WO2023195749A1 - Novel foxn1 mutant and use thereof - Google Patents

Novel foxn1 mutant and use thereof Download PDF

Info

Publication number
WO2023195749A1
WO2023195749A1 PCT/KR2023/004541 KR2023004541W WO2023195749A1 WO 2023195749 A1 WO2023195749 A1 WO 2023195749A1 KR 2023004541 W KR2023004541 W KR 2023004541W WO 2023195749 A1 WO2023195749 A1 WO 2023195749A1
Authority
WO
WIPO (PCT)
Prior art keywords
foxn1
gene
mutant gene
variant
forkhead
Prior art date
Application number
PCT/KR2023/004541
Other languages
French (fr)
Korean (ko)
Inventor
염수청
이건성
Original Assignee
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단 filed Critical 서울대학교 산학협력단
Publication of WO2023195749A1 publication Critical patent/WO2023195749A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0653—Adipocytes; Adipose tissue
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/54—Proteins
    • A23V2250/542—Animal Protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/09—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from epidermal cells, from skin cells, from oral mucosa cells
    • C12N2506/094—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from epidermal cells, from skin cells, from oral mucosa cells from keratinocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1307—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from adult fibroblasts

Definitions

  • the present invention relates to novel Foxn1 variants and uses thereof.
  • Fat plays a role in maintaining energy homeostasis by chewing excessively consumed energy in the form of triglyceride. Fat accumulates in various areas of the skin, including the abdomen, subcutaneous tissue, skin, bone marrow, and muscle. Subcutaneous fat can be differentiated into beige adipocytes and is recently considered a major target for metabolic diseases. Dermal white adipose tissue (dWAT) is another type of fat that differs from subcutaneous fat in origin and function.
  • dWAT Dermal white adipose tissue
  • Dermal white adipose tissue has been considered to function as a simple mechanical cushion, but recent studies have shown that it is involved in skin immune response, wound healing, scar formation, hair follicle formation, and thermoregulation. Roughly 1) the development of dermal white adipose tissue is synchronized with the hair follicle cell cycle, and dermal white adipose tissue increases in the hair follicle formation stage (anagen stage); 2) the defect of dermal white adipose tissue is unable to respond to external bacterial infection; 3 ) Loss of dermal skin fat cells during aging is associated with decreased skin elasticity. The mechanism for selective differentiation or proliferation of dermal white adipocytes has not yet been identified.
  • Foxn1 (Forkhead-box N1) is a Forkhead box gene family member, expressed in the basal layer of thymic epithelial cells (TEC) and epidermal keratinocytes, and is a transcription factor and key player in TEC-derived T cell differentiation, education, and selection. It is an adjuster. Additionally, in the skin, Foxn1 regulates skin development, homeostasis of epidermal proliferation, dermal white adipose tissue (dWAT) adipogenesis, differentiation, and wound healing, and mutations in this gene can cause T cell immunodeficiency, skin diseases, It is known to be correlated with congenital hair loss, nail dystrophy, and dementia. Changes in the expression of the Foxn1 gene that occur in wound recovery and proliferation of dermal skin fat in the hair follicle cycle suggest a relationship between the Foxn1 gene and dermal skin fat differentiation, but are limited phenomena observed only in special environments such as wound recovery.
  • TEC thymic epithelial cells
  • missense mutations, nonsense mutations, and frame shift mutations of bases in the transcription frame of protein-coding genes can cause changes in the primary structure of the amino acid sequence of their protein products, generally only mutations that occur in the exon region of protein-coding genes This can lead to relatively large changes in protein product performance. These mutations can lead to loss of function or gain of function, and new useful traits can be discovered through random mutation induction and phenotypic analysis. Therefore, if it is possible to induce the proliferation of dermal skin fat by artificially inducing a mutation in the Foxn1 gene, it could be an effective new treatment and application method for related diseases and cosmetic aspects.
  • the present inventors made intensive research efforts to develop a method that can induce selective differentiation and proliferation of dermal white adipose tissue.
  • the Foxn1 c.55 C>A(p.L19M) variant was first identified by inducing random missense mutations through the CRISPR/Cas9 base editor editing system, and the novel Foxn1 L19M variant resulted in the formation of keratinocytes.
  • mesenchymal-type cells into mesenchymal-type cells
  • conversion of mesenchymal-type cells into preadipocytes activation of keratinocyte-derived adipogenic signals, increased dermal white adipose tissue production, and cell transition from fibroblasts to myofibroblasts are achieved.
  • the present invention was completed.
  • one object of the present invention is to provide a FoxN1 protein variant encoded by a FoxN1 (Forkhead-box N1) variant gene.
  • Another object of the present invention is to provide a method for inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes using a FoxN1 protein variant. It is to provide.
