WO2023214578A1 - ウイルス由来構築物プラスミドライブラリーおよびその構築 - Google Patents
ウイルス由来構築物プラスミドライブラリーおよびその構築 Download PDFInfo
- Publication number
- WO2023214578A1 WO2023214578A1 PCT/JP2023/017130 JP2023017130W WO2023214578A1 WO 2023214578 A1 WO2023214578 A1 WO 2023214578A1 JP 2023017130 W JP2023017130 W JP 2023017130W WO 2023214578 A1 WO2023214578 A1 WO 2023214578A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- virus
- nucleic acid
- nucleic acids
- derived
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
- C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10041—Use of virus, viral particle or viral elements as a vector
- C12N2710/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10051—Methods of production or purification of viral material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15051—Methods of production or purification of viral material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14041—Use of virus, viral particle or viral elements as a vector
- C12N2750/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14051—Methods of production or purification of viral material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Definitions
- the present disclosure provides methods for efficiently producing virus-derived construct plasmids.
- the present disclosure also provides virus-derived construct plasmid libraries.
- Patent Document 1 Various virus-derived constructs such as adenovirus vectors (Patent Document 1) have been developed for gene therapy, vaccine therapy, etc.
- virus-derived constructs For the preparation of virus-derived constructs, it is usually necessary to introduce the virus-derived construct plasmid into producer cells. Therefore, it is necessary to synthesize and construct a virus-derived construct plasmid.
- Virus-derived construct plasmids are usually individually designed and produced, and improving plasmid performance, such as yield of virus-derived constructs, often involves significant effort.
- the present inventors have discovered a method for efficiently producing various virus-derived construct plasmids. Based on this knowledge, the present disclosure provides methods for generating various virus-derived construct plasmids from a starting plasmid. Furthermore, the present inventors also provide libraries of virus-derived construct plasmids produced by such methods.
- a method for producing a virus-derived construct plasmid comprising: providing a set of starting plasmids comprising at least a portion of the nucleic acid sequences necessary to construct a virus-derived construct, said set of starting plasmids comprising a corresponding set of alternative unit nucleic acids; the set of surrogate unit nucleic acids comprising at least one set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences; treating the set of starting plasmids with restriction enzymes to prepare a mixed solution containing cleavage substitute unit nucleic acid fragments; ligating the cleavage substitute unit nucleic acid fragments to form an integrated nucleic acid; contacting the accumulated nucleic acid with a transformed organism to form a virus-derived construct plasmid; method including.
- (Item 2) The method of any of the above items for producing a collection of virus-derived construct plasmids.
- (Item 3) The method of any of the preceding items, wherein at least one of the set of initiation plasmids comprises a transcription initiation sequence that is operative in animal cells, producing a virus-derived construct plasmid containing said transcription initiation sequence that is operative in animal cells.
- (Item 4) The method of any of the above items, wherein the set of starting plasmids includes three or more types of starting plasmids.
- (Item 5) The method of any of the preceding items, wherein the set of corresponding surrogate unit nucleic acids comprises at least two sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences.
- (Item 6) The method according to any of the above items, further comprising the step of selecting a virus-derived construct plasmid excellent in a desired function from a collection of virus-derived construct plasmids formed.
- the desired function is the production amount of a virus-derived construct.
- (Item 8) The method according to any of the above items, wherein the desired function is the amount of impurities mixed into the target virus-derived constituent composition.
- each of said set of starting plasmids contains the necessary nucleic acid sequences to construct a virus-derived construct.
- at least a portion of the starting plasmid is a plasmid produced by the method of item 1.
- said set of corresponding surrogate unit nucleic acids comprises at least two sets of corresponding surrogate unit nucleic acids comprising nucleic acid sequences encoding at least a portion of different subtypes of the same gene.
- each of said set of starting plasmids comprises three or more surrogate unit nucleic acids comprising at least a portion of the nucleic acid sequences necessary to construct said virus-derived construct.
- each of said set of starting plasmids comprises three or more surrogate unit nucleic acids comprising at least a portion of the nucleic acid sequences necessary to construct said virus-derived construct.
- the method according to any of the above items comprising adding a barcode nucleic acid in the step of ligating to form an integrated nucleic acid.
- each of said set of starting plasmids contains the necessary nucleic acid sequences to construct said virus-derived construct of about 10 kb or more.
- the nucleic acid sequence necessary for constructing the virus-derived construct is (A) a nucleic acid sequence containing a terminal repeat sequence; (B) a nucleic acid sequence encoding a packaging factor; (C) a nucleic acid sequence encoding a structural protein; (D) a nucleic acid sequence encoding a functional cofactor. (Item 19) The method of any of the preceding items, wherein the set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids encoding promoters of different types or orientations.
- the set of corresponding alternative unit nucleic acids is (A) a nucleic acid sequence containing a terminal repeat sequence; (B) a nucleic acid sequence encoding a packaging factor; (C) a nucleic acid sequence encoding a structural protein; (D) a nucleic acid sequence encoding a functional cofactor; (E) a nucleic acid sequence encoding a promoter; (F) a nucleic acid sequence encoding a desired gene; (G) at least two sets of corresponding alternative unit nucleic acids comprising different nucleic acid sequences selected from nucleic acid sequences involved in host cell biosynthesis.
- the nucleic acid sequences involved in the biosynthesis of the host cell include SV40 Large T antigen (SV40LTA), TAX, Kras, Myc, MIR17HG, BCL-2, BCL-XL, PDIA2, XBP1, HSPA5, PC (pyruvate carboxylase), PDK. , HIF1A, NRF2, and CPSF6.
- SV40LTA Large T antigen
- TAX TAX
- Kras TAX
- Myc MIR17HG
- BCL-2 BCL-XL
- PDIA2 XBP1
- HSPA5 pyruvate carboxylase
- PDK. pyruvate carboxylase
- HIF1A HIF1A
- NRF2 CPSF6
- said set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising a different nucleic acid sequence encoding a desired gene, and a set of corresponding surrogate unit nucleic acids adjacent upstream thereof comprising a different nucleic acid sequence encoding a promoter; Any of the above items, including sets.
- said starting plasmid comprises a nucleic acid sequence comprising two terminal repeat sequences, and said surrogate unit nucleic acid encoding said desired gene is present between said two terminal repeat comprising nucleic acid sequences.
- virus-derived construct is selected from viral vectors, virus-like particles (VLPs), oncolytic viruses and viral replicons.
- the virus-derived constituents include alphavirus, vaccinia virus, measles virus, influenza virus, vesicular stomatitis virus, coronavirus, Sindbis virus, Semliki Forest virus, herpes simplex virus, retrovirus, lentivirus, rabies virus, and Sendai virus. , adeno-associated virus, adenovirus, reovirus, Coxsackie virus, and Newcastle disease virus.
- the virus-derived composition is a virus-derived composition of a virus selected from the group consisting of adeno-associated virus, adenovirus, retrovirus, lentivirus, herpes simplex virus, and Sendai virus. .
- the virus-derived construct is a virus-derived construct of a virus selected from the group consisting of an adeno-associated virus or a lentivirus.
- the virus-derived construct is a viral vector of adeno-associated virus.
- the set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different inverted terminal repeats (ITRs) from any of adeno-associated virus serotypes 1 to 12 and variants thereof; Any of the above methods.
- ITRs inverted terminal repeats
- the starting plasmid contains a promoter, a desired gene, and a terminator from upstream between the 5'ITR and 3'ITR.
- said set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences encoding functional cofactors derived from at least one of adenovirus, herpesvirus, papillomavirus, bocavirus and simian virus. Any of the above items, including sets.
- Said set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences encoding functional cofactors derived from any of adenovirus serotypes 1 to 52 and variants thereof. Item either way.
- the functional cofactors include adenovirus E1A, E1B, E2A, E4, and VA, herpesvirus UL5, UL8, UL30, UL42, UL52, ICP0, ICP4, ICP8, and ICP22, papillomavirus E1, E2, and The method of any of the preceding items, comprising at least one of E6, Bocavirus NP1, NS2, NS4, and BocaSR, and Simian Virus Large T antigen.
- said set of corresponding alternative unit nucleic acids comprising a different nucleic acid sequence encoding said functional cofactor, and corresponding alternative unit nucleic acids adjacent upstream thereof comprising a different nucleic acid sequence encoding a promoter; Any method of the above items, including a set of.
- the starting plasmid comprises E2A, E4, and VA.
- said set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences encoding rep.
- the method of any of the preceding items, wherein the set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences encoding caps.
- the cap includes at least one of VP1, VP2, VP3, AAP and MAAP.
- the set of corresponding alternative unit nucleic acids comprises a set of corresponding alternative unit nucleic acids comprising a different nucleic acid sequence encoding the cap, and a set of corresponding alternative unit nucleic acids adjacent upstream thereof comprising a different nucleic acid sequence encoding a promoter.
- any of the above items including: (Item 46) Item 43, wherein the set of corresponding surrogate unit nucleic acids encoding cap comprises a set of corresponding surrogate unit nucleic acids comprising a different nucleic acid sequence from any of adeno-associated virus serotypes 1 to 12 and variants thereof. Method described. (Item 47) The method of any of the above items, wherein the starting plasmid contains a 5'ITR, promoter, desired gene, 3'ITR, rep, cap and functional cofactors.
- the starting plasmid contains 5'ITR, 3'ITR, rep and cap, one of the rep and cap is located downstream of the region flanked by the 5'ITR and 3'ITR, and the other is located downstream of the region flanked by the 5'ITR and 3'ITR.
- Said starting plasmid comprises two ITRs and other parts of the nucleic acid sequence necessary to construct said virus-derived construct, said other parts being outside the region flanked by said two ITRs. Item either way.
- the starting plasmid comprises a 5'ITR, a promoter, a desired gene, a 3'ITR, a rep, a cap and a functional cofactor in that order.
- the starting plasmid comprises a first promoter, a first rep, a second promoter, a second rep, a third promoter and a cap in this order.
- the virus-derived construct is a lentivirus viral vector.
- the set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different long terminal repeats (LTRs) or variants thereof derived from lentiviruses.
- LTRs long terminal repeats
- the starting plasmid contains a promoter, a desired gene, and a terminator from upstream between the 5'LTR and 3'LTR.
- the starting plasmid contains two or more sets of the promoter, desired gene, and terminator.
- said set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences encoding structural proteins selected from gag, pol, VSV-G and env. .
- said set of corresponding alternative unit nucleic acids comprises a set of corresponding alternative unit nucleic acids comprising a different nucleic acid sequence encoding said structural protein and a set of corresponding alternative unit nucleic acids adjacent upstream thereof comprising a different nucleic acid sequence encoding a promoter; Any of the above items, including sets.
- the virus-derived construct is an adenovirus viral vector.
- the set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different inverted terminal repeats (ITRs) derived from an adenovirus.
- ITRs inverted terminal repeats
- the set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences encoding structural proteins selected from L1, L2, L3, L4 and L5. .
- said set of corresponding alternative unit nucleic acids comprises a set of corresponding alternative unit nucleic acids comprising a different nucleic acid sequence encoding said structural protein and a set of corresponding alternative unit nucleic acids adjacent upstream thereof comprising a different nucleic acid sequence encoding a promoter; Any of the above items, including sets. (Item 66) of the above items, wherein the set of corresponding surrogate unit nucleic acids encoding structural proteins comprises a set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences derived from any of adenovirus serotypes 1 to 52 and variants thereof. Either way.
- any of the above items, wherein said set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences encoding functional cofactors selected from E1A, E1B, E2A, E2B and E4.
- Method. said set of corresponding alternative unit nucleic acids comprising a different nucleic acid sequence encoding said functional cofactor, and corresponding alternative unit nucleic acids adjacent upstream thereof comprising a different nucleic acid sequence encoding a promoter; Any method of the above items, including a set of.
- the item above, wherein the set of corresponding surrogate unit nucleic acids encoding functional cofactors comprises a set of corresponding surrogate unit nucleic acids comprising a different nucleic acid sequence derived from any of adenovirus serotypes 1 to 52 and variants thereof. Either way.
- a virus-derived construct plasmid library comprising a virus-derived construct plasmid containing three or more alternative unit nucleic acids as a series of parallel alternative unit nucleic acids, said virus-derived construct plasmid library comprising different nucleic acid sequences. comprising a plurality of sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences, wherein the parallel surrogate unit nucleic acids on each virus-derived construct plasmid of said plurality of sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences are about 10 kb or more; Virus-derived construct plasmid library with length.
- a virus-derived construct plasmid library comprising a plurality of virus-derived construct plasmids, wherein a different portion in combination in the plurality of virus-derived construct plasmids includes a nucleic acid sequence that is a promoter or a functional cofactor. product plasmid library.
- Elements constituting different parts in combinations of a plurality of virus-derived construct plasmids in the virus-derived construct plasmid library contain promoters, and the promoters in the plurality of virus-derived construct plasmids are naturally associated with different genes.
- said plurality of sets of corresponding alternative unit nucleic acids comprising different nucleic acid sequences, (A) a nucleic acid sequence containing a terminal repeat sequence; (B) a nucleic acid sequence encoding a packaging factor; (C) a nucleic acid sequence encoding a structural protein; (D) A virus-derived construct plasmid library according to any of the above items, comprising a set of corresponding alternative unit nucleic acids comprising at least one different nucleic acid sequence from the nucleic acid sequence encoding a functional cofactor.
- Each virus-derived construct plasmid is (A) a nucleic acid sequence containing a terminal repeat sequence; (B) a nucleic acid sequence encoding a packaging factor; (C) a nucleic acid sequence encoding a structural protein; (D) A virus-derived construct plasmid library according to any of the above items, comprising a nucleic acid sequence encoding a functional cofactor. (Item 77) The virus-derived construct plasmid library of any of the above items, wherein said plurality of sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences comprise surrogate unit nucleic acids having a GC content of 75% or more.
- the plurality of sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences include a plurality of sets of corresponding surrogate unit nucleic acids allowing for 64 or more different parallel surrogate unit nucleic acid combinations, and each virus-derived construct A virus-derived construct plasmid library of any of the above items, wherein the plasmids contain the same number of parallel alternative unit nucleic acids.
- a method of producing a virus-derived construct comprising: (Item 82) producing a collection of virus-derived construct plasmids by any of the methods listed above; introducing the collection of virus-derived construct plasmids into producer cells to form virus-derived constructs to construct a virus-derived construct library;
- a method of producing a virus-derived construct library comprising: (Item 83) The method of any of the above items, wherein the step of introducing the virus-derived construct plasmid into a producer cell comprises introducing a single virus-derived construct plasmid into the producer cell.
- (Item 84) The method according to any of the above items, wherein at least a portion of the nucleic acid contained in the virus-derived construct plasmid is integrated into the chromosome of the producer cell.
- (Item 85) Producer cells produced by any of the methods listed above.
- (Item 86) A virus-derived construct produced by any of the methods listed above.
- (Item 87) A composition containing a virus-derived constituent produced by any of the methods described above.
- the structure of the seed plasmid used in the examples is shown schematically.
- the structures of the five types of seed plasmids that were initially produced are shown schematically.
- the structure of eight seed plasmids with additional seed plasmids is shown schematically.
- the genome copy number of rAAV produced from each plasmid of Control, #20, #24, and #46 is shown.
- the vertical axis shows the number of genome copies per mL.
- the results of measurement of purified rAAV produced from plasmid #46 by mass photometry are shown.
- the horizontal axis shows the measured mass (kDa) and the vertical axis shows the counts detected in the corresponding mass.
- An example of a plasmid structure envisioned for the construction of a virus-derived construct plasmid is shown.
- An example of a plasmid structure envisioned for the construction of a virus-derived construct plasmid is shown.
- An example of a plasmid structure envisioned for the construction of a virus-derived construct plasmid is shown.
- An example of a plasmid structure envisioned for the construction of a virus-derived construct plasmid is shown.
- An example of a plasmid structure envisioned for the construction of a virus-derived construct plasmid is shown.
- the structure of the seed plasmid constructed in Example 4 to create a combinatorial library is shown schematically.
- Example 4 shows the AAV particle production ability of the viral vector plasmid clone obtained in Example 4.
- the horizontal axis shows the clone number, and the vertical axis shows the amount of AAV particles produced (genome copy number).
- the structure of the seed plasmid constructed in Example 5 to create a combinatorial library is shown schematically.
- 2 shows the AAV particle production ability of the viral vector plasmid clone obtained in Example 5.
- the horizontal axis shows the clone number, and the vertical axis shows the amount of AAV particles produced (genome copy number).
- plasmid refers to a circular DNA that exists separately from a chromosome in a cell or exists separately from a chromosome when introduced into a cell. Because the methods of the present disclosure may use plasmids as starting materials to produce plasmids, the plasmids used as starting materials in the methods may be referred to as "starting plasmids" and the produced plasmids may be referred to as “product plasmids.” The totality of starting plasmids present in or to form one reaction solution may be referred to herein as a "set of starting plasmids.”
- the OGAB (Ordered Gene Assembly in Bacillus subtilis) method used in the method of the present disclosure is a method in which a circular plasmid is generated in a transformed organism by incorporating the accumulated nucleic acid into this organism (details can be found in the present specification). (described elsewhere). Any organism capable of taking up non-circular long nucleic acids and producing plasmids can be used in the OGAB method, and such organisms are referred to herein as "transformed organisms.”
- a nucleic acid to be introduced into a transformed organism is referred to herein as an "accumulated nucleic acid," and typically an accumulated nucleic acid has a tandem repeat structure in which nucleic acid units having the same sequence appear repeatedly in the same direction.
- unit nucleic acid refers to a nucleic acid fragment having a partial sequence constituting the sequence of an integrated nucleic acid or a portion that produces such a nucleic acid fragment, typically an overhanging sequence generated by restriction enzyme treatment. Refers to a nucleic acid fragment having at both ends or a nucleic acid region sandwiched between two protruding sequences generated by restriction enzyme treatment.
- the term "corresponding" between a plurality of unit nucleic acids refers to a relationship in which these unit nucleic acids, which are nucleic acid fragments, have the same protruding sequence, or a plurality of nucleic acid molecules each containing these unit nucleic acids (typically, This refers to a relationship in which the same overhanging sequence is produced when a plasmid (plasmid) is treated with a specific restriction enzyme.
- unit nucleic acids that correspond to each other are referred to as "alternative unit nucleic acids", and when fragmented alternative unit nucleic acids are assembled to produce an integrated nucleic acid and a plasmid is formed by the OGAB method, the alternative unit nucleic acids are , may be integrated at the same location on the plasmid (eg, unit nucleic acids at the same rank counting from the start of transcription).
- the base sequences other than the protruding sequence of the plurality of alternative unit nucleic acids may be the same or different.
- the totality of surrogate unit nucleic acids present in one reaction solution, or present in a set of starting plasmids to form one reaction solution, may be referred to herein as a "set of surrogate unit nucleic acids.” It is used with a set of alternative unit nucleic acids at position A, etc.
- the term "parallel” refers to a relationship in which the unit nucleic acids, which are nucleic acid fragments, have different protruding sequences, or a relationship in which the unit nucleic acids (typically, plasmids) containing these unit nucleic acids are used. Refers to a relationship that produces different overhanging sequences when treated with a specific restriction enzyme. Typically, parallel unit nucleic acids are present on the same plasmid.
- two unit nucleic acids being "adjacent" refers to a relationship in which these unit nucleic acids have complementary protruding sequences, or a relationship in which a nucleic acid molecule (typically a plasmid) containing these unit nucleic acids is Refers to a relationship that produces complementary overhanging sequences when treated with a restriction enzyme, and typically refers to a relationship located on both sides of the cut point of restriction enzyme treatment.
- the collection of parallel unit nucleic acids present on a plasmid or produced when a plasmid is treated with a restriction enzyme may be referred to herein as a "series of parallel unit nucleic acids.” A series of parallel unit nucleic acids on a starting plasmid 1, etc. are used.
- nucleic acid that can be defined by a terminal or overhanging sequence of a nucleic acid molecule refers to the form of a nucleic acid fragment having a terminal or overhanging portion of the sequence and potentially this terminal, unless otherwise specified. It can refer to any partial region in a nucleic acid molecule that can form a portion or an overhang. When a "nucleic acid fragment" is described, it actually has a terminal or overhanging portion of the sequence.
- Bacillus subtilis is an aerobic Gram-positive catalase-positive bacterium that is ubiquitous in soil and plants, and is present in the gastrointestinal tract of ruminants and humans.
- Bacillus amyloliquefaciens which has a size of .8 x 2 to 3 ⁇ m, is mesophilic, has an optimal growth temperature of 25 to 40 degrees Celsius, and forms spores, and its scientific name is Bacillus subtilis or a closely related Bacillus genus bacterium. Refers to any non-pathogenic bacteria with natural transformation ability, including Bacillus licheniformis, Bacillus pumilus, etc.
- the Bacillus subtilis is the Marburg strain 168, which is a strain with high natural transformation potential among Bacillus subtilis, or its derivative strain RM125.
- Strain 168 is the most genetically studied Gram-positive bacterium, and along with strain RM125, it is available from ATCC (American Type Culture Collection), etc., and it is harmless to humans and animals, and the OGAB method can be applied to it. Since this is known, it can be suitably used in the present disclosure.
- library refers to a collection of homogeneous materials (plasmids, viral vectors, etc.) with similar structures. Similar structures include having similar base sequence lengths (for example, within 10% difference in base length), having the same number of unit nucleic acids in a series of parallel unit nucleic acids, and functions of parts with different structures. are the same (for example, different serotypes of the same gene, promoters that function in the same host cell), etc.
- packing cell refers to a cell for producing a virus-derived construct plasmid.
- virus-derived construct plasmid refers to a plasmid for producing a virus-derived construct in a producer cell, which contains a gene to be carried in the virus-derived construct.
- the virus-derived construct plasmid contains the sequence of the gene (desired gene) to be expressed in the target cell of the virus-derived construct between two terminal repeat sequences, and also contains a promoter and other elements (e.g. enhancer, terminator, etc.).
- producer cell refers to a cell capable of producing a desired virus-derived construct, in which the genes necessary for the production of the virus-derived construct are expressed from the chromosome and the introduced plasmid. It can be a cell.
- a desired virus-derived construct can be produced by introducing the virus-derived construct plasmid of the present disclosure into producer cells.
- AAV adeno-associated virus
- E1A and E1B are required for its production, but since HEK293 has these, they can be removed from the helper plasmid.
- Other cells can also function as producer cells if they are modified to have such functional cofactors.
- animal cells refer to cells obtained from animals (humans, mice, rats, monkeys, dogs, etc.) or cells obtained by modifying cells obtained from animals.
- virus-derived construct refers to a nucleic acid construct that at least partially has a structure derived from a virus, or a construct containing a protein produced therefrom.
