the art, such as Whitlow linkers.
- Glycine and glycine-serine polymers are relatively unstructured and thus can serve as neutral tethers between domains of fusion proteins such as the CAR of the present application.
- CDR complementarity determining region
- CDRs Chothia CDRs
- Padlan FASEB J.9:133-139 (1995)
- MacCallum J Mol Biol 262(5):732-45 (1996).
- CDR boundaries for CDR may not strictly follow one of the above systems, but will still overlap with Kabat CDRs, although they can be shortened according to predictions or experimental findings that specific residues or groups of residues or even CDRs as a whole do not significantly affect antigen binding. or extended. In this application, the IMGT numbering system is used.
- FR generally refers to the more highly conserved portions of antibody variable domains, known as the framework regions.
- the variable domains of native heavy and light chains may each comprise four FR regions, four in VH (H-FR1, H-FR2, H-FR3, and H-FR4), and four in VL. (L-FR1, L-FR2, L-FR3 and L-FR4).
- Framework region generally refers to the art-recognized portion of an antibody variable region that exists between the more divergent (ie hypervariable) CDRs.
- Framework regions are typically referred to as Frameworks 1 to 4 (FR1, FR2, FR3, and FR4) and provide the backbone for representing the six CDRs (three from the heavy chain and three from the light chain) in three-dimensional space, to Forms the antigen-binding surface.
- homologous sequences may include amino acid sequences that may be at least 80%, 85%, 90%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identical to the subject sequence .
- a homologue will comprise the same active site, etc., as the subject amino acid sequence.
- Homology can be considered in terms of similarity (ie, amino acid residues having similar chemical properties/functions), or can be expressed in terms of sequence identity.
- a sequence having a percentage identity of any one of the SEQ ID NOs of the mentioned amino acid sequence or nucleotide sequence means having said percentage identity over the entire length of the mentioned SEQ ID NO the sequence of.
- sequence alignment can be performed by various means known to those skilled in the art, for example, using BLAST, BLAST-2, ALIGN, NEEDLE or Megalign (DNASTAR) software and the like. Those skilled in the art can determine appropriate parameters for alignment, including any algorithms needed to achieve optimal alignment across the full-length sequences being compared.
- K D can be used interchangeably with “KD”, and generally refers to the dissociation equilibrium constant of a specific antibody-antigen interaction, and the unit is M (mol/L).
- isolated nucleic acid molecule generally refers to an isolated form of nucleotides, deoxyribonucleotides or ribonucleotides or their analogs of any length, isolated from their natural environment or artificially synthesized .
- the term "vector” generally refers to a nucleic acid molecule capable of self-replication in a suitable host, which transfers an inserted nucleic acid molecule into and/or between host cells.
- the vectors may include vectors mainly used for inserting DNA or RNA into cells, vectors mainly used for replicating DNA or RNA, and vectors mainly used for expression of transcription and/or translation of DNA or RNA.
- the carrier also includes a carrier having various functions as described above.
- the vector may be a polynucleotide capable of being transcribed and translated into a polypeptide when introduced into a suitable host cell. Generally, the vector can produce the desired expression product by culturing an appropriate host cell containing the vector.
- viral vector is used broadly to refer to nucleic acid molecules (such as transfer plasmids) or viral particles that mediate the transfer of nucleic acid molecules, including virus-derived nucleic acid elements that generally facilitate the transfer or integration of nucleic acid molecules into the genome of a cell .
- Virions typically include various viral components and sometimes host cell components in addition to nucleic acid.
- a viral vector may refer to a virus or virus particle capable of transferring nucleic acid into a cell, or the transferred nucleic acid itself.
- lentivirus generally refers to the group (or genus) of complex retroviruses.
- exemplary lentiviruses include, but are not limited to: HIV (human immunodeficiency virus; including HIV type 1 and HIV type 2); Visna-maedi virus (visna-maedivirus, VMV) virus; caprine arthritis-encephalitis virus ( CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immunodeficiency virus (BIV); and simian immunodeficiency virus (SIV).
- HIV-based vector backbones ie, HIV cis-acting sequence elements
- lentiviruses are used to deliver CAR-containing polynucleotides to cells.
- the term "host cell” or “cell” generally refers to an individual cell, cell lines or cell cultures.
- the host cells may include progeny of a single host cell. Due to natural, accidental or deliberate mutations, the progeny cells may not necessarily be completely identical in morphology or genome to the original parent cells, but they only need to be able to express the isolated antigen-binding fragments described in this application.
- the host cells can be obtained by using the vectors described in this application to transfect cells in vitro.
- the host cell can be a prokaryotic cell (such as Escherichia coli), or a eukaryotic cell (such as yeast cells, such as COS cells, Chinese hamster ovary (CHO) cells, HeLa cells, HEK293 cells, COS-1 cells, NSO cells or myeloma cells).
- the host cells may be E. coli cells.
- the host cell may be a yeast cell.
- the host cell can be a mammalian cell.
- the mammalian cells can be CHO-K1 cells.
- T cell or "T lymphocyte” may be any T cell, such as a cultured T cell, such as a primary T cell, or a T cell from a cultured T cell line, such as Jurkat, SupTI, etc., or T cells obtained from a mammal (preferably a primate, species including monkey, dog or human). If obtained from a mammal, T cells can be obtained from a number of sources including, but not limited to, blood, bone marrow, lymph nodes, thymus or other tissues or fluids. T cells can also be enriched or normalized. T cells can be obtained by maturing hematopoietic stem cells into T cells in vitro or in vivo.
- a cultured T cell such as a primary T cell
- a T cell from a cultured T cell line such as Jurkat, SupTI, etc.
- T cells obtained from a mammal preferably a primate, species including monkey, dog or human.
- T cells can be obtained from a number of sources including, but not
- the T cells are human T cells.
- the T cells are T cells isolated from humans.
- T cells can be of any type, including NKT cells, and can be of any developmental stage, including but not limited to CD4+/CD8+ double positive T cells; CDA+ helper T cells; e.g. Th1 and Th2 cells, CD8+ T cells (e.g. Cytotoxic T cells); peripheral blood mononuclear cells (PBMC); peripheral blood leukocytes (PBL); tumor infiltrating cells (TIL); memory T cells; untreated T cells, etc.
- the T cells are CD8+ T cells or CD4+ T cells.
- the T cells are allogeneic (from a different donor of the same species) to the subject receiving the cells or cells to be received (e.g., the cells are in the form of a therapeutic composition); in some alternatives, the T cells are autologous (donor and recipient are identical); in some alternative approaches, T cells are syngeneic (donor and recipient are different, but identical twins).
- immune effector cells generally refers to immune cells that participate in the immune response and perform effector functions.
- the exercising effector functions may include clearing foreign antigens or promoting immune effector responses and the like.
- Immune effector cells may include plasma cells, T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.
- the immune effector cells of the present application may be autologous/autogeneic ("own") or non-autologous ("non-self", eg allogeneic, syngeneic or allogeneic).
- autologous generally refers to cells from the same subject.
- Allogeneic generally refers to cells that are of the same species but are genetically different from those to which they are being compared.
- Isgeneic generally refers to cells of a different subject that are genetically identical to the cells being compared.
- Allogeneic generally refers to a cell of a different species than the compared cell.
- the cells of the present application are autologous or allogeneic.
- the term "modify” generally refers to altering the state or structure of a cell and/or changing the state or structure of a cell.
- the change is usually compared with the state or structure of the corresponding unmodified cell, and the change may include a change in the expression level or function of an endogenous gene, such as down-regulating the expression level of an endogenous gene in a cell by means of genetic engineering, Up-regulation or non-expression, the genetic engineering means may include homologous recombination, CRISPR/Cas9 system gene editing, etc.; the change may also include changes in cellular protein expression, structure or function, such as through the endogenous gene expression level or Changes in protein expression, changes in structure or function achieved by changes in function, such as changes in protein expression, changes in structure or function achieved by regulating protein translation, post-translational modification; the changes may also include introducing exogenous Genes, expression of foreign proteins, etc.
- T cell receptor alpha cons-stant T cell receptor alpha cons-stant
- T cell receptor T cell receptor
- MHC major histocompatibility complex
- ⁇ T cells account for about 95% of the total T cells, and ⁇ T cells account for about 5% of the total T cells. This ratio varies during ontogeny and in disease states (such as leukemia) and also varies between species. different.
- Each chain that makes up the TCR contains a variable region and a constant region.
- the gene encoding the ⁇ chain (TRA, such as the information shown in HGNC: 12027) is located on chromosome 14 and consists of multiple gene segments, including variable Segment (V), connecting segment (J) and constant region (C), TRAC gene usually refers to the gene sequence (for example, the information shown in HGNC:12029) encoding T cell receptor ⁇ chain constant region (C), which is located in Chromosome 14 (14q11.2;14:22,547,505-22,552,131).
- variable segment (V) genes encoding the N-segment antigen recognition domain is rearranged with one of the junction segment (J) to generate a functional V region exon that is transcribed and spliced together with the
- the constant regions (C) are linked to form the T cell receptor alpha chain coding sequence.
- MHC major histocompatibility complex antigen
- HLA human leukocyte antigen
- HLA class I antigens (A, B, C in humans) allow each cell to be recognized as "self", while HLA class II antigens (DR, DP and DQ in humans) participate in the communication between lymphocytes and antigen-presenting cells reaction between. Both have been implicated in the rejection of transplanted organs.
- An important aspect of the HLA gene system is its polymorphism. Different alleles exist for each gene, MHC class I (A, B, and C) and MHC class II (DP, DQ, and DR). HLA alleles are indicated by numbers and subscripts. For example, two unrelated individuals may carry the class I HLA-B genes B5 and Bw41, respectively. Allelic products differ in one or more amino acids in the alpha and/or beta domains.
- HLA-A MHC class I and II proteins
- HLA-B HLA-DR
- the HLA genes are clustered in a "superlocus" present on chromosome position 6p21, which encodes six classical Transplantation of HLA genes and at least 132 protein-coding genes. The complete locus measures roughly 3.6Mb, with at least 224 loci.
- haplotype a set of alleles present on a single chromosome, inherited from one parent, that tends to be inherited as a group.