  • Another object of the present invention is to induce in vitro conversion from keratinocytes or fibroblasts containing FoxN1 protein variants to preadipocytes or adipocytes. To provide a composition.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; The object is to provide a cosmetic composition for fat filling or skin regeneration comprising; or a FoxN1 protein variant encoded by the FoxN1 mutant gene.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; The object is to provide a food composition for fat filling or skin regeneration comprising; or a FoxN1 protein variant encoded by the FoxN1 mutant gene.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a pharmaceutical composition for treating wounds or inhibiting scar formation, including.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a cosmetic composition for improving scars comprising a.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a pharmaceutical composition for the prevention or treatment of fibrosis, including.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a food composition for preventing or improving fibrosis comprising a.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a cosmetic composition for preventing or improving fibrosis comprising a.
  • another object of the present invention is the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; providing a method for treating wounds or inhibiting scar formation, comprising administering to a subject a pharmaceutical composition for treating wounds or inhibiting scar formation, comprising as an active ingredient It is there.
  • FoxN1 Formhead-box N1
  • another object of the present invention is the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a method for treating fibrosis, comprising administering to a subject a pharmaceutical composition for preventing or treating fibrosis, which contains as an active ingredient. .
  • FoxN1 Formhead-box N1
  • the present invention in the group consisting of Single Nucleotide variant (SNV), Indel (Insertion or Deletion), and Gene Copy-number variation (CNV)
  • SNV Single Nucleotide variant
  • Indel Insertion or Deletion
  • CNV Gene Copy-number variation
  • a FoxN1 protein variant encoded by a FoxN1 (Forkhead-box N1) variant gene comprising one or more selected nucleotide mutations.
  • the present invention can provide a transformed cell line in which a target cell is transformed with a FoxN1 mutant gene or a fragment thereof, and a vector containing the FoxN1 mutant gene.
  • the FoxN1 mutant gene refers to a FoxN1 gene in which a mutation has occurred.
  • the mutation may include a single nucleotide variant (SNV), insertion or deletion (Indel), and copy-number variation (CNV). ), but is not limited thereto, and refers to all genetic mutations recognized by those skilled in the art.
  • the present inventors first produced a new mutation c.55 C>A of the FoxN1 gene.
  • the FoxN1 mutant gene of the present invention has a nucleotide mutation in one or more exons selected from the group consisting of exons 1 to 3 of the wild-type FoxN1 (Forkhead-box N1) gene having the base sequence shown in SEQ ID NO: 1. It exists.
  • the nucleotide mutation is a nucleotide mutation in exon 2, which results in an amino acid change (p.L19M) in which leucine at the 19th position of the wild-type FoxN1 protein is replaced with methionine, in the base sequence of SEQ ID NO: 1. It is a mutant gene (c.55 C>A) in which cytosine (C) at position 55 is replaced with adenine (A).
  • the FoxN1 mutant protein (FoxN1 protein variant) encoded by the FoxN1 mutant gene is a mutant gene (c.57C> in which cytosine (C) at position 57 is replaced with thymine (T) in the base sequence of SEQ ID NO: 1. It is a mutant protein (Foxn1 p.L19M) encoded by T) and has the amino acid sequence shown in SEQ ID NO: 2.
  • FoxN1 gene used herein while referring to the wild type includes all homologous genes found in all animals, including humans, and the base sequence of the FoxN1 normal gene of the present invention is, for example, SEQ ID NO: 1 (MGI: 102949), but is not limited thereto.
  • Single Nucleotide Variant used in this specification is also called a single-nucleotide alteration, and refers to a mutation that shows a difference in a single base sequence among mutations in the genome. These include single nucleotide polymorphism (SNP) and point mutations. Single nucleotide polymorphism means that a specific base sequence is changed to a different base at the same location in the genome of another individual, resulting in a different trait. It is the most common form of genetic mutation in the genome. Single nucleotide polymorphisms generally occur at a frequency of more than 1% of the population, and when less than 1% occur, they are classified as mutations. A point mutation occurs when a single base sequence is substituted, inserted, or deleted and can prevent or modify the production of a specific protein.
  • SNP single nucleotide polymorphism
  • Single nucleotide mutations are classified according to their location and function in the genome. In addition, depending on the presence or absence of amino acid sequence variation, it is classified into synonymous SNV (sSNV), which does not cause amino acid sequence variation, and nonsynonymous SNV (nsSNV), which causes amino acid sequence variation.
  • SNV synonymous SNV
  • nsSNV nonsynonymous SNV
  • indels can cause more serious mutations than substitutions. In the case of indels, a frame shift in the amino acid sequence occurs, causing the amino acid translated after the SNV to change.
  • cSNVs coding SNVs
  • ncSNVs noncoding SNVs
  • SNP and “SNV” can be used interchangeably, and can be used with the same meaning, such as “SNV of the FoxN1 gene” or “SNP of the FoxN1 gene”, and can be used with the same meaning as “SNP of the FoxN1 gene”, where a single base changes in the polynucleotide sequence. (replacement), removal (deletion), or addition (insertion), SNPs can cause a change in the translation frame (inframe shift).
  • Index Insertion or Deletion
  • Indel in SNV means insertion or deletion of one nucleotide
  • insertion or deletion (Indel) can be used to include this.
