WO2023214617A1 - 엑소좀 내의 인터페론 감마 유전자 측정을 이용한 암 조기 진단 방법 및 진단 키트 - Google Patents

엑소좀 내의 인터페론 감마 유전자 측정을 이용한 암 조기 진단 방법 및 진단 키트 Download PDF

Info

Publication number
WO2023214617A1
WO2023214617A1 PCT/KR2022/010944 KR2022010944W WO2023214617A1 WO 2023214617 A1 WO2023214617 A1 WO 2023214617A1 KR 2022010944 W KR2022010944 W KR 2022010944W WO 2023214617 A1 WO2023214617 A1 WO 2023214617A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
interferon gamma
present
rna
exosomes
Prior art date
Application number
PCT/KR2022/010944
Other languages
English (en)
French (fr)
Inventor
김연수
임성식
Original Assignee
(주)다이오진
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)다이오진 filed Critical (주)다이오진
Publication of WO2023214617A1 publication Critical patent/WO2023214617A1/ko

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863—Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • G01N33/6866—Interferon
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/70—Mechanisms involved in disease identification
    • G01N2800/7023—(Hyper)proliferation
    • G01N2800/7028—Cancer

Definitions

  • the present invention relates to a method and diagnostic kit for early cancer diagnosis using measurement of interferon gamma gene concentration in exosomes.
  • Cancer can be said to be an uncontrollable condition caused by abnormal growth of normal cells due to internal/external factors. This abnormal cell growth usually develops into a cell mass known as a tumor and infiltrates surrounding tissues. It then spreads to other parts of the body (metastasis). Looking at the metastasis rate of the seven major cancers among various cancers, colon cancer (34.7%), stomach cancer (30.1%), lung cancer (28.7%), breast cancer (24.1%), liver cancer (13.1%), cervical cancer (10.3%), and prostate cancer. Cancer (8.2%) is in that order, and the most common sites to which cancer metastasizes are lung (20.9%), bone (20.7%), and liver (19.7%), with these three organs accounting for 61.4% of metastatic sites.
  • cancer diagnosis methods to date mainly detect the presence of cancer through contrast images such as CT, MRI, and Since it is performed when the procedure is performed and is limited to specific tissues, there is a problem that it is easy to overlook the presence of cancer.
  • a method of determining the possibility of cancer using blood is also being performed, but this uses blood tumor markers for prostate cancer, colon cancer, ovarian cancer, ileal cancer, liver cancer, etc. Even if it is not cancer, if there is an etiology in the relevant organ, it is positive.
  • there are still limitations in calling it a diagnostic method for cancer Attempts to diagnose cancer using antibodies are also being made, but this is also limited to some cancers.
  • non-invasive methods using blood have the advantage of being very simple, causing little pain, and requiring no hospitalization or recovery period after the test.
  • a liquid biopsy has the advantage of avoiding the side effects of a biopsy, enabling early diagnosis even in potential patients who have not developed cancer, and being advantageous in periodically observing the treatment progress of patients who have already developed cancer.
  • Exosomes are small types of membrane vesicles secreted by most cells. It has been reported that these exosomes contain various types of proteins, genetic materials (DNA, mRNA, miRNA), and lipids derived from the cells. It has been done. In particular, since there is an excessive amount of RNA degrading enzyme (RNase) in serum, genetic material secreted from cells is easily decomposed and is not easy to measure. However, in the case of RNA present in exosomes, it is protected from RNA degrading enzyme and exists stably. It is known. In this way, it has been reported that tissue-derived exosomes can be used to diagnose diseases because they reflect the state of the tissue that secreted the exosomes.
  • RNase RNA degrading enzyme
  • interferon- ⁇ is known to be very important in early host defense, recognition of microorganisms by innate immune cells and development of cell mediated immunity against intracellular pathogens.
  • T cells sensitive to a specific antigen secrete INF- ⁇ when restimulated by the same antigen, so the level of INF- ⁇ secretion is affected by bacterial or viral infections such as Mycobacterium tuberculosis and Leishmania braziliensis. It is applied to the diagnosis of.
  • the present invention was completed by deriving a method for screening and early diagnosis of high-risk groups of cancer by extracting RNA from blood and plasma and indirectly measuring the expression level of interferon gamma in exosomes present in the blood. did.
  • an object of the present invention is to provide a composition for diagnosing cancer.
  • Another object of the present invention is to provide a kit for diagnosing cancer.
  • Another object of the present invention is to provide a method of providing information for cancer diagnosis.
  • the present invention provides a composition for cancer diagnosis including an agent for measuring the concentration of interferon gamma RNA.
  • the agent for measuring interferon gamma RNA may be a composition characterized in that it is a primer set or probe that specifically binds to interferon gamma RNA.
  • the primer set may be a dumbbell structure oligonucleotide primer, and the primer set may be composed of SEQ ID NOs: 1 and 2.
  • interferon gamma RNA may be derived from exosomes in the blood.
  • kits for diagnosing cancer including an agent for measuring the concentration of interferon gamma RNA in blood.
  • the kit may be characterized as a real-time gene amplification kit.
  • Another aspect of the present invention provides a method of providing information for cancer diagnosis including the following steps.
  • the interferon gamma RNA of step (a) may be present in exosomes.
  • cancer can be diagnosed early with high accuracy in a non-invasive manner using a liquid biopsy such as blood.
  • the present invention is expected to complement the problems of existing tests by enabling quick and accurate screening of high-risk cancer groups using a non-invasive method.
  • Figure 1 shows the results of measuring the concentration according to the expression of the interferon gamma gene between the normal group and the patient group using DLPTM-based real-time polymerase chain reaction.
  • Figure 2 is a diagram comparing the Ct values of a normal group and a cancer patient.
  • Figure 3 shows the prediction of the occurrence of various cancers and management guidelines accordingly by measuring interferon gamma gene concentration in blood and plasma using DLPTM-based real-time polymerase chain reaction.
  • Figure 4 shows the principle of the dumbbell structure oligonucleotide of the present invention in a target-dependent extension reaction. (a) shows an environment in which amplification cannot occur due to the high hybridization specificity of the dumbbell structure oligonucleotide under high stringency conditions, and (b) shows that a successful extension reaction of the dumbbell structure oligonucleotide occurs.
  • the present invention provides a composition for diagnosing cancer, including an agent for measuring the concentration of interferon gamma gene.
  • the interferon gamma gene can be isolated from a biological sample.
  • a biological sample is a sample that can be obtained non-invasively, and may be, for example, blood, cells, saliva, sputum, hair, urine, feces, milk, etc.
  • the interferon gamma gene can be isolated from blood, urine, feces, or milk, but is not limited thereto.
  • the interferon gamma gene can be isolated from blood.
  • liquid biopsy such as blood, it is possible to diagnose diseases without causing pain to the examiner, unlike invasive methods such as biopsy.
  • the use of liquid biopsy has a great advantage over biopsy in conducting early diagnosis in potential patients who have not developed cancer or in periodically observing the treatment progress of patients who have already developed cancer.
  • the concentration of the interferon gamma gene of the present invention may be measured by measuring the concentration of RNA expressed by the interferon gamma gene.
  • the RNA of exosomes in the blood may be measured.
  • RNase RNA degrading enzyme
  • genetic material secreted from cells is easily decomposed and is not easy to measure.
  • RNA present in exosomes it is protected from RNA degrading enzyme and exists stably. It is known that RNA in exosomes can be measured by removing gDNA from the blood and then measuring RNA.
  • the agent for measuring the expression level of the interferon gamma gene may be a primer or probe that specifically binds to the biomarker according to the present invention, but is not limited thereto.
  • the primer or probe has a sequence complementary to the biomarker sequence of the present invention.
  • the term “complementary” means having a level of complementarity capable of selectively hybridizing to the above-described nucleotide sequence under certain hybridization or annealing conditions. Accordingly, the term “complementary” has a different meaning from the term “perfectly complementary,” and if the primer or probe of the present invention is capable of selectively hybridizing to the above-described nucleotide sequence, one or more May have mismatched base sequences.
  • probe refers to a linear oligomer of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, capable of specifically hybridizing to a target nucleotide sequence, and having a natural or modified form. It may exist or be artificially synthesized.
  • the end of the probe may be labeled with a reporter such as a fluorescent substance.
  • primer refers to a primer that acts as the starting point for the synthesis of a template sequence under suitable conditions (i.e., four different nucleoside triphosphates and polymerization enzymes) in a suitable buffer at a suitable temperature. refers to a single-stranded oligonucleotide that can be A suitable length of primer is typically 15-30 nucleotides, although it varies depending on various factors such as temperature and the intended use of the primer. Short primer molecules generally require lower temperatures to form sufficiently stable hybrid complexes with the template.
  • Primer design can be easily performed by a person skilled in the art with reference to the above-described nucleotide sequence, for example, by using a primer design program (eg, PRIMER 3 program).
  • a dumbbell structure primer set can be used, and the structure and description of the dumbbell structure primer are explained in detail in FIG. 4.
  • primer sets of SEQ ID NOs: 1 and 2 that can target interferon gamma RNA can be used.
  • the term "primer” is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a template of a complementary nucleic acid and copies the strand of the nucleic acid template. refers to a short nucleic acid sequence that serves as a starting point for Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature.
  • the primers there are various restrictions, such as the A, G, C, and T content ratio of the primers, prevention of primer complex (dimer) formation, and prohibition of repeating the same base sequence more than three times.
  • the template (template) Conditions such as the amount of DNA, concentration of primers, concentration of dNTP, concentration of Mg2+, reaction temperature, and reaction time must be appropriate.
  • the above primers may incorporate additional features without changing the basic properties. That is, the nucleic acid sequence can be modified using many means known in the art. Examples of such modifications include methylation, capping, substitution of a nucleotide with one or more homologs, and uncharged linkages such as phosphonates, phosphotriesters, phosphoroamidates, or carbamates, or phosphorothioates or phosphorodithioates.
  • nucleic acids may contain one or more nucleases, toxins, antibodies, signal peptides, proteins such as poly L lysine, intercalating agents such as acridine or psoralen, chelating agents such as metals, radioactive metals, iron oxidizing metals, and alkylating agents. It may have additional covalently linked residues.
  • Primer sequences of the present invention may also be modified using labels that can directly or indirectly provide a detectable signal.
  • the primer may contain a label that can be detected using spectroscopy, photochemistry, biochemistry, immunochemistry or chemical means.
  • Useful labels include 32P, fluorescent dyes, electron dense reagents, enzymes (commonly used in ELISA), biotin or haptens, and proteins for which antisera or monoclonal antibodies are available.
  • the primers of the present invention are prepared by cloning of appropriate sequences, restriction enzyme digestion, phosphotriester method by Narang et al. (1979, Meth, Enzymol. 68:90-99), and diethylphosphoramidase method by Beaucage et al. Tetrahedron Lett. 22: 1859-1862 (1981, Tetrahedron Lett. 22: 1859-1862), and any other well-known method, including direct chemical synthesis methods such as the solid support method of U.S. Pat. No. 4,458,066.