- Virus-derived constructs include viral vectors, virus-like particles (VLPs), oncolytic viruses (including those that have been modified to grow only in cancer cells), and viral replicons (including those that have been modified to proliferate only in cancer cells) (viral genomes capable of self-replication).
- viral vector refers to a construct that has at least a portion of a structure derived from a virus and is capable of introducing nucleic acids into target cells.
- viral vectors are in the form of viral particles that contain viral structural proteins and nucleic acids that include heterologous genes.
- nucleic acid sequence necessary to construct a virus-derived construct refers to a nucleic acid sequence (e.g., a combination of nucleic acid sequences) that allows a producer cell containing the same to produce a virus-derived construct.
- the nucleic acid sequences necessary to construct the virus-derived construct include a nucleic acid sequence encoding a structural protein of the virus, a nucleic acid sequence encoding a packaging factor, and two terminal repeat sequences of the virus; and a nucleic acid sequence encoding a functional cofactor.
- a "nucleic acid sequence encoding a functional cofactor” includes, for example, a nucleic acid sequence encoding a structural protein of a virus, a nucleic acid sequence encoding a packaging factor, and any virus-derived construct other than the two terminal repeat sequences of a virus. It may contain or consist essentially of the nucleic acid sequences necessary for its construction. The nucleic acid sequences of each of these may vary from virus-derived construct to virus-derived construct. These details are described elsewhere in this specification. In a preferred embodiment, the nucleic acid sequences necessary to construct the virus-derived construct may utilize advantageous sequences common to AAV and adenovirus, more preferably sequences advantageous to AAV.
- sequences common to such AAVs and adenoviruses include the desired gene between the inverted terminal repeats (ITRs) and functional cofactors, rep, cap, or L1, L2, L3, L4, L5.
- Sequences that are advantageous for AAV include the desired gene between the ITRs and may include functional cofactors, rep, and cap. It has the characteristic that the functional cofactors, rep, and cap can be placed outside the two ITRs.
- such examples include, but are not limited to, the sequences of certain functional cofactors E1A, E1B, E2A, E2B, E3, E4.
- packaging factor includes proteins that encapsulate the viral genome in structural proteins, and examples include rep and ⁇ .
- packaging factors include adenovirus serotypes 1-52 or adeno-associated virus serotypes 1-12, or variants thereof (rh10, DJ, DJ/8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, Anc80, etc.) can be used.
- This protein may be a natural protein or may be one in which mutations have been introduced artificially. Those into which "artificial mutations" have been introduced can be produced, for example, by introducing appropriate mutations into the sequences of natural products described in known literature.
- structural protein refers to a protein produced from genes carried by a virus, at least a portion of which is present on the surface (e.g., traverses the envelope) of the virus or virus-derived construct. . Structural proteins may be responsible for infectivity of cells.
- capsid refers to a protein produced from a gene carried by a virus that is present on the surface (optionally enclosed in an envelope) of a virus or a virus-derived construct, and refers to ” is also called.
- tandem repeat nucleic acid sequence
- Any repeat sequence used in the art can be used in this disclosure. Typically, promoter sequences occur repeatedly.
- terminal repeat sequence is a general term for nucleic acid sequences of biological genomes in which the same sequence is repeated (especially several times or more) and is present at the ends.
- terminal repeats include, but are not limited to, inverted terminal repeats (ITR) and long terminal repeats (LTR).
- the terminal repeat sequences are adenovirus serotypes 1 to 52, adeno-associated virus serotypes 1 to 12, or variants thereof (rh10, DJ, DJ/8, PHP.eB, PHP.S, AAV2-retro, AAV2 - QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, Anc80, etc.) can be used.
- the terminal repeat sequence may be a natural one or one in which mutations have been introduced artificially. Those into which "artificial mutations" have been introduced can be produced, for example, by introducing appropriate mutations into the sequences of natural products described in known literature.
- the term "functional cofactor” refers to a gene that supports the amplification of a virus that cannot grow on its own.
- functional cofactors include, for example, nucleic acid sequences encoding packaging factors of the virus, as well as constructs derived from any virus other than the two terminal repeat sequences of the virus, for constructing, propagating, improving activity, and reducing toxicity. These include, but are not limited to, the nucleic acid sequences necessary to do so.
- Functional cofactors that can be used include, but are not limited to, for example, E1A, E1B, E2A, E2B, E4, RPE, WRPE, PPT, oPRE, enhancer, insulator, silencer sequences, and the like.
- loaded nucleic acid refers to a nucleic acid carried by a virus-derived construct (such as a viral vector). Whether or not it is a loaded nucleic acid can be confirmed by treating a virus-derived construct preparation with DNase to degrade nucleic acids outside the virus particle, inactivating DNase, and then checking the nucleic acid extracted from the virus particle. can. Whether or not it is a loaded nucleic acid can also be confirmed by examining the sequence (preferably full length or near full length) of the obtained nucleic acid product.
- host cell refers to a cell (including the progeny of such a cell) into which an exogenous nucleic acid or protein or virus or virus-derived construct has been introduced.
- Protein Polypeptide and “peptide” are used interchangeably herein and refer to a polymer of amino acids of any length. This polymer may be linear, branched, or cyclic. Amino acids may be natural or non-natural, or may be modified amino acids. The term also encompasses natural or artificially modified polymers. Such modifications include, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification (eg, conjugation with a labeling moiety).
- Polynucleotide and “nucleic acid” are used interchangeably herein and refer to a polymer of nucleotides of any length. Examples of nucleic acids include DNA, RNA, cDNA, mRNA, rRNA, tRNA, microRNA (miRNA), and lncRNA. The term also includes “polynucleotide derivatives.” “Polynucleotide derivative” refers to a polynucleotide that includes a nucleotide derivative or has an unusual internucleotide linkage.
- Nucleotide derivative refers to a nucleotide having a structure different from the normal nucleotides used in natural DNA or RNA, such as locked nucleic acid (LNA), 2'-O,4'-C-ethylene bridged nucleic acid (2'-O,4'-C-ethylene bridged nucleic acid, ENA), other bridged nucleic acid (BNA), hexitol nucleic acid (HNA), amide bridged nucleic acid (Amido -bridged nucleic acid, AmNA), morpholino nucleic acids, tricyclo-DNA (tcDNA), polyether nucleic acids (see, for example, US Pat. No.
- internucleotide bonds that are different from normal ones include, for example, oligonucleotide bonds in which a phosphodiester bond is converted to a phosphorothioate bond, and oligonucleotides in which a phosphodiester bond is converted to an N3'-P5' phosphoroamidate bond. Examples include inter-oligonucleotide bonds in which ribose and phosphodiester bonds are converted into peptide-nucleic acid bonds.
- nucleic acid sequence may also include conservatively modified variants (e.g., degenerate codon substitutions) and complementary sequences thereof, as well as the explicitly indicated sequence. It is intended to include. Specifically, degenerate codon substitutions create sequences in which the third position of one or more selected (or all) codons is replaced with a mixed base and/or deoxyinosine residue.
- variants based on specific wild-type sequences include known variants (e.g., rh10, DJ, DJ/8, PHP .eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, Anc80, etc.), as well as at least 70% of the original sequence. , at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% sequence identity. It will be done.
- the term "gene” refers to a nucleic acid portion that performs a certain biological function.
- This biological function can include encoding a polypeptide or protein, encoding a protein-non-coding functional RNA (rRNA, tRNA, microRNA (miRNA), lncRNA, etc.), or encoding a polypeptide, protein or protein-coding function.
- rRNA protein-non-coding functional RNA
- miRNA microRNA
- lncRNA lncRNA
- a gene herein includes transcriptional and translational control elements such as promoters, terminators, enhancers, insulators, silencers, origins of replication, and internal ribosome entry sites. sequence, and the nucleic acid portions required for packaging into virus particles.
- gene product may refer to a polypeptide, protein, or non-protein-encoding functional RNA encoded by a gene.
- two genes being in cis refers to the presence of those genes on the same nucleic acid molecule or on a complementary strand (in the case of a double-stranded nucleic acid) nucleic acid molecule.
- two genes being in trans means that in a certain cell (in a certain organism) these genes are located on the same nucleic acid molecule or on a complementary strand (in the case of a double-stranded nucleic acid) nucleic acid molecule.
- a gene present on the genome and a gene on a nucleic acid introduced with a virus-derived construct can be in trans.
- whether two genes are in trans can be determined based on the state at which the two genes are simultaneously present in the cell (eg, upon introduction of the nucleic acid into the cell).
- one gene refers to a gene that has a continuous sequence in a form that normally (highest frequency or probability of 50% or more) exists on the genome of a certain organism.
- two exons encoding a protein can be two genes.
- the nucleic acid portion containing the promoter sequence and the protein-encoding sequence can be one gene.
- the nucleic acid sequence need not be a continuous sequence; for example, multiple exons encoding a protein are collectively referred to as the gene for that protein.
- nucleic acid does not contain the gene or does not exhibit the normal function of the gene (e.g., the ability to produce a functional protein). This refers to containing modified genes.
- operably linked refers to transcriptional and translational regulatory sequences (e.g., promoters, enhancers, etc.) or translational regulatory sequences that have expression (operation) of the desired sequence. It means to be placed at the bottom.
- a promoter to be operably linked to a gene, it is typically placed immediately upstream of the gene, but does not necessarily need to be placed adjacent to it.
- transcription and translation regulatory sequences collectively refer to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, enhancers, IRES, etc., which cooperate to Enables replication, transcription and translation of coding sequences in human cells. Not all of these transcriptional-translational control sequences necessarily need to be present, so long as replication, transcription, and translation of the selected coding sequence is possible in the appropriate host cell. Those skilled in the art can readily identify regulatory nucleic acid sequences from public information. Furthermore, those skilled in the art will be able to identify transcriptional translational control sequences that are applicable to the intended use, eg in vivo, ex vivo or in vitro.
- promoter refers to a segment of a nucleic acid sequence that controls transcription of an operably linked nucleic acid sequence.
- a promoter contains specific sequences that are sufficient for recognition, binding, and initiation of transcription by RNA polymerase.
- a promoter may contain sequences that regulate RNA polymerase recognition, binding, or transcription initiation.
- nucleic acid sequence refers to a segment of a nucleic acid sequence that has the function of increasing the efficiency of expression of a gene of interest.
- silica refers to a segment of a nucleic acid sequence that has the function of reducing the expression efficiency of a gene of interest, contrary to an enhancer.
- insulator refers to a segment of a nucleic acid sequence that has a cis-regulatory function that regulates the expression of genes located at distant positions on a DNA sequence.
- terminal refers to a segment of a nucleic acid sequence located downstream of a protein-encoding region and responsible for terminating transcription when a nucleic acid is transcribed into mRNA.
- an "origin of replication” refers to a DNA double helix partially formed by binding of a protein that recognizes the nucleic acid sequence (e.g., initiator DnaA protein, etc.) or by synthesis of RNA. refers to a segment of a nucleic acid sequence that is unwound and replication begins.
- an internal ribosome entry site refers to a nucleic acid segment that facilitates ribosome entry or retention during translation of a nucleic acid sequence downstream thereof.
- homology of nucleic acids refers to the degree of identity between two or more nucleic acid sequences, and generally “having homology” refers to a high degree of identity or similarity. say. Therefore, the higher the homology between two nucleic acids, the higher the identity or similarity of their sequences.
- two types of nucleic acids have homology can be determined by direct sequence comparison or by hybridization methods under stringent conditions. When directly comparing two nucleic acid sequences, typically there is at least 50% identity, preferably at least 70% identity, more preferably at least 80%, 90%, 95% identity between the nucleic acid sequences. , 96%, 97%, 98% or 99% identical, then the genes have homology.
- Amino acids may be referred to herein by either their commonly known three-letter symbol or the one-letter symbol recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by their commonly recognized one-letter codes.
- comparisons of similarity, identity, and homology of amino acid and base sequences are calculated using default parameters using BLAST, a sequence analysis tool. Identity searches can be performed using, for example, NCBI's BLAST 2.10.1+ (published June 18, 2020). The identity value in this specification usually refers to the value obtained when alignment is performed using the above-mentioned BLAST under default conditions. However, if a higher value is obtained by changing the parameters, the highest value is taken as the identity value. When identity is evaluated in multiple areas, the highest value among them is taken as the identity value. Similarity is a value that takes into account similar amino acids in addition to identity.
- references to a biological material refer to a biological function similar to, if not to the same extent as, the biological material's biological function. It is understood that it is also a reference to variants of the biological substance (eg, variants with modifications in the amino acid sequence) that exhibit a good effect on the biological substance. Such variants include fragments of the original molecule, spanning amino acid or nucleic acid sequences of the original biological material of the same size, or fragments of the original that are aligned by alignment by computer homology programs known in the art.
- Variants can include molecules with modified amino acids (e.g., modified by disulfide bond formation, glycosylation, lipidation, acetylation, or phosphorylation) or modified nucleotides (e.g., modified by methylation).
- modified amino acids e.g., modified by disulfide bond formation, glycosylation, lipidation, acetylation, or phosphorylation
- modified nucleotides e.g., modified by methylation
- stringent conditions refer to well-known conditions commonly used in the field. As the stringent conditions, for example, the following conditions can be adopted. (1) using low ionic strength and high temperature for washing (e.g., 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50 °C); (2) during hybridization.
- a denaturing agent such as formamide (e.g., 50% (v/v) formamide and 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 at 42 °C; and 750mM sodium chloride, 75mM sodium citrate), or (3) 20% formamide, 5x SSC, 50mM sodium phosphate (pH 7.6), 5x Denhard's solution, 10% dextran sulfate, and 20mg/ml denaturation. Incubate overnight at 37 °C in a solution containing sheared salmon sperm DNA, then wash the filter with 1x SSC at approximately 37-50 °C.
- formamide e.g. 50% (v/v) formamide and 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 at 42 °C; and 750mM sodium chloride, 75
- the formamide concentration may be 50% or more. Wash times may be 5, 15, 30, 60, or 120 minutes or longer. There are multiple factors that can affect the stringency of hybridization reactions, such as temperature and salt concentration.For details, refer to Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995). . Examples of "highly stringent conditions" are 0.0015M sodium chloride, 0.0015M sodium citrate, 65-68°C, or 0.015M sodium chloride, 0.0015M sodium citrate, and 50% formamide, 42 It is °C.
- sequences that hybridize under stringent conditions preferably include sequences containing only the A sequence or only the T sequence.
- Moderate stringency conditions can be readily determined by those skilled in the art based on the length of the DNA, for example, and are described by Sambrook et al., Molecular Cloning: A Laboratory Manual, No. 3, Vol.
- polypeptides as used in this disclosure include those encoded by nucleic acid molecules that hybridize under highly or moderately stringent conditions to nucleic acid molecules encoding the polypeptides specifically described in this disclosure. Also included are polypeptides.
- a "corresponding" amino acid or nucleic acid has or has a similar effect in a certain polypeptide molecule or polynucleotide molecule as a given amino acid or nucleotide in a polypeptide or polynucleotide that serves as a reference for comparison.
- an antisense molecule it can be a similar portion in an ortholog that corresponds to a particular portion of the antisense molecule.
- Corresponding amino acids can be identified, for example, by cysteination, glutathionylation, SS bond formation, oxidation (e.g., oxidation of methionine side chains), formylation, acetylation, phosphorylation, glycosylation, myristylation, etc. amino acids.
- the corresponding amino acid may be an amino acid responsible for dimerization.
- Such "corresponding" amino acids or nucleic acids may be a range of regions or domains. In such cases, therefore, the regions or domains are referred to herein as "corresponding" regions or domains.
- a "corresponding" gene e.g., a polynucleotide sequence or molecule
- a gene e.g, a polynucleotide sequence or molecule
- a gene corresponding to a given gene may be an ortholog of that gene.
- a serotype 1 AAV cap may correspond to a serotype 2 AAV cap.
- a corresponding gene in a certain virus can be found by searching a sequence database for that virus using the gene sequence of the virus as a reference for the corresponding gene as a query sequence.
- the term "activity" herein refers to the function of a molecule in the broadest sense.
- Activity generally includes, but is not intended to be limiting, a biological, biochemical, physical, or chemical function of the molecule.
- Activity includes, for example, enzymatic activity, the ability to interact with other molecules, and the ability to activate, promote, stabilize, inhibit, suppress, or destabilize the function of other molecules. stability, and the ability to localize to specific subcellular locations. Where applicable, the term also relates to the function of protein complexes in the broadest sense.
- biological function refers to a specific function that the gene, nucleic acid molecule, or polypeptide may have in a living body when referring to a certain gene or a nucleic acid molecule or polypeptide related thereto. Examples include, but are not limited to, specific cell surface structure recognition ability, enzymatic activity, and ability to bind to specific proteins. In the present disclosure, examples include, but are not limited to, functions that a certain promoter is recognized in a specific host cell.
- biological function may be exerted by “biological activity.”
- biological activity refers to the activity that a certain factor (e.g., polynucleotide, protein, etc.) may have in vivo, and it exhibits various functions (e.g., transcriptional promotion activity). For example, activities in which interaction with one molecule activates or inactivates another molecule are also included. For example, if a factor is an enzyme, its biological activity includes its enzymatic activity. Another example is where an agent is a ligand, including binding of that ligand to a corresponding receptor. Such biological activity can be measured by techniques well known in the art.
- activity refers to or reveals a binding (either direct or indirect) that affects a response (i.e., has a measurable effect in response to some exposure or stimulus); refers to a variety of measurable indicators, including, for example, the amount of upstream or downstream proteins or other similar measures of function in a host cell.
- infectious virus or virus-derived construct refers to the ability of the virus or virus-derived construct to introduce the nucleic acid within the virus or virus-derived construct into a cell by attachment to or membrane fusion of the virus or virus-derived construct. refers to The "replication capacity" of a virus or virus-derived construct refers to its ability to produce infectious virus particles or virus-derived construct particles within infected cells.
- transformation As used herein, the terms “transformation,” “transduction,” and “transfection” are used interchangeably, unless otherwise stated, and refer to the introduction of a nucleic acid (as appropriate by a virus or virus) into a host cell. derived construct).
- any method that introduces a nucleic acid into a host cell can be used, such as using competent cells, electroporation, a method using a particle gun (gene gun), and a calcium phosphate method.
- particle gun gene gun
- calcium phosphate method Various well-known techniques such as
- a purified substance or biological factor refers to one in which at least a portion of the factors naturally associated with the biological factor have been removed. Therefore, the purity of the biological agent in a purified biological agent is typically higher (ie, more concentrated) than the state in which the biological agent normally exists.
- the term "purified” as used herein preferably means at least 75%, more preferably at least 85%, even more preferably at least 95%, and most preferably at least 98% by weight. It means that the same type of biological agent is present.
- the materials used in this disclosure are preferably "purified" materials.
- the term "medicinal ingredient” refers to any ingredient that can constitute a medicine, such as active ingredients (those that exhibit medicinal efficacy by themselves), additive ingredients (which are not expected to have medicinal efficacy by themselves), Examples include ingredients that are expected to play a certain role (for example, excipients, lubricants, surfactants, etc.) when included as a medicine.
- the pharmaceutical component may be a single substance or a combination of multiple substances or agents. Any combinations such as combinations of active ingredients and additive ingredients, combinations of adjuvants and active ingredients, etc. may also be included.
- active ingredient refers to an ingredient that exerts the intended medicinal effect, and may be a single ingredient or a plurality of ingredients.
- additional component refers to any component that is not expected to have medicinal efficacy but plays a certain role when included as a medicine, such as a pharmaceutically acceptable carrier, a stabilizer, Examples include auxiliary agents, solubility improvers, solubilizers, diluents, excipients, buffers, binders, diluents, flavorings, and lubricants.
- drug drug
- agent agent
- factor factor
- any term can be used as long as it can achieve the intended purpose. It may also be a substance or other element (eg, light, radioactivity, heat, energy such as electricity).
- Such substances include, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (including, for example, DNA such as cDNA and genomic DNA, and RNA such as mRNA), Saccharides, oligosaccharides, lipids, organic small molecules (e.g., hormones, ligands, information transmitters, organic small molecules, molecules synthesized by combinatorial chemistry, small molecules that can be used as pharmaceuticals (e.g., small molecule ligands, etc.)) , composite molecules thereof, and mixtures thereof.
- proteins proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (including, for example, DNA such as cDNA and genomic DNA, and RNA such as mRNA), Saccharides, oligosaccharides,
- conjugate or “complex molecule” refers to any construct that includes two or more moieties.
- the other part may be a polypeptide or another substance (e.g., a substrate, a sugar, a lipid, a nucleic acid, another hydrocarbon, etc.). You can.
- two or more parts constituting a complex may be bonded by a covalent bond or by other bonds (e.g., hydrogen bond, ionic bond, hydrophobic interaction, van der Waals force, etc.) may have been done.
- label refers to the presence (eg, substance, energy, electromagnetic waves, etc.) for distinguishing a target molecule or substance from others.
- labeling methods include the RI (radioisotope) method, the fluorescence method, the biotin method, and the chemiluminescence method.
- RI radioisotope
- fluorescence method the fluorescence method
- biotin method the chemiluminescence method.
- chemiluminescence method When a plurality of target proteins or factors or means for capturing them are labeled by a fluorescence method, they are labeled with fluorescent substances having mutually different maximum fluorescence emission wavelengths. The difference in maximum fluorescence emission wavelength is preferably 10 nm or more.
- Fluorescent materials include Alexa TM Fluor, although any label that does not affect function can be used.
- Alexa TM Fluor is a water-soluble fluorescent dye obtained by modifying coumarin, rhodamine, fluorescein, cyanine, etc., and is a series that supports a wide range of fluorescence wavelengths, and has a very low fluorescence compared to other fluorescent dyes with corresponding wavelengths. It is stable, bright and has low pH sensitivity.
- Examples of the combination of fluorescent dyes having a maximum fluorescence wavelength of 10 nm or more include a combination of Alexa TM 555 and Alexa TM 633, a combination of Alexa TM 488 and Alexa TM 555, and the like.
- Other fluorescent labels include cyanine dyes (eg, Cy3, Cy5, etc.
- such labels can be utilized to modify the target so that it can be detected by the detection means used. Such modifications are known in the art, and those skilled in the art can implement such methods as appropriate depending on the label and the intended target.
- kits refers to a unit in which parts to be provided (eg, virus-derived constructs, instructions, etc.) are provided, usually divided into two or more compartments.
- This kit format is preferable when the purpose is to provide a composition that should not be provided mixed for reasons of stability etc., but is preferably mixed immediately before use.
- kits preferably include instructions or instructions describing how to use the parts provided or how to treat the reagents.
- the kit When the kit is used as a reagent kit herein, the kit usually includes instructions describing how to use the virus-derived construct, etc.
- instructions describe instructions for a physician or other user on how to use the present disclosure.
- This instruction sheet contains words instructing the administration of the medicament of the present disclosure. Additionally, the instructions may include language instructing the dosage form.