- the set of alleles inherited from each parent forms a haplotype, some of which tend to be associated together. Identifying a patient's haplotype can help predict the probability of finding a matching donor and help develop a search strategy because some alleles and haplotypes are more common than others and they are more common in different races and ethnicities The frequencies in the distribution are different.
- HLA-A generally refers to a type of human leukocyte antigen polypeptide chain, encoded by the HLA-A gene located on human chromosome 6p21.3 (for example, the information shown in HGNC:4931).
- HLA-A is one of three major polypeptide types that make up MHC class I molecules on the surface of human cells, the others including HLA-B and HLA-C.
- the heterodimer composed of the ⁇ chain encoded by the HLA-A gene and the ⁇ chain ( ⁇ 2-microglobulin) encoded by the B2M gene is the HLA-A class MHC I molecule.
- the ⁇ chain encoded by the HLA-A gene may comprise an ⁇ 1 domain, an ⁇ 2 domain, an ⁇ 3 domain, a transmembrane region, and a cytoplasmic region, wherein the ⁇ 1 domain and the ⁇ 2 domain may be combined with peptides to be activated by MHC I molecules (eg, HLA-A class) present the peptides to cells of the immune lineage.
- MHC I molecules eg, HLA-A class
- HLA-A alleles may include those named by the WHO HLA Factor Nomenclature Committee included in the IMGT/HLA database version 3.38.0 (https://www.ebi.ac.uk/ipd/imgt/hla/) Sequence information of the different HLA-A alleles.
- HLA-B generally refers to a part of the gene family of the human leukocyte antigen (HLA) complex.
- HLA is the human version of the major histocompatibility complex (MHC), a family of genes present in many species. The genes in this complex are divided into three basic groups: class I, class II and class III.
- MHC major histocompatibility complex
- HLA-B gene and two related genes, HLA-A and HLA-C are the major MHC class I genes.
- the HLA-B gene is located in band 21.3 of the short (p) arm of chromosome 6, from base pairs 31,353,871 to 31,357,211.
- HLA-B is one of the three main HLAs that should be matched between donor and recipient.
- HLA-A HLA-B
- HLA-DR MHC class II
- HLA-matched refers to a donor-recipient pair in which there is no mismatch in HLA antigens between the donor and recipient, such as providing hematopoietic stem cell transplantation therapy to a recipient in need of A donor for a stem cell transplant.
- HLA-matched (i.e., in which all 6 alleles are matched) donor-recipient pairs have a reduced risk of graft rejection because endogenous T cells and NK cells are less likely to enter the graft recognized as foreign and thus less likely to mount an immune response against the graft.
- HLA-mismatched refers to a donor- A recipient pair, such as a donor who provides a hematopoietic stem cell transplant to a recipient in need of hematopoietic stem cell transplantation therapy.
- one haplotype is matched while the other is not.
- HLA-mismatched donor-recipient pairs may have an increased risk of graft rejection relative to HLA-matched donor-recipient pairs because endogenous Sexual T cells and NK cells are more likely to recognize an incoming graft as foreign, and such T cells and NK cells are therefore more likely to mount an immune response against the graft.
- B2M generally refers to ⁇ 2-microglobulin ( ⁇ 2-microglobulin), which is one of the components of MHC class I molecules.
- ⁇ 2 microglobulin also known as ⁇ chain
- B2M is normally expressed in all nucleated cells.
- ⁇ 2 microglobulin is encoded by the B2M gene located at 15q21.1 (for example, the information shown in HGNC:914).
- CIITA generally refers to the transactivator of major histocompatibility complex class II (MHC II).
- the transactivator may be a protein having an acidic transcription activation domain, 4 LRRs (leucine rich repeats) and a GTP binding domain.
- the protein can be localized in the nucleus and acts as a positive regulator of the transcription of major histocompatibility complex class II (MHC II) genes, known as the "master control factor” for the expression of these genes.
- MHC II major histocompatibility complex class II
- the protein also binds GTP and uses the binding to GTP to transport itself into the nucleus where it normally acts in a coactivator-like manner through acetyltransferase (AT) activity.
- the protein is encoded by a gene located at 16p13.13 (for example the information shown at HGNC:7067), enabling the generation of several transcript variants encoding different isoforms.
- wild-type cell generally refers to a naturally occurring or naturally derived cell.
- nucleic acid or “polynucleotide” or “nucleic acid molecule” generally refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in single- or double-stranded form. Unless specifically limited, the term may include nucleic acids that contain analogs of natural nucleotides that have similar binding properties to a reference nucleic acid (for example, for which sequence information is shown) and in a manner similar to naturally occurring nucleotides metabolism. Unless otherwise stated, the sequence of a nucleic acid may include conservatively modified variants thereof, such as degenerate codon substitutions, alleles, orthologs, SNPs, and complementary sequences, as well as the sequences explicitly indicated.
- expression generally refers to the transcription and/or translation of a specific nucleotide sequence.
- gene mutation generally refers to changes in the composition or sequence of base pairs in the structure of a gene. For example, point mutations caused by single base changes, or deletions, duplications, and insertions of multiple bases.
- the term "gene silencing” generally refers to preventing the expression of certain genes by regulatory mechanisms. It can mainly include two types: one is transcriptional gene silencing (TGS) at the transcriptional level caused by factors such as DNA methylation, heterochromatinization, and position effects, and the other is post-transcriptional gene silencing (post -transcriptional gene silencing (PTGS), that is, at the post-transcriptional level of the gene, it affects the expression of the gene by specifically interfering with the target RNA.
- TGS transcriptional gene silencing
- PTGS post-transcriptional gene silencing
- the expression of the corresponding gene is downregulated/decreased.
- Gene silencing is generally considered to be a gene knockdown mechanism, and methods commonly used to silence genes can be RNAi, etc.
- endogenous refers to any substance derived from or produced within an organism, cell, tissue or system.
- exogenous refers to any substance introduced from or produced outside of an organism, cell, tissue or system.
- antisense RNA generally refers to a single-stranded RNA that is complementary to the transcript mRNA (messenger RNA). Antisense RNA can inhibit gene expression by binding to mRNA. For example, the combination of antisense RNA and target mRNA increases the sensitivity of the double-stranded RNA molecule to RNase III and degrades it; for example, antisense RNA binds to the upstream non-coding region of mRNA, thereby directly inhibiting the translation of target mRNA .
- siRNA generally refers to the abbreviation of Small interfering RNA (small interfering RNA) or short in-terfering RNA (short interfering RNA).
- siRNA is a type of double-stranded non-coding RNA molecule with a length of about 18-28 base pairs, which can cause mRNA degradation through complementary binding to mRNA, thereby interfering with the expression of specific genes.
- siRNA may be a product obtained by treating long double-stranded RNA or shRNA with Dicer enzyme.
- the siRNA enters the cell and forms an RNA-induced silencing complex (RISC) with other proteins, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.
- RISC RNA-induced silencing complex
- shRNA generally refers to the abbreviation of short hairpin RNA, namely “short hairpin RNA”.
- shRNA usually includes two short inverted repeat sequences separated by a stem-loop sequence to form a hairpin structure.
- 5-6 T bases can also be included as the transcription terminator of RNA polymerase III.
- shRNA can enter cells through viral vectors or plasmids, and be transcribed under the action of polymerase II or polymerase III, and the transcripts are exported from the nucleus (usually through Exportin 5) and then transported after being treated by Dicer To RISC, the sense strand is degraded, and the antisense strand can bind to a complementary targeting sequence, thereby achieving gene silencing.
- CRISPR/Cas system generally refers to a group of molecules comprising an RNA-guided nuclease or other effector molecule and a gRNA molecule capable of directing and implementing the RNA-guided nuclease or other effector molecule Nucleic acid is modified at a target sequence, eg, causing degradation of the target sequence.
- a CRISPR system comprises a gRNA and a Cas protein, e.g., a Cas9 protein.
- Cas9 systems systems comprising Cas9 or functional mutants thereof are referred to herein as “Cas9 systems” or "CRISPR/Cas9 systems”.
- the gRNA molecule and the Cas molecule can complex to form a ribonucleoprotein (RNP) complex.
- RNP ribonucleoprotein
- gRNA molecule or “guide RNA”, “guide RNA”, “guide RNA”, “guide RNA molecule”, “gRNA” are used interchangeably and generally refer to Nucleases or other effector molecules (generally complexed with gRNA molecules) to nucleic acid molecules on the target sequence. In certain embodiments, this is accomplished by hybridizing a portion of the gRNA to DNA (e.g., via a gRNA guidance domain) and by binding a portion of the gRNA molecule to an RNA-guided nuclease or other effector molecule (e.g., at least via gRNAtracr). described guide.
- a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a "single guide RNA” or “sgRNA” or the like.
- a gRNA molecule consists of multiple (eg, two) polynucleotide molecules that are themselves capable of associating (typically by hybridization), referred to herein as “dual guide RNA” or “dgRNA” and the like.
- Cas protein generally refers to the enzyme responsible for cutting DNA in the CRISPR/Cas system. Enzymes from Type I, II, and III CRISPR/Cas systems may be included. For example, Cas3, Cas9, Cas10.
- Cas9 protein generally refers to the enzyme from the bacterial type II CRISPR/Cas system responsible for cutting DNA. Cas9 can include the wild-type protein and its functional mutants.
- allele generally refers to the different variations that the gene sequence at a locus may have.
- a genetic locus also known as a gene locus or site, refers to a fixed location on a chromosome, such as where a certain gene is located. The arrangement of loci in the genome is called a genetic map.
- homozygous generally refers to a genotyped individual whose two alleles on the same locus of the homologous chromosome are the same.
- a pair of relative genes can have individuals of both genotypes AA and aa.
- heterozygote generally refers to a diploid individual whose two alleles at the same site on the homologous chromosome are different, such as Aa. Heterozygous genotypes generally have higher fitness than homozygous dominant or homozygous recessive genotypes, a phenomenon known as heterozygous dominance.
- tumor and cancer are used interchangeably and generally refer to a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread to other parts of the body locally or through the bloodstream and lymphatic system. Examples of various cancers are described herein and they include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, Lung cancer, etc.
- cancer or “tumor” includes pre-malignant as well as malignant cancers and tumors, and also encompasses solid and non-solid tumors.