  • Amplification reaction refers to a reaction that amplifies a nucleic acid molecule, such as polymerase chain reaction (PCR), multiplex real time-polymerase chain reaction (multiplex RTPCR), reverse transcription- Reverse transcription polymerase chain reaction (RT-PCR), ligase chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), Transcription-mediated amplification (TMA) (WO88/10315), self sustained sequence replication (WO90/06995), selective amplification of target polynucleotide sequences , consensus sequence primed polymerase chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-PCR), nucleic acid sequence based amplification ; NASBA), strand displacement amplification, and loop-mediated isothermal amplification (LAMP) may be amplification methods, but are not limited thereto.
  • PCR polymerase chain reaction
  • multiplex RTPCR multiplex real time-polymerase chain
  • PCR is a PCR reaction. It can be performed using a PCR reaction mixture containing various components known in the art.
  • the PCR reaction mixture may include an appropriate amount of DNA polymerase, dNTPs, PCR buffer, and water (dH2O) in addition to the genomic DNA isolated from the biological sample isolated from the patient to be analyzed and the primer pair provided in the present invention. there is.
  • the PCR buffer is not limited thereto, but may include one or more of Tris-HCl, MgCl2, and KCl.
  • MgCl2 concentration greatly affects the specificity and quantity of amplification, and can preferably be used in the range of 1.5 to 2.5 mM.
  • the PCR buffer may additionally contain an appropriate amount of Triton X-100.
  • the PCR reaction may be performed according to a known method. Although not limited thereto, pre-denaturation of the template DNA at 94 to 95° C.
  • denaturation may be performed at 90 to 99°C, 92 to 97°C, or 94 to 95°C
  • amplification may be performed at 70 to 75°C, 71 to 74°C, or 72°C.
  • the temperature at the time of binding may vary depending on the type of primer, for example, 50 to 59°C, 52 to 57°C, or 55°C. The time and number of cycles of each step can be determined according to conditions generally used in the art.
  • the optimal reaction conditions when performing PCR using the SSR primer pair according to an embodiment of the present invention are as follows: pre-denature the template DNA at 95°C for 5 minutes, then at 95°C for 30 seconds; 30 seconds at 55°C; And after repeating 30 cycles of 1 minute at 72°C, the reaction was finally performed at 72°C for 30 minutes.
  • the DNA of the PCR product can be separated by size according to a method well known in the art.
  • the amplified target sequence can be labeled with a detectable label.
  • the labeling material may be a material that emits fluorescence, phosphorescence, or radioactivity, but is not limited thereto.
  • the labeling agent is 6-FAM, NEN, VIC or PET.
  • the target sequence can be labeled with a detectable fluorescent labeling substance.
  • the labeling material may include Cy5 or Cy-3.
  • labeling using a radioactive material may cause radioactivity to be incorporated into the amplification product as the amplification product is synthesized during PCR or when a radioactive isotope such as S is added to the PCR reaction solution, causing the amplification product to be radioactively labeled.
  • the primer sets used to amplify the target sequence were as described above.
  • the term “diagnosis” refers to determining the susceptibility of an object to a specific disease or disorder, determining whether an object currently has a specific disease or condition, and determining whether an object currently has a specific disease or disorder. Determining the prognosis (e.g., identifying a pre-metastatic or metastatic cancer state, determining the stage of the cancer, or determining the responsiveness of the cancer to treatment) of a subject suffering from Monitoring the condition of the object to provide information about efficacy).
  • the prognosis e.g., identifying a pre-metastatic or metastatic cancer state, determining the stage of the cancer, or determining the responsiveness of the cancer to treatment
  • the composition of the present invention can be used for early diagnosis of cancer.
  • the present invention can be used to screen groups at risk of developing cancer (eg, high-risk groups).
  • the present invention provides a kit for diagnosing cancer, including the composition for diagnosing cancer of the present invention described above.
  • the kit of the present invention may include not only an agent for measuring the expression level of the interferon gamma gene according to the present invention, but also tools or reagents commonly used in the art to be suitable for use as a cancer diagnostic kit.
  • the tool or reagent may include a suitable carrier, a label capable of generating a detectable signal, chromophores, solubilizers, detergents, buffers, stabilizers, etc.
  • the kit of the present invention may further include an agent capable of measuring the expression level of a housekeeping gene that can be used as an internal control.
  • the kit of the present invention may be a gene amplification kit, but is not limited thereto.
  • amplification refers to a reaction that amplifies a nucleic acid molecule.
  • a variety of amplification reactions have been reported in the art, for example, polymerase chain reaction (PCR) is disclosed in US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159.
  • the present invention includes the steps of (a) measuring the expression level of the interferon gamma gene in an isolated sample; and (b) determining that the measured expression level of the interferon gamma gene is cancerous or at risk of developing cancer when the expression level of the interferon gamma gene is reduced compared to the control group.
  • the expression level of the interferon gamma gene can be measured according to methods commonly used in the biokit field, such as reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (Competitive RT-PCR), and real-time reverse transcription. It can be measured using real-time RT-PCR, RNase protection assay (RPA), Northern blotting, or gene chip.
  • RT-PCR reverse transcriptase polymerase reaction
  • Competitive RT-PCR competitive reverse transcriptase polymerase reaction
  • RPA RNase protection assay
  • Northern blotting or gene chip.
  • the expression level of the interferon gamma gene of the present invention can be measured by measuring the concentration of interferon RNA in the sample.
  • gDNA can be removed to measure RNA expressing interferon gamma contained in exosomes in the sample, and the expression level of interferon gamma gene in exosomes, that is, RNA Concentration can be measured.
  • the term “method for providing information” refers to a method of providing information regarding the diagnosis of cancer, where the level of the interferon gamma gene according to the present invention is measured using the interferon gamma gene in the blood. It refers to a method of obtaining information about the occurrence or possibility (risk) of cancer when it is reduced.
  • the amount of interferon gamma RNA is 1/3 to 1/2.5 compared to the normal control group, cancer can be determined, and if the amount is 1/2 to 1/1, the possibility of developing cancer is high. You can judge.
  • the interferon gene marker in the blood was secured, and standard materials for it were obtained as described in Table 1 (Table 1).
  • dumbbell structure oligonucleotide primers were designed using a computer program for each marker gene sequence obtained, and each of these PCR conditions were established for positive standard materials. .
  • a screening test for these markers was performed on clinical samples using the dumbbell structure oligonucleotide primers constructed in this way.
  • Nucleic acids were extracted using the prepared plasma of cancer patients and normal control plasma according to the manufacturer's manual.
  • the nucleic acid extraction equipment used was Smart Lab Assist-32, and the equipment was warmed up 10 minutes before use. After peeling off the vinyl from the enclosed auto plate, the aluminum foil attached to the top of the auto plate was removed, and then 300 ⁇ l of sample was dispensed into each well of the column using a micro pipette. Proteinase K stored at 4°C was taken out and 20 ⁇ l of sample was dispensed into each well using a micro pipette.
  • An 8-channel strip was mounted on the strip rack frame of the nucleic acid extraction device, and the auto plate containing the sample and Proteinase K was placed on the 96-well plate rack (deep well plate rack) of the nucleic acid extraction device. It was installed by pushing it all the way to the back, then the door was closed and the program was run according to the sample. After completing the program of the nucleic acid extraction device, the auto plate was taken out, and the nucleic acids extracted from each well were transferred to a clean microtube. The concentration of the extracted total RNA was measured, and the measured concentration was analyzed to calculate the concentration value of all samples. It was corrected.
  • gDNA removal and RT processes were performed on the extracted total RNA using PrimeScriptTM RT reagent Kit with gDNA Eraser (product code RR047A, Takara). Specifically, 2.0 ⁇ l of 5X gDNA Eraser Buffer, 1.0 ⁇ l of gDNA Eraser, and 7.0 ⁇ l of Total RNA were mixed to make a final volume of 10 ⁇ l. Then, the mixed reagent was reacted at 42°C for 2 minutes and stored at 4°C. . For analysis, the reagents were mixed in the ratio below, the reagents were reacted sequentially at 37°C for 15 minutes, then at 85°C for 5 seconds, and then stored at 4°C.
  • gDNA was removed from the extracted total RNA and then quantified once more using an internal control primer using the cDNA of the synthesized sample.
  • the reaction conditions were as follows. 4 ⁇ l of synthesized cDNA, 5 ⁇ l of qRT-PCR mastermix, and 1 ⁇ l of internal control primer were mixed to make a final 10 ⁇ l mixture, and then the reaction was performed according to the real-time polymerase chain reaction conditions in Table 4.
  • PCR was performed according to the conditions in Table 5.
  • the GAPDH (house keeping gene) gene was used as a comparison group.
  • RT-qPCR results were analyzed using the formula below.
  • ⁇ Ct (Ct of gene of IFNG cancer patient serum - Ct of GAPDH cancer patient serum)-(Ct of IFNG normal serum - Ct of GAPDH normal serum)
  • the level of interferon gamma gene expression which is expected to be significant in screening normal and patient groups, was measured. At this time, genomic DNA was completely removed from the RNA extracted from the plasma of the normal and patient groups and then quantified as an internal control (house-keeping gene). The results were confirmed in Figure 2. As a result of checking the average Ct value for the normal group and 6 types of cancer using the interferon gamma gene, as shown below, the average Ct value for the interferon gamma gene was 27.30 to 30.78 in the normal group, which was 29.38, whereas in liver cancer, the average Ct value was 29.38.
  • the Ct value ranges from 30.09 to 39.77, with an average of 32.73, in colon cancer, the Ct value ranges from 31.53 to 39.83, with an average of 32.37, in lung cancer, the Ct value ranges from 29.7 to 34.58, with an average of 32.12, in breast cancer, the Ct value ranges from 32.14 to 37.22, with an average of 34.79, and in pancreatic cancer, the Ct value is 34.79.
  • the values ranged from 32.14 to 37.22, with an average of 34.78, and in gastric cancer, the Ct values ranged from 25.91 to 34.43, with an average of 32.01, showing significant results between the normal group and the six types of cancer in the comparison group.
  • the expression of the IFN ⁇ gene was confirmed to be reduced by more than 16.5 times in liver cancer, 23.5 times in pancreatic cancer, 9.5 times in colon cancer, 10.0 times in lung cancer, 6 times in stomach cancer, and 3.2 times in breast cancer. There was a statistically significant level.
  • the above results suggest that the IFNG gene in exosomes isolated from the blood of various cancer patients is contained at a lower concentration than that of normal people.
  • the sensitivity and specificity for stomach cancer and liver cancer were all 91.7%, and the sensitivity and specificity for colon cancer, breast cancer, and pancreatic cancer were all 100.0%.
  • the sensitivity and specificity in lung cancer tended to be somewhat low at 83.4% and 91.7%, respectively, but it was judged that there was no reason for disqualification in early diagnosis of cancer or in identifying high-risk groups.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 엑소좀 내의 인터페론 감마 유전자 농도 측정을 이용한 암 조기 진단 방법 및 진단 키트에 관한 것이다. 본 발명에 따른 엑소좀 내 인터페론 감마 유전자를 이용하면, 혈액과 같은 액체 생검을 이용하여 비침습적 방법으로 암을 높은 정확성으로 조기에 진단할 수 있다. 또한, 본 발명을 이용하면 비침습적 방법으로 암 고위험군을 빠르고 정확하게 선별 검사할 수 있어 기존 검사의 문제점을 보완할 것으로 기대된다.