- This instruction is prepared in accordance with the format prescribed by the regulatory authority of the country where the disclosure will be made (e.g., the Ministry of Health, Labor and Welfare in Japan, the Food and Drug Administration (FDA) in the United States, etc.), and approved by that regulatory authority. It will be clearly stated that it was received.
- the instruction sheet is a so-called package insert, and is usually provided in a paper medium, but is not limited to this, and may be provided in the form of an electronic medium (e.g., a home page provided on the Internet, e-mail), etc. can also be provided.
- the present disclosure provides methods for making various virus-derived construct plasmids from a starting plasmid (eg, a virus-derived construct plasmid of the present disclosure).
- the method of making a virus-derived construct plasmid of the present disclosure comprises providing a set of starting plasmids containing at least a portion of the nucleic acid sequences necessary to construct the virus-derived construct, comprising: the set of starting plasmids comprises a set of corresponding surrogate unit nucleic acids, the set of corresponding surrogate unit nucleic acids comprising at least one set of corresponding surrogate unit nucleic acids comprising a different nucleic acid sequence; A step of preparing a mixed solution containing the cleaved surrogate unit nucleic acid fragment by treatment with a restriction enzyme, a step of ligating the cleaved surrogate unit nucleic acid fragment to form an integrated nucleic acid, and
- the unit nucleic acid fragments generated by restriction enzyme treatment of the starting plasmid have approximately equimolar moles, and the transformed organism can be efficiently transformed without the need for complicated adjustment of the number of moles of unit nucleic acid fragments. It is possible to create integrated nucleic acids that can be taken up. Additionally, by including a set of corresponding surrogate unit nucleic acids with different nucleic acid sequences in the set of starting plasmids, the surrogate unit nucleic acids that are incorporated into a particular position of the product plasmid are randomly selected from among the set of corresponding surrogate unit nucleic acids.
- the set of corresponding surrogate unit nucleic acids comprises a plurality of sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences, and 16 or more, 27 or more. 32 or more, 64 or more, 81 or more, 128 or more, 243 or more, 256 or more, 512 or more, 729 or more, 1024 or more, or more different parallel alternative unit nucleic acids possible.
- the method of generating virus-derived construct plasmids of the present disclosure generates a collection of virus-derived construct plasmids.
- at least one of the set of starting plasmids comprises a transcription initiation sequence that is operative in an animal cell, and comprises a transcription initiation sequence that is operative in an animal cell.
- a virus-derived construct plasmid is created.
- the methods of making virus-derived construct plasmids of the present disclosure use three or more starting plasmids.
- the set of corresponding surrogate unit nucleic acids comprises at least two sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences.
- a virus-derived construct plasmid produced by the method of producing a virus-derived construct plasmid of the present disclosure can be used as a starting plasmid to be subjected to the next round of the method of producing a virus-derived construct plasmid of the present disclosure.
- the method for producing a virus-derived construct plasmid of the present disclosure further includes the step of selecting a virus-derived construct plasmid excellent in a desired function from a collection of virus-derived construct plasmids formed.
- desired functions that serve as selection criteria include the amount of virus-derived constructs produced per plasmid, the amount of virus-derived constructs produced per producer cell, and the amount of impurities generated when producing virus-derived constructs from plasmids. , the purity of the target virus-derived construct when producing the virus-derived construct from the plasmid, etc.
- Impurities include outer shell protein that does not contain a nucleic acid sequence, outer shell protein that contains an incomplete nucleic acid sequence, incomplete outer shell protein, incomplete nucleic acid sequence, and self-replication ability (genetic recombination during the production process). (containing a wild-type virus-like nucleic acid sequence generated by a virus), etc. (virus-derived constructs that have a structure different from the complete nucleic acid or protein assumed from the nucleic acid sequence of the plasmid, such as introduction of mutations and cleavages) may be considered incomplete).
- the method of making a virus-derived construct plasmid of the present disclosure may include adding a barcode nucleic acid during the step of ligating to form an integrated nucleic acid, so that the Differentiation of virus-derived construct plasmids may be facilitated.
- the method of producing a virus-derived construct plasmid of the present disclosure can be performed to improve the partial structure of a virus-derived construct plasmid.
- this is a virus-derived construct plasmid comprising a combination of parallel alternative unit nucleic acids of the virus-derived construct plasmid selected in the above step of selecting a virus-derived construct plasmid superior in the desired function. It can be carried out by preparing.
- virus-derived construct plasmid superior in a desired function the combination of elements on that plasmid may be considered favorable for the desired function, so information on the nucleic acid sequence of the plasmid or the resulting amino acid
- a structure similar to this combination of elements may be constructed on another plasmid with reference to sequence information, or a specific region may be excised from that plasmid and transferred to another plasmid.
- the methods of making virus-derived construct plasmids of the present disclosure can be carried out to do so.
- the elements for examining structural variations include (A) a nucleic acid sequence containing a terminal repeat sequence, (B) a nucleic acid sequence encoding a packaging factor, (C) a nucleic acid sequence encoding a structural protein, (D) a nucleic acid sequence encoding a functional cofactor, (E) a nucleic acid sequence encoding a promoter, (F) a nucleic acid sequence encoding a desired gene, and (G) a host.
- Examples include nucleic acid sequences involved in cell biosynthesis.
- variants of different serotypes, variants, different promoters that function in the same host cell, etc.
- the desired This may facilitate the design of virus-derived construct plasmids with excellent functions.
- those skilled in the art can appropriately determine the elements to be included in the alternative unit nucleic acid. For example, when considering an appropriate combination of a promoter and a desired gene, a set of corresponding alternative unit nucleic acids containing different promoter sequences is prepared, and a set of corresponding alternative unit nucleic acids containing different desired gene sequences is prepared as an adjacent alternative unit nucleic acid.
- a set of corresponding surrogate unit nucleic acids can be prepared to carry out the methods of making virus-derived construct plasmids of the present disclosure. Thereafter, multiple combinations of promoters and desired genes with relatively excellent performance are selected, and a set of corresponding alternative unit nucleic acids is prepared as unit nucleic acids containing combinations of these promoters and desired genes at the same time. , in combination with a corresponding set of alternative unit nucleic acids containing different ITR sequences, and by implementing the method of making virus-derived construct plasmids of the present disclosure, suitable combinations of promoters, desired genes and ITRs can be explored. can.
- the set of corresponding surrogate unit nucleic acids comprises a set of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences encoding a desired gene, and a promoter. It comprises a set of corresponding alternative unit nucleic acids upstream thereof containing different encoding nucleic acid sequences.
- the present disclosure provides a method of making an adeno-associated virus-derived construct plasmid in Bacillus subtilis, a method of making a virus-derived construct plasmid of the present disclosure, a virus-derived construct plasmid produced by such a method, and a method of making an adeno-associated virus-derived construct plasmid in Bacillus subtilis.
- the virus-derived construct plasmids and/or libraries thereof of the present disclosure may be generated by the OGAB method.
- the OGAB (Ordered Gene Assembly in Bacillus subtilis) method is a method for producing a circular plasmid in a transformed organism by incorporating an integrated nucleic acid into the organism. With the OGAB method, plasmids containing large-sized nucleic acids can be easily prepared.
- the unit nucleic acids used to prepare the assembled nucleic acids may be prepared as unit vectors (mainly for the construction of new plasmids), as described in detail below, or by cutting the constructed plasmids. May be prepared. Below, the procedure for producing an integrated nucleic acid for incorporation into a transformed organism will be explained.
- Unit nucleic acids can be produced by any known method, for example, by polymerase chain reaction (PCR) or chemical synthesis.
- a unit nucleic acid is a sequence or part thereof encoding a desired protein (therapeutic protein, protein constituting a virus-derived construct, etc.), a sequence controlling a gene (promoter, enhancer, etc.), a sequence for manipulating the nucleic acid (restriction enzyme recognition sequences, etc.).
- each unit nucleic acid can be configured to produce a specific protruding sequence so that multiple types of unit nucleic acids are arranged in a specific order and/or characteristic direction when incorporated into an integrated nucleic acid. Since a large number of unit nucleic acids can ultimately be assembled on a plasmid, one or more unit nucleic acids may be designed to encode one or more genes with a long base length. Examples of genes with long base lengths include a group of genes that constitute a series of metabolic pathways.
- a unit vector can be prepared by ligating a unit nucleic acid and an additional nucleic acid different from the unit nucleic acid.
- the use of unit vectors may allow for easier handling of unit nucleic acids.
- the additional nucleic acid may be a linear nucleic acid or a circular plasmid.
- the unit vector can also have a circular structure, and therefore can be used, for example, to transform E. coli.
- the additional nucleic acid may include an origin of replication such that the unit vector is replicated in the host into which it is introduced.
- all unit nucleic acids for constructing a given aggregate nucleic acid may be ligated to the same type of additional nucleic acid, thereby reducing size differences between unit vectors and combining multiple types of units. Vector handling may be easier.
- a unit nucleic acid for constructing an integrated nucleic acid may be linked to different types of additional nucleic acids.
- the ratio (base length of unit nucleic acid)/(base length of unit vector) or its average is 50% or less, 40% or less. % or less, 30% or less, 20% or less, 15% or less, 10% or less, 7% or less, 5% or less, 2% or less, 1.5% or less, 1% or less, or 0.5% or less.
- the larger the size of the additional nucleic acid than the unit nucleic acid may allow for more uniform handling of different types of unit vectors.
- the unit nucleic acid and the additional nucleic acid can be linked by any method such as ligation using DNA ligase or TA cloning method.
- the ratio (base length of unit nucleic acid)/(base length of unit vector) or its average is 1% or more, 0 It may be .3% or more, 0.1% or more, 0.03% or more, 0.01% or more, 0.003% or more, or 0.001% or more, which may facilitate manipulation of the unit vector.
- the length of the unit nucleic acid is 10 bp or more, 20 bp or more, 50 bp or more, 70 bp or more, 100 bp or more, 200 bp or more, 500 bp or more, 700 bp or more, 1000 bp or more, or 1500 bp or more, and 5000 bp or less, 5000 bp or less, It can be 2000 bp or less, 1500 bp or less, 1200 bp or less, 1000 bp or less, 700 bp or less or 500 bp or less.
- the accumulated nucleic acids include 2 or more types, 4 or more types, 6 or more types, 8 or more types, 10 or more types, 15 or more types, 20 or more types, 30 or more types, 40 or more types, 50 or more types, 60 or more, 70 or more, 80 or more, 90 or more, or 100 or more, and 1000 or less, 700 or less, 500 or less, 200 or less, 120 or less, 100 or less, 80 or less, 70 It can be constructed from up to 60 types, up to 70 types, or up to 50 types of unit nucleic acids. By adjusting the number of moles of each unit nucleic acid (or unit vector) to be approximately the same, a desired integrated nucleic acid having a tandem repeat structure can be efficiently produced.
- the unit nucleic acids may have a base length that is approximately equal to the number of unit nucleic acids that divide one set of repeat sequences in the integrated nucleic acid. By doing so, it may become easier to adjust the number of moles of each unit nucleic acid (or unit vector). In one embodiment, the unit nucleic acids are 30% or less, 25% or less, 20% or less, 15% or less, 10% or less of the base length obtained by dividing one set of repetitive sequences in the integrated nucleic acid approximately equally by the number of unit nucleic acids. , may have an increased or decreased base length of no more than 7% or no more than 5%.
- the unit nucleic acid can be designed to have a non-palindromic sequence (a non-palindromic sequence) at the end of the unit nucleic acid.
- a non-palindromic sequence a non-palindromic sequence
- the non-palindromic sequence of the unit nucleic acid designed in this way is made into a protruding sequence, a structure in which the unit nucleic acids are linked to each other while maintaining the order in the integrated nucleic acid can be easily provided.
- An integrated nucleic acid can be constructed by linking unit nucleic acids to each other. When a plurality of unit nucleic acids exist on the same starting plasmid, unit nucleic acid fragments are produced by cleaving this starting plasmid, and integrated nucleic acids can be constructed by ligating these unit nucleic acid fragments together.
- a unit nucleic acid can be prepared by cutting out a unit vector using a restriction enzyme or the like.
- the integrated nucleic acid can include one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more sets of repetitive sequences. .
- the repetitive sequences in the assembly nucleic acid can include the sequence of the unit nucleic acid and, optionally, the sequence of the assembly vector nucleic acid.
- the integrated nucleic acid may have a sequence that allows the nucleic acid to replicate in a transformed organism.
- a sequence that enables replication of a nucleic acid in a transformed organism may include an effective origin of replication in the transformed organism (eg, Bacillus subtilis).
- the sequence of the replication origin effective in Bacillus subtilis is not particularly limited, but for example, pTB19 (Imanaka, T., et al. J.Gen.Microbioi. 130, 1399) has a ⁇ -type replication mechanism.
- the integrated nucleic acid may include additional base sequences as necessary.
- the integrated nucleic acid may include base sequences that control transcription and translation, such as promoters, operators, activators, and terminators.
- the promoter when using Bacillus subtilis as a host is Pspac (Yansura, D. and Henner, D.J. Pro. Natl. Acad. Sci, USA 81), whose expression can be controlled by IPTG (isopropyl s-D-thiogalactopyranoside). 439-443. (1984.)), or the Pr promoter (Itaya, M. Biosci. Biotechnol. Biochem. 63, 602-604. (1999)).
- a unit nucleic acid can form a repeating structure that maintains a fixed order and orientation in an integrated nucleic acid.
- unit nucleic acids are constructed such that the base sequences of the overhanging ends of unit nucleic acids cut out from unit vectors are complementary to each other, thereby creating a repeating structure that maintains a fixed order and orientation in the assembled nucleic acids. formation may be possible.
- the overhang may have a nonbatch sequence and may be either a 5' overhang or a 3' overhang.
- a unit nucleic acid having an overhanging end can be excised from a unit vector using a restriction enzyme.
- the unit vector may have one or more restriction enzyme recognition sequences.
- each restriction enzyme recognition sequence may be recognized by the same restriction enzyme or different restriction enzymes.
- a unit vector may contain a pair of regions recognized by the same restriction enzyme such that a complete unit nucleic acid region is contained between these regions.
- Restriction enzymes used include, but are not particularly limited to, type II restriction enzymes, such as AarI, BbsI, BbvI, BcoDI, BfuAI, BsaI, BsaXI, BsmAI, BsmBI, BsmFI, BspMI, BspQI, BtgZI, FokI, SfaNI, etc.
- type II restriction enzymes such as AarI, BbsI, BbvI, BcoDI, BfuAI, BsaI, BsaXI, BsmAI, BsmBI, BsmFI, BspMI, BspQI, BtgZI, FokI, SfaNI, etc.
- Type IIS restriction enzymes can be used and these restriction enzymes can be capable of creating overhanging ends at a distance from the recognition sequence outside of the recognition sequence.
- the unit vector does not include a region recognized by the Type IIS restriction enzyme in the unit nucleic acid region.
- the unit vector may contain the region recognized by the restriction enzyme at the end of the unit nucleic acid region.
- the restriction enzyme treatment when using the same type of restriction enzyme to cut out unit nucleic acids from multiple unit vectors, the restriction enzyme treatment can be performed in a solution containing the multiple unit vectors, increasing the efficiency of the work. It can be improved.
- the types of restriction enzymes used to produce a certain integrated nucleic acid can be, for example, 5 or less, 4 or less, 3 or less, 2 or less, or 1. , the variation in molar numbers between unit nucleic acids can be reduced.
- a unit nucleic acid excised from a unit vector can be easily purified by any known fractionation method such as agarose gel electrophoresis.
- the unit nucleic acids and, if necessary, the integrated vector nucleic acids can be ligated to each other using DNA ligase or the like. Thereby, integrated nucleic acids can be produced.
- the ligation of a unit nucleic acid and optionally an assembly vector nucleic acid can be performed in the presence of components such as polyethylene glycol (e.g., PEG2000, PEG4000, PEG6000, PEG8000, etc.) and salts (e.g., monovalent alkali metals, sodium chloride, etc.). It can be carried out below.
- the concentration of each unit nucleic acid in the ligation reaction solution is not particularly limited, and may be 1 fmol/ ⁇ l or more.
- the ligation reaction temperature and time are not particularly limited, and may be 37° C. for 30 minutes or more.
- the composition comprising the unit nucleic acids and optionally the integrating vector nucleic acids may be subjected to any conditions that inactivate the restriction enzymes. Good (e.g. phenol/chloroform treatment).
- the unit nucleic acids can be adjusted to approximately the same number of moles using the method described in WO2015/111248.
- the (parallel) unit nucleic acid fragments produced by cleaving this starting plasmid are naturally adjusted to the same molar number.
- the total moles of sets of (parallel) alternative unit nucleic acids produced by mixing and cutting multiple starting plasmids are also naturally adjusted to be the same.
- By adjusting the number of moles of unit nucleic acids to be approximately the same a desired integrated nucleic acid having a tandem repeat structure can be efficiently produced.
- the concentration of the unit vector or unit nucleic acid the number of moles of the unit nucleic acid can be adjusted.
- Plasmids can be formed in the transformed organism by contacting the accumulated nucleic acid with the transformed organism.
- the transformed organism includes bacteria of the genus Bacillus, bacteria of the genus Streptococcus, bacteria of the genus Haemophilus, bacteria of the genus Neisseria, and the like.
- Bacillus bacteria include B. subtilis, B. subtilis. megaterium, B. stearothermophilus (moderate hyperthermia bacteria) and the like.
- the transformed organism is Bacillus subtilis.
- the transformed organism into which the integrated nucleic acid is taken up is competent and capable of actively taking up the nucleic acid.
- Competent refers to a state in which a cell has become more permeable to exogenous substances (eg, nucleic acids).
- Bacillus subtilis in a competent state cleaves a double-stranded nucleic acid as a substrate on the cell, degrades one of the two strands from this cleavage point, and degrades the other single strand. Taken into the bacterial body. The imported single strand can be repaired into a circular double stranded nucleic acid within the bacterial body.
- any known method can be used to render the transformed organism competent, for example, Bacillus subtilis can be transformed using the method described in Anagnostopoulou, C. and Spizizen, J. J. Bacteriol., 81, 741-746 (1961). A method can be used to achieve a competent state. As the transformation method, any known method suitable for each transformed organism can be used.
- the disclosure provides a virus-derived construct plasmid.
- elements of virus-derived construct plasmids are described below, any element or combination of elements can be included in a substitute unit nucleic acid to carry out the methods of making virus-derived construct plasmids of the present disclosure.
- the elements of the virus-derived construct plasmid described below apply to both the starting plasmid and the product plasmid.
- the elements of the virus-derived construct plasmids described below also apply to the virus-derived construct plasmid libraries of the present disclosure.
- the present disclosure provides a plasmid operably linked to at least a portion of the nucleic acid sequences necessary to construct a virus-derived construct.
- the nucleic acid sequences necessary to construct the virus-derived construct include (A) a nucleic acid sequence comprising a terminal repeat sequence (e.g., derived from any of serotypes 1-12 or variants thereof); (B) a nucleic acid sequence encoding a packaging factor (which may be derived from, for example, rep, any of adeno-associated virus serotypes 1-12 or variants thereof); and (C) a nucleic acid sequence encoding a structural protein.
- the virus-derived construct plasmid of the present disclosure comprises two, three, or four of the nucleic acid sequences of (A)-(D).
- the nucleic acid sequences necessary to construct a virus are located in a cohesive region on a virus-derived construct plasmid.
- a virus-derived construct plasmid having such a structure can be formed by incorporating a nucleic acid fragment containing a nucleic acid sequence necessary for constructing a virus into an original plasmid.
- the nucleic acid sequences necessary to construct the virus comprise about 50% or less, about 40% or less, about 30% or less, about 25% or less, about 20% of the total base length of the virus-derived construct plasmid. present in a continuous region with a base length of about 15% or less, about 10% or less, or about 5% or less.
- elements other than the terminal repeats of the nucleic acid sequences necessary to construct the virus e.g., nucleic acid sequences encoding structural proteins of the virus, nucleic acid sequences encoding packaging factors, and functional cofactors
- each element of the nucleic acid sequence necessary to construct the virus may be arranged in any order and position, and various arrangements other than those specifically shown in the drawings etc. It is understood that the following can be used.
- a nucleic acid sequence described for a particular function such as a functional cofactor, contains multiple elements
- the order and position of each element in the virus-derived construct plasmid can be arbitrary, unless otherwise specified, but any element (e.g. VA, E2A, E4) may be arranged consecutively (without any other genes in between).
- genes or combinations of genes derived from viruses different from the source virus of the virus-derived construct plasmids such as adenoviruses, herpesviruses, papillomaviruses, bocaviruses and simian viruses, may be used.
- the functional cofactors include E1A, E1B, E2A, E4, and VA of adenoviruses, UL5, UL8, UL30, UL42, UL52, ICP0, ICP4, ICP8, and ICP22 of herpesviruses, and ICP22 of papillomaviruses.
- the nucleic acid sequence necessary to construct the virus includes two terminal repeat sequences of the virus, and the base length of the region sandwiched between the two terminal repeat sequences (excluding the terminal repeat sequence itself) is: It can be about 1 kb or more, about 5 kb or more, about 10 kb or more, about 20 kb or more, about 30 kb or more, about 40 kb or more, about 50 kb or more, about 70 kb or more, or about 100 kb or more.
- the nucleic acid sequences necessary to construct the virus include two terminal repeats and other parts of the virus, and the other parts are outside the region sandwiched between the two terminal repeats. be positioned.
- the virus-derived construct plasmid of the present disclosure includes a promoter, a desired gene, and a terminator from upstream between the 5'ITR and 3'ITR.
- the nucleic acid sequences encoding structural proteins of the virus may be variants of wild-type sequences (eg, adeno-associated virus serotypes 1-12).
- the virus-derived construct plasmids of the present disclosure optionally include a promoter upstream of the element.
- the virus-derived construct plasmid of the present disclosure may contain one of the nucleic acid sequences (B), (C), and (D) of the nucleic acid sequences necessary to construct the virus-derived construct or the genes contained therein. Alternatively, it may contain multiple upstream promoters.
- a virus-derived construct plasmid of the present disclosure may include one or more promoters upstream of one or more desired genes.
- the virus-derived construct plasmid of the present disclosure includes a drug selection marker nucleic acid sequence between any two of the nucleic acid sequences (A)-(D).
- the virus-derived construct plasmid of the present disclosure includes a drug selection marker nucleic acid sequence between any two genes encoded by the nucleic acid sequences (A) to (D).
- the set of surrogate unit nucleic acids encoding promoters comprises a set of corresponding surrogate unit nucleic acids encoding promoters of different types or orientations.
- the promoter includes a drug-responsive promoter.
- the virus-derived construct plasmids of the present disclosure are viral vectors, virus-like particles (VLPs), oncolytic viruses (including those modified to grow only in cancer cells), or viral replicons ( It is used to produce a self-replicable viral genome lacking the ability to produce virus particles.