- the term "pharmaceutically acceptable” generally refers to a drug that is commensurate with a reasonable benefit/risk ratio, suitable within the scope of sound medical judgment for use in contact with human and animal tissues without undue toxicity, irritation, Those compounds, materials, compositions and/or dosage forms for allergic reactions or other problems or complications.
- the term "pharmaceutically acceptable carrier” generally refers to any of those conventionally used, and is subject only to physico-chemical considerations such as solubility and reactivity with active binding agents. lack of) and is limited by the route of administration.
- the pharmaceutically acceptable carriers described herein, such as vehicles, adjuvants, excipients, and diluents, are well known to those skilled in the art and are readily available to the public.
- a pharmaceutically acceptable carrier is one that is chemically inert to the active ingredients of the pharmaceutical composition and that exhibits no adverse side effects or toxicity under the conditions of use. In some embodiments, the carrier does not produce an adverse, allergic or other inappropriate reaction when administered to an animal or a human.
- compositions are free of pyrogens and other impurities that could be harmful to humans or animals.
- Pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like; their use is well known in the art.
- Acceptable carriers, excipients, or stabilizers are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphates, citrates, or other organic acids; antioxidants; , such as ascorbic acid; low-molecular-weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulin; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine amino acids; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugar alcohols, such as mannitol or sorbitol; salt-forming counterions, such as sodium; and/or Or nonionic surfactants such as Tween, Pluronics or polyethylene glycol (PEG).
- buffers such as phosphates, citrates,
- the term “effective amount” or “effective dose” generally refers to an amount sufficient to achieve, or at least partially achieve, the desired effect.
- a “therapeutically effective amount” or “therapeutically effective dose” of a drug or therapeutic agent is typically one that, when used alone or in combination with another therapeutic agent, promotes regression of disease (by reducing the severity of disease symptoms, frequency of asymptomatic periods of disease), any amount of drug that is evidenced by an increase in the degree and duration of the disease, or by the prevention of impairment or disability due to the presence of a disease.
- a “therapeutically effective amount” or “effective amount” of an anti-GD2 CAR-T cell is also an amount or dose in which the therapeutically beneficial effect outweighs any toxic or detrimental effects of the anti-GD2 CAR-T cell, such as CRS.
- the term “therapeutically effective amount” includes an amount effective to "treat” a subject (eg, a patient).
- the therapeutically effective dose is the minimum effective dose (MED) of anti-GD2 CAR-T cells used to treat multiple myeloma in a subject.
- the therapeutically effective dose is the maximum tolerated dose (MTD) of anti-GD2 CAR-T cells that does not cause the subject to have unresolved CRS.
- MED minimum effective dose
- MTD maximum tolerated dose
- up-regulation of expression generally refers to an increase in the expression of a nucleic acid at the mRNA level or an increase in the expression of a polypeptide.
- the term may also refer to post-translational modifications required for increased polypeptide activity and/or function, such as addition of sugar moieties, phosphorylation, and the like.
- the term "about” generally refers to a range of 0.5%-10% above or below the specified value, such as 0.5%, 1%, 1.5%, 2%, 2.5%, above or below the specified value. 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%.
- subject generally refers to human or non-human animals, including but not limited to cats, dogs, horses, pigs, cows, sheep, rabbits, mice, rats or monkeys.
- the present application provides an immune effector cell, wherein the function of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in the immune effector cell is inhibited in the cell, And the immune effector cells comprise a chimeric antigen receptor (CAR) targeting GD2.
- TCR T cell antigen receptor
- MHCI major histocompatibility complex
- CAR chimeric antigen receptor
- the VH comprises a heavy chain complementarity determining region 1 (HCDR1), a heavy chain complementarity determining region 2 (HCDR2) and a heavy chain complementarity determining region 3 (HCDR3), the HCDR1 comprising the same sequence as SEQ ID NO:
- the amino acid sequence shown in 1 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5 % identity amino acid sequence.
- the HCDR1 may comprise the amino acid sequence shown in SEQ ID NO:1.
- the HCDR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 2 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the HCDR2 can comprise the amino acid sequence shown in SEQ ID NO:2
- the HCDR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:3 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the HCDR3 may comprise the amino acid sequence shown in SEQ ID NO:3.
- the VH comprises: comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence shown in SEQ ID NO: 1, HCDR1 having an amino acid sequence of about 96%, about 97%, about 98%, about 99%, about 99.5% identical, comprising at least about 90%, about 91%, about 90%, about 91%, about 99.5% identical to the amino acid sequence shown in SEQ ID NO:2 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HCDR2 and comprising the same as SEQ ID NO:3
- the amino acid sequences shown are at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical Sexual amino acid sequence of HCDR3.
- the functions of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in the immune effector cells are inhibited in the cells, and the immune effector cells contain chimeric cells targeting GD2 Combined antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting GD2 comprises a targeting moiety, the targeting moiety comprises an antibody heavy chain variable region (VH), and the VH may comprise: comprising HCDR1 having the amino acid sequence shown in SEQ ID NO:1, HCDR2 comprising the amino acid sequence shown in SEQ ID NO:2, and HCDR3 comprising the amino acid sequence shown in SEQ ID NO:3.
- CAR Combined antigen receptor
- VH antibody heavy chain variable region
- the VH comprises heavy chain framework region 1 (HFR1), heavy chain framework region 2 (HFR2), heavy chain framework region 3 (HFR3) and heavy chain framework region 4 (HFR4), the HFR1 comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO:4, Amino acid sequences of about 99%, about 99.5% identity.
- HFR1 heavy chain framework region 1
- HFR2 heavy chain framework region 2
- HFR3 heavy chain framework region 3
- HFR4 heavy chain framework region 4
- the HFR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:5. %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the HFR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:6 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the HFR4 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO:7. %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the VH comprises HFR1, HFR2, HFR3 and HFR4, and the HFR1, HFR2, HFR3 and HFR4 are selected from:
- HFR1 having an amino acid sequence of about 99%, about 99.5% identity, comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 94% of the amino acid sequence shown in SEQ ID NO:5 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HFR2, comprising at least about 90%, about 91% of the amino acid sequence shown in SEQ ID NO:6 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of HFR3 comprising the same as SEQ ID NO
- the amino acid sequence shown in: 7 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 9
- the VH comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence set forth in SEQ ID NO:8. %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- TCR T cell antigen receptor
- MHCI major histocompatibility complex
- MHCII major histocompatibility complex
- the immune effector cells contain chimeric cells targeting GD2
- the chimeric antigen receptor (CAR) targeting GD2 comprises a targeting moiety comprising an antibody heavy chain variable region (VH)
- VH antibody heavy chain variable region
- the VH may comprise a VH comprising Amino acid sequence shown in SEQ ID NO:8.
- the VL comprises light chain complementarity determining region 1 (LCDR1), light chain complementarity determining region 2 (LCDR2) and light chain complementarity determining region 3 (LCDR3), said LCDR1 comprising the same sequence as SEQ ID NO:
- the amino acid sequence shown in 9 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% % identity amino acid sequence.
- the LCDR1 may comprise the amino acid sequence shown in SEQ ID NO:9.
- the LCDR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 10 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the LCDR2 may comprise the amino acid sequence shown in SEQ ID NO:10.
- the LCDR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 11 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the LCDR3 may comprise the amino acid sequence shown in SEQ ID NO: 11.
- the VL comprises: comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence shown in SEQ ID NO:9, LCDR1 having an amino acid sequence of about 96%, about 97%, about 98%, about 99%, about 99.5% identity, comprising at least about 90%, about 91%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to the amino acid sequence of LCDR2 and comprising SEQ ID NO: 11
- the amino acid sequence has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identity Amino acid sequence of LCDR3.
- the functions of T cell antigen receptor (TCR) and major histocompatibility complex (MHCI, MHCII) in the immune effector cells are inhibited in the cells, and the immune effector cells contain chimeric cells targeting GD2 Combined antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting GD2 comprises a targeting moiety, the targeting moiety comprises VH and VL, and the VH may comprise: comprising SEQ ID NO: 1 HCDR1 comprising the amino acid sequence shown in SEQ ID NO: 2 and HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 2 and HCDR3 comprising the amino acid sequence shown in SEQ ID NO: 3; the VL may comprise: comprising the same as shown in SEQ ID NO: 9 LCDR1 of the amino acid sequence, LCDR2 comprising the amino acid sequence shown in SEQ ID NO:10 and LCDR3 comprising the amino acid sequence shown in SEQ ID NO:11.
- said VL comprises light chain framework region 1 (LFR1), light chain framework region 2 (LFR2), light chain framework region 3 (LFR3) and light chain framework region 4 (LFR4), said LFR1 comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO: 12, Amino acid sequences of about 99%, about 99.5% identity.
- LFR1 comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% of the amino acid sequence shown in SEQ ID NO: 12, Amino acid sequences of about 99%, about 99.5% identity.
- the LFR2 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 13 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the LFR3 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 14 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the LFR4 comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 15 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the VL comprises LFR1, LFR2, LFR3 and LFR4, and the LFR1, LFR2, LFR3 and LFR4 are selected from:
- LFR1 having an amino acid sequence of about 99%, about 99.5% identity, comprising at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to an amino acid sequence of LFR2 comprising at least about 90%, about 91% of the amino acid sequence shown in SEQ ID NO: 14 %, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical to an amino acid sequence of LFR3 comprising an amino acid sequence identical to SEQ ID NO :
- the amino acid sequence shown in 15 has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about
- the VL comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96% of the amino acid sequence shown in SEQ ID NO: 16 %, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- TCR T cell antigen receptor
- MHCI major histocompatibility complex
- MHCII major histocompatibility complex
- the immune effector cells contain chimeric cells targeting GD2 Composite antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting GD2 comprises a targeting moiety, the targeting moiety comprises VH and VL, and the VH may comprise the gene shown in SEQ ID NO:8 Amino acid sequence; the VL may comprise the amino acid sequence shown in SEQ ID NO:16.
- CAR Composite antigen receptor
- the chimeric antigen receptor (CAR) targeting GD2 comprises a targeting moiety, the targeting moiety comprises VH and VL, and the VH may comprise the gene shown in SEQ ID NO:8 Amino acid sequence; the VL may comprise the amino acid sequence shown in SEQ ID NO:16.