Description

엑소좀 내의 인터페론 감마 유전자 측정을 이용한 암 조기 진단 방법 및 진단 키트
본 발명은 엑소좀 내의 인터페론 감마 유전자 농도 측정을 이용한 암 조기 진단 방법 및 진단 키트에 관한 것이다.
최근 WHO(세계보건기구) 국제 암연구소는 암으로 인한 사망자 수가 2030년에는 현재의 2배에 가까운 1,330만 명에 달할 것이라는 연구 결과를 내놓기도 했다. 국제 암연구소에 따르면 2030년까지 신규 암 환자는 2,130만 명으로 급증하고 이 가운데 1,330만 명이 사망할 것으로 추산됐다. 이는 2008년 1,270만 명에 달하는 암 환자가 새로 생겨나 이 중 760만 명이 사망한 것과 비교하면 2배에 가까운 규모다. 특히 2008년 신규 암 환자의 56%, 사망자의 63%가 개발도상국에서 발생한 것으로 나타났다. 우리나라의 경우 국민 10명 중 3명은 암으로 사망하고 있다. 최근 통계청 조사에 의하면 2006년 총 사망자 24만 6,000명 가운데 6만5,000명이 암으로 사망했다. 이 같은 수치는 전체 사망자의 26.7%에 해당한다. 특히 암 사망률은 매년 증가 추세를 보이고 있다. 지난 1995년 인구 10만 명당 암 사망자가 110.8명이었던 것이 지난 2000년 122.1명, 2005년 134.5명으로 급증하고 있는 추세로 현재 암은 우리나라 성인 사망 원인의 2위를 차지하고 있다. 경제적인 손실을 고려하면 약 1조 3천억원 정도의 비용이 암 환자의 치료비로 쓰여지고 있는 것으로 추정되고 있으므로 이 시점에서 국가적인 대책이 시급히 요구되는 질병이다(1999.5.2.,조선일보). 이처럼, 암은 조기 진단시 완치 또는 치료효과가 높기 때문에, 당업계에서 암의 조기진단 방법에 대한 연구가 활발히 진행되고 있고 1995~2007년 동안 7대 암 환자를 분석하여 '암 전이지도'를 완성하였다. 이러한 암 전이지도는 암에 대한 공포를 감소시키고, 치료 예측에 도움이 될 것으로 판단되고 있다.
암이란 정상세포가 내적/외적 요인에 의해 성장에 이상을 초래하여 통제할 수 없는 증상이라 할 수 있는데 이러한 비정상적인 세포 성장은 보통 종양(tumor)으로 알려진 세포 덩어리로 발전하고 주위의 조직으로 침투하고, 이어서 신체 다른 부위로 전이 (metastasis)된다. 각종 암 가운데 7대 암 전이율을 살펴보면, 대장암(34.7%), 위암(30.1%), 폐암(28.7%), 유방암(24.1%), 간암(13.1%), 자궁경부암(10.3%), 전립샘암 (8.2%) 순이며 암이 전이되는 부위로는 폐(20.9%), 뼈(20.7%), 간(19.7%)이 가장 많으며, 이 3기관이 전이된 부위의 61.4%를 차지하고 있다.
한편, 현재까지의 암 진단 방법은 CT, MRI, X선 등의 조영 이미지를 통해 암의 존재를 찾아내는 주를 이루고 있으나, 이러한 검사는 주로 환자가 통증이나 불편함으로 인하여 검사에 대한 적극적 의지를 갖고 있을 때 수행되며, 특정 조직에 국한하여 수행되기 때문에 암의 존재를 지나치기 쉬운 문제점이 존재한다. 혈액으로 암의 발생 가능성을 판별하는 방법이 또한 수행되고 있지만, 이는 전립선암, 대장암, 난소암, 훼장암, 간암 등에 대한 혈액 종양표지자를 이용하는 것으로 암이 아니더라도 해당 장기에 병인이 있을 경우에는 양성으로 나타나기 때문에 사실상 암의 진단 방법이라고 하기에는 아직 한계가 있다. 항체를 이용하여 암을 진단하고자 하는 시도 또한 이루어지고 있으나 이 또한 일부 암에 국한되어 있다. 반면, 혈액을 이용한 비침습적인 방법(채혈)은 매우 간단하고 고통이 거의 없으며, 입원과 검사 후 회복기간이 필요 없다는 이점을 가지고 있다. 또한, 이와 같은 액체 생검은 조직검사의 부작용을 피하는 동시에 암이 발병하지 않은 잠재적 환자를 대상으로도 조기진단이 가능하며, 이미 발병한 환자의 치료 경과를 주기적으로 관찰하는데 유리하다는 장점이 있다.
엑소좀은 대부분의 세포에서 분비되는 작은 형태의 소포체(membrane vesicle)로 이 엑소좀 안에는 그 세포에서 유래된 다양한 종류의 단백질, 유전물질(DNA, mRNA, miRNA), 지질 등이 포함되어 있는 것이 보고된 바 있다. 특히 혈청 내에는 과량의 RNA 분해 효소(RNase)가 존재하므로 세포로부터 분비되는 유전물질들이 쉽게 분해되어 측정하기 쉽지 않은 반면, 엑소좀 안에 존재하는 RNA의 경우에는 RNA 분해효소로부터 보호되어 안정적으로 존재하는 것이 알려져 있다. 이와 같이, 조직 유래 엑소좀은 엑소좀을 분비한 조직의 상태를 반영하기 때문에, 질병의 진단에 이용될 수 있음이 보고된 바 있다.
한편, 인터페론 감마(interferon-γ; INF-γ)는 초기 숙주 방어에서 선천성 면역 세포에 의한 미생물 인식 및 세포내 병원균에 대한 세포 매개성 면역(cell mediated immunity) 발달에 매우 중요한 것으로 알려져 있다. 특히, 특정항원에 민감한 T세포는 동일한 항원에 의해 재자극되었을 때 INF-γ를 분비하므로, INF-γ 분비정도는 결핵균(Mycobacterium tuberculosis) 및 브라질 레슈마니아균(Leishmania braziliensis) 등과 같은 박테리아 또는 바이러스 감염의 진단에 적용되고 있다. 현재 sandwich ELISA 방법으로 인터페론-감마의 양을 측정하는 방법있고, 효소-결합 면역흡착 검사(enzyme-linked immunosorbent assay: ELISA)를 이용하여 환자의 혈액 중 IFNγ의 농도(IU/㎖)를 측정하는 방법이 있다. 그러나, 현재까지 전혈에서 즉시 RNA를 분리하고 실시간 유전자 증폭 기술(qRT-PCR)을 이용하여 인터페론 감마 유전자의 발현 정도를 측정하여 혈액 중 인터페론 감마의 농도를 측정하고, 이를 이용하여 암을 진단하는 기술은 현재까지 전무한 실정이다.
이에 본 발명은 혈액 및 혈장에서 RNA를 추출하여, 간접적으로 혈액에 존재하는 엑소좀 내의 인터페론 감마의 발현양을 간접적으로 측정하여, 암의 고위험군 선별 및 조기진단하는 하는 방법을 도출하여 본 발명을 완성하였다.
따라서, 본 발명의 목적은 암 진단용 조성물을 제공하는 것이다.
본 발명의 다른 목적은 암 진단용 키트를 제공하는 것이다.
본 발명의 또 다른 목적은 암 진단을 위한 정보제공방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명은 인터페론 감마 RNA의 농도를 측정하는 제제를 포함하는 암 진단용 조성물을 제공한다.
본 발명에 따른 일실시예로서, 인터페론 감마 RNA를 측정하는 제제는 인터페론 감마 RNA에 특이적으로 결합하는 프라이머 세트 또는 프로브인 것을 특징으로 하는, 조성물일 수 있다. 상기 프라이머 세트는 덤벨구조 올리고뉴클레오티드 프라이머일 수 있고, 상기 프라이머 세트는 서열번호 1 및 2로 이루어진 것일 수 있다.
또한, 본 발명에 따른 일실시예로서, 인터페론 감마 RNA는 혈액 내의 엑소좀으로부터 유래된 것일 수 있다.
본 발명의 다른 측면에서, 혈액 내 인터페론 감마 RNA의 농도를 측정하는 제제를 포함하는 암 진단용 키트를 제공한다. 상기 키트는 실시간 유전자 증폭 키트인 것을 특징으로 할 수 있다.
본 발명의 또 다른 측면에서 다음의 단계를 포함하는 암 진단을 위한 정보제공방법을 제공한다.
(a) 분리된 시료에서 gDNA를 제거 후, 인터페론 감마 RNA의 농도를 측정하는 단계; 및
(b) 측정된 인터페론 감마 RNA의 농도 수준이 대조군에 감소된 경우 암으로 판정 또는 암에 걸릴 위험이 있는 것으로 판정하는 단계;
본 발명의 일 실시예는 상기 단계 (a)의 인터페론 감마 RNA는 엑소좀 내에 존재하는 것일 수 있다.
본 발명에 따른 엑소좀 내 인터페론 감마 유전자를 이용하면, 혈액과 같은 액체 생검을 이용하여 비침습적 방법으로 암을 높은 정확성으로 조기에 진단할 수 있다. 또한, 본 발명을 이용하면 비침습적 방법으로 암 고위험군을 빠르고 정확하게 선별 검사할 수 있어 기존 검사의 문제점을 보완할 것으로 기대된다.
도 1은 DLP™ 기반의 실시간 중합효소연쇄반응을 이용한 정상군과 환자군간의 인터페론 감마 유전자의 발현에 따른 농도를 측정한 결과를 나타낸 것이다.