- VLPs virus-like particles
- oncolytic viruses including those modified to grow only in cancer cells
- viral replicons It is used to produce a self-replicable viral genome lacking the ability to produce virus particles.
- the virus-derived construct plasmid of the present disclosure includes a nucleic acid sequence that promotes plasmid replication in a microbial host cell.
- the nucleic acid sequence that promotes plasmid replication in B. subtilis is an origin of replication that operates in B. subtilis, such as oriC, and pTB19 (Imanaka, T., et al. J. Gen. Microbioi. 130, 1399 -1408. (1984)), pLS32 (Tanaka, T. and Ogra, M. FEBS Lett. 422, 243-246. (1998)), pAM ⁇ 1 (Swinfield, T. J., et al. Gene 87, 79-90 (1990)).
- Nucleic acid sequences that promote plasmid replication in Bacillus subtilis include plasmids, parts thereof, origins of replication, or modified versions thereof, which are known to activate replication mechanisms such as rolling circle type, theta type, oriC, and phages. Can be mentioned.
- the nucleic acid sequence that promotes plasmid replication in Bacillus subtilis is a sequence that is identical or similar to a known origin of replication (e.g., 90% or more, 95% or more, 97% or more, 98% or more, 99% or more than 99.5% sequence identity).
- the nucleic acid sequences that promote plasmid replication in microbial host cells may be located within the contiguous region in which the nucleic acid sequences necessary to construct the virus are located, or may be located outside of this contiguous region. It's okay.
- the virus-derived construct plasmids of the present disclosure can be made or used in cells of organisms other than B. subtilis, so that they contain transcriptional translational control sequences, such as origins of replication, promoters, and transcription termination sequences, that operate in those organisms. may be included. Transcription and translation control sequences for each organism are known and can be appropriately selected by those skilled in the art.
- the virus-derived construct plasmids of the present disclosure can be made or replicated in E. coli, yeast, etc., and thus can contain transcriptional translational control sequences that operate in these microorganisms.
- the virus-derived construct plasmid of the present disclosure can be introduced into a producer cell and thus contain transcriptional translational regulatory sequences that are operative in the producer cell.
- the producer cell can be an animal cell
- the virus-derived construct plasmid of the present disclosure can contain transcriptional translational control sequences that operate in animal cells.
- the virus-derived construct plasmid of the present disclosure does not contain sequences for at least a portion of the genes of the entire genome of the virus.
- the virus-derived construct plasmids of the present disclosure include nucleic acid sequences involved in host cell biosynthesis.
- Nucleic acid sequences involved in host cell biosynthesis are nucleic acid sequences that include genes related to intracellular communication (metabolism, endoplasmic reticulum processing, etc.), anti-apoptosis, oxidative stress, and cell proliferation; Examples include V40 Large T antigen (SV40LTA), TAX, Kras, Myc, MIR17HG, BCL-2, BCL-XL, PDIA2, XBP1, HSPA5, PC (pyruvate carboxylase), PDK, HIF1A, NRF2, and CPSF6. .
- the virus-derived construct plasmid of the present disclosure contains the desired gene.
- the desired gene can be placed between two terminal repeat sequences.
- the desired gene in the virus-derived construct plasmid of the present disclosure may be ultimately included in the loaded nucleic acid of the virus-derived construct.
- Such a desired gene may encode a therapeutic protein, a gene for gene therapy, a gene for gene cell therapy such as CART therapy, It may encode a protein-non-coding functional RNA (rRNA, tRNA, microRNA (miRNA), lncRNA, etc.), or it may encode a promoter, terminator, insulator, enhancer, silencer, origin of replication, etc. in combination with or independently of these.
- the desired gene comprises a viral promoter (optionally upstream of the protein-coding gene), such as a cytomegalovirus promoter, CAG promoter, SV40 promoter, RSV promoter.
- the desired gene comprises an IRES (optionally upstream of the protein-coding gene).
- the desired gene is included in the virus-derived construct plasmid at the following positions, from upstream to promoter, desired gene, and terminator between the 5'LTR and 3'LTR. In one embodiment, more than one set of promoters, desired genes, and terminators are included in the virus-derived construct plasmid.
- the desired gene can be integrated into the chromosome of the subject to whom the virus-derived construct is administered.
- the desired gene may have the function of controlling the expression of a subject's naturally occurring gene, or may result in long-term protein expression.
- virus-derived constructs based on adeno-associated viruses, retroviruses, etc. can integrate into a subject's chromosome.
- the desired gene may be integrated into the therapeutic cell (eg, chromosome) (eg, via treatment of the cell with a virus-derived construct in vitro).
- the virus-derived construct plasmids of the present disclosure do not contain all of the genes necessary for the virus from which the virus-derived construct originates to propagate, so that the virus-derived construct produced is capable of propagation. It may be configured so that it is not provided.
- the desired gene in the virus-derived construct plasmid of the present disclosure may include multiple genes.
- the desired genes are 2 to 100, such as 2 or more, 3 or more, 4 or more, 5 or more, 7 or more, 10 or more, 12 or more, 15 or more, 20 or more, 25 or more, 30 or more, 40 or more, or 50 or more, and 100 or less, 90 or less, 80 or less, 70 or less, 60 or less, 50 or less, 40 or less, 35 or less, 30 or more, 25 or less, 20 or less, 17 or less, 15 or less, 12 or less, or 10 May include the following genes:
- the desired gene in the virus-derived construct plasmid of the present disclosure is about 0.1 to 1000 kbp, such as about 0.1 kbp or more, about 0.3 kbp or more, about 1 kbp or more, about 2 kbp or more, about 5 kbp or more, about 7 kbp or more, about 10 kbp or
- the virus-derived construct plasmids of the present disclosure can be constructed into complex structures containing multiple genes by the OGAB method, desired genes can also be constructed into complex structures. Since the size of the loaded nucleic acid can be limited depending on the type of virus-derived construct, the type of virus-derived construct may be selected depending on the size of the desired gene.
- the desired gene comprises a plurality of genes, such that the therapeutic gene ( Therapeutic protein coding sequences, gene therapy genes, gene cell therapy genes, etc.) enable the coordinated expression of a series of enzymes that control metabolic cascades. It may be possible to deliver to a subject a nucleic acid having a
- the proteins encoded by the desired genes in the virus-derived construct plasmids of the present disclosure include therapeutic polypeptides (e.g., replacement therapy), immunogenic polypeptides (e.g., pathogen polypeptides, cancer antigen polypeptide), etc.
- therapeutic polypeptides include cystic fibrosis transmembrane regulatory protein (CFTR), dystrophin (mini- and microdystrophin, myostatin propeptide, follistatin, activin type II soluble receptor, IGF-1, anti-inflammatory polypeptides).
- CFTR cystic fibrosis transmembrane regulatory protein
- dystrophin mini- and microdystrophin
- myostatin propeptide myostatin propeptide
- follistatin activin type II soluble receptor
- IGF-1 anti-inflammatory polypeptides
- sarcospan utrophin, miniutrophin, coagulation factors (e.g., factor VIII, factor IX, factor X, etc.), erythropoietin, angiostatin, endostatin, catalase, tyrosine hydroxylase, superoxide dismutase, leptin, LDL receptor body, lipoprotein lipase, ornithine transcarbamylase, ⁇ -globin, ⁇ -globin, spectrin, ⁇ 1-antitrypsin, adenosine deaminase, hypoxanthine guanine phosphoribosyltransferase, ⁇ -glucocerebrosidase, sphingomyelinase, lysosomal hexosa minidase A, branched-chain keto acid dehydrogenase, RP65 protein, cytokines (e.g., ⁇ -interferon, ⁇ -interfer
- somatotropin insulin, insulin-like growth factors 1 and 2, platelet-derived growth factor, epidermal growth factor, fibroblast growth factor, nerve growth factor, neurotrophic factor-3) and -4, brain-derived neurotrophic factor, bone morphogenetic protein, glial-derived growth factor, transforming growth factor- ⁇ and - ⁇ ), lysosomal acid ⁇ -glucosidase, ⁇ -galactosidase A, tumor necrosis growth factor ⁇ soluble receptor body, S100A1, parvalbumin, adenylyl cyclase type 6, anti-inflammatory factors, anti-myostatin protein, aspartoacylase, suicide gene products (e.g., thymidine kinase, cytosine deaminase, diphtheria toxin, tumor necrosis factor), tumor suppressor genes products (eg, p53, Rb, Wt-1), TRAIL, FAS-ligand, and the like.
- suicide gene products e.g.
- Pathogen polypeptides include cell surface proteins of pathogenic organisms such as bacteria, fungi, and parasites, and proteins expressed on the surface of viruses (eg, spike proteins, envelope proteins, capsid proteins, etc.).
- pathogen polypeptides include orthomyxovirus immunogens (e.g., influenza virus hemagglutinin (HA), nucleoprotein), lentivirus immunogens (e.g., HIV or SIV envelope GP160 protein, matrix/capsid protein, gag, pol, env gene products), arenavirus immunogens (e.g., Lassa fever virus nuclear capsid protein, envelope glycoprotein), poxvirus immunogens (e.g., vaccinia L1 or L8 gene products), flavivirus immunogens (e.g., yellow fever virus viruses or Japanese encephalitis virus immunogens), filovirus immunogens (e.g.
- orthomyxovirus immunogens e.g., influenza virus hemagglutinin (HA), nucle
- Ebola virus or Marburg virus immunogens such as NP and GP gene products
- bunyavirus immunogens e.g. RVFV, CCHF, SFS virus immunogens
- coronaviruses Immunogens e.g., human coronavirus immunogens such as human coronavirus envelope glycoprotein
- polio immunogens e.g., herpesvirus immunogens (e.g., CMV, EBV, HSV immunogens), mumps virus immunogens, measles virus immunogens,
- rubella virus immunogens diphtheria toxin or other diphtheria immunogens, pertussis antigens, and hepatitis (eg, hepatitis A, hepatitis B, hepatitis C, etc.) immunogens.
- Cancer antigen polypeptides include BRCA1 gene product, BRCA2 gene product, gp100, tyrosinase, GAGE-1/2, BAGE, RAGE, LAGE, NY-ESO-1, CDK-4, ⁇ -catenin, MUM-1, and caspase.
- the desired gene can be a gene for treating a particular disease (eg, a gene therapy gene).
- Genes to be selected for a specific disease can be appropriately selected by those skilled in the art. Examples of such diseases include infections caused by various pathogens, cystic fibrosis, hemophilia A, hemophilia B, thalassemia, anemia, Alzheimer's disease, multiple sclerosis, Parkinson's disease, Huntington's disease, and muscular atrophy.
- Lateral sclerosis, spinal muscular atrophy, epilepsy, cancer (melanoma, adenocarcinoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, colon cancer, leukemia, uterine cancer, breast cancer, prostate cancer) cancer, ovarian cancer, cervical cancer, bladder cancer, kidney cancer, pancreatic cancer, brain cancer, etc.), diabetes, muscular dystrophy, Gaucher disease, Hurler disease, adenosine deaminase deficiency, glycogen storage disease, congenital Emphysema, Lesch-Nyhan syndrome, Niemann-Pick disease, Tay-Sachs disease, Angelman syndrome, maple syrup urine disease, age-related macular degeneration, amaurosis, diabetic retinopathy, retinal degenerative disease, astrocytoma, glioblastoma , heart failure, peripheral artery disease, arthritis, joint disorder, intimal hyperplasia, AIDS, muscle wasting, kidney defici
- the present disclosure provides a virus-derived construct plasmid library that includes the virus-derived construct plasmids of the present disclosure.
- the present disclosure provides a virus-derived construct plasmid library comprising a virus-derived construct plasmid comprising three or more alternate unit nucleic acids as a series of parallel alternate unit nucleic acids, and wherein said virus-derived construct
- the product plasmid library comprises a plurality of sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences, and a parallel on each virus-derived construct plasmid of the plurality of sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences.
- a surrogate unit nucleic acid can have a length of about 10 kb or more.
- the set of corresponding surrogate unit nucleic acids in the virus-derived construct plasmid library comprises (A) a nucleic acid sequence comprising a terminal repeat sequence; (B) a nucleic acid sequence encoding a packaging factor; (D) a nucleic acid sequence encoding a structural protein; and (D) a nucleic acid sequence encoding a functional cofactor.
- each virus-derived construct plasmid in the virus-derived construct plasmid library comprises (A) a nucleic acid sequence comprising a terminal repeat sequence; (B) a nucleic acid sequence encoding a packaging factor; and (C) It includes a nucleic acid sequence encoding a structural protein and (D) a nucleic acid sequence encoding a functional cofactor.
- the set of corresponding surrogate unit nucleic acids in the virus-derived construct plasmid library comprises (A) a nucleic acid sequence encoding a desired gene located between terminal repeat sequences; (B) a packaging factor.
- a set of corresponding alternative unit nucleic acids comprising at least one different nucleic acid sequence of: (C) a nucleic acid sequence encoding a structural protein; and (D) a nucleic acid sequence encoding a functional cofactor; and a corresponding set of alternative unit nucleic acids upstream and adjacent thereof comprising different nucleic acid sequences encoding promoters.
- the plurality of sets of corresponding surrogate unit nucleic acids comprising different nucleic acid sequences in the virus-derived construct plasmid library include surrogate unit nucleic acids with a GC content of 75% or more.
- the set of corresponding surrogate unit nucleic acids of the virus-derived construct plasmid library comprises multiple sets of corresponding surrogate unit nucleic acids that allow for 64 or more different parallel surrogate unit nucleic acid combinations.
- each virus-derived construct plasmid contains the same number of parallel alternative unit nucleic acids.
- each virus-derived construct plasmid includes a barcode nucleic acid sequence.
- each plasmid in the library may have the same sequence and order of the gene portions.
- each plasmid in the library may have in common the structural feature of having a recognition sequence for a type II restriction enzyme at a specific location (eg, upstream or downstream of a given gene).
- each plasmid in the library has the structural characteristic of having a type II restriction enzyme recognition sequence and the same sequence between the recognition sequences at a specific location (e.g., upstream or downstream of a given gene).
- the plasmid contains a recognition sequence for a type II restriction enzyme, since in the CombiOGAB method it can be operationally efficient to use the same restriction enzyme to generate different cut ends.
- the library comprises or consists of plasmids having common parts and parts that differ in combination. "Different in combination” means that the same elements of the combination are found on different plasmids in the library, but the same combination of elements is not found on different plasmids in the library. , refers to a combination of elements.
- a "common portion" may include sequences that are found in all plasmids in the library.
- promoter library is Promoter 1 + Gene A + Promoter 3 + Gene B Promoter 2 + Gene A + Promoter 3 + Gene B Promoter 1 + Gene A + Promoter 4 + Gene B Promoter 2 + Gene A + Promoter 4 + Gene B
- the combination of promoter 1 and promoter 3 is a different part in combination.
- elements that make up different parts in combination in plasmids in a library e.g., a promoter at a particular position
- an element that has a similar function e.g., function as a promoter
- an element that has a similar function can be used, but is not particularly limited to, an element that elements may be included in the corresponding positions of the plasmid.
- virus-derived construct The virus-derived construct plasmids of the present disclosure are used to produce virus-derived constructs. In one embodiment, the present disclosure provides methods of making virus-derived constructs using the virus-derived construct plasmids of the present disclosure. In one embodiment, the present disclosure provides a composition containing a virus-derived construct or a virus-derived construct so produced.
- Virus-derived constructs include alphavirus, vaccinia virus, measles virus, influenza virus, vesicular stomatitis virus, coronavirus, Sindbis virus, Semliki Forest virus, herpes simplex virus, retrovirus, lentivirus, rabies virus, Sendai virus, Included are virus-derived constructs based on adeno-associated virus, adenovirus, reovirus, coxsackievirus, and Newcastle disease virus.
- the virus-derived construct is a retrovirus, lentivirus, adeno-associated virus, or adenovirus-based virus-derived construct.
- the present disclosure provides methods of generating virus-derived construct libraries using the virus-derived construct plasmids of the present disclosure and the virus-derived construct libraries so generated.
- a virus-derived construct plasmid of the present disclosure is introduced into a producer cell to produce a virus-derived construct.
- producer cells include human embryonic kidney cells (produced by transfecting human fetal kidney cells with adenovirus 5-cleaved DNA), 911 cells, PER.
- C6 cells E1-transformed amniotic cells, E1-transformed A549 cells, GH329:HeLa cells, HEK293 cells, IT293SF cells, HEK293T, HEK293F, Vero cells, CHO cells, Sf9 cells, Freestyle(TM) 293-F, Expi293-F (trademark), Expi293 inducible, Expi293 NGT-Viral Production Cells 1.0, Viral Production Cells 2.0 (VPC2.0 cells), AAVpro (registered trademark) ) 293T Cell Line, Lenti-X (trademark) 293T Cell Line, FreeStyle Examples include, but are not limited to, CHO-S (trademark) cells, ExpiCHO-S (trademark), VirusExpress (trademark) 293 AAV-producing cells, VirusExpress (trademark) 293T lentivirus-producing cells, and the like.
- a virus-derived construct plasmid of the present disclosure is deficient in a small number (e.g., one, two, three, four, or five) of the genes of the virus of origin of the virus-derived construct; May include all other genes.
- the virus-derived construct plasmid of the present disclosure is deficient in a portion of the gene set necessary for producing the virus-derived construct, and the virus-derived construct plasmid of the gene set is deleted. The genes involved are supplied in the producer cell in trans with the virus-derived construct plasmid.
- the virus-derived construct plasmids of the present disclosure can be introduced into producer cells alone without combination with other plasmids to enable production of virus-derived constructs.
- a virus-derived construct plasmid of the present disclosure can be introduced into a producer cell in which the virus-derived construct plasmid expresses all of the genes that are deleted from the gene set necessary to produce the virus-derived construct.
- the virus-derived construct plasmids of the present disclosure including AAV cap and rep, and adenovirus E2A, E4, and VA, can be used alone to transform the virus-derived constructs into HEK293 cells expressing adenovirus E1A and E1B. can be produced.
- a virus-derived construct plasmid of the present disclosure comprises another nucleic acid or a product of that gene that contains a gene in which the virus-derived construct plasmid is defective among the gene set necessary to produce the virus-derived construct (e.g. virus particles) into producer cells.
- a virus-derived construct is produced by introducing a virus-derived construct plasmid into a producer cell infected with the virus of origin of the virus-derived construct and allowing homologous recombination to occur in the cell. I can do it.
- the virus-derived construct plasmid used in this embodiment contains a desired gene and a nucleic acid sequence that has homology to any region of the genome of the source virus (eg, an intergenic region).
- the virus-derived construct plasmid may have a structure that includes the desired gene between any genes of the genome of the virus of origin of the virus-derived construct being produced.
- at least a portion of the nucleic acid contained in the viral-derived construct plasmid is integrated into the chromosome of the producer cell.
- the virus-derived construct plasmid of the present disclosure includes a segment (LTR in retrovirus, ITR in AAV, etc.) for excision of the onboard nucleic acid of the source virus of the virus-derived construct to be produced, and in one embodiment, , containing the desired gene between this segment.
- the virus-derived construct plasmids of the present disclosure contain between this segment the desired gene and a promoter and/or terminator operably linked thereto (e.g. including those that are).
- a virus-derived construct plasmid of the present disclosure does not contain genes necessary for replication of the virus from which the virus-derived construct originates between this segment.
- a virus-derived construct plasmid of the present disclosure contains the packaging signal of the virus from which the virus-derived construct is produced.
- the virus-derived constructs produced have structural proteins (such as capsids), which may be involved in binding to tissues or cells. Therefore, targeting of virus-derived constructs to tissues or cells can be adjusted by modifying the structural proteins to alter their binding properties to tissues or cells (or their surface structures).
- the virus-derived construct plasmid of the present disclosure may have a gene encoding a structural protein, and the structural protein may be modified.
- modifications of structural proteins that modulate tissue or cell targeting may include other proteins, such as other viral capsids (e.g., capsids of other serotypes of viruses, VSV-G), antigen-binding regions of antibodies, substitution or fusion with a ligand protein (ligand for a cancer antigen, etc.).
- Enveloped virus-derived constructs may also include cell membrane components of the producer cell in the envelope. Therefore, by modifying the cell membrane components of producer cells, targeting of enveloped virus-derived constructs to tissues or cells can be adjusted.
- non-viral-derived materials such as lipid particles can be used to modulate targeting to cells.
- the virus-derived constructs are derived from neural cells (such as cells of the peripheral or central nervous system, brain cells such as neurons and oligodendrocytes), lung cells, ocular cells (retinal cells, retinal pigment epithelium, corneal cells), epithelial cells (e.g. intestinal or respiratory epithelial cells), muscle cells (e.g.
- skeletal muscle cells cardiomyocytes, smooth muscle cells, diaphragm muscle cells), dendritic cells, pancreatic cells (such as islet cells) ), designed to target liver cells, cardiomyocytes, bone cells (e.g., bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, germ cells, cancer cells, etc.
- Surface structures such as receptors
- the virus-derived construct plasmid of the present disclosure may contain a gene encoding a protein that is an attenuated protein of the source virus of the virus-derived construct to be produced.
- Virus-derived construct plasmids of the present disclosure can include genes encoding any known attenuated viral proteins.
- the present disclosure provides a plasmid-containing composition comprising a population of virus-derived construct plasmids of the present disclosure.
- the plasmid-containing composition has a CCC (covalently closed circular) purity of the plasmid of about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more. % or more or about 95% or more.
- the virus-derived construct plasmid of the present disclosure, the virus-derived construct plasmid library of the present disclosure, and the composition containing the virus-derived construct plasmid of the present disclosure produced by the method of the present disclosure cannot be completely analyzed in terms of plasmid three-dimensional structure, base modification, etc.
- the feature that they are produced by the method of the present disclosure is one of the features that appropriately expresses the virus-derived construct plasmid, the virus-derived construct plasmid library, and the composition containing the virus-derived construct plasmid of the present disclosure. .
- Adenovirus is a virus of the genus Mastadenovirus of the Adenoviridae family, and the virus particle is composed of a nucleocapsid and a double-stranded linear DNA genome, and has a regular icosahedral structure of 90 to 100 nm.
- Adenovirus infection is initiated by adsorption of the virus capsid to the coxackie-adenovirus receptor (CAR) on the cell surface, and then the virus can enter the cell via integrins on the cell surface. Subsequently, the viral genome that escapes from the lysosome can reach the nucleus and result in replication of the viral genome.
- CAR coxackie-adenovirus receptor
- Viral replication is initiated by first expressing the E1A protein and activating the expression of other early proteins E1B, E2, E3, and E4.
- the terminal protein (TP) expressed from E2 is covalently bound to deoxycytidine, and a complex is formed in which a polymerase is further bound to this, and replication is initiated.