- the targeting moiety comprises a full length antibody, Fab, single chain variable fragment (scFv) or single domain antibody (VHH).
- the targeting moiety includes scFv.
- the targeting moiety comprises a linker polypeptide between VH and VL.
- linker polypeptide comprises the amino acid sequence shown in SEQ ID NO: 17 or SEQ ID NO: 18.
- the targeting moiety comprises at least about 90%, about 91%, about 92%, about 93%, about Amino acid sequences that are 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
- targeting moiety may comprise the amino acid sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20.
- TCR T cell antigen receptor
- MHCI major histocompatibility complex
- MHCII major histocompatibility complex
- the immune effector cells contain GD2-targeting Chimeric antigen receptor (CAR), the chimeric antigen receptor (CAR) targeting GD2 comprises a targeting moiety, and the targeting moiety may comprise amino acids shown in SEQ ID NO:19 or SEQ ID NO:20 sequence.
- the CAR includes a transmembrane domain comprising a transmembrane domain derived from one or more proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e) , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC, CD3 ⁇ , CTLA-4, LAG-3, CD5, ICOS, OX40, NKG2D, 2B4, CD244, Fc ⁇ RI ⁇ , BTLA, CD30, GITR, HVEM , DAP10, CD2, NKG2C, LIGHT, DAP12, CD40L (CD154), TIM1, CD226, DR3, CD45, CD80, CD86, CD9, CD16, CD22, CD33, CD37, CD64, and SLAM.
- proteins selected from the group consisting of: CD8A, CD8B, CD28, CD3 ⁇ (CD3e) , 4-1BB, CD4, CD27, CD7, PD-1, TRAC, TRBC
- the transmembrane domain comprises a transmembrane domain derived from CD8A.
- the transmembrane domain may comprise a transmembrane domain derived from CD8A.
- the transmembrane domain comprises at least about 90%, about 91%, about 92%, about 90% of the amino acid sequence shown in any one of SEQ ID NO:29 to SEQ ID NO:77 Amino acid sequences that are 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
- the transmembrane domain can comprise the amino acid sequence shown in SEQ ID NO:29.
- the CAR includes an intracellular co-stimulatory signaling domain comprising an intracellular co-stimulatory protein derived from one or more proteins selected from the group consisting of: Signal transduction domain: CD28, 4-1BB (CD137), CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4, Fc ⁇ RI ⁇ , BTLA, GITR, HVEM, DAP10, DAP12, CD30, CD40, CD40L, TIM1, PD-1, LFA-1, LIGHT, JAML, CD244, CD100, ICOS, CD40, and MyD88.
- Signal transduction domain CD28, 4-1BB (CD137), CD27, CD2, CD7, CD8A, CD8B, OX40, CD226, DR3, SLAM, CDS, ICAM-1, NKG2D, NKG2C, B7-H3, 2B4,
- the intracellular costimulatory signaling domain is derived from a costimulatory signaling domain of 4-1BB.
- the intracellular co-stimulatory signaling domain comprises at least about 90%, about 91%, of the amino acid sequence shown in any one of SEQ ID NO:78 to SEQ ID NO:110, Amino acid sequences that are about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
- the intracellular co-stimulatory signaling domain may comprise the amino acid sequence shown in SEQ ID NO:79.
- the CAR includes an intracellular signaling domain comprising an intracellular signaling structure derived from one or more proteins selected from the group consisting of Domains: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef, DAP10, DAP-12 and contains at least one ITAM domain.
- CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b proteins selected from the group consisting of Domains: CD3 ⁇ , CD3 ⁇ , CD3 ⁇ , CD79a, CD79b, FceRI ⁇ , FceRI ⁇ , Fc ⁇ RIIa, bovine leukemia virus gp30, Epstein-Barr virus (EBV) LMP2A, simian immunodeficiency virus PBj14Nef,
- the intracellular signaling domain comprises a signaling domain derived from CD3 ⁇ .
- said intracellular signal transduction domain comprises any of SEQ ID NO:94, SEQ ID NO:98, SEQ ID NO:99, SEQ ID NO:111 to SEQ ID NO:121
- a given amino acid sequence has at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about Amino acid sequences with 99.5% identity.
- the intracellular signal transduction domain may comprise the amino acid sequence shown in SEQ ID NO: 111.
- the CAR includes a hinge region between the targeting moiety and the transmembrane domain, the hinge region comprising a hinge region derived from one or more proteins selected from the group consisting of: CD28, IgG1 , IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
- proteins selected from the group consisting of: CD28, IgG1 , IgG4, IgD, 4-1BB, CD4, CD27, CD7, CD8A, PD-1, ICOS, OX40, NKG2D, NKG2C, Fc ⁇ RI ⁇ , BTLA, GITR, DAP10, TIM1, SLAM, CD30, and LIGHT.
- the hinge region comprises a hinge region derived from CD8A.
- the hinge region comprises at least about 90%, about 91%, about 92%, about 93% of the amino acid sequence shown in any one of SEQ ID NO: 122 to SEQ ID NO: 143. , about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
- the hinge region can comprise the amino acid sequence shown in SEQ ID NO: 130.
- the non-targeting portion of the chimeric antigen receptor comprises the transmembrane domain of the CD8A molecule, the hinge region of CD8A, the intracellular co-stimulatory signaling domain of 4-1BB, and the CD3 ⁇ intracellular signaling structure area.
- the non-targeting portion of the chimeric antigen receptor comprises at least about 90%, about 91%, about 92%, about 93%, about 90% of the amino acid sequence set forth in SEQ ID NO: 21. Amino acid sequences that are 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
- the non-targeting portion of the chimeric antigen receptor can comprise the amino acid sequence set forth in SEQ ID NO:21.
- the chimeric antigen receptor may include a CAR including a signal peptide, an anti-GD2 scFv, a CD8A hinge domain, a CD8A transmembrane domain, a 4-1BB co-stimulatory domain, and a CD3 ⁇ main signaling domain.
- the signal peptide fragment comprises a CD8A signal peptide fragment.
- the signal peptide fragment comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence shown in SEQ ID NO: 22, Amino acid sequences that are about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
- the signal peptide fragment may comprise the amino acid sequence shown in SEQ ID NO:22.
- the chimeric antigen receptor comprises at least about 90%, about 91%, about 92%, about 93%, about 94%, about 95% of the amino acid sequence set forth in SEQ ID NO: 23 %, about 96%, about 97%, about 98%, about 99%, about 99.5% identical amino acid sequences.
- the chimeric antigen receptor can comprise the amino acid sequence shown in SEQ ID NO:23.
- the immune effector cells include human cells.
- the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
- the immune effector cells may be T cells, such as human T cells.
- the immune effector cells comprise autologous or non-autologous immune effector cells.
- the immune effector cells can be non-autologous human T cells.
- the immune effector cells include modified immune effector cells, wherein the modification includes down-regulation of the expression and/or activity of one or more genes associated with immune rejection.
- the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
- the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the unmodified corresponding cells.
- the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
- the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding cells without the modification.
- the expression and/or activity of TRAC gene and HLA-A gene can be down-regulated in the modified immune effector cells, and the expression and/or activity of CIITA gene and B2M gene can be down-regulated. May not be lowered.
- the expression and/or activity of the TRAC gene and the HLA-A gene are down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
- the expression and/or activity of the B2M gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
- the expression and/or activity of the CIITA gene is not down-regulated in the modified immune effector cells compared to the corresponding wild-type cells.
- the expression and/or activity of TRAC gene and HLA-A gene can be down-regulated, and the expression and/or activity of CIITA gene and B2M gene can be unregulated in the modified immune effector cells. down.
- the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
- the modification includes: gene knockout, gene mutation and/or gene silencing.
- the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
- the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
- the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
- said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
- said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
- the modification further comprises administering to the immune effector cells sgRNA targeting the exon portion of the TRAC gene.
- the sgRNA targeting the exon portion of the TRAC gene comprises at least about 90 %, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
- the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
- the sgRNA targeting the exon portion of the HLA-A gene comprises at least one of the nucleotide sequences shown in any one of SEQ ID NO: 159 to SEQ ID NO: 199 Amino acid sequences that are about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
- said modification further comprises administering a Cas enzyme to said cells.
- the Cas enzyme comprises a Cas9 protein.
- the antisense RNA comprises at least about 90%, about 91%, about 92% of the nucleotide sequence shown in any one of SEQ ID NO:200 to SEQ ID NO:203 , about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
- the immune effector cells are HLA-B homozygous cells.
- HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
- the immune effector cells are HLA-A homozygous or heterozygous cells.
- HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
- the immune effector cells can be human T cells, and the human T cells can be HLA-B homozygous cells.
- the present application provides a method for preparing the aforementioned immune effector cells, which includes: introducing into the immune effector cells a polynucleotide sequence encoding the aforementioned GD2-targeting CAR or comprising a polynucleotide encoding the aforementioned GD2-targeting CAR Before/after the carrier of the sequence, the immune effector cells are modified, and the modification includes down-regulation of the expression and/or activity of one or more genes related to immune rejection.
- the method for preparing immune effector cells may include:
- the modification includes down-regulating the expression and/or activity of one or more genes related to immune rejection.
- the method for preparing immune effector cells may include:
- CD3 magnetic beads were added in proportion to collect CD3-T cells (cells not bound to magnetic beads).
- the vector is an expression vector.
- the vector is selected from DNA vectors, RNA vectors, plasmids, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors and retroviral vectors.
- the vector further comprises an EF-1 ⁇ promoter.
- the vector further comprises a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
- WPRE woodchuck hepatitis virus post-transcriptional regulatory element
- the gene related to immune rejection is selected from one or more genes in the group consisting of TRAC, TRBC, HLA-A, HLA-B, B2M and CIITA.
- the genes related to immune rejection may include TRAC and/or HLA-A.
- the expression and/or activity of the TRAC gene and the HLA-A gene in said immune effector cells are down-regulated compared to the expression and/or activity of the corresponding genes in corresponding cells without said modification.
- the expression and/or activity of the CIITA gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
- the expression and/or activity of the B2M gene is not down-regulated compared to the expression and/or activity of the corresponding gene in a corresponding cell without said modification.