도 2는 정상군과 암환자의 Ct 값을 비교한 도이다.
도 3은 DLP™ 기반의 실시간 중합효소연쇄반응을 이용한 혈액 및 혈장 내 인터페론 감마 유전자 농도 측정을 통한 각종 암 발병 예측 및 이에 따른 관리 지침을 나타낸 것이다.
도 4는 표적 의존적 연장 반응에서 본 발명의 덤벨구조 올리고뉴클레오타이드의 원리를 보여주고 있다. (a)는 높은 엄격조건 하에서 덤벨구조 올리고뉴클레오타이드의 고혼성화 특이성에 기인하여 증폭이 일어날 수 없는 환경임을 보여주고 있으며, (b)는 덤벨구조 올리고뉴클레오타이드의 성공적인 연장반응이 일어남을 보여주고 있다.
본 발명은 인터페론 감마 유전자의 농도를 측정하는 제제를 포함하는 암의 진단용 조성물을 제공한다.
이하, 본 발명을 상세히 설명한다.
상기 인터페론 감마 유전자는 생물학적 시료(biological sample)로부터 분리될 수 있다. 본 명세서에 있어서, “생물학적 시료”란, 비침습적으로 획득될 수 있는 시료로서, 예를 들어, 혈액, 세포, 타액, 객담, 머리카락, 소변, 대변, 유즙 등일 수 있다. 상기 인터페론 감마 유전자는 혈액, 소변, 대변 또는 유즙으로부터 분리될 수 있으나, 이에 제한되는 것은 아니다. 하나의 바람직한 예로, 상기 인터페론 감마 유전자는 혈액으로부터 분리될 수 있다. 혈액과 같은 액체 생검(liquid biopsy)을 이용하면, 조직검사와 같은 침습적인 방법과 달리 검사자에게 고통을 주지 않으면서 질병의 진단이 가능하다. 또한, 액체 생검을 이용하는 경우 암이 발병하지 않은 잠재적 환자를 대상으로 조기 진단을 실시하거나, 이미 발병한 환자의 치료 경과를 주기적으로 관찰하는데 있어 조직검사에 비하여 큰 이점을 가진다.
본 발명의 인터페론 감마 유전자의 농도는 인터페론 감마 유전자가 발현하는 RNA의 농도를 측정하는 것일 수 있다. 바람직하게는 혈액 내의 엑소좀의 RNA를 측정하는 것일 수 있다. 일반적으로 혈청 내에는 과량의 RNA 분해 효소(RNase)가 존재하므로 세포로부터 분비되는 유전물질들이 쉽게 분해되어 측정하기 쉽지 않은 반면, 엑소좀 안에 존재하는 RNA의 경우에는 RNA 분해효소로부터 보호되어 안정적으로 존재하는 것이 알려져 있어, 혈액 내에서 gDNA를 제거한 후, RNA를 측정함으로써, 엑소좀 내의 RNA를 측정할 수 있다.
본 발명에 있어서, 상기 인터페론 감마 유전자의 발현 수준을 측정하는 제제는 본 발명에 따른 바이오마커에 특이적으로 결합하는 프라이머 또는 프로브일 수 있으나, 이에 제한되는 것은 아니다.
상기 프라이머 또는 프로브는 본 발명의 바이오마커 서열에 대하여 상보적(complementary)인 서열을 갖는다. 본 명세서에서 사용된 용어, “상보적”은 어떤 특정한 혼성화(hybridization) 또는 어닐링 조건 하에서 상술한 뉴클레오티드 서열에 선택적으로 혼성화할 수 있을 정도의 상보성을 갖는 것을 의미한다. 따라서, 용어 “상보적”은 용어 “완전 상보적(perfectly complementary)”과는 다른 의미를 가지며, 본 발명의 프라이머 또는 프로브는 상술한 뉴클레오티드 서열에 선택적으로 혼성화할 수 있을 정도이면, 하나 또는 그 이상의 미스매치(mismatch) 염기서열을 가질 수 있다.
본 명세서에서 사용된 용어, “프로브”는 자연의 또는 변형된 모노머 또는 연쇄(linkages)의 선형 올리고머를 의미하며, 디옥시리보뉴클레오티드 및 리보뉴클레오티드를 포함하고 타깃 뉴클레오티드 서열에 특이적으로 혼성화할 수 있으며, 자연적으로 존재하거나 또는 인위적으로 합성된 것일 수 있다.
상기 프로브의 말단에는 형광 물질 등의 리포터를 표지(labeling)할 수 있다.
본 명세서에서 사용된 용어, “프라이머”는 적합한 온도에서 적합한 완충액 내에서 적합한 조건(즉, 4종의 다른 뉴클레오사이드 트리포스페이트 및 중합반응 효소) 하에서 주형(template) 서열의 합성의 개시점으로 작용할 수 있는 단일-가닥 올리고뉴클레오티드를 의미한다. 프라이머의 적합한 길이는 다양한 요소, 예컨대, 온도와 프라이머의 용도에 따라 변화가 있지만 전형적으로 15-30 뉴클레오티드이다. 짧은 프라이머 분자는 주형과 충분히 안정된 혼성 복합체를 형성하기 위하여 일반적으로 보다 낮은 온도를 요구한다. 프라이머의 디자인은 상술한 뉴클레오티드 서열을 참조하여 당업자에 의해 용이하게 실시될 수 있으며, 예컨대, 프라이머 디자인용 프로그램(예: PRIMER 3 프로그램)을 이용하여 실시할 수 있다. 다만, 본 발명에서는 덤벨 구조 프라이머 세트를 이용할 수 있으며, 덤벨 구조 프라이머의 구조 및 설명에 대해서는 도 4에서 상세하게 설명되었다. 본 발명에서는 인터페론 감마 RNA를 타겟할 수 있는 서열번호 1 및 2의 프라이머 세트를 이용할 수 있다.
본 발명에서 용어 "프라이머"는 짧은 자유 3 말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 핵산의 주형(template)과 염기쌍(base pair)을 형성할 수 있고 핵산 주형의 가닥 복사를 위한 시작 지점으로 기능하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재 하에서 DNA 합성을 개시할 수 있다. 상기 프라이머 설계 시, 프라이머의 A, G, C, T 함량비, 프라이머 결합체(dimer) 형성 방지, 같은 염기 서열의 3회 이상 반복금지 등 여러 가지 제약이 따르며, 그 외에 단독 PCR 반응조건에 있어서 주형(template) DNA의 양, 프라이머의 농도, dNTP의 농도, Mg2+의 농도, 반응온도, 반응시간 등의 조건이 적정해야 한다. 상기의 프라이머는 기본 성질을 변화시키지 않은 추가의 특징을 혼입할 수 있다. 즉 핵산 서열이 당해 분야에 공지된 많은 수단을 이용하여 변형될 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 뉴클레오타이드의 하나 이상의 동족체로의 치환 및 포스포네이트, 포스포트리에스테르, 포스포로아미데이트 또는 카바메이트 등의 하전되지 않은 연결체나 포스포로티오에이트 또는 포스포로디티오에이트 등의 하전된 연결체로의 뉴클레오타이드의 변형이 가능하다. 또한 핵산은 뉴클레아제, 독소, 항체, 시그날 펩타이드, 폴리 L 리신 등의 단백질, 아크리딘 또는 프소랄렌 등의 삽입제, 금속, 방사성 금속, 철 산화성 금속 등의 킬레이트화제 및 알킬화제 등의 하나 이상의 부가적인 공유 결합된 잔기를 가질 수 있다.또한 본 발명의 프라이머 서열은 검출 가능한 시그날을 직접적 또는 간접적으로 제공할 수 있는 표지를 이용하여 변형시킬 수 있다. 상기 프라이머는 분광학, 광화학, 생화학, 면역화학 또는 화학적 수단을 이용하여 검출될 수 있는 표지를 포함할 수 있다. 유용한 표지는 32P, 형광 염료, 전자 밀집 시약, 효소(일반적으로 ELISA 에이용되는 것), 바이오틴 또는 합텐 및 항혈청 또는 단일클론성 항체가 이용가능한 단백질을 포함한다. 본 발명의 프라이머는 적절한 서열의 클로닝 및 제한효소 분해 및 나랭(Narang)등의 포스포트리에스테르 방법(1979, Meth, Enzymol. 68:90-99), 보카지(Beaucage)등의 디에틸포스포라미다이트 방법(1981, Tetrahedron Lett. 22: 1859-1862), 및 미국 특허 제 4458066호의 고형물 지지 방법과 같은 직접적인 화학적 합성법을 포함하는 임의의 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다.