- the genome also contains five late transcription units (L1) that encode structural proteins, including pentons (L2), hexons (L3), scaffold proteins (L4), and fiber proteins (L5), and are under the control of a single promoter. , L2, L3, L4, and L5). Both ends of the genome contain inverted terminal repeats (ITRs) necessary for viral replication.
- ITRs inverted terminal repeats
- Adenovirus particles After the structural proteins of the virus are translated in the cytoplasm, they translocate into the nucleus and form virus particles, where they recognize the packaging signal ( ⁇ ) of the viral genome and package the genome.
- Adenoviruses also produce non-protein-coding VA RNA, which is encoded by the VA gene.
- Adenovirus particles may have L2 and L3 capsids.
- subgroup A e.g., serotypes 12, 18, and 31
- B e.g., serotypes 3, 7, 11, 14, 16, 21, 34, 35, and 50
- subgroup C e.g., serotypes 1, 2, 5, and 6
- subgroup D e.g., serotypes 8, 9, 10, 13, 15, 17, 19, 20, 22-30, 32, 33, 36-39 and 42-48
- subgroup E e.g. serotype 4
- subgroup F e.g. serotypes 40 and 41
- unclassified serogroups eg, serotypes 49 and 51.
- the adenovirus-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the adenovirus-derived construct and the desired gene. In one embodiment, the adenovirus-derived construct plasmid contains the desired gene between the 5'ITR and 3'ITR. In one embodiment, the adenovirus-derived construct plasmid contains the desired gene, promoter and terminator between the 5'ITR and 3'ITR. In one embodiment, the adenovirus-derived construct plasmid does not contain one or more (e.g., all) of the nucleic acid sequences necessary to construct the adenovirus-derived construct between the 5'ITR and 3'ITR. .
- the adenovirus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the adenovirus-derived construct.
- one or more (e.g., all) of the nucleic acid sequences necessary to construct the adenovirus-derived construct that are not included in the virus-derived construct plasmid are encoded in the chromosome of the producer cell. You can leave it there.
- the nucleic acid sequences necessary to construct the adenovirus-derived construct include genes encoding E1A, E1B, E2A, E2B, E3, E4, L1, L2, L3, L4, L5, IX, IVa2. may include.
- the nucleic acid sequences necessary to construct the adenovirus-derived construct can be all genes of the adenovirus except E3.
- the nucleic acid sequences necessary to construct the adenovirus-derived construct include nucleic acid sequences encoding structural proteins (L2, L3) and nucleic acid sequences encoding packaging factors (E1A, E1B, E2A, E2B, E4), two terminal repeat sequences (5'ITR, 3'ITR), and a nucleic acid sequence encoding a functional cofactor.
- the nucleic acid sequence encoding the functional cofactor can be any adenoviral gene except L2, L3, E1A, E1B, E2A, E3, E2B, E4, 5'ITR, 3'ITR.
- the adenovirus-derived construct plasmid may be free of one or more of VA, E1A, E1B, E2A, E2B, E4; The nucleic acid sequences necessary to do so include these. In certain embodiments, the adenovirus-derived construct plasmid does not include E1A and E1B. In one embodiment, the adenovirus-derived construct plasmid lacks E1A, and a desired gene may be inserted into this defective site.
- VA RNA is known to interact with exportin, RISK, Dicer, etc. in humans, and by deleting VA from an adenovirus-derived construct plasmid, side effects on adenovirus-derived construct-infected cells can be reduced. Since E1A, E1B, E2A, E2B, and E4 may be genes necessary for adenovirus replication, an adenovirus-derived construct plasmid in which these genes are deleted may have reduced replication ability in infected cells.
- the adenovirus-derived constructs of the present disclosure may be from human subgroup C, eg, serotype 2 or serotype 5.
- the adenovirus-derived constructs of the present disclosure include serotype 12 (subgroup A), serotype 7 or serotype 35 (subgroup B), serotype 30 or serotype 36 (subgroup D), serotype It may be derived from type 4 (subgroup E) or serotype 41 (subgroup F).
- Producer cells for producing adenovirus-derived constructs include cells such as HEK293, HEK293T, HEK293F, Hela, Sf9, and the like.
- Adeno-associated virus is a linear single-stranded DNA virus of the Dependovirus genus of the Parvoviridae family, and the virus particles have a diameter of 20 to 26 nm.
- Adenoviral elements are required for AAV replication.
- a T-shaped hairpin structure called ITR inverted terminal repeat
- ITR inverted terminal repeat
- the left half of the genome contains the rep genes, which encode non-structural proteins, namely regulatory proteins that control replication and transcription (Rep78, Rep76, Rep52, Rep40), and the right half of the genome contains the genes that encode structural proteins (VP1, VP2, VP3).
- rep genes which encode non-structural proteins, namely regulatory proteins that control replication and transcription (Rep78, Rep76, Rep52, Rep40)
- structural proteins VP1, VP2, VP3
- the life cycle of AAV is divided into latent infection and lytic infection.
- the former is a case of infection alone, and is characterized by integration into the AAVS1 region (19q13.3-qter) of the long arm of chromosome 19 of the host cell. This integration is due to non-homologous recombination and involves Rep. It has been reported that Rep78/Rep76 binds to a base sequence (GAGC repeat sequence) that is present in common in the AAVS1 region and the Rep binding region of ITR. Therefore, when wild-type AAV infects a target cell, Rep binds to AAV ITR and AAVS1, and site-specific integration of the AAV genome into chromosome 19 is thought to occur through Rep's intervention.
- helper virus such as an adenovirus
- AAV replication occurs when a cell that is latently infected with AAV is further superinfected with the helper virus, and a large amount of virus is released due to cell destruction (lytic infection).
- the AAV-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the AAV-derived construct and the desired gene. In one embodiment, the AAV-derived construct plasmid contains the desired gene between the 5'ITR and 3'ITR. In one embodiment, the AAV-derived construct plasmid contains the desired gene, promoter and terminator between the 5'ITR and 3'ITR. In one embodiment, the AAV-derived construct plasmid does not include one or more (eg, all) of the necessary nucleic acid sequences to constitute the AAV-derived construct between the 5'ITR and 3'ITR.
- the AAV-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the AAV-derived construct.
- one or more (e.g., all) of the nucleic acid sequences necessary to construct the AAV-derived construct that are not included in the virus-derived construct plasmid are encoded in the chromosome of the producer cell. You can.
- the nucleic acid sequences necessary to construct the AAV-derived construct include the AAV 5'ITR, rep, cap, AAP (assembly activating protein), MAAP (membrane associated accessory protein) and 3'ITR, and adenovirus E1A, E1B, E2A, VA and E4.
- the nucleic acid sequences necessary to construct the AAV-derived construct include a nucleic acid sequence encoding an AAV structural protein (cap), a nucleic acid sequence encoding an AAV packaging factor (rep), and a nucleic acid sequence encoding an AAV packaging factor (rep).
- the AAV-derived construct plasmid may be free of one or more of rep, cap, VA, E1A, E1B, E2A, E4; Nucleic acid sequences necessary for the construction include these.
- AAV has been reported to have serotypes 1 to 12 based on its capsid. Also, rh10, DJ, DJ/8, PHP. eB, PHP. S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh. 74, AAV2.5, AAV-TT, and Anc80 serotypes have also been reported.
- the AAV-derived constructs of the present disclosure may be made based on the appropriate serotype of AAV depending on the target tissue.
- the (serotype): (target tissue) relationship may be selected as follows; (AAV1): (muscle, liver, airways, nerve cells), (AAV2): (muscle, liver, nerve cells).
- AAV3 (muscle, liver, nerve cells), (AAV4): (muscle, ventricular ependymal cells), (AAV5): (muscle, liver, nerve cells, glial cells, airways), (AAV6): (muscles, liver, airways, nerve cells), (AAV7): (muscles, liver), (AAV8): (muscles, liver), (AAV9): (muscles, liver, airways).
- Producer cells for producing AAV-derived constructs include cells such as HEK293, HEK293T, HEK293F, Hela, Sf9, and the like.
- AAV capsids include capsids with targeted mutations (AAV2i8, AAV2.5, AAV-TT, AAV9.HR, etc.), capsids with random mutations (AAV-PHP.B, etc.), In silico designed capsids (such as Anc80) are included; in one embodiment, the AAV-derived constructs of the present disclosure may include these modified capsids, and the AAV-derived construct plasmids of the present disclosure encode these modified capsids. It may be constructed as follows.
- nucleic acid sequence when a nucleic acid sequence is described as being derived from a particular serotype, the nucleic acid sequence may encode a wild-type capsid or may be based on a wild-type capsid with the above-mentioned modifications. It is contemplated that it may encode a capsid.
- Retrovirus generally refers to a virus of the Retroviridae family. Retroviruses are double-stranded RNA enveloped viruses primarily characterized by the ability to reverse transcribe the genome from RNA to DNA. Virions are approximately 100-120 nm in length and contain a dimeric genome of identical positive RNA strands in complex with nucleocapsid proteins. The genome is enclosed in a capsid that contains the enzyme proteins necessary for viral infection: reverse transcriptase, integrase and protease. Matrix proteins form the outer layer of the capsid core that interacts with the envelope, a lipid bilayer derived from the host cell membrane, that surrounds the viral core particle.
- This bilayer has immobilized viral envelope glycoproteins that recognize specific receptors on host cells and initiate the infection process.
- Envelope proteins are formed by two subunits: the transmembrane (TM), which anchors the protein within the lipid membrane, and the surface (SU), which binds to cell receptors.
- TM transmembrane
- SU surface
- Retroviruses include murine leukemia virus (MLV), human immunodeficiency virus (HIV), equine infectious anemia virus (EIAV), murine mammary tumor virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), avian myelocytomatosis virus 29 (MC29) , and avian erythroblastosis virus (AEV), and lentiviruses.
- MMV murine leukemia virus
- HBV human immunodeficiency virus
- EIAV equine infectious anemia virus
- MMTV murine mammary tumor virus
- RSV Rous sarcoma virus
- FuSV Fujinami sarcom
- Lentiviruses can be divided into “primate” and "non-primate”.
- primate lentiviruses include human immunodeficiency virus (HIV), the causative agent of human acquired immunodeficiency syndrome (AIDS), and simian immunodeficiency virus (SIV).
- the group of non-primate lentiviruses includes the prototype "late-onset virus” Visna/Maedi virus (VMV), as well as the related caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and more recently Feline immunodeficiency virus (FIV), which was previously described, and bovine immunodeficiency virus (BIV).
- retroviruses first attach to specific cell surface receptors. Upon entry into a susceptible host cell, the retroviral RNA genome is copied into DNA by reverse transcriptase. This DNA is transported into the host cell nucleus and then integrated into the host genome, a condition called provirus.
- Proviruses are stable in host chromosomes during cell division and are transcribed like other cellular proteins. Proviruses encode the proteins and packaging machinery needed to make more viruses and can bud and leave the cell. When retroviruses bud from the host cell, they contain the host cell lipid membrane. In this way, host cell-derived membrane proteins become part of the retroviral particle.
- the retrovirus genome contains four genes: gag (group-specific antigen), pro (protease), pol (polymerase), and env (envelope).
- gag sequence encodes three major structural proteins: matrix protein, nucleocapsid protein, and capsid protein.
- the pro sequence encodes a protease responsible for cleaving Gag and Gag-Pol during particle assembly, budding and maturation.
- the pol sequences encode the enzymes reverse transcriptase and integrase, the former catalyzing the reverse transcription of the viral genome from RNA to DNA during the infection process, and the latter processing the LTR and transferring proviral DNA to the host. It plays a role in integrating into the cell genome.
- the env sequence encodes both the SU and TM subunits of the envelope glycoprotein.
- SU surface component
- TM membrane-anchored transmembrane moiety
- PPTs polypurine tracts
- Examples include gender sequences.
- the long terminal repeat (LTR) is approximately 600 nt long, of which the U3 region is 450 nt long, the R sequence is 100 nt long, and the U5 region is approximately 70 nt long.
- the genomes of complex retroviruses can contain, in addition to gag, pro, pol, and env, accessory genes that regulate viral gene expression, assembly of infectious particles, and modulate viral replication in infected cells.
- a typical lentivirus is HIV-1.
- Lentiviruses may contain two control genes, tat and rev.
- HIV-1 further includes vif, vpr, vpu and nef.
- accessory genes such as vpx. These accessory genes are involved in the control of viral RNA synthesis and processing and other replication functions.
- HIV also includes other structural landmarks (TAR, RRE, PE, SLIP, CRS, INS), etc.
- Lentiviral particles may contain the p24 capsid protein.
- the retrovirus-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the retrovirus-derived construct and the desired gene. In one embodiment, the retrovirus-derived construct plasmid contains the desired gene between the 5'LTR and 3'LTR. In one embodiment, the retrovirus-derived construct plasmid may include a primer binding site (PBS) and/or a polypurine tract (PPT) between the 5' LTR and the desired gene. In one embodiment, the retrovirus-derived construct plasmid may include a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) between the desired gene and the 3'LTR.
- PBS primer binding site
- PPT polypurine tract
- WPRE woodchuck hepatitis virus post-transcriptional regulatory element
- the retrovirus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the retrovirus-derived construct.
- one or more (e.g., all) of the nucleic acid sequences necessary to construct the retrovirus-derived construct that are not included in the virus-derived construct plasmid are encoded in the chromosome of the producer cell. You can leave it there.
- env may be replaced with the gene encoding VSV-G (vesicular stomatitis virus (VSV) glycoprotein G) during construction of the retrovirus-derived construct.
- VSV-G vesicular stomatitis virus
- the retrovirus-derived construct (including lentivirus) plasmid may additionally contain the VSV-G gene.
- the rabies virus glycoprotein gene (RV-G) or the intracellular A fusion glycoprotein (FuG-B) in which the domains are replaced with those of the vesicular stomatitis virus glycoprotein (VSV-G) may be used, and retrovirus-derived constructs (including lentiviruses) plasmids may carry these genes. May include.
- the nucleic acid sequences necessary to construct the retrovirus-derived construct include a nucleic acid sequence encoding a structural protein (gag), a packaging factor ( ⁇ ), and two terminal repeat sequences (5'LTR). , 3'LTR) and a nucleic acid sequence encoding a functional cofactor.
- the nucleic acid sequences encoding functional cofactors can be pro, pol, and env.
- the retrovirus-derived construct plasmid may be free of one or more of gag, pro, pol, env, and in one embodiment, the components necessary to construct the retrovirus-derived construct. Nucleic acid sequences include these.
- a retrovirus-derived construct plasmid in which pol is deleted may have a reduced ability to replicate in infected cells.
- the retrovirus-derived construct plasmid does not contain one or more (e.g., all) of the nucleic acid sequences necessary to constitute the retrovirus-derived construct between the 5'LTR and 3'LTR. .
- the retrovirus-derived construct plasmid contains the desired gene between the 5'LTR and 3'LTR.
- the retrovirus-derived construct plasmid contains the desired gene, promoter, and terminator between the 5'LTR and 3'LTR.
- the retrovirus-derived construct plasmid may be modified so that the U3 region of the LTR is deleted.
- Producer cells for producing retrovirus-derived constructs include cells such as HEK293T.
- the nucleic acid sequences necessary to construct the lentivirus-derived construct include nucleic acid sequences encoding structural proteins (gag, pol, VSV-G, env) and packaging factors (packaging signal ( ⁇ )). ) sequence), two terminal repeat sequences (5'LTR, 3'LTR), and a nucleic acid sequence encoding a functional cofactor.
- the nucleic acid sequence encoding the functional cofactor can be rev.
- the lentivirus-derived construct plasmid may be free of one or more of rev, gag, pro, pol, env; The necessary nucleic acid sequences include these.
- a lentivirus-derived construct plasmid in which these are deleted may have a reduced ability to replicate in infected cells.
- the lentivirus-derived construct plasmids include tat, vif, vpr, vpu, nef, vpx, TAR, RRE, PE, SLIP, CRS, INS, APP, MAAP, RPE, PPT, PRE, WRPE, oPRE. may include one or more of the following.
- the lentivirus-derived construct plasmid does not include one or more (e.g., all) of the nucleic acid sequences necessary to constitute the lentivirus-derived construct between the 5'LTR and 3'LTR. .
- the lentivirus-derived construct plasmid contains the desired gene between the 5'LTR and 3'LTR.
- the lentivirus-derived construct plasmid contains the desired gene, promoter, terminator, and WPRE between the 5'LTR and 3'LTR.
- the lentivirus-derived construct plasmid may be modified to lack the U3 region of LTR, TAT.
- the retrovirus-derived construct plasmid may be modified so that the U3 region of the LTR is deleted.
- Producer cells for producing lentivirus-derived constructs include cells such as HEK293T, HEK293, Hela, and the like.
- Herpes simplex virus is a virus of the family Herpesviridae, subfamily Alphaherpesvirinae, and genus Simplexvirus. HSV particles have a diameter of about 100 nm and have a structure in which an icosahedral capsid is covered with an envelope. A linear double-stranded DNA of approximately 150 kbp is packaged inside the capsid, and the viral DNA genome encodes at least 74 types of viral proteins. The genes encoding these viral proteins are classified into three groups ( ⁇ , ⁇ , and ⁇ ) depending on the time of expression, and the expression of each group is regulated in a cascade.
- the ⁇ gene group includes ⁇ 0, ⁇ 4, ⁇ 22, ⁇ 27, and ⁇ 47, and ⁇ 0, ⁇ 4, ⁇ 22, and ⁇ 27 encode proteins that control the expression of other viral genes. When the ⁇ genes are expressed, these gene products activate the expression of the ⁇ genes.
- the ⁇ gene group mainly encodes proteins essential for viral DNA replication, such as the DNA polymerase complex and DNA primase/helicase complex, and enzymes involved in deoxyribonucleotide metabolism, such as thymidine kinase (TK) and ribonucleotide reductase. .
- TK thymidine kinase
- ribonucleotide reductase ribonucleotide reductase.
- LAT latency associated transcript
- LAP latency active promoter
- HSV-derived constructs have a wide host range and can infect and proliferate in most cultured cells, (2) they can infect both dividing and non-dividing cells, and (3) they do not contain foreign genes. (4) Since it has its own TK, the antiviral drugs acyclovir and ganciclovir are effective, and even if unexpected proliferation occurs, it can be treated. (5) It exists stably as an episome within nerve cells, and depending on the promoter, gene expression can be sustained for a long period of time. (6) It exhibits pathogenicity in mice similar to that in humans, and can be used as a model animal. Also, strong cytotoxicity may be beneficial for tumor treatment.
- the HSV-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the HSV-derived construct and the desired gene. In one embodiment, the HSV-derived construct plasmid contains a DNA origin of replication (ori) upstream of the desired gene. In one embodiment, the HSV-derived construct plasmid may include a LAP (e.g., between the ori and the desired gene) to allow long-term expression of the introduced gene in the host cell of the HSV-derived construct. . In one embodiment, the HSV-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the HSV-derived construct.
- a LAP e.g., between the ori and the desired gene
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the HSV-derived construct are included in the virus-derived construct plasmid. and can be supplied in trans in a producer cell.
- genes not included in the virus-derived construct plasmid may be encoded in the chromosome of the producer cell, or may be encoded in another nucleic acid molecule (e.g., a plasmid) introduced into the producer cell, Gene products of genes not contained in virus-derived construct plasmids (which may be in the form of virus particles) may be introduced into producer cells.
- the nucleic acid molecule separate from the virus-derived construct plasmid of the present disclosure that is introduced into the producer cell may be deficient in one or more of a pac and a DNA origin of replication (ori). , it can be avoided that the onboard nucleic acid contains nucleic acids derived from this nucleic acid.
- the nucleic acid sequences necessary to construct the HSV-derived construct can be all genes of HSV.
- the nucleic acid sequences necessary to construct the HSV-derived construct may include genes encoding UL9, UL19, UL26, UL35, US6, US7, US11.
- the nucleic acid sequences necessary to construct the HSV-derived construct can be all genes of HSV except one or more of ⁇ 0, ⁇ 22, ⁇ 47.
- the nucleic acid sequences necessary to construct the HSV-derived construct can be all genes of HSV except ⁇ 22.
- the HSV-derived construct plasmid may be free of one or more of ⁇ 0, ⁇ 4, ⁇ 22, ⁇ 27, ⁇ 47, which in one embodiment is required to construct the HSV-derived construct. Nucleic acid sequences include these.
- the HSV-derived construct plasmid is deficient in one or both of the ⁇ 4 and ⁇ 27 genes.
- the HSV-derived construct plasmid is deficient in ICP6.
- the HSV-derived construct plasmid is deficient in ⁇ 4, ⁇ 22 and ⁇ 27.
- the HSV-derived construct can be modified to be attenuated.
- the HSV-derived construct plasmid is modified to lack one or more of thymidine kinase (TK), ribonucleotide reductase (RR), deoxyuridine triphosphatase (dUTPase), ⁇ 34.5. can be done.
- the HSV-derived construct plasmid can be modified to introduce a gene encoding a cytokine (such as an immune activating cytokine) at the site of the ⁇ 34.5 deletion.
- an HSV-derived construct deficient in these genes can be obtained by allowing a producer cell containing an HSV-derived construct plasmid deficient in these genes to produce the HSV-derived construct without supplying these genes.
- TK can be highly expressed in cancer cells, so a TK-deficient HSV-derived construct can function selectively in cancer cells.
- Producer cells for producing HSV-derived constructs include cells such as Hela and Vero.
- Sendai virus is a negative-strand RNA virus classified into the family Paramyxoviridae and the genus Respirovirus. Sendai virus can also infect nondividing cells, including neurons. After Sendai virus infection, the viral genome is not integrated into the chromosome of the host cell and remains in the cytoplasm in the form of RNA.
- genes encoding Sendai virus proteins include the N, P, M, F, HN, and L genes.
- the N, P, M, F, HN and L genes encode nucleocapsid, phospho, matrix, fusion, hemagglutinin neuraminidase and large proteins, respectively.
- the wild-type Sendai virus genome contains a short 3' leader region (LE) followed by N (nucleocapsid protein), P (phosphoprotein), M (matrix protein), F (fusion protein), HN
- Six genes encoding (hemagglutinin neuraminidase) and L (large protein) are lined up, and a short 5' trailer region (TR) exists at the other end.
- Accessory proteins called C and V are also translated from the P gene region.
- Sendai virus expresses genes by both tubulin and Sendai virus RNA polymerase (L protein) in the host cell cytoplasm. Sendai virus does not interact with host cell genomes and is not pathogenic to humans. These characteristics of Sendai virus suggest the safety of Sendai virus-derived constructs for humans.
- the M, F, and HN proteins may be responsible for Sendai virus virion formation and viral infection.
- the N, P and L proteins may be responsible for the expression and replication of the viral genome.
- the nucleic acid transcribed from the Sendai virus-derived construct plasmid in the producer cell becomes the loading nucleic acid of the Sendai virus-derived construct. Therefore, the following characteristics regarding the Sendai virus-derived construct plasmid may also be characteristics of the carrying nucleic acid of the Sendai virus-derived construct.