- the expression and/or activity of TRAC gene and HLA-A gene can be down-regulated in the modified immune effector cells, and the expression and/or activity of CIITA gene and B2M gene can be down-regulated. May not be lowered.
- the expression and/or activity of the TRAC gene and the HLA-A gene of the immune effector cells is down-regulated compared to corresponding wild-type cells.
- the expression and/or activity of the CIITA gene is not downregulated compared to corresponding wild-type cells.
- the expression and/or activity of the B2M gene is not down-regulated compared to corresponding wild-type cells.
- the expression level and/or activity of the gene is down-regulated, including down-regulating the expression and/or activity of a nucleic acid molecule encoding the gene; and/or down-regulating the expression of a protein product encoded by the gene and/or activity is downregulated.
- the expression and/or activity of TRAC gene and HLA-A gene can be down-regulated, and the expression and/or activity of CIITA gene and B2M gene can be unregulated in the modified immune effector cells. down.
- the modification includes: gene knockout, gene mutation and/or gene silencing.
- the modification comprises the knockout of either of the two TRAC alleles and the knockout of either of the two HLA-A alleles in the immune effector cells.
- the modification comprises knockout of two TRAC alleles and knockout of either of the two HLA-A alleles in the immune cells.
- the modification comprises knockout of exon of TRAC gene and knockout of exon of HLA-A gene in the immune cells.
- said modification comprises administering to said immune effector cells one or more substances selected from the group consisting of antisense RNA, siRNA, shRNA and CRISPR/Cas9 system.
- said modification comprises administering a CRISPR/Cas9 system to said immune effector cells.
- the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the TRAC gene.
- the sgRNA targeting the exon portion of the TRAC gene comprises at least about 90 %, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
- the modification comprises administering to the immune effector cells an sgRNA targeting an exon portion of the HLA-A gene.
- the sgRNA targeting the exon portion of the HLA-A gene comprises at least one of the nucleotide sequences shown in any one of SEQ ID NO: 159 to SEQ ID NO: 199 Amino acid sequences that are about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% identical.
- said modification further comprises administering a Cas enzyme to said cells.
- the Cas enzyme comprises a Cas9 protein.
- the antisense RNA comprises at least about 90%, about 91%, about 92% of the nucleotide sequence shown in any one of SEQ ID NO:200 to SEQ ID NO:203 , about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5% amino acid sequence identity.
- the immune effector cells comprise human cells.
- the immune effector cells include T cells, B cells, natural killer cells (NK cells), macrophages, NKT cells, monocytes, dendritic cells, granulocytes, lymphocytes, leukocytes and/or peripheral blood mononuclear cells.
- the immune effector cells may be T cells, such as human T cells.
- the immune effector cells comprise autologous or non-autologous immune effector cells.
- the cells are homozygous for HLA-B.
- the immune effector cells can be human cells, and the human cells can be HLA-B homozygous cells.
- the immune effector cells may be human T cells, and the human cells may be HLA-B homozygous cells.
- HLA-B homozygote includes HLA-B*40 homozygote, HLA-B*15 homozygote, HLA-B*46 homozygote, HLA-B*13 homozygote, HLA-B* B*51 homozygote, HLA-B*58 homozygote, HLA-B*07 homozygote, HLA-B*35 homozygote, HLA-B*44 homozygote, HLA-B*52 homozygote, HLA-B* 57 homozygous, HLA-B*54 homozygous, HLA-B*55 homozygous.
- the cells are HLA-A homozygous or heterozygous cells.
- HLA-A homozygote or heterozygote comprises HLA-A*02 homozygote, HLA-A*11 homozygote, HLA-A*02/A*11 heterozygote or HLA-A *24 homozygotes.
- the present application provides the application of the aforementioned immune effector cells in the preparation of CAR-T cells.
- the present application provides a pharmaceutical composition, which comprises the aforementioned immune effector cells, and optionally a pharmaceutically acceptable carrier.
- the present application provides the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition, which are used for treating diseases or conditions related to the expression of GD2.
- the disease or disorder associated with the expression of GD2 comprises a disease or disorder associated with up-regulated expression of GD2.
- GD2 comprises cancer
- the cancer comprises a GD2 positive tumor.
- the cancer comprises: neuroblastoma, melanoma, retinoblastoma, small cell lung cancer, Ewing sarcoma, medulloblastoma, soft tissue sarcoma, osteosarcoma, or glioma.
- the present application provides the use of the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition in the preparation of medicines for treating diseases or conditions related to the expression of GD2.
- the disease or disorder associated with the expression of GD2 comprises a disease or disorder associated with up-regulation of the expression of GD2.
- GD2 comprises cancer
- the cancer comprises a GD2 positive tumor.
- the cancer comprises: neuroblastoma, melanoma, retinoblastoma, small cell lung cancer, Ewing sarcoma, medulloblastoma, soft tissue sarcoma, osteosarcoma, or glioma.
- the present application provides a method for preventing or treating a disease or disorder related to the expression of GD2, which includes administering an effective amount of the aforementioned immune effector cells and/or the aforementioned pharmaceutical composition to a subject in need .
- the disease or disorder associated with the expression of GD2 comprises a disease or disorder associated with up-regulated expression of GD2.
- GD2 comprises cancer
- the cancer comprises a GD2 positive tumor.
- the cancer comprises: neuroblastoma, melanoma, retinoblastoma, small cell lung cancer, Ewing sarcoma, medulloblastoma, soft tissue sarcoma, osteosarcoma, or glioma.
- the anti-GD2 CAR VLVH (murine) structure includes: a GD2 antigen-binding region (derived from the anti-GD2 monoclonal antibody Scfv), a CD8A extracellular hinge region, a CD8A transmembrane region, a 4-1BB intracellular co-stimulatory domain and A CD3 ⁇ activation signal domain, its DNA sequence is shown in SEQ ID NO:28 and its amino acid sequence is shown in SEQ ID NO:23.
- the GD2 sequence information and the CAR vector structure construct the GD2 CAR lentiviral expression vector, and the schematic diagram of the vector (see Figure 1). Optimization: select the commercial lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP as the backbone, and carry out element transformation on the basis of this vector.
- the ampicillin resistance gene ⁇ -lactamase of the vector was replaced with the aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance.
- the CMV promoter and its adjacent downstream multiple cloning sites which are potentially threatening for in vivo applications.
- the copGFP gene expressed by the EF1 promoter in the original vector was deleted, the SalI restriction site was retained, and the SmaI restriction site was added at the 5' end of SalI for vector construction to form the final destination vector.
- the added SmaI restriction site is a single restriction site for the final destination vector, and other sequence parts of the vector do not have this restriction site.
- the non-limiting design principle of the sgRNA of the CRISPR/Cas9 system used in this example is: 5'-NNN(20)-NGG-3', NGG is called protospacer adjacent motif (PAM), wherein , N represents A, T, C or G.
- PAM protospacer adjacent motif
- sgRNAs Since many sgRNAs can be designed on the same exon, and sgRNAs consisting of 20 nucleotide sequences may appear repeatedly in the genome, use the website http://crispr.cos.uni-heidelberg.de to Carry out the design and evaluation of sgRNA, paste the exon sequence to this website, the website designs sgRNA and conducts prediction evaluation, the higher the score in the evaluation, it means that there may be higher editing efficiency and lower off-target risk, from which Select the sgRNA with higher score to test.
- the sgRNA targeting the TRAC gene is shown in SEQ ID NO:144 to SEQ ID NO:158
- the sgRNA targeting the HLA-A02 gene is shown in SEQ ID NO:159 to SEQ ID NO:180
- the targeting HLA-A11 gene The sgRNA of the gene is shown in SEQ ID NO:181 to SEQ ID NO:191
- the sgRNA targeting the HLA-A24 gene is shown in SEQ ID NO:192 to SEQ ID NO:199, which were synthesized by GenScript Biotechnology Company.
- HLA-B typing of the recipient select HLA-B homozygotes that match the HLA-B typing of the recipient.
- the source of the donor is based on the HLA-B homozygote in the population.
- One of the alleles of the patient's HLA-B is consistent with the donor's HLA-B homozygote.
- Cells from these donors can cover a high number of patient populations . Reduce the rejection caused by the inconsistency of HLA-B subtypes.
- HLA-B mainly selects B*40 homozygote, B*15 homozygote, B*46 homozygote, B*13 homozygote, B*51 homozygote, B*58 homozygote, B*07 homozygote with high frequency in the population Homozygote, B*35 homozygote, B*44 homozygote, B*52 homozygote, B*57 homozygote, B*54 homozygote, B*55 homozygote.
- HLA-A selects A*02 homozygotes, A*11 homozygotes and A*02/A11 heterozygotes with higher frequencies in the population.
- Peripheral blood was collected from healthy donors and diluted 1:1 with PBS buffer.
- cell separation solution Ficoll
- blood cell dilution solution very slowly along the tube wall, and centrifuge at 800g for 20min at room temperature (set the centrifuge to increase speed 1, reduce speed 0).
- the liquid in the centrifuge tube is divided into PBS and serum layer, white blood cell layer, lymphocyte separation solution, and red blood cell layer from top to bottom.
- remove the PBS and serum layer move the white blood cell layer to a new 50ml centrifuge tube, add PBS to 40ml to wash the cells, and centrifuge at 450g for 10min. After centrifugation, the supernatant was discarded to obtain peripheral blood mononuclear cells. Cell counts were performed after the cells were resuspended.
- T cells in peripheral blood mononuclear cells were extracted using EasySep TM Human T Cell Separation Kit (purchased from StemCell Technologies, catalog number: 17951). Adjust the PBMC density to 5 ⁇ 10 7 cells/ml, and add PBS buffer in the range of 0.25-2ml; first add cocktail to mix well, then add isolation cocktail at 50 ⁇ l/ml, mix well and place at room temperature for 5 minutes; shake RapidSpheres by vortex After vortexing for 30s, add 40 ⁇ l/ml to the cells and mix well; add buffer to the multiple of 2.5ml, and gently blow up and down 2-3 times; add 2.5ml to each tube respectively, and put Place the cryovial on the magnetic stand, and let it stand at room temperature for 3 minutes; gently open the cap of the cryovial, carefully hold the two sides to pick up the magnetic stand, keep it upside down for 2-3 seconds, and pour the cell solution into a new centrifuge tube at one time; use 10 - After resuspending the cells in 20ml buffer (dependured
- CD3+T cells (D0 day) according to the method of Example 2, and activate with CD3/CD28 antibody magnetic beads, and carry out lentiviral vector (GD2 CAR lentiviral expression vector prepared in Example 1) transfection on D1 day after activation, On D2, the lentiviral vector was washed away, and on D3, electroporation was performed.