“증폭 반응”은 핵산 분자를 증폭하는 반응을 의미하며, 중합효소 연쇄반응(polymerase chain reaction, PCR)으로, 다중 실시간-중합효소 연쇄 반응(multiplex real time-polymerase chain reaction, multiplex RTPCR), 역전사-중합효소 연쇄 반응(reverse transcription polymerase chain reaction, RT-PCR), 리가아제 연쇄반응(ligase chain reaction; LCR), Gap-LCR(WO 90/01069), 복구 연쇄 반응(repair chain reaction; EP 439,182), 전사-중재 증폭 (transcription-mediatedamplification; TMA) (WO88/10315), 자가유지염기서열복제(self sustained sequence replication) (WO90/06995), 타깃 폴리뉴클레오티드 염기서열의 선택적 증폭(selective amplification of target polynucleotide sequences), 컨센서스 서열 프라이밍 중합효소 연쇄 반응(consensus sequence primed polymerase chain reaction; CP-PCR), 임의적 프라이밍 중합효소 연쇄 반응(arbitrarily primed polymerase chain reaction; AP-PCR), 핵산염기서열 기반 증폭 (nucleic acid sequence based amplification; NASBA), 가닥 치환 증폭 (strand displacement amplification) 및 고리-중재 항온성 증폭 (loop-mediated isothermal amplification; LAMP) 등의 증폭 방법일 수 있으며, 이에 한정되지는 않는다.상기 증폭 방법에서 PCR은 PCR 반응에 필요한 당업계에 공지된 여러 성분을 포함하는 PCR 반응 혼합액을 이용하여 수행될 수 있다. 상기 PCR 반응 혼합액에는 분석하고자 하는 환자로부터 분리된 생물학적 시료에서 분리된 게놈 DNA와 본 발명에서 제공되는 프라이머 쌍 이외에 적당량의 DNA 중합효소, dNTP, PCR 버퍼(buffer) 및 물(dH2O)을 포함할 수 있다.
상기 PCR 버퍼는 이에 제한되는 것은 아니나, Tris-HCl, MgCl2, KCl 중 1 이상의 버퍼를 포함할 수 있다. 이때, MgCl2 농도는 증폭의 특이성과 수량에 크게 영향을 주며, 바람직하게는 1.5 내지 2.5 mM의 범위로 사용될 수 있다. 일반적으로 Mg2+가 과량인 경우는 비특이적인 PCR 증폭산물이 증가하고, Mg2+가 부족한 경우 PCR 산물의 산출율이 감소한다. 상기 PCR 버퍼에는 적당량의 트리톤 X-100(Triton X-100)이 추가로 포함될 수 있다. 또한 상기 PCR을 수행함에 있어, PCR 반응은 공지된 방법에 따라 수행될 수 있다. 이에 제한되는 것은 아니나, 94 내지 95℃에서 주형 DNA를 전변성시킨 후, 변성(denaturation); 결합(annealing); 및 연장(extension)의 사이클을 거친 후, 최종적으로 70 내지 75℃, 예를 들면 72℃에서 연장(elongation)시키는 일반적인 PCR 반응 조건에서 수행될 수 있다. 상기에서 변성은 90 내지 99℃, 92 내지 97℃ 또는 94 내지 95℃에서 수행될 수있으며, 증폭은 70 내지 75℃, 71 내지 74℃ 또는 72℃에서 수행될 수 있다. 결합시의 온도는 프라이머의 종류에 따라 달라질 수 있는데, 예를 들어 50 내지 59℃, 52 내지 57℃ 또는 55℃로 수행할 수 있다. 각 단계의 시간과 싸이클 수는 당업계에 일반적으로 행해지는 조건에 따라 정해질 수 있다. 본 발명의 일 실시예에 따른 SSR프라이머 쌍을 이용한 PCR 수행시의 최적의 반응 조건은 다음과 같다: 95℃에서 5분간 주형 DNA를 전변성 시킨 후, 95℃에서 30초; 55℃에서 30초; 및 72℃에서 1분을 30 싸이클 반복 수행한 후, 최종적으로 72℃에서 30분동안 반응시킨다.
상기 “발현 수준 측정”에서는 당업계에서 널리 공지된 방법에 따라 PCR 산물의 DNA를 크기별로 분리할 수 있다. 예를 들면 증폭된 표적 서열은 검출가능한 표지 물질로 표지될 수 있다. 일 구현 예에서, 상기 표지 물질은 형광, 인광 또는 방사성을 발하는 물질일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 표지 물질은 6-FAM, NEN, VIC 또는 PET이다. 표적 서열의 증폭 시 프라이머의 5'-말단에 6-FAM, NEN, VIC 또는 PET를 표지하여 PCR을 수행하면 표적 서열이 검출가능한 형광 표지 물질로 표지될 수 있다. 또한, 상기 표지 물질에는 Cy5 또는 Cy-3가 포함될 수 있다. 또한, 방사성 물질을 이용한 표지는 PCR 수행 시 또는 S 등과 같은 방사성동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지될 수 있다. 표적 서열을 증폭하기 위해 이용된 프라이머 세트는 상기에 기재된 바와 같다.
본 명세서에서 사용된 용어,“진단”은 특정 질병 또는 질환에 대한 한 객체의 감수성(susceptibility)을 판정하는 것, 한 객체가 특정 질병 또는 질환을 현재 가지고 있는지 여부를 판정하는 것, 특정 질병 또는 질환에 걸린 한 객체의 예후(prognosis)(예컨대, 전-전이성 또는 전이성 암 상태의 동정, 암의 단계 결정 또는 치료에 대한 암의 반응성 결정)를 판정하는 것, 또는 테라메트릭스(therametrics)(예컨대, 치료 효능에 대한 정보를 제공하기 위하여 객체의 상태를 모니터링 하는 것)를 포함한다.
본 발명에 있어서, 본 발명의 조성물은 암의 조기 진단에 사용될 수 있다. 다른 한편으로, 본 발명은 암 발병 위험군(예컨대, 고위험군)을 선별 검사하는데 사용될 수 있다.
본 발명의 다른 양태로서, 본 발명은 상술한 본 발명의 암 진단용 조성물을 포함하는 암 진단용 키트를 제공한다.
본 발명의 키트는 본 발명에 따른 인터페론 감마 유전자의 발현 수준을 측정하는 제제뿐만 아니라, 암 진단 키트로 사용되기에 적합하도록 당분야에서 일반적으로 사용되는 도구나 시약 등을 포함할 수 있다. 예를 들어, 상기 도구 또는 시약으로는 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지 물질, 발색단(chromophores), 용해제, 세정제, 완충제, 안정화제 등을 포함할 수 있다. 또한, 본 발명의 키트는 내부 대조군(internal control)으로 사용할 수 있는 하우스키핑(housekeeping) 유전자의 발현 수준을 측정할 수 있는 제제를 더 포함할 수 있다.
본 발명에 있어서, 본 발명의 키트는 유전자 증폭 키트일 수 있으나, 이에 제한되는 것은 아니다. 상기 용어 “증폭”은 핵산 분자를 증폭하는 반응을 의미한다. 다양한 증폭 반응들이 당업계에 보고되어 있으며, 예를 들어, 중합효소 연쇄반응(PCR)은 미국 특허 제4683195호, 제4683202호, 제4800159호에 개시되어 있다.
본 발명의 또 다른 양태로서, 본 발명은 (a)분리된 시료에서 인터페론 감마 유전자의 발현 수준을 측정하는 단계; 및 (b) 측정된 인터페론 감마 유전자의 발현 수준이 대조군에 비하여 감소된 경우 암으로 판정하거나, 또는 암에 걸릴 위험이 있는 것으로 판정하는 단계를 포함하는 암 진단을 위한 정보제공방법을 제공한다.
상기 인터페론 감마 유전자의 발현 수준은 바이오 키트 분야에서 통상 사용되는 방법에 따라 측정될 수 있는데, 예컨대 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(Competitive RT-PCR), 실시간 역전사효소 중합효소반응(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 또는 유전자 칩 등을 사용하여 측정될 수 있다.
본 발명의 인터페론 감마 유전자의 발현 수준을 측정하는 것은 시료 내 인터페론 RNA의 농도를 측정함으로써 인터페론 감마 유전자 발현 수준을 확인할 수 있다. 특히, 인터페론 RNA의 농도를 선별적으로 측정하기 위하여, gDNA를 제거하여 시료 내 엑소좀에 포함된 인터페론감마가 발현된 RNA를 측정할 수 있어, 엑소좀 내 인터페론 감마 유전자의 발현량, 즉 RNA의 농도를 측정할 수 있다.
본 명세서에서 사용된 용어, “정보제공방법(method for providing information)”이란, 암의 진단에 관한 정보를 제공하는 방법으로서, 혈액 내 인터페론 감마 유전자를 이용하여 본 발명에 따른 인터페론 감마 유전자의 수준이 감소되었을 때 암의 발병이나 발병 가능성(위험성)에 대한 정보를 획득하는 방법을 의미한다.