- the Sendai virus-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the Sendai virus-derived construct and a desired gene.
- the desired gene may be located upstream and/or downstream of any of the Sendai virus genes (N, P, M, F, HN and L genes).
- the Sendai virus-derived construct plasmid can contain an EIS sequence (transcription termination (E) sequence - intervening (I) sequence - transcription initiation (S) sequence) upstream or downstream of the desired gene, By doing so, expression of genes upstream or downstream of the desired gene can be promoted.
- EIS sequence transcription termination (E) sequence - intervening (I) sequence - transcription initiation (S) sequence
- the Sendai virus-derived construct plasmid can be modified to insert a sequence having a multiple of 6 bases (eg, a sequence containing the desired gene).
- the Sendai virus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the Sendai virus-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the Sendai virus-derived construct are included in the virus-derived construct.
- the plasmid can be supplied in trans with the producer cell.
- the nucleic acid sequences necessary to construct the Sendai virus-derived construct can be all genes of Sendai virus.
- the Sendai virus-derived construct plasmid contains the necessary nucleic acid sequences to constitute the Sendai virus-derived construct between the LE and the TR.
- the nucleic acid sequences necessary to construct the Sendai virus-derived construct may include the N, P, V, C, M, F, HN, and L genes.
- the nucleic acid sequences necessary to construct a Sendai virus-derived construct can be all genes of Sendai virus except one or more of M, F, and HN.
- the loaded nucleic acid may lose transmissibility in the host.
- the Sendai virus-derived construct plasmid may be free of one or more of M, F, and HN; The array includes these.
- the Sendai virus-derived construct plasmid may include a gene encoding bacteriophage T7 RNA polymerase.
- the Sendai virus-derived construct plasmid may include the self-cleaving ribozyme Rbz.
- the Sendai virus gene may be modified to reduce the antigenicity of the Sendai virus protein or to increase the efficiency of RNA transcription and replication.
- one or more of the replication factors N, P, and L genes may be modified to enhance transcription or replication function.
- the structural protein HN protein may be modified so that hemagglutinin activity and/or neuraminidase activity may be altered, reducing the stability of the virus in the blood. and changes in neuraminidase activity may alter the infectivity of the virus.
- the F protein involved in membrane fusion may be modified.
- modification may be made to delete the V gene, which is an accessory gene.
- Producer cells for producing Sendai virus-derived constructs include cells such as BHK/T7.
- Measles virus is an RNA virus classified into the genus Morbillivirus in the family Paramyxoviridae. Measles virus, like Sendai virus, has N, P, M, F, H and L genes.
- the measles virus-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the measles virus-derived construct and the desired gene.
- the desired gene may be located upstream and/or downstream of any measles virus gene.
- the measles virus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the measles virus-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the measles virus-derived construct are included in the virus-derived construct.
- the plasmid can be supplied in trans with the producer cell.
- the nucleic acid sequences necessary to construct a measles virus-derived construct can be all genes of measles virus.
- alphavirus refers to a virus of the Togaviridae family, Alphavirus genus.
- Alphaviruses are enveloped RNA viruses that proliferate in the cytoplasm without passing through a DNA intermediate and can infect various cells via laminin receptors and the like.
- the alphavirus genome is a single-stranded messenger sense RNA modified at the 5' end with a methylated cap and at the 3' end with poly(A) strands of various lengths.
- Virus particles have a structure that contains the RNA genome in an icosahedral nucleocapsid.
- the alphavirus genome contains genes encoding the nonstructural proteins nsp1, nsp2, nsp3, and nsp4, and genes encoding the structural proteins capsid (C) protein, E1 glycoprotein, and E2 glycoprotein.
- Alphaviruses include Venezuelan equine encephalitis (VEE) virus, Semliki Forest virus (SFV), Sindbis virus, Ross River virus, Western equine encephalitis virus, Eastern equine encephalitis virus, Chikungunya virus, S. A.
- AR86 Everglade Virus, Mukambo Virus, Barma Forest Virus, Middelburg Virus, Pixna Virus, Onyonnyon Virus, Geta Virus, Sagiyama Virus, Bebal Virus, Mayaro Virus, Una Virus, Aura Virus , Whataroa virus, Babanky virus, Kijiragatche virus, Highland J virus, Fort Morgan virus, Nujumu virus, Buggy Clark virus, etc.
- the alphavirus-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the alphavirus-derived construct and the desired gene.
- the desired gene may be placed between any of nsp1, nsp2, nsp3, and nsp4.
- the alphavirus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the alphavirus-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the alphavirus-derived construct are included in the alphavirus-derived construct.
- the plasmid can be supplied in trans with the producer cell.
- genes not included in the virus-derived construct plasmid may be encoded in the chromosome of the producer cell, or may be encoded in another nucleic acid molecule (e.g., a plasmid) introduced into the producer cell, Gene products of genes not contained in virus-derived construct plasmids (which may be in the form of virus particles) may be introduced into producer cells.
- the nucleic acid molecule separate from the disclosed virus-derived construct plasmid that is introduced into the producer cell comprises one or more of a 5' alphavirus replication recognition sequence and a 3' alphavirus replication recognition sequence. It may be deleted, and it may be avoided that the loaded nucleic acid contains nucleic acids derived from this nucleic acid.
- the nucleic acid sequences necessary to construct the alphavirus-derived construct can be all genes of the alphavirus.
- the alphavirus-derived construct plasmid comprises one or more of the alphavirus genes other than the 5' alphavirus replication recognition sequence, nsp1, nsp2, nsp3, nsp4, and the 3' alphavirus replication recognition sequence.
- the nucleic acid sequences necessary to construct the alphavirus-derived construct include these.
- Rabies virus is a negative-strand single-stranded RNA virus of the Rhabdoviridae family, genus Lyssavirus, and the virus particles are cylindrical, bullet-shaped.
- the cylinder has a length of about 180 nm and a diameter of about 75 nm. It has five genes encoding L (large protein), G (glycoprotein), N (nucleoprotein), P (phosphoprotein), and M (matrix protein). Among these, G protein may be associated with infectivity.
- the genes are arranged in the order of N, P, M, G, and L starting from the leader site. The expression level of a gene closer to the Leader site may increase.
- the rabies virus-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the rabies virus-derived construct and the desired gene.
- the desired gene may be located upstream and/or downstream of any of the N, P, M, G, L genes.
- the rabies virus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the rabies virus-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the rabies virus-derived construct are included in the virus-derived construct.
- the plasmid can be supplied in trans with the producer cell.
- the nucleic acid sequences necessary to construct the rabies virus-derived construct can be all genes of the rabies virus.
- the rabies virus derived construct plasmid may be free of one or more of N, P, M, G, L.
- VSV Vesicular stomatitis virus
- VSV is an RNA virus of the genus Vesiculovirus in the family Rhabdoviridae, and has a negative single-stranded RNA genome consisting of approximately 11 kb.
- Vesicular stomatitis virus (VSV) like rabies virus, contains five genes encoding L (large protein), G (glycoprotein), N (nucleoprotein), P (phosphoprotein), and M (matrix protein). have
- the VSV-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the VSV-derived construct and the desired gene.
- the desired gene may be located upstream and/or downstream of any of the N, P, M, G, L genes.
- the VSV-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the VSV-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the VSV-derived construct are included in the virus-derived construct plasmid. and can be supplied in trans in a producer cell.
- the nucleic acid sequences necessary to construct a VSV-derived construct can be all genes of VSV.
- the VSV-derived construct plasmid may be free of one or more of N, P, M, G, L.
- Virus particles of coronavirus (CoV) family viruses exhibit a circular (spherical) shape with a diameter of approximately 80 to 100 nm, and the envelope surrounding the nucleocapsid contains spike (S) protein and integral membrane (M) protein. ) protein and envelope (E) protein.
- the CoV genome contains genes that are approximately 30 kb (+) strand RNA and encode non-structural proteins 1a and 1b from the 5' side, as well as downstream structural genes S, E, M, and N genes. However, there are also genes for several nonstructural proteins in the region immediately below the S gene.
- the coronavirus-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the coronavirus-derived construct and the desired gene. In one embodiment, the coronavirus-derived construct plasmid contains the desired gene between the 5'ITR and 3'ITR. In one embodiment, the coronavirus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the coronavirus-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the coronavirus-derived construct are included in the virus-derived construct.
- the plasmid can be supplied in trans with the producer cell.
- the nucleic acid sequences necessary to construct the coronavirus-derived construct can be all genes of the coronavirus.
- the coronavirus-derived construct plasmid may be free of one or more of the coronavirus genes other than 1a, 1b; The necessary nucleic acid sequences include these.
- Influenza virus is an enveloped virus with a negative-strand RNA genome belonging to the Orthomyxoviridae family.
- the genome of influenza A virus is segmented into eight segments, which encode 11 types of proteins (PB1, PB2, PA, HA, NA, M1, M2, NS1, NS2/NEP, and NP). Both ends of the 5' untranslated region, 3' untranslated region, and translated region of influenza virus RNA can be packaging sequences.
- the influenza virus-derived construct plasmid comprises the 5' end of the untranslated region of the segmented influenza virus RNA, the 5' end of the translated region, the desired gene, the 3' end of the translated region, and the 3' end of the segmented influenza virus RNA. May contain untranslated regions.
- the influenza virus gene may be removed or maintained.
- the retrovirus-derived construct plasmid may contain the nucleic acid sequences necessary to construct an influenza virus.
- the nucleic acid sequences necessary to constitute an influenza virus may be PB1, PB2, PA, HA, NA, M1, M2, NS1, NS2/NEP and NP.
- influenza virus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the influenza virus-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the influenza virus-derived construct are included in the virus-derived construct.
- the plasmid can be supplied in trans with the producer cell.
- Vaccinia virus is an enveloped virus that belongs to the Poxviridae family and has a linear double-stranded DNA genome of about 190 Kbp. Vaccinia virus replicates only in the cytoplasm of host cells. During viral DNA replication, vaccinia virus separates into several infectious forms that differ in their outer membranes: intracellular mature virions (IMVs), intracellular enveloped virions (IEVs), cell-associated enveloped virions (CEVs), and extracellular enveloped virions ( EEV).
- IMVs intracellular mature virions
- IEVs intracellular enveloped virions
- CEVs cell-associated enveloped virions
- EEV extracellular enveloped virions
- the vaccinia virus-derived construct plasmid contains the necessary nucleic acid sequences and desired genes to construct the vaccinia virus-derived construct.
- the nucleic acid sequences necessary to construct the vaccinia virus-derived construct may encode the D1R, D2L, D3R, D4R, D5R, D6R, D7R, D8L, D11L, D13L genes.
- the vaccinia virus-derived construct plasmid may be deleted in the gene encoding thymidine kinase.
- a vaccinia virus-derived construct can be made by introducing a virus-derived construct plasmid into a producer cell infected with vaccinia virus and allowing homologous recombination to occur within the cell.
- the vaccinia virus-derived construct plasmid used in this embodiment contains the desired gene and a nucleic acid sequence with homology to any region of the vaccinia virus genome.
- the vaccinia virus-derived construct plasmid may contain the desired genes between the vaccinia virus genome and any of the vaccinia virus genes.
- Viruses of the Reoviridae family have icosahedral virions with a diameter of approximately 60 to 80 nm, a genome of 10 to 12 linear double-stranded RNAs, and an enveloped virion. It is an RNA virus.
- Viruses of the Reoviridae family include rotavirus and mammalian orthoreovirus (MRV). MRV has four serotypes: MRV-1, MRV-2, MRV -3, classified as MRV-4 type.
- the 10 segmented dsRNA genome contains eight structural proteins: ⁇ 1 (L3 gene), ⁇ 2 (L2 gene), ⁇ 3 (L1 gene), ⁇ 1 (M2 gene), ⁇ 2 (M1 gene), ⁇ 1 (S1 gene), ⁇ 2 (S2 gene), ⁇ 3 (S4 gene) and four nonstructural proteins: ⁇ NS (M3 gene), ⁇ NSC (M3 gene), ⁇ NS (S3 gene), ⁇ 1s (S1 gene).
- MRV is composed of a two-layered capsid, with an outer shell composed of ⁇ 1, ⁇ 3, and ⁇ 1, and an inner shell (core structure) composed of ⁇ 1, ⁇ 2, and ⁇ 2.
- the core particle contains ⁇ 3, an RNA-dependent RNA polymerase, and ⁇ 2, a polymerase cofactor.
- the nonstructural protein ⁇ NS plays a central role in the formation of the VF, which is a site of replication, and binds to various MRV proteins and recruits them into the VF.
- ⁇ NSCs may not be essential for replication in cultured cells.
- ⁇ NS interacts with ⁇ NS, has a high binding capacity for single-stranded RNA, and may be involved in the recruitment of positive-strand viral RNA into the VF.
- ⁇ 1s is not essential for viral replication, it may be involved in pathogenesis.
- the reovirus-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the reovirus-derived construct and the desired gene.
- the nucleic acid sequences necessary to construct the reovirus-derived construct may include the L1, L2, L3, M1, M2, M3, S1, S2, S3, S4 genes.
- the reovirus-derived construct plasmid may include L1, L2, L3, M1, M2, M3, S1, S2, S3, S4 genes.
- the reovirus-derived construct plasmid may not encode at least one of ⁇ NSC and ⁇ 1s.
- the reovirus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the reovirus-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the reovirus-derived construct are included in the virus-derived construct.
- the plasmid can be supplied in trans with the producer cell.
- the nucleic acid sequences necessary to construct a reovirus-derived construct can be all genes of reovirus.
- the reovirus-derived construct plasmid may be free of one or more of L1, L2, L3, M1, M2, M3, S1, S2, S3, S4.
- Producer cells for producing reovirus-derived constructs include cells such as L929.
- Coxsackievirus is a non-enveloped linear single-stranded positive-strand RNA virus that belongs to the genus Enterovirus in the Picornaviridae family.
- Coxsackievirus which is an enterovirus, is composed of the following genes from 5' to 3': VP0 (VP4 and VP2), VP3, VP1, 2A, 2B, 2C, 3A, 3B, 3C, and 3D, with the VP gene encoding the capsid. , other genes encode nonstructural proteins.
- VP4 behaves like the amino terminus of VP2.
- the coxsackievirus-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the coxsackievirus-derived construct and the desired gene.
- the desired gene may be located upstream and/or downstream of any of the VP0, VP3, VP1, 2A, 2B, 2C, 3A, 3B, 3C, 3D genes.
- the coxsackievirus-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the coxsackievirus-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the coxsackievirus-derived construct are included in the virus-derived construct plasmid. and can be supplied in trans in a producer cell.
- the nucleic acid sequences necessary to construct a coxsackievirus-derived construct can be all genes of a coxsackievirus.
- the nucleic acid sequences necessary to construct the coxsackievirus-derived construct can be 2A, 2B, 2C, 3A, 3B, 3C, 3D, VP1, VP2, VP3, VP4.
- the coxsackievirus-derived construct plasmid may be free of one or more of VP0, VP3, VP1, 2A, 2B, 2C, 3A, 3B, 3C, 3D.
- Producer cells for producing coxsackievirus-derived constructs include cells such as H1299 and HeLa.
- Newcastle disease virus is classified into the Paramyxoviridae family and is an enveloped linear minus-single-stranded RNA virus. From 3' to 5', the NDV genomic RNA contains nucleocapsid protein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin-neuraminidase (HN), and large protein (L). Contains genes. Genomic RNA also includes a leader sequence at the 3' end. Fusion protein (F) is an integral membrane protein that is activated to promote fusion of the viral envelope with the host cell membrane. Matrix protein (M) is involved in virus assembly and interacts with the viral membrane and nucleocapsid proteins.
- NP nucleocapsid protein
- P phosphoprotein
- M matrix protein
- F fusion protein
- HN hemagglutinin-neuraminidase
- L large protein
- Fusion protein is an integral membrane protein that is activated to promote fusion of the viral envelope with the host
- Nucleocapsid protein is the major protein of the nucleocapsid and is associated with phosphoprotein (P) and large protein (L). Phosphoproteins (P) can undergo phosphorylation and participate in transcriptional regulation, methylation, phosphorylation and polyadenylation.
- the large protein (L) gene encodes an RNA-dependent RNA polymerase and is required, along with P protein, for viral RNA synthesis.
- the NDV-derived construct plasmid contains at least one of the nucleic acid sequences necessary to construct the NDV-derived construct and the desired gene.
- the desired gene may be located upstream and/or downstream of any of the NP, P, M, F, HN, L genes.
- the NDV-derived construct plasmid is configured to function in a producer cell such that the virus-derived construct plasmid and the producer cell contain the necessary nucleic acid sequences to construct the NDV-derived construct.
- one or more (e.g., all) of the genes or gene products thereof that are not included in the virus-derived construct plasmid among the nucleic acid sequences necessary to construct the NDV-derived construct are included in the virus-derived construct plasmid. and can be supplied in trans in a producer cell.
- the nucleic acid sequences necessary to construct the NDV-derived construct can be all genes of NDV.
- the NDV-derived construct plasmid may be free of one or more of NP, P, M, F, HN, L.
- the present disclosure provides a virus-derived construct-containing composition comprising a population of virus-derived constructs of the present disclosure.
- the virus-derived construct-containing composition may have a virus-derived construct particle number to virus-derived construct genome copy number (VP/VG) of 35, 30, 25, 20, 15, 10, or 5 or less. .
- virus-derived construct plasmids produced from packaging cells can be purified using any known method, and the present disclosure also provides virus-derived construct plasmids so purified. In one embodiment, it can be confirmed that the purified virus-derived construct plasmid has the desired nucleic acid sequence by examining the size pattern of fragments generated by restriction enzyme cleavage, PCR method, base sequencing method, etc. . In one embodiment, the virus-derived construct plasmid-containing composition prepared by the virus-derived construct plasmid production method of the present disclosure may contain a small amount of endotoxin. In one embodiment, a Bacillus subtilis is provided that includes a virus-derived construct plasmid of the present disclosure.
- the present disclosure provides a composition comprising a virus-derived construct plasmid or virus-derived construct described herein.
- the virus-derived construct of the present disclosure, the virus-derived construct library, and the virus-derived construct-containing composition of the present disclosure produced by the method of the present disclosure cannot be completely analyzed or may have structural features that make it very difficult to Therefore, the feature that it was produced by the method of the present disclosure is one of the features that appropriately expresses the virus-derived construct, the virus-derived construct library, and the virus-derived construct-containing composition of the present disclosure.
- compositions described herein can be provided in a variety of forms.
- the composition may be in the form of, for example, an injection, a capsule, a tablet, a granule, an inhaler, or the like.
- Aqueous solutions for injection may be stored, for example, in vials or stainless steel containers.
- the aqueous solution for injection may also contain, for example, physiological saline, sugar (eg, trehalose), NaCl, NaOH, or the like.
- compositions of the present disclosure include a pharmaceutically acceptable carrier or excipient.
- a pharmaceutically acceptable carrier or excipient can be sterile liquids such as water and oils, including, but not limited to, those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral Contains oil, sesame oil, etc. Water is the preferred carrier when the medicament is administered orally.
- saline and aqueous dextrose are preferred carriers.
- saline solutions and aqueous dextrose and glycerol solutions are used as liquid carriers for injectable solutions.
- Suitable excipients include light silicic anhydride, microcrystalline cellulose, mannitol, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, chloride.
- compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations, and the like.
- the composition can also be formulated as a suppository, with traditional binders and carriers such as triglycerides.
- Oral formulations can also include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. Examples of suitable carriers are described in E.W. Martin, Remington's Pharmaceutical Sciences (Mark Publishing Company, Easton, U.S.A.).
- any liquid composition of the present disclosure is about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, It can be about 7, about 7.5, about 8, about 8.5, about 9, about 9.5, about 10, about 10.5, about 11 or a range between any two of these values.
- compositions of the present disclosure may be provided as a pharmaceutically acceptable salt, for example, formed with a free carboxyl group derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc.
- Salts formed with free amine groups such as those derived from isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, etc., as well as sodium, potassium, ammonium, calcium, and ferric hydroxides. It can be a salt formed with
- the composition can be formulated as a pharmaceutical composition adapted for human administration according to known methods. Such compositions can be administered by injection. Typically, compositions for injectable administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition can also include a solubilizing agent and a local anesthetic such as lidocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, e.g. in a hermetically sealed container such as an ampoule or sachet indicating the amount of active agent, lyophilized powder or water-free concentrate. It can be supplied as a product.
- a hermetically sealed container such as an ampoule or sachet indicating the amount of active agent, lyophilized powder or water-free concentrate. It can be supplied as a product.
- composition is to be administered by injection, it can also be dispensed using an infusion bottle containing sterile pharmaceutical grade water or saline. If the composition is to be administered by injection, an ampoule of sterile water or saline for injection can be provided so that the ingredients can be mixed before administration.
- virus-derived construct plasmids or virus-derived constructs described herein, or compositions containing them can be used in a variety of applications, including gene therapy, functional genomics, cancer vaccination, and/or antiviral vaccination. can.
- the subject When applying the virus-derived construct or virus-derived construct-containing composition of the present disclosure to a subject, the subject is not particularly limited, and may be a mammal (e.g., mouse, rat, hamster, rabbit, cat, dog, cow, sheep, pigs, monkeys, humans, etc.), birds, reptiles, amphibians, arthropods, fish, etc.
- a mammal e.g., mouse, rat, hamster, rabbit, cat, dog, cow, sheep, pigs, monkeys, humans, etc.
- birds reptiles, amphibians, arthropods, fish, etc.
- the amount of a virus-derived construct or virus-derived construct-containing composition of the present disclosure will vary depending on the nature of the disorder or condition being treated or prevented, but can be determined by one of ordinary skill in the art using standard clinical techniques based on the description herein. be. In some cases, in vitro assays can also be used to help identify optimal dosage ranges.
- the precise dose to be employed in the formulation will also vary depending on the route of administration, and the severity of the disease or disorder, and should be decided according to the judgment of the attending physician and each patient's circumstances.
- the dosage of the virus-derived construct or virus-derived construct-containing composition of the present disclosure is not particularly limited, but for example, 1 x 10 5 pieces, 1 x 10 6 pieces, 1 x 10 7 pieces, 1 x 10 8 pieces per dose.
- the administration interval is not particularly limited, but for example, it may be administered once or twice every 1, 7, 14, 21, or 28 days, or once or twice within the range of any two of these values. Good too.
- the dosage, administration interval, and administration method may be appropriately selected depending on the patient's age, weight, symptoms, target organ, etc.
- Administration routes for the virus-derived constructs or virus-derived construct-containing compositions described herein include, for example, intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal, intrathecal, intraventricular, intraparenchymal, and pulmonary. , intranasal, epidural, or oral administration.