- lentiviral vector GD2 CAR lentiviral expression vector prepared in Example 1
- TRAC sgRNA AGAGTCTCTCAGCTGGTACA (SEQ ID NO: 144), A02 sgRNA: CTGACCATGAAGCCACCCCTG (SEQ ID NO: 161), A11 sgRNA: GGCCCCTCCTGCTCTATCCA (SEQ ID NO: 191).
- Sorting CD3-negative T cells centrifuging after counting cells, discarding supernatant; resuspending cells with buffer and mixing, adding CD3 magnetic beads to 20ul CD3 magnetic beads/ 107 cells, mixing evenly, and incubating in a 4-degree refrigerator.
- Cell harvesting Collect cells in a centrifuge tube and discard after centrifugation, wash the cells again with normal saline, centrifuge, prepare a cryopreservation solution, resuspend the centrifuged cells in the cryopreservation solution, and draw the cell suspension into the final product with a cell freezer In the storage bag, label the cell cryopreservation bag for the next step of freezing.
- Knockout efficiency (AB)/A ⁇ 100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.
- GD2 target cells IMR-32-Luciferase-GFP; adjust the target cell state to the logarithmic growth phase, and need to be continuously passaged twice before the experiment;
- the target cells were resuspended in 1640+10% FBS, and three 24-well plates were taken for each target site, and the target cells were inoculated according to the amount of 2x10 ⁇ 5/well. (Both target cells and effector cells were seeded at a density of 2x10 ⁇ 6/ml). Then add effector cells according to the E/T (effect-to-target ratio, effector cells: target cells) ratio. Fill each well to the maximum volume (such as 600ul). The control was inoculated with the same number of target cells without adding effector cells (600ul). The well plate was placed in a 5% CO 2 , 37° C. incubator and incubated for 24 hours. E/T: 1:2, 1:1, 2:1, 5:1, 10:1 plank, repeat three times.
- anti-GD2 UCAR-T has a significant killing effect on IMR-32-LG cells, and the killing efficiency can reach more than 95% when the effect-to-target ratio is 2:1 (see Figure 4).
- mice aged 8-10 weeks were intravenously injected with tumor cell IMR-32-Luciferase-GFP (1x10 ⁇ 6-1x10 ⁇ 7), and the mice were divided into three groups with 5 mice in each group.
- the mice were injected with 5x10 ⁇ 6 of anti-GD2 UCAR-T cells, anti-GD2 CAR-T cells, and T cells without gene knockout respectively, and the tumors of the mice were monitored by luciferase fading condition.
- mice Fifteen humanized immune system mice (hHSC-NCG) were prepared and divided into 3 groups. Preparation of cells, experimental group anti-GD2 UCAR-T cells (knockout TRAC+HLA-A02); control group 1: anti-GD2 CAR-T; control group 2: anti-GD2 UCAR-T cells (knockout TRAC+B2M ); each mouse was injected with 1x10 ⁇ 7 cells, and blood was collected at different time points D0, 2h, D3, D7, D14, D21, D28, D35, D42, D49, D56, D60. Genomes were extracted from blood samples at different time points, and the copy/ng genome DNA was calculated by QPCR absolute quantification method. The positive control used UCAR-T cells harvested on the 14th day, and the negative control used DEPC water.
- GVHD response Prepare TRAC, HLA-A double-knockout T cells, T cells without gene knockout, irradiate allogeneic PBMC, stimulate the two groups of cells prepared respectively, and detect the level of IFN-r.
- Allogeneic reaction Allogeneic PBMC stimulated the cells of the two groups after irradiation, and detected the level of IFN-r.
- GVHD response prepare TRAC, HLA-A double knockout T cells, and T cells without gene knockout. 8-10 weeks NSG mice were injected with 1x10 ⁇ 7 respectively, and the graft-versus-host reaction was observed through clinical indicators: survival rate, fur texture and skin integrity, etc. Cytokine detection: Peripheral blood serum was collected to detect the levels of cytokines such as IL6, IL-2, TNF- ⁇ , IFN- ⁇ , etc. Blood collection time: before reinfusion, 24h, D3, D7, D14, D28, 2M. Detection of organ lesions: At the end of the observation period (about 2 months), the spleen, liver, skin, gastrointestinal tract, lung, and kidney of the mice were taken for HE section staining analysis.
- mice injected with untreated T cells developed lethal graft-versus-host disease (GVHD) within 2 months of injection. None of the mice receiving TRAC, HLA-A double knockout cells developed GVHD; the TRAC, HLA-A double knockout T cell group secreted very low levels of cytokines IL6, IL-2, TNF- ⁇ , IFN- ⁇ ; and The morphology of different organs of the mice was normal. It shows that TRAC, HLA-A double-knockout T cell group greatly reduces the GVHD response.
- GVHD lethal graft-versus-host disease
- Allogeneic reaction preparation of TRAC, HLA-A double-knockout CAR-T cells, and co-injection of 1x10 ⁇ 7 TCR-HLA-A-double-knockout CAR-T cells (irradiated) and 2x10 ⁇ 6 allogeneic T cells into NSG mice.
- Control group Inject 1x10 ⁇ 7 TCR - CAR-T cells into NSG mice.
- Control group transfer to CAS9+ODN label
- On-target and off-target-WGS (Whole genome sequencing): 1 ⁇ 10 ⁇ 6 T cells without gene knockout, TRAC, and HLA-A double-knockout T cells were taken respectively and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for detection .
- Result analysis double-knockout T cells (TRAC+HLA-A) detected whether chromosomal translocation occurred on D14 (harvest).
- the detection results the detection values of both translocation methods were close to zero detection value, indicating that no rearrangement of the loci occurred ( See Figure 10).
- Residual Cas9 protein During cell preparation, 1 ⁇ 10 ⁇ 6 cells at each of the three time points before knockout, after knockout, and before harvest were lysed, and then protein quantification kit (NOVATEINBIO, Cat. No. NB-E1372PR ) for quantification, the samples in each group were adjusted to the same loading volume of 2 ⁇ g, and the CRISPR/Cas9 protein ELISA kit was used for detection according to the instructions.
- the Cas9 protein in the sample is firmly and stably placed on the test paper well. Then use the detection antibody to recognize the bound Cas9 protein, and then develop with the developer.
- the Cas9 ratio is proportional to the absorbance, and the absolute amount of Cas9 protein is quantified by comparing with the Cas9 control.
- Double knockout T cells detected the residue of spCas9 at four time points before electroporation (D3), before electroporation (D5), D9, and D14 (harvest). Trace residues were detected before solution (D5), but not detected at the other three time points. (See Figure 12).
- the RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance.
- the sgRNA sequence of TRAC is sg9 (as shown in SEQ ID NO: 144)
- the sgRNA sequence of HLA-A is HLA-A02 Sg2 (as shown in SEQ ID NO: 160) or HLA-A02Sg5 (as shown in SEQ ID NO: 160) ID NO: 161) or HLA-A11sg21 (as shown in SEQ ID NO: 191) or HLA-A11Rsg2 (as shown in SEQ ID NO: 190)
- first add 20 ⁇ g sgRNA to the PCR tube (without RNase) and then added 10 ⁇ g of Cas9 protein (purchased from thermo, product number A36499), mixed gently, and incubated at room temperature for 12 minutes.
- Example 2 Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100 ⁇ l of prepared electroporation buffer .
- Add the preheated medium into the electro-cup then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO 2 incubator for culture.
- Knockout efficiency (AB)/A ⁇ 100%; A is the positive expression rate of the control group; B is the positive expression rate of the knockout group.
- the three detection results of TRAC single gene knockout are shown in Figure 13 to Figure 15, and the knockout efficiency calculation results are shown in Table 1.
- the three detection methods are basically the same, and only the Sanger sequencing method was used to detect the editing efficiency in subsequent experiments.
- the RNP complex was transferred into the activated T cells prepared in Example 2 by electroporation using an electroporation kit (purchased from LONZA, product number: V4XXP-3024). Preheat the medium (X-VIVO15 medium + 10% FBS + IL2 (200 U/ml) + IL7 (10 ng/ml) + IL15 (5 ng/ml)) in the well plate 30 minutes in advance.
- TRAC Sg9 20 ⁇ g TRAC sgRNA (TRAC Sg9), 20 ⁇ g HLA-A sgRNA (HLA-A02 Sg2 or HLA-A02 Sg5 or HLA-A11sg21 or HLA-A*24:02:01, HLA-A *30:01:01:01, HLA-A*33:01:01:01, HLA-A*03:01:01:01, HLA-A*01:01:01:01 or HLA-A*26 :01:01:01 sgRNA) into PCR tubes (no RNA), and then add 10 ⁇ g Cas9 protein (purchased from thermo, product number A36499) respectively, mix gently, and incubate at room temperature for 12 minutes.
- Cas9 protein purchased from thermo, product number A36499
- Example 2 Count the activated T cells cultured in Example 2, centrifuge at 300g for 8min, discard the supernatant, add PBS to resuspend the cells, absorb 1E7 cells and centrifuge again at 300g for 8min, discard the supernatant, and resuspend the cells with 100 ⁇ l of prepared electroporation buffer .
- Add the preheated medium into the electro-cup then transfer the cells into the preheated medium in the well plate with a matching pipette, and then place them in a 37°C, 5% CO 2 incubator for culture.
- the double-gene knockout efficiency is detected by sequencing, and TRAC-negative and HLA-A-negative T cells with a double-gene knockout efficiency of not less than 80% can be obtained.
- the results are shown in Figure 20-21.
- Figure 20A shows the result of using HLA-A02 Sg5 to knock out HLA-A02, wherein the upper row shows the results of the control group (that is, without using HLA-A02 Sg5 to knock out); the next row shows the simultaneous knockout of HLA -The results of A02 and TRAC;
- Figure 20B shows the results of knocking out TRAC using TRAC Sg9, where the upper line shows the results of the control group (that is, no knocking out with TRAC Sg9); the next line shows simultaneous knockout HLA-A02 and TRAC results.