본 발명에서, 암의 진단을 위하여 정상 대조군 보다 인터페론 감마 RNA의 양이 대조군보다 1/3 내지 1/2.5이면 암으로 판정할 수 있고, 1/2 내지 1/1이면 암의 발명 가능성이 높은 것으로 판단할 수 있다.
[실시예 1] 인테페론 유전자 발현
혈액 내 인터페론 유전자 표지를 확보하고, 이에 대한 표준 물질에 대하여 표 1에 기재된 바와 같이 확보하였다(표 1). 확보한 인터페론 감마 유전자를 이용한 실시간 유전자 증폭 기술을 구축하기 위하여, 확보한 각 표지 유전자 서열을 컴퓨터 프로그램을 활용하여 덤벨 구조 올리고뉴클레오티드 프라이머를 설계하고 이들 각각의 PCR 조건을 양성 표준물질을 대상으로 구축하였다. 이렇게 구축한 덤벨 구조 올리고 뉴클레오티드 프라이머를 이용하여 임상 시료를 대상으로 이들 표지에 대한 선별 시험을 실시하였다.
유전자 NCBI 정방향 프라이머(5’→3’) 역방향 프라이머(5’→3’)
IFNλ NM_000619.2 GAGTTXXXXXCATTCAGATGTAGCGGATAATGGAACTC(서열번호 1) GAGACXXXXXGACATTCATGTCTTCCTTGATGGTCTC(서열번호 2)
GAPDH MK476504.1 GGACAXXXXXCACTAAGCTCGCTTTCTTGCTGTCC GGATAXXXXXGATGCTCAAGGCCCTTCATAATATCC
(표 1의 프라이머 서열 중 X는 A, T, C, G 중 어느 하나의 염기임)
[실시예 2] 총 RNA 추출
준비된 암 환자의 혈장 및 정상 대조군 혈장을 이용하여 제조사의 매뉴얼에 따라 핵산을 추출하였다. 핵산 추출 장비는 Smart Lab Assist-32를 사용하였으며, 장비 사용 10분 전부터 장비를 준비(warming up)하였다. 동봉된 오토 플레이트(auto plate)의 비닐을 벗긴 뒤, 오토 플레이트의 윗면에 붙어있는 알루미늄 호일을 제거한 다음, 마이크로 파이펫을 이용하여 컬럼의 각 웰(well)에 300 ㎕ 의 검체를 분주하였다. 4℃에서 보관 중인 Proteinase K를 꺼내 검체가 분주된 각 웰에 20 ㎕씩 마이크로 파이펫을 이용하여 분주하였다.
8채널 스트립(channel strip)을 핵산 추출기구의 스트립 받침대 프레임(strip rack frame)에 장착시키고, 검체와 Proteinase K를 분주한 오토 플레이트를 핵산 추출기구의 96 웰 플레이트 받침대(deep well plate rack)에 끼운 뒤 끝까지 밀어서 장착시킨 다음 문을 닫고 시료에 맞게 프로그램을 실행시켰다. 핵산 추출기구의 프로그램이 끝난 후 오토 플레이트를 밖으로 빼낸 다음 각 웰에 추출되어 있는 핵산을 깨끗한 마이크로 튜브에 옮겨 담았다.추출한 총 RNA의 농도를 측정하고, 측정한 농도를 분석하여 모든 검체의 농도 값을 보정하였다.
[실시예 3]gDNA(genomic DNA) 제거
PrimeScript™ RT reagent Kit with gDNA Eraser(제품 코드 RR047A, Takara)를 이용하여 추출한 총 RNA에서 gDNA 제거 및 RT 과정을 수행하였다. 구체적으로, 5X gDNA Eraser Buffer 2.0㎕, gDNA Eraser 1.0㎕, Total RNA 7.0㎕를 혼합하여 최종 부피가 10㎕가 되도록 맞춘 후, 혼합 된 시약을 42℃에서 2분 동안 반응시킨 후 4℃에서 보관하였다. 분석은 아래와 같은 비율로 시약을 혼합하고, 시약을 37℃에서 15분 후 85℃에서 5초 동안 차례대로 반응시킨 후 4℃에서 보관하였다.
10 ㎕ Reaction solution from Step 1
4 ㎕ 5X PrimeScript Buffer 2
1 ㎕ PrimeScript RT Enzyme Mix 1
1 ㎕ RT Primer Mix
4 ㎕ RNase Free dH2O
20 ㎕ 총 부피
[실시예 4] 내부 대조군 유전자 증폭
확보한 암 유전자 분석을 수행하기 전에 추출한 총 RNA에서 gDNA를 제거한 후 합성된 검체의 cDNA를 이용하여 내부 대조군 프라이머(internal control primer)로 한번 더 정량화하였다. 반응 조건은 다음과 같았다. 합성된 cDNA 4 ㎕, qRT-PCR mastermix 5 ㎕, 내부 대조군 프라이머 1 ㎕를 혼합하여 최종 10 ㎕의 혼합액을 완성한 다음 표 4의 실시간 중합효소연쇄반응 조건에 따라 반응을 수행하였다.
Segment 사이클 수 온도 시간 분석
1 1 50℃ 10분
2 1 95℃ 10분
3 40 95℃ 20초
67℃ 30초 형광 측정
[실시예 5] 인터페론 감마 유전자 증폭
내부 대조군을 이용하여 정규화를 수행한 주형(template)을 이용하여 실시간 유전자 증폭을 위한 인터페론 감마 유전자 프라이머 1.0㎕, template 4.0㎕, qRT-PCR master mix 5.0㎕를 혼합하여 최종 10.0㎕의 혼합액을 만든 다음 표 5의 조건에 따라 PCR을 수행하였다.
Segment 사이클 수 온도 시간 분석
1 1 50℃ 10분
2 1 95℃ 10분
3 40 95℃ 20초
67℃ 30초 형광 측정
이 때 RNA 농도를 보정하기 위하여, GAPDH(house keeping gene) 유전자를 비교군으로 사용하였다. 그리고 정상인과 암 환자로부터 분리한 혈액내 6종의 유전자의 상대적인 양을 비교하기 위하여 RT-qPCR 결과를 하기 공식을 이용하여 분석하였다.
Fold change = 2-ΔΔCt (threshold cycle number)
ΔΔCt=(Ct of gene of IFNG cancer patient serum - Ct of GAPDH cancer patient serum)-(Ct of IFNG normal serum - Ct of GAPDH normal serum)
분석한 결과를 가지고 Student's t test를 시행하였고, p<0.05인 경우 의미있는 차이라고 판단하였다. 그 결과는 도 1에 나타내었다.
실험결과
정상군과 환자군을 선별(screening)하는데 유의미할 것이라 예상되는 인터페론 감마 유전자 발현 정도를 측정하였다. 이때 정상군과 환자군의 혈장(plasma)에서 추출한 RNA에서 genomic DNA를 완벽하게 제거한 후 내부 대조군(internal control; house-keeping gene)으로 정량화 하였다. 이의 결과를 도 2에서 확인하였다. 인터페론 감마 유전자를 이용하여 정상군과 6종의 암종별 Ct 값의 평균을 확인한 결과, 아래에서 보는바와 같이, 인터페론 감마 유전자는 정상군의 경우 27.30 내지 30.78로 평균 Ct값이 29.38인 반면, 간암에서는 Ct값이 30.09 내지 39.77로 평균 32.73, 대장암에서는 Ct값이 31.53 내지 39.83으로 평균 32.37, 폐암에서는 Ct값이 29.7 내지 34.58로 평균 32.12, 유방암에서는 Ct값이 32.14 내지 37.22로 평균 34.79, 췌장암에서는 Ct값이 32.14 내지 37.22로 평균 34.78 그리고 위암에서는 Ct값이 25.91 내지 34.43으로 평균 32.01로 나타나 정상군과 비교군 6종의 암종간에 유의미한 결과를 나타내었다.
암 환자의 경우 정상인에 비하여, IFNλ 유전자의 발현이 간암에서는 16.5배, 췌장암에서는 23.5배, 대장암에서는 9.5배, 폐암에서는 10.0배, 위암에서는 6배, 유방암에서는 3.2배 이상 감소되어 있음을 확인할 수 있었으며, 이는 통계적으로 유의한 수준이다. 상기 결과는 각종 암 환자의 혈액에서 분리한 엑소좀 내 IFNG 유전자가 정상인에 비해 저농도로 포함되어 있음을 시사한다.
또한, 이들 임상검체를 통한 임상적 민감도와 특이도를 분석한 결과 위암과 간암에서의 민감도와 특이도는 모두 91.7%를 나타내었고, 대장암, 유방암, 췌장암에서의 민감도와 특이도는 모두 100.0%를 나타낸 반면 폐암에서의 민감도와 특이도는 각각 83.4%와 91.7%로 다소 낮은 경향을 보였으나 암의 조기진단 또는 고위험군을 찾아내는데 있어서의 결격 사유는 없다고 판단되었다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.