- the compositions of the present disclosure can be used with a variety of delivery systems. Such systems include, for example, encapsulation in liposomes, microparticles, and microcapsules: the use of receptor-mediated endocytosis.
- the medicament may be administered by any suitable route, such as by infusion, by bolus injection, by absorption through epithelial or mucocutaneous linings (such as the oral cavity, rectum, and intestinal mucosa), and as required.
- An inhaler or nebulizer may be used with an aerosolizing agent, and it may also be administered with other drugs. Administration can also be systemic or local.
- the composition of the present disclosure can be provided as a kit.
- the present disclosure provides a kit for making a virus-derived construct, the kit comprising a virus-derived construct plasmid of the present disclosure.
- the present disclosure provides a pharmaceutical pack or kit that includes one or more containers filled with one or more ingredients that can be added to the compositions of the present disclosure.
- Manufacture, use or sale for human administration by a government agency regulating the manufacture, use or sale of pharmaceutical or biological products as the case may be, in the form prescribed by the agency regulating the manufacture, use or sale of pharmaceutical or biological products. It is also possible to indicate information indicating authorization.
- the reagents used were the products described in the examples, but equivalent products from other manufacturers (Sigma-Aldrich, Wako Pure Chemical, Nacalai, R&D Systems, USCN Life Science INC, etc.) can be substituted.
- LB medium is prepared by dissolving 10 g of Bactotryptone, 5 g of yeast extract, and 5 g of sodium chloride in 1 L of water. When making an agar plate, add 15 g of Bacto Agar and autoclave (121°C, 20 minutes). Prepared. If necessary, carbenicillin (final concentration 100 ⁇ g/mL) or tetracycline (final concentration 10 ⁇ g/mL) was added and used.
- TF-I medium and TF-II medium for Bacillus subtilis transformation were prepared as follows.
- TF-I medium 500 mL was prepared by mixing and filtering, and stored at 4°C until use. Use the same medium as the TF-I medium, except use 2.5 mL of 2% casamino acids, 0.5 mL of each amino acid solution (5 mg/mL), and 435.5 mL of sterile water, and filter. A TF-II medium (500 mL) was prepared and stored at 4°C until use.
- Bacillus subtilis transformation method Pour 2 mL of LB medium into a Falcon 14 mL test tube (2051), inoculate it with Bacillus subtilis from a glycerol stock stored at -70°C, and incubate at 37°C for 17 days while rotating in a rotary culture device. Cultured for hours. Dispense 900 ⁇ L of TF-I medium into a new 14 mL test tube (Falcon 2051), add 25 ⁇ L of 2% casamino acids, add 50 ⁇ L of preculture solution, and incubate at 37°C for 40 minutes while rotating in a rotary culture device. Cultured for hours.
- 900 ⁇ L of TF-II medium was dispensed into a new 14 mL test tube, 100 ⁇ L of TF-I culture solution was added, and cultured at 37° C. for 1.5 hours while rotating with a rotary culture device.
- 100 ⁇ L of TF-II culture solution was placed in a 1.5 mL centrifuge tube, and 8 ⁇ L of DNA was added.
- 300 ⁇ L of LB medium was added, and further culturing was performed at 37° C. for 1 hour while rotating with a rotary culture device.
- transformants were obtained by spreading on an LB medium agar plate containing 10 ⁇ g/mL of tetracycline and incubating at 37° C. overnight.
- Centrifugation was performed at 5,000 ⁇ g for 10 minutes, and the supernatant was pipetted into a new 4-screw cap 50 mL tube (Falcon 2070). 20 mL of 100% ethanol was added to each, mixed, centrifuged at 5,000 xg for 10 minutes, and the supernatant was removed. 5.4 mL of TE was added to the precipitate and completely dissolved. Next, 6.40 g of cesium chloride was added and completely dissolved. Furthermore, 2.6 mL of a 1.1 g/mL cesium chloride solution (a solution prepared by mixing 1.1 g of cesium chloride and 1 mL of water, the volume was not adjusted) was added.
- a 1.1 g/mL cesium chloride solution a solution prepared by mixing 1.1 g of cesium chloride and 1 mL of water, the volume was not adjusted
- Example 1 Screening using DNA barcodes from bulk transfected All-in-One library
- All-in-One genome that serves as the seed plasmid contains the rAAV region (reporter gene surrounded by two ITR sequences), which is normally carried separately in three plasmid vectors. ), Helper region (VA, E4, E2A), and Rep/Cap region were designed to have a structure in which they were linked in this order (FIG. 1).
- the order and direction of adjacent DNA fragments are specified by the complementarity of these overhanging parts. Therefore, the seed plasmids were designed so that the unit DNAs located at the same location had the same protruding sequence for all types of seed plasmids, as shown in FIG.
- Some of the genes planned for use may have natural SfiI recognition sequences, but the recognition sequences on protein-encoding genes are replaced with synonymous codons, and the recognition sequences on non-coding regions such as within ITR sequences are The SfiI recognition site was deleted by changing .
- the obtained DNA solution was measured using a micro-volume spectrophotometer (Nano drop One, Thermofisher), and diluted by adding TE buffer to 100 ng/ ⁇ L. Thereafter, the concentration was measured again, and the volume required to accurately fractionate 500 ng of DNA was calculated to two decimal places ⁇ L, and each plasmid was fractionated using a micropipette to adjust the mole of each plasmid to equimolar. The fractionated DNA solution was divided and pooled into two or three 1.5 mL centrifuge tubes depending on the type of restriction enzyme used (Table A).
- the tube for cutting with AarI when the total volume of the plasmid solution is 1 volume, 1.94 volumes of sterile water, 0.33 volumes of 10x Buffer AarI (Thermofisher), 0.06 A volume of 50x oligonucleotide (0.025mM) and 0.17 volume of AarI (Thermofisher) were added and reacted at 37°C for 2 hours.
- the tube for cutting with BsaI contains 2 volumes of sterile water, 0.33 volumes of 10XCutSmart buffer (NEB), and 0.17 volumes of BsaI-HF v2, when the total volume of the plasmid solution is 1 volume. was added and reacted at 37°C for 2 hours.
- an equimolar mixture of 18 or 19 fragments of approximately 600 to 900 bp cut out from pBR-delTypeIIS-3-AarI was size-fractionated by electrophoresis using a low melting point agarose gel, and the A mixture of 18 or 19 fragments was purified according to the method for excision and purification of DNA fragments from electrophoresis gels.
- Plasmid pGETS118-AarI (Tsuge et al., Scientific Reports, 5, 10655) was cut with the restriction enzyme AarI, size separated by low melting point agarose gel electrophoresis, and the large 15 kb fragment was removed from the gel. It was excised and purified to obtain a fragment for OGAB accumulation.
- ⁇ Plasmid formation by OGAB method Add TE buffer solution to the obtained mixed solution of 18 to 19 types of DNA fragments (10 fmol) and the above fragment for OGAB accumulation (10 fmol) for a total of 4 ⁇ L, and add thereto. Add 5 ⁇ L of 2x ligation buffer (15% polyethylene glycol 6000, 500 mM NaCl, 132 mM Tris ⁇ HCl (pH 7.6), 13.2 mM MgCl2, 20 mM DTT, 0.2 mM ATP) to the solution, mix well, and then add 1 ⁇ L of T4 DNA Ligase (Takara Bio) was added and incubated at 37° C. for 5 hours to prepare transformation DNA ligated into tandem repeats.
- 2x ligation buffer (15% polyethylene glycol 6000, 500 mM NaCl, 132 mM Tris ⁇ HCl (pH 7.6), 13.2 mM MgCl2, 20 mM DTT, 0.2 mM ATP
- plasmid mass preparation method Highly pure plasmid DNA was prepared by cesium chloride-ethidium bromide density gradient ultracentrifugation. 200 mL of LB medium to which tetracycline was added at a concentration of 10 ⁇ g/mL was prepared, 100 mL of each was placed in 500 mL Erlenmeyer flasks, and the Bacillus subtilis plasmid-carrying strain was inoculated and cultured at 37° C. for 16 hours. Thereafter, IPTG was added to 1 mM and cultured for another day to increase the copy number of the plasmid, and then the plasmid was purified by ultracentrifugation.
- DNA barcode fragment 1 nmol of chemically synthesized DNA (SEQ ID NO: 100) having a random sequence synthesized by introducing 10 consecutive N (any of A, T, G, or C bases) during synthesis.
- 2 ⁇ L of After adding ExTaq polymerase (Takara) the mixture was denatured at 99°C for 10 minutes using a PCR device, and then reacted at 58°C for 1 minute and at 72°C for 20 minutes.
- the reaction product was purified using MiniElute PCR Purification Kit to obtain a DNA fragment dissolved in 15 ⁇ L of TE. After adding 9 ⁇ L of water, 3 ⁇ L of 10 ⁇ CutSmart Buffer, and 3 ⁇ L of DraIII-HF and reacting at 37°C for 30 minutes, the reaction product was purified again using the MiniElute PCR Purification Kit, and the DNA dissolved in 15 ⁇ L of TE was added. Obtained barcode fragment.
- ⁇ CombiOGAB library Mix 1 ⁇ g of 5 types of seed plasmids obtained through mass preparation, add water to 85 ⁇ L, add 10 ⁇ L of 10 ⁇ Cut Smart buffer (NEB), 5 ⁇ L of restriction enzyme SfiI, and incubate at 50°C. It reacted for 1 hour. After the reaction is complete, add 600 ⁇ L of water and 500 ⁇ L of TE-saturated phenol (Nacalai Tesque) and mix. Centrifuge at 20,000 x g for 5 minutes to separate into two phases, and transfer the aqueous phase to a new 1.5 mL tube.
- NEB 10 ⁇ Cut Smart buffer
- SfiI restriction enzyme
- Plasmid DNA (plasmid derived from Bacillus subtilis) was obtained by preparing a large amount of Bacillus subtilis plasmid as described above.
- the molecular abundance ratio of each DNA barcode was investigated using Miseq (Illumina) for the obtained DNA. Furthermore, for the ALL-in-One plasmid used for transfection, the molecular abundance ratio of each DNA barcode was determined in the same manner, and the transfection ratio for each clone was determined. The results are shown in Table 2. It was found that the amount produced per unit DNA of the viral vector differs depending on the sequence of All-in-One.
- Viral genomic DNA was extracted using the same method as for the Bacillus subtilis-derived plasmid, and the abundance ratio was examined using MiSeq. The results are shown in Table 2. The obtained results showed almost the same results as the plasmid derived from Bacillus subtilis. *The absence of the number of the derived seed plasmid indicates that the corresponding seed plasmid could not be detected. *Out/In is the genome copy number of the viral vector obtained in one transfection experiment and the copy number of the plasmid used at the time of transfection, calculated based on the number of reads of the DNA barcode region by a next-generation sequencer. shows the ratio of
- Example 2 All-in-One screening by individual transfection
- Table 3 Design of CombiOGAB library
- each recombination unit of 5'ITR, 3'ITR, Helper, and Rep was designed as shown in Table 3 and Figure 3 below.
- a total of 8 types of seed plasmids including new seed plasmids were designed.
- the 3'ITR of #1 in Example 1 was changed from that of AAV-2 to that of AAV-5.
- SEQ ID NO: 104 a DNA fragment newly synthesized from the third fragment of #1 of Example 1 is shown in SEQ ID NO: 104.
- fragments 18 to 19 prepared for synthesis of #6 to #8 are shown in SEQ ID NOs: 105 to 159.
- restriction enzymes used to cut out DNA fragments for the OGAB method are shown in Table A.
- each plasmid was digested with NotI, and then a short NotI fragment of approximately 100 bp to be deleted was extracted. It was removed by electrophoresis and the remaining two fragments were closed. By introducing this into E. coli JM109, a seed plasmid containing one less SfiI fragment than in Example 1 was constructed.
- the base sequences of plasmids #1 to #8 are shown in SEQ ID NOs: 160 to 167.
- the obtained plasmid was fragmented using Illumina prep (Illumina) and analyzed using Miseq (Illumina) to identify the seed plasmid from which each plasmid was derived.
- the results for 48 of these clones are shown in Table 4 below.
- construction of plasmid libraries containing various combinations of Helper recombination units and Rep recombination units was confirmed.
- Benzonase 200 units was added to 10x Lysis buffer (20mM MgCl2 , 1.5M NaCl, 500mM Tris, 1% Triton (registered trademark) X-100; pH 7.5). /mL) was added at 10v/v% and reacted at 37°C for 60 minutes. Thereafter, 2/100 volume of 1.9M MgSO 4 solution was added, and the mixture was allowed to stand at room temperature for 10 minutes. The supernatant was collected by centrifugation at 3,750 rpm for 10 minutes at room temperature.
- a sample was treated with DNaseI for 30 minutes and reacted at 95° C. for 10 minutes, diluted 1000 times, and subjected to qPCR.
- the target was ITR2, and the primer sequences SEQ ID NO: 168 and SEQ ID NO: 169 were used.
- the reaction conditions were 95°C for 10 minutes, followed by 40 cycles of 95°C/15 seconds, 55°C/5 seconds, and 72°C/30 seconds.
- Table 4 Even in the individual screening system, it was possible to screen All-in-One plasmids with different amounts of virus production. *The absence of the number of the derived seed plasmid indicates that the corresponding seed plasmid could not be detected.
- a sample was treated with DNaseI for 30 minutes and reacted at 95°C for 10 minutes, then diluted 1000 times, and qPCR was performed.
- the target was the 3'ITR of AAV-2, and the primer sequences SEQ ID NO: 168 and SEQ ID NO: 169 were used.
- the reaction conditions were 95°C for 10 minutes, followed by 40 cycles of 95°C/15 seconds, 55°C/5 seconds, and 72°C/30 seconds. The results are shown in Figure 4.
- the AAV2 production amount of Control (pGETS103-AAV-Helper-RC2, SEQ ID NO: 170), #20, #24, and #46 was 1.55 ⁇ 10 10 GC/mL, 1.62 ⁇ 10 9 GC/mL, 4 The production amount of #46 was high at .07 ⁇ 10 9 GC/mL and 2.44 ⁇ 10 10 GC/mL.
- rAAV was purified to evaluate the empty/full rate of #46.
- 0.5 mL, 2.5 mL, and 1.0 mL of three types of cesium chloride solutions (1.35 g/cm 3 , 1.27 g/cm 3 , 1.25 g/cm 3 ) were layered, and rAAV was added thereto.
- the cell extract was overlaid.
- Density gradient centrifugation was performed at 226,000 x g, 18°C, for 1.5 hours, and about 2 mL of a solution around 1.27 g/cm 3 was collected, and Pluronic (registered trademark) F-68 was added to a final concentration of 0.001. % was added.
- TBS 0.005% Pluronic® F-68, 10% sucrose, 100 mM Tris, 200mM NaCl, pH 7.4.
- Pluronic® F-68 10% sucrose, 100 mM Tris, 200mM NaCl, pH 7.4
- Example 3 Assumed seed plasmid structure
- Examples of possible seed plasmid structures are shown in FIGS. 6 to 10.
- Each functional unit shown in the schematic diagram may be included separately in one substitute unit nucleic acid, or a plurality of adjacent functional units may be included in one substitute unit nucleic acid.
- the method for producing a virus-derived construct plasmid of the present disclosure is carried out to obtain a plasmid with excellent desired functions (for example, the production amount of a virus-derived construct).
- *Promoter (weak, medium, strong) is indicated by shading.
- *Promoter (arrow) indicates positive/negative direction.
- Figure 6 Example for AAV vector plasmid with All-in-One structure
- Figure 6A Example of the order of ITR ⁇ Rep ⁇ Cap ⁇ Helper
- Figure 6B Example of the order of Rep ⁇ ITR ⁇ Cap ⁇ Helper (a structure in which the positions of Rep and Cap are exchanged is also contemplated)
- Figure 6C Example where Helper genes are divided and arranged
- Figure 7 Examination example of Rep/Cap variations
- Figure 7A An example of examining the arrangement where the Rep gene is divided and variations in the expression strength of the promoter.
- Figure 7B An example of examining the arrangement where the Cep gene is divided and the variations in the expression strength of the promoter. Indicated by shading.
- Figure 8 Example of consideration of Helper variations
- Figure 8A Example of examination of the arrangement of divided Helper genes and variations in promoter expression intensity
- Figure 8B Combination of AdV-derived Helper genes and Helper genes derived from other viruses and variations in positive and negative promoter orientations
- Study example/Figure 8C Study example of combinations of AdV-derived Helper genes and nucleic acid sequences involved in biosynthesis and variations in positive and negative promoter orientations
- Figure 9 Example for lentiviral vector plasmid
- Figure 9A Example of examining variation in expression intensity of promoter of LV vector plasmid with All-in-One structure
- Figure 9B Example of examining variation in expression intensity of multiple desired genes
- Figure 10 Example for adenovirus vector plasmid
- Figure 10A Example of examining variation in structural protein of AdV vector plasmid with All-in-One structure
- Figure 10B Example of examining variation in expression intensity of multiple desired genes
- Example 4 Combinatorial promoter library of helper gene expression plasmid
- Table 5 shows five types of pHelper seed plasmids (SEQ ID NOs: 237 to 241) carrying E1A and E1B regions in addition to the VA, E4, and E2A regions normally used in helper plasmids. It was designed as follows. Using these plasmids, AAV production in producer cells other than HEK293 and HEK293T cells is possible.
- any of the sequences of three types of promoters with different expression strengths (UBC promoter, mPGK promoter, and EF1A promoter) were linked to each gene region (see Figure 11). (see ).
- VA each gene, and the polyA signal sequence downstream thereof are designed in common among the seed plasmids, and the target of the combinatorial library by the CombiOGAB method is the promoter portion.
- Each 3'-terminal overhang of 3 bases generated when each SfiI recognition site was cleaved was designed to be a unique sequence within the plasmid.
- the order and direction of adjacent DNA fragments are specified by the complementarity of these overhanging parts. Therefore, the seed plasmids were designed so that the corresponding unit DNA at each gene position had the same protruding sequence for all types of seed plasmids, as shown in FIG. 11.
- Some genes intended for use naturally contain SfiI recognition sequences, which may be replaced by synonymous codons in the case of protein-coding sequences, or replaced by sequences in non-coding regions, such as within ITR sequences. It was erased by changing it.
- pBR-delTypeIIS-1st pBR-delTypeIIS-2nd, pBR, which are plasmid vectors constructed so that the unit DNA containing the promoter-ORF-polyA signal can be excised with SfiI.
- the five cloning plasmids, -delTypeIIS-3rd, pBR-delTypeIIS-4th, and pBR-delTypeIIS-5th were obtained by cleaving pBR-delTypeIIS-3-AarI (SEQ ID NO: 99) with AarI, followed by SEQ ID NO: 171 and 172, respectively.
- SEQ ID NO: 181 and 182 For confirmation and amplification of promoter fragments for WT_E2A, WT_E4, WT_E1A, WT_E1B, UBC, mPGK, and EF1A, respectively, SEQ ID NO: 181 and 182, SEQ ID NO: 183 and 184, SEQ ID NO: 185 and 186, SEQ ID NO: 187. and 188, SEQ ID NO: 189 and 190, SEQ ID NO: 191 and 192, and SEQ ID NO: 193 and 194 were used.
- VA For confirmation and amplification of the genes (VA) and ORFs of VA (including WT_endogenous promoter), WT_E2A, WT_E4, WT_E1A, and WT_E1B, SEQ ID NO: 195 and 196, SEQ ID NO: 197 and 198, SEQ ID NO: 199 and 200, SEQ ID NOs: 201 and 202, and SEQ ID NOs: 203 and 204 were used.
- VA including WT_endogenous promoter
- WT_E2A, WT_E4, WT_E1A, and WT_E1B SEQ ID NO: 195 and 196, SEQ ID NO: 197 and 198, SEQ ID NO: 199 and 200, SEQ ID NOs: 201 and 202, and SEQ ID NOs: 203 and 204 were used.
- bGH polyA signal For confirmation and amplification of SV40 polyA signal, bGH polyA signal, hGH polyA signal, and HSV polyA signal, SEQ ID NO: 205 and 206, SEQ ID NO: 207 and 208, SEQ ID NO: 209 and 210, SEQ ID NO:
- the primer sets shown in 211 and 212 were used.
- a recognition site for BspQI a TypeIIS restriction enzyme that can generate any three-nucleotide sequence, is introduced at the 5' end of these primers, and by cleaving the obtained DNA fragment with BspQI, Overhang sequences were designed in five cloning plasmid vectors, pBR-delTypeIIS-1st to -5th, so that promoter-ORF-polyA signals could be integrated in this order.
- These amplified DNAs were ligated to pTAKN-2 to construct 16 types of plasmids containing each fragment.
- Escherichia coli carrying the OGAB block plasmid was purified from 2 mL of LB medium using the QIAprep Spin Miniprep Kit (Qiagen), the plasmid was purified using the automated system QIAcube, and finally 30 ⁇ L of TE. Eluted in buffer.
- the obtained plasmid was digested with restriction enzymes SfiI (NEB) and ApaLI (NEB), and 17 types of fragments ranging from about 0.8 kb to 3.2 kb were recovered by electrophoresis using a low melting point agarose gel.
- Plasmid pGETS161 is cut with restriction enzyme SfiI, size separated by low melting point agarose gel electrophoresis, and the large 5.8 kb fragment is cut out from the gel and purified to obtain a fragment for OGAB accumulation. obtained.
- the aqueous phase was separated, 320 ⁇ L of the aqueous phase was transferred to a new tube, 900 ⁇ L of ethanol was added thereto, and the mixture was centrifuged at 20,000 ⁇ g for 10 minutes. The supernatant was removed with a micropipette and 900 ⁇ L of 70% ethanol was added to rinse the entire tube. Thereafter, 70% ethanol was removed with a micropipette, and the resulting precipitate was dissolved in 25 ⁇ L of TE buffer.
- plasmid mass preparation method Highly pure plasmid DNA was prepared by cesium chloride-ethidium bromide density gradient ultracentrifugation. Prepare 200 mL of LB medium with tetracycline added to 10 ⁇ g/mL, add 100 mL each to 500 mL Erlenmeyer flasks, inoculate with Bacillus subtilis plasmid-carrying strain, and culture at 37°C for 16 hours, followed by ultracentrifugation. The plasmid was purified by These plasmids were fragmented using Illumina prep (Illumina), and the entire base sequence was determined using MiSeq (Illumina) to obtain clones that correctly integrated each seed plasmid.
- Illumina prep Illumina
- MiSeq Illumina
- ⁇ CombiOGAB library After adding water to 2 ⁇ g of four types of seed plasmids obtained by mass preparation to make 85 ⁇ L, add 10 ⁇ L of 10 ⁇ Cut Smart buffer (NEB) and 5 ⁇ L of restriction enzyme SfiI, and incubate at 50°C. Time reacted. After the reaction is complete, add 50 ⁇ L of water and 150 ⁇ L of TE-saturated phenol (Nacalai Tesque) and mix. Separate into two phases by centrifuging at 20,000 x g for 5 minutes, and transfer the aqueous phase to a new 1.5 mL tube.