- Figure 21A-21B shows the knockout situation of knockout HLA-A02 and TRAC protein level, wherein NEG refers to the negative control, WT refers to the situation without any knockout treatment, TRAC+HLA-A double knockout refers to the simultaneous knockout of HLA- Results of A02 and TRAC.
- Example 13 Differences in the expression of TRAC gene, HLA-A gene, B2M gene and CIITA gene in T cells with double gene knockout and corresponding genes in corresponding cells
- Example 2 The activated T cells prepared in Example 2 were divided into two groups, one group was used as a control, and the other group prepared TRAC gene and HLA-A gene double gene knockout T cells according to the method in Example 5, according to Sanger sequencing was performed in the manner of step (1) of Example 4. According to the sequencing results, the TRAC and HLA-A double gene knockout cells were obtained.
- the prepared double gene knockout T cells are incubated with corresponding TRAC and HLA-A antibodies, and the double gene knockout cell lines can be obtained by flow sorting or magnetic bead sorting.
- RNA extraction kit purchased from QIAGEN, catalog number: 74004
- reverse transcription kit purchased from Applied Biosystems, catalog number: 4368814
- FIG. 22-23 shows the results.
- Fig. 22 shows the mRNA level determination of gene expression, and wherein Fig. 22 shows the mRNA level of TRAC, HLA-A, B2M and CIITA;
- WT refers to the situation without any knockout treatment
- double knockout group refers to TRAC gene and HLA-A gene double knockout T cells results.
- Figure 23 shows the protein level determination of gene expression, wherein Figure 23A-23B shows the protein expression levels of B2M and CIITA respectively; wherein NEG refers to the negative control, WT refers to the situation without any knockout treatment, TRAC+HLA-A Double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene.
- Example 14 Prepare TRAC gene, HLA-A/B2M gene and CIITA gene knockout T cells and verify the expression changes of the corresponding three genes
- TRAC, HLA-A and CIITA genes in TRAC, HLA-A and CIITA gene knockout T cells were down-regulated; compared with control cells, TRAC, B2M and CIITA triple gene knockout The protein expressions of TRAC, HLA-A and CIITA genes were down-regulated in T cells.
- FIGS 24A-24D show the knockout status of TRAC, HLA-A and B2M protein levels in sequence.
- WT refers to the situation without any knockout treatment
- TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
- TRAC+HLA-A+CIITA triple knockout refers to TRAC, The result of the T cells of HLA-A and CIITA triple gene knockout
- TRAC+B2M+CIITA triple knockout refers to the result of B2M, CIITA and TRAC triple gene knockout of T cells
- TRAC+HLA-A knockdown refers to Example 16 Results of preparation of TRAC and HLA-A knockdown T cells.
- Figure 24D shows the knockdown of CIITA protein levels.
- Embodiment 15 designs antisense RNA sequence
- RNA sequences of the corresponding genes (TRAC gene and HLA-A gene) through the database https://www.ncbi.nlm.nih.gov/ or www.ensembl.org/, and design siRNA with reference to the following principles:
- the antisense RNA sequence that design obtains comprises HLA-A-homo-551 (it comprises the nucleotide sequence shown in SEQ ID NO:200); HLA-A-homo-NEG (it comprises the nucleotide sequence shown in SEQ ID NO:201) nucleotide sequence); TRAC-homo-375 (which comprises the nucleotide sequence shown in SEQ ID NO:202); TRAC-homo-NEG (which comprises the nucleotide sequence shown in SEQ ID NO:203).
- Double gene knockdown was performed using the antisense RNA designed by Example 15.
- the company prepares lentivirus (Gimma) with antisense RNA sequences of TRAC gene and HLA-A gene.
- CD3 + T cells were prepared according to the method in Example 2 (D0 days), and activated with CD3/CD28 antibody magnetic beads, and the activated T cells were transfected with lentiviruses carrying the antisense RNA sequences of the TRAC gene and the HLA-A gene (D1 day), wash off the lentiviral vector on D2, and continue to culture until D5.
- the T cells cultured to D5 days were collected, and the gene knockdown efficiency was detected by quantitative PCR or Western Blot and other methods.
- T cells with TRAC gene and HLA-A gene knockdown can be obtained by flow sorting or magnetic bead sorting.
- the results showed that the mRNA and protein expression levels of TRAC and HLA-A were down-regulated in the TRAC and HLA-A gene knockdown group.
- Figures 25A-25B sequentially show the knockout status of TRAC and HLA-A mRNA levels.
- WT refers to the situation without any knockout treatment
- TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene.
- the knockout levels of TRAC and HLA-A protein levels can be referred to the results in FIG. 24 .
- T cells without gene knockout, double gene knockout, three gene knockouts and double gene knockdown in Examples 2, 12, 14 and 16 compare the cell counts of several T cell activities in each group and take them respectively 1*10 6 cells were inoculated in a 24-well plate, and PHA (0.3 ⁇ g/ml) (ionomycin +) or 5 ng/ml PMA and 50 ng/ml ionomycin were added to the cells in each well, and after continuing to culture for 5 hours, use CD69 (early activation) (purchased from BD Biosciences, catalog number: FN50) and CD137 (late stage) (purchased from BD Biosciences, catalog number: 4B4-1) antibodies were used to detect the activation status of cells by flow cytometry. The results showed that the activity of T cells with double gene knockout and double gene knockout was better than that of triple gene knockout T cells.
- TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
- TRAC+HLA-A+CIITA triple knockout refers to TRAC
- the result of the T cells of HLA-A and CIITA triple gene knockout wherein TRAC+B2M+CIITA triple knockout refers to the result of B2M, CIITA and TRAC triple gene knockout of T cells
- TRAC+HLA-A knockdown refers to Example 16 Results of preparation of TRAC and HLA-A knockdown T cells.
- T cells without gene knockout, double gene knockout, three gene knockouts and double gene knockdown in Examples 2, 12, 14 and 16 were labeled with CFSE (invitrogen, C34554), and the cell counts were taken as 1 *10 6 cells were co-cultured with NK cells (NK92MI) at a ratio of 1:1. After 24 hours, the co-cultured cells were collected, and the ratio of CFSE-positive cells in the mixed cells was detected by flow cytometry.
- NK+T refers to the situation in which NK cells are co-cultured with T cells without any knockout treatment
- NK+TRAC+HLA-A knockdown refers to the combination of NK cells with the TRAC gene and HLA-A gene prepared in Example 16
- the results of the knockdown T cells co-culture NK+TRAC+HLA-A double knockout refers to the co-culture of NK cells and T cells with TRAC gene and HLA-A gene double gene knockout
- NK+TRAC+HLA -A+CIITA triple knockout refers to the situation where NK cells are co-cultured with TRAC, HLA-A and CIITA triple knockout T cells
- NK+TRAC+B2M+CIITA triple knockout refers to the situation where NK cells are combined with B2M
- No gene knockout, double gene knockout, three gene knockout and double gene knockdown T cells in Examples 2, 12, 14 and 16 were prepared from peripheral blood from donor 1.
- CD3 + T cells were prepared from peripheral blood from donor 2.
- Each group of cells prepared from the peripheral blood of donor 1 was mixed with the CD3 + T cells prepared from the peripheral blood of donor 2 in equal proportions, and the expression level of IFN- ⁇ in the cell mixed system was detected 24 hours later. The results showed that the expression level of IFN- ⁇ in the double gene knockout T cell group was lower than that in the triple gene knockout T cell group.
- TRAC+HLA-A double knockout refers to the result of T cells with double gene knockout of TRAC gene and HLA-A gene
- TRAC+HLA-A+CIITA Triple knockout refers to the result of T cells knocked out by three genes of TRAC, HLA-A and CIITA
- TRAC+B2M+CIITA triple knockout refers to the result of T cells knocked out by three genes of B2M, CIITA and TRAC
- TRAC+HLA-A knockout Low refers to the result of TRAC gene and HLA-A gene knockdown T cells prepared in Example 16.
- Example 20 Preparation of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout of TRAC gene, HLA-A gene and CIITA gene, and knockout of TRAC gene, B2M gene and CIITA gene Removed CAR-T cells
- TRAC gene and HLA-A gene double gene knockout cells according to the methods in Example 12 and Example 14 respectively, TRAC gene, HLA-A gene and CIITA gene as well as TRAC gene, B2M gene and CIITA gene knockout CAR-T cells.
- the double-gene knockout and triple-gene knockout CAR-T cells can be obtained through flow cytometry detection, and the yield of double-gene knockout CAR-T cells is higher than that of triple-gene knockout CAR-T cells.
- Figures 29A-29D show the knockout status of TRAC, HLA-A and B2M protein levels in sequence.
- Figure 29D shows the knockdown of CIITA protein levels.
- WT refers to the situation without any knockout treatment
- TRAC+HLA-A double knockout refers to the result of CAR-T cells with double gene knockout of TRAC gene and HLA-A gene
- TRAC+HLA-A+CIITA triple knockout refers to The results of CAR-T cells with triple gene knockout of TRAC, HLA-A and CIITA
- TRAC+B2M+CIITA triple knockout refers to the results of CAR-T cells with triple gene knockout of B2M, CIITA and TRAC.
- the transfection efficiency of CD19CAR is shown in Figure 30A-30B.
- CAR30%+ represents the transfection efficiency of CD19CAR.
- Figure 31 shows the expansion factor of different cells. Among them, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene had the highest amplification factor.
- Figure 32 shows the killing effect of Raji-Luciferase on CD19 target cells, among which the killing effect of CAR-T cells with double knockout of TRAC gene and HLA-A gene is the most significant.
- each E/T ratio is the result corresponding to the legend of A-D from left to right.
- NSG mice were injected with tumor cells intravenously. After the tumor was successfully established, CAR-T cells with double gene knockout of TRAC gene and HLA-A gene, CAR-T cells with triple gene knockout, or CAR-T cells without gene knockout were reinfused into the mice. T cells, monitoring tumor volume in mice.
- the tumor growth rate was significantly slowed down in mice transfused with double-gene knockout CAR-T cells.