Claims (9)

  1. 인터페론 감마 RNA의 농도를 측정하는 제제를 포함하는 암 진단용 조성물.
  2. 제1항에 있어서,
    상기 인터페론 감마 RNA를 측정하는 제제는 인터페론 감마 RNA에 특이적으로 결합하는 프라이머 세트 또는 프로브인 것을 특징으로 하는, 조성물.
  3. 제1항에 있어서,
    상기 인터페론 감마 RNA는 혈액 내의 엑소좀으로부터 유래된 것을 특징으로 하는, 조성물.
  4. 제2항에 있어서, 상기 프라이머 세트는 덤벨구조 올리고뉴클레오티드 프라이머인 특징으로 하는, 조성물.
  5. 제4항에 있어서, 상기 프라이머 세트는 서열번호 1 및 2로 구성된것인, 조성물.
  6. 제1항 내지 제5항의 어느 한 항의 조성물을 포함하는 암 진단용 키트.
  7. 제6항에 있어서, 상기 키트는 실시간 유전자 증폭 키트인 것을 특징으로 하는, 키트.
  8. 다음의 단계를 포함하는 암 진단을 위한 정보제공방법:
    (a) 분리된 시료에서 gDNA를 제거 후, 인터페론 감마 RNA의 농도를 측정하는 단계; 및
    (b) 측정된 인터페론 감마 RNA의 농도 수준이 대조군에 감소된 경우 암으로 판정 또는 암에 걸릴 위험이 있는 것으로 판정하는 단계.
  9. 제8항에 있어서, 상기 단계 (a)의 인터페론 감마 RNA는 엑소좀 내에 존재하는 것인, 정보제공방법.
PCT/KR2022/010944 2022-05-06 2022-07-26 엑소좀 내의 인터페론 감마 유전자 측정을 이용한 암 조기 진단 방법 및 진단 키트 WO2023214617A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0055999 2022-05-06
KR1020220055999A KR20230156518A (ko) 2022-05-06 2022-05-06 엑소좀 내의 인터페론 감마 유전자 측정을 이용한 암 조기 진단 방법 및 진단 키트