- NEB 10 ⁇ Cut Smart buffer
- SfiI restriction enzyme
- the mixture was centrifuged at 6,800 ⁇ g for 3 minutes, the supernatant was removed with a micropipette, and the plasmid was purified using the QIAprep Spin Miniprep Kit (Qiagen) using the automated system QIAcube, and finally eluted in 30 ⁇ L of TE buffer.
- Plasmid DNA Bacillus subtilis-derived plasmids
- plasmids derived from the 96 colonies mentioned above and seed plasmid #9. These plasmids were introduced into HeLa cells and viral particle production was evaluated.
- HeLa cells were seeded in a 24-well plate. After 22 hours, the medium was replaced with 0.38 mL of DMEM medium (2% FBS, 1% penicillin/streptomycin), and cultured at 37° C. and 5% CO 2 for 2 hours. Thereto was added 20 ⁇ L of a transfection solution containing 0.10 ⁇ g of pAAV-GFP plasmid, 0.13 ⁇ g of pR2C1 plasmid, 0.33 ⁇ g of pHelper library plasmid, and 1 volume of PEI pro and DMEM medium. After culturing for 72 hours at 37°C and 5% CO, the supernatant was collected and the rAAV genome copy number was quantified.
- DMEM medium 2% FBS, 1% penicillin/streptomycin
- the supernatant was treated with DNaseI for 30 minutes, and the sample prepared by reacting at 95°C for 10 minutes was diluted 1000 times and qPCR was performed.
- the primer sequences 5'-CATCAATGGGCGTGGATAGC-3' (SEQ ID NO: 213) and 5'-GGAGTTGTTACGACATTTTGGAAA-3' (SEQ ID NO: 314) targeting the CMV promoter were used.
- the reaction conditions were 95°C for 10 minutes, followed by 40 cycles of 95°C/15 seconds, 55°C/5 seconds, and 72°C/30 seconds.
- Example 5 Promoter library of pDual (Helper/Rep/Cap) gene expression plasmid
- Example 5 Design of seed plasmid for CombiOGAB method
- a pDual species carrying the VA, E4, and E2A regions normally used in helper plasmids, the Rep gene of serotype 2, and the Cap gene of serotype 1 was created.
- Five types of plasmids (SEQ ID NOs: 242 to 246) were designed as shown in Table 6. These plasmids are capable of producing AAV in HEK293 and HEK293T cells.
- VA each gene, and the polyA signal sequence downstream thereof are designed in common among the seed plasmids, and the target of the combinatorial library by the CombiOGAB method is the promoter portion.
- Each 3'-terminal overhang of 3 bases generated when each SfiI recognition site was cleaved was designed to be a unique sequence within the plasmid.
- the order and direction of adjacent DNA fragments are specified by the complementarity of these overhanging parts. Therefore, the seed plasmids were designed so that the corresponding unit DNA at each gene position had the same protruding sequence for all types of seed plasmids, as shown in FIG. 13.
- Some genes intended for use naturally contain SfiI recognition sequences, which may be replaced by synonymous codons in the case of protein-coding sequences, or replaced by sequences in non-coding regions, such as within ITR sequences. It was erased by changing it.
- Example 4 Of the other necessary DNAs, those constructed in Example 4 were used as they were. Those not included in Example 4 were obtained by PCR from appropriate template DNA in the same manner as in Example 4, and then cloned into pTAKN-2. For confirmation and amplification of the Cap2 and Rep1 promoter fragments, primer sets shown in SEQ ID NOs: 215 and 216, and SEQ ID NOs: 217 and 218, respectively, were used. For confirmation and amplification of the Cap2 and Rep1 ORFs, primer sets shown in SEQ ID NOs: 219 and 220 and SEQ ID NOs: 221 and 222 were used, respectively. In the same manner as in Example 4, an OGAB block plasmid for preparing the DNA fragments listed in Table 6 was constructed.
- ⁇ CombiOGAB library Four seed plasmids #15, #16, #17, and #18 obtained by mass preparation were cut with restriction enzyme SfiI, T4 DNA ligase was added, and after mixing, incubated at 37°C for 2 hours. used for transformation. Approximately 30,000 colonies were obtained as a result of overnight culture at 37° C. at LB rate containing tetracycline.
- rAAV Production of rAAV from pDual promoter library
- 96 of these colonies were randomly selected and plasmids were purified.
- a total of 97 types of plasmid DNA (Bacillus subtilis-derived plasmid) including seed plasmid #14 were introduced into HEK293 cells, and virus particle production was evaluated.
- HEK293 cells On the day before transfection, 0.225 ⁇ 10 6 HEK293 cells were seeded in a 24-well plate. After 22 hours, the medium was replaced with 0.38 mL of DMEM medium (2% FBS, 1% penicillin/streptomycin), and cultured at 37° C. and 5% CO 2 for 2 hours. Thereto was added 20 ⁇ L of a transfection solution containing 0.10 ⁇ g of pAAV-GFP plasmid, 0.34 ⁇ g of pDual library plasmid, 1 volume of PEI pro, and DMEM medium.
- DMEM medium 2% FBS, 1% penicillin/streptomycin
- a transfection solution containing 0.10 ⁇ g of pAAV-GFP plasmid, 0.12 ⁇ g of pR2C1 plasmid, 0.22 ⁇ g of pHelper plasmid, 1 volume of PEI pro, and DMEM medium was added. After culturing for 72 hours at 37°C and 5% CO, the supernatant was collected and the rAAV genome copy number was quantified.
- the supernatant was treated with DNaseI for 30 minutes, and the sample prepared by reacting at 95°C for 10 minutes was diluted 1000 times and qPCR was performed.
- the primer sequences 5'-CATCAATGGGCGTGGATAGC-3' (SEQ ID NO: 213) and 5'-GGAGTTGTTACGACATTTTGGAAA-3' (SEQ ID NO: 214) targeting the CMV promoter were used.
- the reaction conditions were 95°C for 10 minutes, followed by 40 cycles of 95°C/15 seconds, 55°C/5 seconds, and 72°C/30 seconds.
- Each plasmid used in the above examples was obtained or produced as follows.
- ⁇ pAAV-GFP Purchased from Vector Builder (pAAV[Exp]-CMV>EGFP:WPRE).
- ⁇ VB3_pAAV-EF1A-dTomato-T2A-Hygro It was purchased from Vector Builder (pAAV[Exp]-EF1A>dTomato(ns):T2A:Hygro).
- ⁇ VB6_pAAV-UBC-EBFP (VB) Purchased from Vector Builder (pAAV[Exp]-UBC>EBFP).
- ⁇ VB7_VB211117-TRE-tTA Purchased from Vector Builder (pRP[Exp]-TRE>tTA).
- ⁇ 6230_pAAV-CMV Purchased from TAKARA (6230_pAAV-CMV).
- SYNp34_pHelper The pUC19 vector plasmid (Addgene: #500005) was treated with restriction enzymes (AatII, PciI). The following three fragments (VA fragment, E4 fragment, and E2A fragment) were inserted therein using InFusion.
- the VA fragment was prepared using the Ad5 genome (see ATCC VR-1516) as a template and the following primers: primer sequence 5'-ttagtaagcttccctctgacgcggtaggaggaggggaggtgccctgcatg-3' (SEQ ID NO: 223), 5'-ccttttgctc acatgtcaattggtagatgtacctggacatccaggtgatgccggcg- 3' (SEQ ID NO: 224).
- the E4 fragment was prepared using the Ad5 genome as a template and the following primers: primer sequence 5'-tgtacaGGCGCGCCgaattcgttttagggcggagtaacttgtatgtgttgggaattgtag-3' (SEQ ID NO: 225), 5'-agggaagcttactaaacggt acacaggaaacaggagacacaactccaagtg-3' (SEQ ID NO: 226).
- the E2A fragment was prepared using the Ad5 genome as a template and the following primers: primer sequence 5'-gaaaagtgccacctgacgtcgcggccgcGCGATCGCggtacccaactccatgctcaacagtccccaggtacagccc-3' (SEQ ID NO: 227), 5'-gaa ttcGGCGCGCCtgtacagcccgggcgacgcaccctgtgacgaaagccgccgcaag-3' (SEQ ID NO: 228).
- pUC19 vector plasmid (Addgene: #500005) was treated with restriction enzymes (AatII, PciI). The following three fragments (p5 gene fragment, AAV2 Rep fragment, and SV40 ori fragment) were inserted therein using InFusion.
- the p5 gene fragment was prepared using the following primers: primer sequence 5'-gaaaagtgccacctgacgtcgcggccgcggaggggtggagtcgtgacgtgaattacgtcataggttaggaggtcctgtattagaggtcacgtgagtgtt ttgcgac-3' (SEQ ID NO: 229), 5'-gttcaaacctcccgcttcaaaatggagaccctgcgtgctcactcgggcttaaatacccagcgtgaccacatggtgtcgcaaaatgtcgcaaaacactca-3' (SEQ ID NO: 230).
- AAV2 Rep fragment was prepared using pRC2-mi342 (Takara) as a template and the following primers: primer sequence 5'-gcgggaggtttgaacgcgcagccgccATGCCGGGGTTTTAC-3' (SEQ ID NO: 231), 5'-GATCGCAGCGCTattaaat catTTATTGTTCAAAGAT-3' (SEQ ID NO: 232 ).
- the SV40 ori fragment was prepared using the SV40 ori gene sequence (TOYOBO) as a template and the following primers: primer sequence 5'-aatAGCGCTGCGATCGCggcctccaaaaaagc-3' (SEQ ID NO: 233), 5'-cctttgctcacatgtcaattgatcccgcc cctaact-3' (SEQ ID NO: 234 ).
- the obtained plasmid was treated with restriction enzymes (Swal, AfeI).
- the AAV1 Cap fragment was inserted therein using InFusion.
- the AAV1 Cap fragment was prepared using pRC1 (Takara) as a template and the following primers: primer sequences 5'-AACAATAAatgatttaaatcagg-3' (SEQ ID NO: 235), 5'-ggccGCGATCGCAGCGCTgtagccatggaaactagata-3' (SEQ ID NO: 236).
- primer sequences 5'-AACAATAAatgatttaaatcagg-3' SEQ ID NO: 235
- 5'-ggccGCGATCGCAGCGCTgtagccatggaaactagata-3' SEQ ID NO: 236).
- ⁇ SYNp177_AIO_Helper-Ad5_R2C1_EGFP_wtE1_km It was produced by gene synthesis and OGAB method.
- 5'ITR2 vector builder
- CMV promoter vector builder
- EGFP vector builder
- WPRE vector builder
- hGH polyA signal TAKARA
- 3'ITR2 vector builder
- E2A Ad5
- E4 Ad5
- VA Ad5
- Cap AAV1
- Rep AAV2
- p5 AAV2
- E1A Ad5
- E1B Ad5
- pUC ori pUC19
- kanamycin resistance gene vector builder
- mPGK promoter vector builder
- the target introduced nucleic acid is divided into fragments of approximately 1 kb or less.
- the ends of each fragment are designed to be unique and complementary only to a specific fragment.
- Primers are designed for each of the fragments thus designed, and each fragment is prepared by PCR.
- Each fragment is cloned into a vector plasmid and each vector plasmid is used to transform E. coli to obtain a clone containing the correct sequence for each fragment. Plasmids are purified from these E. coli clones, and the DNA concentration of the plasmid solution is measured. Each plasmid solution is separated and mixed so that the amount of plasmid in each fragment is equal.
- Restriction enzymes are added to this mixture to produce DNA fragments, each with a unique end that is complementary only to a specific fragment. Thereafter, OGAB accumulation vectors cut with the same restriction enzymes are added to the solution in an amount that matches the molar concentration with each fragment, ligation is performed, and fragments with complementary ends (including fragments of OGAB accumulation vectors) are added to the solution. Connect pairs of . After adding this to Bacillus subtilis competent cells and culturing, transformed colonies are obtained. A plasmid having the desired structure is recovered from this colony. ⁇ SYNp44-2_pHelper(Ad5 ⁇ SfiI)_km It was produced by gene synthesis and OGAB method.
- E4 Ad5
- E2A Ad5 ⁇ SfiI
- VA Ad5
- pUC ori pUC19
- kanamycin resistance gene vector builder
- AmpR promoter pUC19
- virus-derived construct plasmids it is possible to efficiently produce various virus-derived construct plasmids, and virus-derived construct plasmids with improved performance can be efficiently obtained.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Crystallography & Structural Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3257330A CA3257330A1 (en) | 2022-05-02 | 2023-05-02 | VIRUS-DERIVED PLASMID BANK AND ITS CONSTRUCTION |
| AU2023265204A AU2023265204A1 (en) | 2022-05-02 | 2023-05-02 | Virus-derived construct plasmid library and construction of same |
| JP2024519231A JPWO2023214578A1 (https=) | 2022-05-02 | 2023-05-02 | |
| US18/862,464 US20250277236A1 (en) | 2022-05-02 | 2023-05-02 | Virus-derived construct plasmid library and construction of same |
| EP23799507.1A EP4520832A1 (en) | 2022-05-02 | 2023-05-02 | Virus-derived construct plasmid library and construction of same |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2022076058 | 2022-05-02 | ||
| JP2022-076058 | 2022-05-02 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023214578A1 true WO2023214578A1 (ja) | 2023-11-09 |
Family
ID=88646543
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2023/017130 Ceased WO2023214578A1 (ja) | 2022-05-02 | 2023-05-02 | ウイルス由来構築物プラスミドライブラリーおよびその構築 |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20250277236A1 (https=) |
| EP (1) | EP4520832A1 (https=) |
| JP (1) | JPWO2023214578A1 (https=) |
| AU (1) | AU2023265204A1 (https=) |
| CA (1) | CA3257330A1 (https=) |
| WO (1) | WO2023214578A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024068990A1 (en) * | 2022-09-30 | 2024-04-04 | Polyplus Transfection | A chimeric helper nucleic acid molecule comprising helper elements from three distinct helper viruses |
| WO2024143429A1 (ja) | 2022-12-27 | 2024-07-04 | 株式会社シンプロジェン | ヘルパー遺伝子制御 |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5908845A (en) | 1996-10-30 | 1999-06-01 | Segev; David | Polyether nucleic acids |
| WO2001090392A1 (en) | 2000-05-26 | 2001-11-29 | Sumitomo Pharmaceuticals Company, Limited | Novel recombinant adenovirus vector with relieved side effects |
| JP2002528049A (ja) * | 1998-07-22 | 2002-09-03 | イミューソル インコーポレイテッド | 実質的に完全なリボザイムライブラリー |
| WO2015111248A1 (ja) | 2014-01-21 | 2015-07-30 | 学校法人慶應義塾 | 単位dna組成物の調製方法及びdna連結体の作製方法 |
| US20180155740A1 (en) * | 2015-09-23 | 2018-06-07 | Wuhan Institute Of Physics And Mathematics, Chinese Academy Of Sciences | Recombinant baculovirus and method of using the same for preparing recombinant adeno-associated virus vector |
| JP2019198236A (ja) | 2018-05-14 | 2019-11-21 | 国立大学法人神戸大学 | 二本鎖dna合成方法 |
| WO2020203496A1 (ja) | 2019-04-01 | 2020-10-08 | 国立大学法人神戸大学 | キメラプラスミドライブラリーの構築方法 |
| JP2020188763A (ja) * | 2019-05-20 | 2020-11-26 | Jcrファーマ株式会社 | 組換えaavビリオンの製造に用いる核酸分子 |
| JP2021502799A (ja) * | 2017-09-19 | 2021-02-04 | オックスフォード ジェネティクス リミテッドOxford Genetics Limited | レトロウイルスベクター |
| JP2021510496A (ja) * | 2018-01-19 | 2021-04-30 | オックスフォード ジェネティクス リミテッドOxford Genetics Limited | Aav粒子の産生を目的としたベクター |
| WO2022097646A1 (ja) * | 2020-11-04 | 2022-05-12 | 株式会社シンプロジェン | 枯草菌におけるウイルスベクタープラスミド生産 |
-
2023
- 2023-05-02 JP JP2024519231A patent/JPWO2023214578A1/ja active Pending
- 2023-05-02 CA CA3257330A patent/CA3257330A1/en active Pending
- 2023-05-02 US US18/862,464 patent/US20250277236A1/en active Pending
- 2023-05-02 AU AU2023265204A patent/AU2023265204A1/en active Pending
- 2023-05-02 EP EP23799507.1A patent/EP4520832A1/en active Pending
- 2023-05-02 WO PCT/JP2023/017130 patent/WO2023214578A1/ja not_active Ceased
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5908845A (en) | 1996-10-30 | 1999-06-01 | Segev; David | Polyether nucleic acids |
| JP2002528049A (ja) * | 1998-07-22 | 2002-09-03 | イミューソル インコーポレイテッド | 実質的に完全なリボザイムライブラリー |
| WO2001090392A1 (en) | 2000-05-26 | 2001-11-29 | Sumitomo Pharmaceuticals Company, Limited | Novel recombinant adenovirus vector with relieved side effects |
| WO2015111248A1 (ja) | 2014-01-21 | 2015-07-30 | 学校法人慶應義塾 | 単位dna組成物の調製方法及びdna連結体の作製方法 |
| US20180155740A1 (en) * | 2015-09-23 | 2018-06-07 | Wuhan Institute Of Physics And Mathematics, Chinese Academy Of Sciences | Recombinant baculovirus and method of using the same for preparing recombinant adeno-associated virus vector |
| JP2021502799A (ja) * | 2017-09-19 | 2021-02-04 | オックスフォード ジェネティクス リミテッドOxford Genetics Limited | レトロウイルスベクター |
| JP2021510496A (ja) * | 2018-01-19 | 2021-04-30 | オックスフォード ジェネティクス リミテッドOxford Genetics Limited | Aav粒子の産生を目的としたベクター |
| JP2019198236A (ja) | 2018-05-14 | 2019-11-21 | 国立大学法人神戸大学 | 二本鎖dna合成方法 |
| WO2020203496A1 (ja) | 2019-04-01 | 2020-10-08 | 国立大学法人神戸大学 | キメラプラスミドライブラリーの構築方法 |
| JP2020188763A (ja) * | 2019-05-20 | 2020-11-26 | Jcrファーマ株式会社 | 組換えaavビリオンの製造に用いる核酸分子 |
| WO2022097646A1 (ja) * | 2020-11-04 | 2022-05-12 | 株式会社シンプロジェン | 枯草菌におけるウイルスベクタープラスミド生産 |
Non-Patent Citations (10)
| Title |
|---|
| ANAGNOSTOPOULOU, C.SPIZEN, J., J. BACTERIOL., vol. 81, 1961, pages 741 - 746 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1995, WILEY INTERSCIENCE PUBLISHERS, article "Current Protocols in Molecular Biology" |
| CHRISTOPHER VOIGT (ED.): "Computer aided design and DNA assembly: Synthetic biology, Pt. B IN: Methods in Enzymology; ISSN 0076-6879; Vol. 498", vol. 498, 1 January 2011, ELSEVIER, ACAD. PRESS , NL , ISBN: 978-0-12-385120-8, article MITSUHIRO ITAYA, TSUGE KENJI, VOIGT CHRISTOPHER A.: "Construction and Manipulation of Giant DNA by a Genome Vector", pages: 427 - 447, XP055355825, DOI: 10.1016/B978-0-12-385120-8.00019-X * |
| IMANAKA, T. ET AL., J. GEN. MICROBIOI., vol. 130, 1984, pages 1399 - 1408 |
| ITAYA, M., BIOSCI. BIOTECHNOL. BIOCHEM., vol. 63, 1999, pages 602 - 604 |
| SAMBROOK, J. ET AL.: "Molecular Cloning: A Laboratory Manual", vol. 1, 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SWINFIELD, T. J. ET AL., GENE, vol. 87, 1990, pages 79 - 90 |
| TANAKA, TOGRA, M., FEBS LETT., vol. 422, 1998, pages 243 - 246 |
| TSUGE KENJI, MATSUI K, ITAYA M: "One step assembly of multiple DNA fragments with a designed order and orientation in Bacillus subtilis plasmid.", NUCLEIC ACIDS RESEARCH, OXFORD UNIVERSITY PRESS, GB, vol. 31, no. 21, 1 November 2003 (2003-11-01), GB , pages E133.1 - E133.8, XP002569369, ISSN: 0305-1048, DOI: 10.1093/NAR/GNG133 * |
| YANSURA, D.HENNER, D. J., PRO. NATL. ACAD. SCI, USA, vol. 81, 1984, pages 439 - 443 |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024068990A1 (en) * | 2022-09-30 | 2024-04-04 | Polyplus Transfection | A chimeric helper nucleic acid molecule comprising helper elements from three distinct helper viruses |
| WO2024143429A1 (ja) | 2022-12-27 | 2024-07-04 | 株式会社シンプロジェン | ヘルパー遺伝子制御 |
| EP4624584A1 (en) | 2022-12-27 | 2025-10-01 | Synplogen Co., Ltd. | Helper gene control |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2023265204A1 (en) | 2024-12-19 |
| CA3257330A1 (en) | 2025-04-22 |
| US20250277236A1 (en) | 2025-09-04 |
| JPWO2023214578A1 (https=) | 2023-11-09 |
| EP4520832A1 (en) | 2025-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7104263B1 (ja) | 枯草菌におけるウイルスベクタープラスミド生産 | |
| JP2021528959A (ja) | 細胞内で存続する遺伝子送達のためのベクター | |
| EP4624584A1 (en) | Helper gene control | |
| US20250230448A1 (en) | Integrative plasmid | |
| CA3157063A1 (en) | Dual viruses and dual oncolytic viruses and methods of treatment | |
| WO2023214578A1 (ja) | ウイルス由来構築物プラスミドライブラリーおよびその構築 | |
| US20260071232A1 (en) | Plasmid for virus-derived structure | |
| HK40090351A (zh) | 枯草杆菌中的病毒载体质粒生产 | |
| HK40101140A (en) | Production of virus vector plasmid in bacillus subtilis | |
| EP4660308A1 (en) | Helper gene | |
| HK40098582A (en) | Integrative plasmid | |
| HK40123233A (en) | Plasmid for virus-derived structure | |
| HK40090349A (zh) | 整合型质粒 | |
| HK40123223A (zh) | 来源於病毒的构建体质粒 | |
| EP4522632A1 (en) | Adeno-associated viral vectors for targeting brain microvasculature | |
| HK40050876A (en) | Vectors for gene delivery that persist within cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23799507 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024519231 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AU2023265204 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023799507 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023799507 Country of ref document: EP Effective date: 20241202 |
|
| ENP | Entry into the national phase |
Ref document number: 2023265204 Country of ref document: AU Date of ref document: 20230502 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 18862464 Country of ref document: US |