- Figures 33-34 show the administration method to mice, i.v. means intravenous injection, and CAR-T cells represent double-gene knockout CAR-T cells and triple-gene knockout CAR-T cells expressing CD19CAR.
- Figure 34 shows the volume of tumors in mice after administration of CAR-T cells. Among them, from left to right in Figure 34, the CD19CAR-T cells, TRAC, HLA-A and CIITA three-gene knockout were administered with normal saline, unmodified T cells, TRAC gene and HLA-A gene double gene knockout respectively.
- mice The volume of tumors in mice after removing CD19CAR-T cells, B2M, CIITA and TRAC knockout CD19CAR-T cells.
- the results showed that the growth rate of tumors was significantly slowed down in mice transfused with CAR-T cells with double gene knockout of TRAC gene and HLA-A gene.
- This application is the first to construct high-efficiency double-knockout TCR, HLA-A GD2-UCAR-T cells, to achieve a safe shelf-type ready-to-use therapeutic agent, which improves the anti-tumor effect and is used for neuroblasts Treatment of cancer, osteosarcoma, glioma and other tumors.
- the present application provides a lentiviral expression vector.
- pCDH-CMV-MCS-EF1-copGFP as the backbone, the ampicillin resistance gene ⁇ -lactamase of the vector was replaced with aminoglycoside phosphotransferase derived from Tn5, so that the vector had kanamycin resistance;
- the potentially threatening CMV promoter and its adjacent downstream multiple cloning sites in in vivo applications; delete the copGFP gene expressed by the EF1 promoter in the original vector, retain the SalI restriction site, and add it at the 5' end of SalI
- the SmaI restriction site is used for vector construction to form the final destination vector.
- This application optimizes the protein-RNA complex electrotransfection technology. A double gene knockout efficiency of more than 90% in primary T cells was obtained.
- the source of donors for this application is based on the high frequency of HLA-B homozygotes in the population.
- One allele of the patient’s HLA-B is consistent with the donor’s homozygosity.
- Cells from these donors can cover a high number of patients population, and can reduce the rejection caused by HLA-B.
- This application screened out the HLA-A molecules that are highly related to rejection and knocked them out, while retaining other HLA-I molecules, which not only reduced the rejection of allogeneic cells, but also avoided the complete knockout of HLA molecules being NK
- the occurrence of cell clearance greatly prolongs the half-life of allogeneic CAR-T cells in vivo.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Oncology (AREA)
- Hematology (AREA)
- Virology (AREA)
- Transplantation (AREA)
- Communicable Diseases (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202280046726.1A CN118019842A (zh) | 2021-07-01 | 2022-06-30 | 靶向gd2的通用型car-t细胞及其制备方法和应用 |
| JP2023580373A JP2024527537A (ja) | 2021-07-01 | 2022-06-30 | Gd2を標的とするユニバーサルcar-t細胞及びその製造方法並びに使用 |
| US18/575,451 US20240139321A1 (en) | 2021-07-01 | 2022-06-30 | Universal car-t cell targeting gd2, preparation method therefor, and application thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110749475 | 2021-07-01 | ||
| CN202110749475.0 | 2021-07-01 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023274387A1 true WO2023274387A1 (zh) | 2023-01-05 |
Family
ID=84690472
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CN2022/103102 Ceased WO2023274387A1 (zh) | 2021-07-01 | 2022-06-30 | 靶向gd2的通用型car-t细胞及其制备方法和应用 |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20240139321A1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2024527537A (cg-RX-API-DMAC7.html) |
| CN (1) | CN118019842A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2023274387A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025219520A1 (en) * | 2024-04-18 | 2025-10-23 | Match Medicines Gmbh | MODIFIED HUMAN T CELL WITH A REDUCED HLA-Ia REPERTOIRE AND METHOD OF PRODUCTION |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140349402A1 (en) * | 2011-11-18 | 2014-11-27 | Board Of Regents, The University Of Texas System | Car+ t cells genetically modified to eliminate expression of t-cell receptor and/or hla |
| CN107630006A (zh) * | 2017-09-30 | 2018-01-26 | 山东兴瑞生物科技有限公司 | 一种制备tcr与hla双基因敲除的t细胞的方法 |
| CN107723275A (zh) * | 2017-10-20 | 2018-02-23 | 重庆精准生物技术有限公司 | 通用型car‑t细胞及其制备方法和应用 |
| CN108728460A (zh) * | 2018-05-25 | 2018-11-02 | 上海恒润达生生物科技有限公司 | 靶向gd2的嵌合抗原受体及其用途 |
| CN108884164A (zh) * | 2016-02-25 | 2018-11-23 | 细胞医学瑞士公司 | 用于免疫疗法的经修饰细胞 |
| CN109456943A (zh) * | 2017-09-06 | 2019-03-12 | 亘喜生物科技(上海)有限公司 | 通用型嵌合抗原受体t细胞制备技术 |
| WO2019097305A2 (en) * | 2017-05-12 | 2019-05-23 | Crispr Therapeutics Ag | Materials and methods for engineering cells and uses thereof in immuno-oncology |
| CN113061580A (zh) * | 2020-01-02 | 2021-07-02 | 江苏茂行科技有限公司 | 一种经修饰的免疫效应细胞及其制备方法 |
-
2022
- 2022-06-30 WO PCT/CN2022/103102 patent/WO2023274387A1/zh not_active Ceased
- 2022-06-30 CN CN202280046726.1A patent/CN118019842A/zh active Pending
- 2022-06-30 JP JP2023580373A patent/JP2024527537A/ja active Pending
- 2022-06-30 US US18/575,451 patent/US20240139321A1/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140349402A1 (en) * | 2011-11-18 | 2014-11-27 | Board Of Regents, The University Of Texas System | Car+ t cells genetically modified to eliminate expression of t-cell receptor and/or hla |
| CN108884164A (zh) * | 2016-02-25 | 2018-11-23 | 细胞医学瑞士公司 | 用于免疫疗法的经修饰细胞 |
| WO2019097305A2 (en) * | 2017-05-12 | 2019-05-23 | Crispr Therapeutics Ag | Materials and methods for engineering cells and uses thereof in immuno-oncology |
| CN109456943A (zh) * | 2017-09-06 | 2019-03-12 | 亘喜生物科技(上海)有限公司 | 通用型嵌合抗原受体t细胞制备技术 |
| CN107630006A (zh) * | 2017-09-30 | 2018-01-26 | 山东兴瑞生物科技有限公司 | 一种制备tcr与hla双基因敲除的t细胞的方法 |
| CN107723275A (zh) * | 2017-10-20 | 2018-02-23 | 重庆精准生物技术有限公司 | 通用型car‑t细胞及其制备方法和应用 |
| CN108728460A (zh) * | 2018-05-25 | 2018-11-02 | 上海恒润达生生物科技有限公司 | 靶向gd2的嵌合抗原受体及其用途 |
| CN113061580A (zh) * | 2020-01-02 | 2021-07-02 | 江苏茂行科技有限公司 | 一种经修饰的免疫效应细胞及其制备方法 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025219520A1 (en) * | 2024-04-18 | 2025-10-23 | Match Medicines Gmbh | MODIFIED HUMAN T CELL WITH A REDUCED HLA-Ia REPERTOIRE AND METHOD OF PRODUCTION |
Also Published As
| Publication number | Publication date |
|---|---|
| US20240139321A1 (en) | 2024-05-02 |
| JP2024527537A (ja) | 2024-07-25 |
| CN118019842A (zh) | 2024-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN115916833B (zh) | 靶向b7h3的抗原结合多肽及其应用 | |
| TW202003845A (zh) | 增強功能之經修飾免疫細胞及其篩選方法 | |
| US20220193135A1 (en) | Modified immune effector cell and preparation method therefor | |
| KR20230051677A (ko) | 메소텔린 양성 암을 치료하기 위한 조성물 및 방법 | |
| WO2023274385A1 (zh) | 靶向her2的通用型car-t细胞及其制备方法 | |
| EP4620978A1 (en) | Universal car-t cell targeting b7h3, and preparation method therefor and use thereof | |
| JP7776414B2 (ja) | Cd371を標的にする抗原認識受容体およびその使用 | |
| WO2023274387A1 (zh) | 靶向gd2的通用型car-t细胞及其制备方法和应用 | |
| US20240376216A1 (en) | Universal car-t cell targeting il13ralpha2, preparation method therefor and application thereof | |
| WO2023274386A1 (zh) | 靶向egfr的通用型car-t细胞及其制备方法 | |
| CA3228546A1 (en) | Antigen recognizing receptors targeting cd33 and uses thereof | |
| HK40111889A (en) | UNIVERSAL CAR-T CELL TARGETING IL13Rα2, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF | |
| HK40085140A (en) | UNIVERSAL CAR-T CELL TARGETING IL13Rα2, PREPARATION METHOD THEREFOR AND APPLICATION THEREOF | |
| HK40087387A (zh) | 靶向b7h3的抗原结合多肽及其应用 | |
| HK40087387B (zh) | 靶向b7h3的抗原结合多肽及其应用 | |
| EA050876B1 (ru) | Антигенсвязывающий полипептид, нацеленный на b7h3, и его применение | |
| TWI915404B (zh) | 用於治療egfr陽性癌症之組合物及方法 | |
| EP4620974A1 (en) | Anti-afp/hla02 tcr-like antibody and use thereof | |
| HK40109832A (zh) | 靶向b7h3的通用型car-t细胞及其制备方法和应用 | |
| CN118271440A (zh) | 靶向IL13Rα2的抗体以及靶向IL13Rα2的免疫效应细胞 | |
| WO2024240248A1 (zh) | 用于靶向b7h3的同种异体嵌合抗原受体t细胞的给药的方法和组合物 | |
| TW202214846A (zh) | 用於治療egfr陽性癌症之組合物及方法 | |
| HK40083622A (en) | Modified immune effector cell and preparation method therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22832199 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2023580373 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280046726.1 Country of ref document: CN Ref document number: 18575451 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 22832199 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 22832199 Country of ref document: EP Kind code of ref document: A1 |
|
| 32PN | Ep: public notification in the ep bulletin as address of the adressee cannot be established |
Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 14/06/2024) |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 22832199 Country of ref document: EP Kind code of ref document: A1 |