Publications (1)

Publication Number Publication Date
WO2023214617A1 true WO2023214617A1 (ko) 2023-11-09

Family

ID=82943231

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/010944 WO2023214617A1 (ko) 2022-05-06 2022-07-26 엑소좀 내의 인터페론 감마 유전자 측정을 이용한 암 조기 진단 방법 및 진단 키트

Country Status (3)

Country Link
US (1) US20230358749A1 (ko)
KR (1) KR20230156518A (ko)
WO (1) WO2023214617A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120103387A (ko) * 2011-03-10 2012-09-19 연세대학교 원주산학협력단 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
CN106520946A (zh) * 2016-11-10 2017-03-22 四川大学华西医院 一种利用多重pcr检测多种胰腺癌肿瘤标记物的方法及检测用引物和探针
US20180079814A1 (en) * 2015-04-01 2018-03-22 Medimmune Limited Combined anti-pld-1 and anti-ctla-4 antibodies for treating non-small lung cancer
US20200072843A1 (en) * 2018-08-30 2020-03-05 Mackay Memorial Hospital Methods of diagnosing diseases by extracellular vesicles and uses thereof
KR20210115291A (ko) * 2020-03-12 2021-09-27 (주) 바이오인프라생명과학 유방암 진단용 다중 바이오마커 및 이의 용도

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120093002A (ko) 2011-02-14 2012-08-22 (주)에이티젠 Ｎｋ 세포의 활성 측정을 이용한 암 진단 방법 및 진단 키트
KR102090698B1 (ko) 2017-08-24 2020-04-23 연세대학교 산학협력단 암의 진단, 모니터링, 또는 예후 예측을 위해 생체 외 인터페론-감마의 양을 측정하는 방법

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120103387A (ko) * 2011-03-10 2012-09-19 연세대학교 원주산학협력단 실시간 역전사효소 중합반응을 이용한 결핵의 진단을 위한 정보제공방법 및 이를 위한 결핵 진단용 키트
US20180079814A1 (en) * 2015-04-01 2018-03-22 Medimmune Limited Combined anti-pld-1 and anti-ctla-4 antibodies for treating non-small lung cancer
CN106520946A (zh) * 2016-11-10 2017-03-22 四川大学华西医院 一种利用多重pcr检测多种胰腺癌肿瘤标记物的方法及检测用引物和探针
US20200072843A1 (en) * 2018-08-30 2020-03-05 Mackay Memorial Hospital Methods of diagnosing diseases by extracellular vesicles and uses thereof
KR20210115291A (ko) * 2020-03-12 2021-09-27 (주) 바이오인프라생명과학 유방암 진단용 다중 바이오마커 및 이의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DRAGICA JORGOVANOVIC;MENGJIA SONG;LIPING WANG;YI ZHANG: "Roles of IFN-γ in tumor progression and regression: a review", BIOMARKER RESEARCH, BIOMED CENTRAL LTD, LONDON, UK, vol. 8, no. 1, 29 September 2020 (2020-09-29), London, UK , pages 1 - 16, XP021282369, DOI: 10.1186/s40364-020-00228-x *

Also Published As

Publication number Publication date
KR20230156518A (ko) 2023-11-14
US20230358749A1 (en) 2023-11-09

Similar Documents

Publication Publication Date Title
US20230313300A1 (en) Biomarkers of traumatic brain injury
US20190136330A1 (en) Method for screening cancer
US11767565B2 (en) Use of detection reagent for detecting methylation of genes associated with colorectal cancer, and kit
US20180237859A1 (en) Methods for detection of depressive disorders
CN101003835B (zh) 用于大肠癌检查的基因组合
CN112852957B (zh) 先天性巨结肠早期诊断标志物及其应用
WO2012161385A1 (ko) 실시간 중합반응을 이용한 암의 진단을 위한 정보제공방법 및 이를 위한 암 진단용 키트
WO2020242080A1 (ko) 편평상피세포암의 진단 또는 예후 예측용 마커 및 이의 용도
CN112708673B (zh) Prdm9转座子融合作为先天性巨结肠疾病标志物的应用
WO2023214617A1 (ko) 엑소좀 내의 인터페론 감마 유전자 측정을 이용한 암 조기 진단 방법 및 진단 키트
US11535897B2 (en) Composite epigenetic biomarkers for accurate screening, diagnosis and prognosis of colorectal cancer
WO2018143574A1 (ko) 비만 진단용 조성물 및 이의 용도
WO2021112612A1 (ko) 자궁경부암 환자의 항암방사선 치료 반응성 예측용 바이오마커 조성물
EP4112745A1 (en) Biomarkers for predicting a patient&#39;s response to bcg therapy, methods and uses based thereon
CN106868130B (zh) 用于结肠直肠癌中使用的生物标志物
CN113215257A (zh) 一种用于检测乳腺癌相关基因甲基化的核酸组合物、试剂盒和检测方法
WO2020116839A1 (ko) 식습관 민감도 예측용 조성물, 키트, 및 이를 이용한 방법
WO2020116838A1 (ko) 운동 민감도 예측용 조성물, 키트, 및 이를 이용한 방법
CN109439743A (zh) 一种重症哮喘的生物标志物及其应用
CN112813168B (zh) 一种与口腔鳞癌相关的生物标志物
WO2020091386A1 (ko) 간암 전이 진단 또는 예후 예측용 바이오마커 및 이의 용도
WO2020091387A1 (ko) 간암 전이 진단 또는 예후 예측용 바이오마커 및 이의 용도
CN113981141B (zh) 乙型肝炎感染患者和携带者血浆中的一组分子标志物及其用途
WO2023128429A1 (ko) 대장암 및 진행 선종의 선별 검사 방법 및 그 응용
WO2022124564A1 (ko) 마이크로rna를 이용한 당뇨병성 신경병증의 예측 및 진단 방법 및 이를 위한 키트

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22940858

Country of ref document: EP

Kind code of ref document: A1