  • CNV Codon-number variation
  • the FoxN1 protein variant (Foxn1 p.L19M) of the present invention affects skin cell homeostasis, converting keratinocytes or fibroblasts into preadipocytes or adipocytes. As a result, fat formation was promoted and subcutaneous fat increased.
  • transition used in the present invention may mean “Direct Reprogramming/Direct Conversion/Transdifferentiation,” which refers to mature (completely differentiated) cells with completely different cell types in higher organisms. As a process that induces liver transformation, EMT is included herein.
  • the FoxN1 protein variant (Foxn1 p.L19M) of the present invention can not only induce fat formation in a specific area, but can also induce conversion to other cells when applied to fibroblasts, which are a factor in fibrosis. It can also be applied to related diseases such as fibrosis.
  • the present invention provides an in vitro method of converting keratinocytes or fibroblasts into preadipocytes or adipocytes, including the following steps: Provides ways to drive conversions:
  • the vector can be prepared by any method known in the art, for example, homologous recombination, TALEN, ZFN, and CRISPR, as long as it can achieve the purpose of the present invention, that is, mutagenesis.
  • transfection For the introduction of vectors into the cells, transfection, electroporation, transduction, microinjection, or ballistic introduction can all be used.
  • the vector is preferably designed using CRISPR-Cas9 technology, and a vector containing the Cas9 protein is designed to recognize the PAM (protospacer adjacent motif) base sequence and cleave the target base sequence. It is desirable to do so. In addition, this causes location-specific mutations in the FoxN1 gene at the location designated by the Cas9 protein.
  • PAM protospacer adjacent motif
  • the FoxN1 gene associated with thymus development and keratinocyte differentiation is selected as a target to discover new SNPs using a CRISPR/Cas9 base editor and to confirm the function of the Foxn1 SNP variant, listed as SEQ ID NO: 1.
  • an sgRNA target was designed as a targeting vector expressing the FoxN1 mutation as shown in Figure 1a, and was targeted to keratinocytes or When fibroblasts are transformed, they are converted into preadipocytes or adipocytes and the proliferation of dermal fat (hyperplasia) can be induced by activating the adipogenic differentiation signal derived from keratinocytes. , Accelerates wound healing and skin regeneration by promoting epithelial-mesenchymal transition of keratinocytes.
  • progenitor cell is referred to as a committed stem cell, and when a cell corresponding to a descendant (X) is found to express specific differentiation, an undifferentiated parental cell that does not express differentiation traits is used as a progenitor cell of It is called.
  • preadipocyte refers to a progenitor cell that has been shown to differentiate into adipocytes.
  • the present invention provides the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; or a FoxN1 protein variant encoded by the FoxN1 mutant gene; inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes.
  • the FoxN1 FoxN1 (Forkhead-box N1) mutant gene
  • a vector containing the FoxN1 mutant gene or a FoxN1 protein variant encoded by the FoxN1 mutant gene
  • inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes.
  • the term “conversion to preadipocytes or adipocytes” means that keratinocytes or fibroblasts of animals, specifically mammals, are preadipocytes or fibroblasts due to FoxN1 (Forkhead-box N1) mutation. This means differentiating into fat cells.
  • the term “composition for inducing conversion” refers to a composition capable of inducing the process by which cells in the early stages acquire the characteristics of each tissue, and for the purpose of the present invention, keratinocytes or fibroblasts are converted into preadipocytes. Alternatively, it refers to a composition that can induce differentiation into adipocytes.
  • the composition for inducing conversion can induce differentiation of adipocytes by promoting the expression of the FoxN1 mutant gene or FoxN1 protein mutant.
  • the composition can promote the formation of fat cells and induce refilling of skin fat that has degenerated due to skin damage or aging.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as a cosmetic composition for fat filling or skin regeneration, comprising as an active ingredient.
  • fat filling means alleviating, improving, or filling the degree to which fat tissue in the skin has degenerated and the volume of the fat tissue has decreased. By filling with fat, dermal white skin fat-mediated skin regeneration is achieved. This means that the volume of the skin is improved.
  • the term "skin regeneration” means allowing severely damaged skin to recover its original function, and may include skin elasticity or wrinkle improvement. Although not specifically limited to this, skin regeneration relieves the degree of sagging or sagging skin, or replenishes the skin with fat to compensate for structural collapse caused by decreased skin elasticity and strength due to skin fat filling or decrease in fat tissue volume. This may include maintaining elasticity. In addition, it may include suppressing or inhibiting the formation of wrinkles on the skin or alleviating wrinkles that have already been formed.
  • Fat formation by the FoxN1 mutation of the present invention suggests that the degree of reduction in the volume of skin adipose tissue can be alleviated, improved, or filled, and thus the cosmetic composition of the present invention can be used for fat filling purposes.
  • composition of the present invention improves or improves skin elasticity and wrinkles by alleviating or improving the volume of degenerated fatty tissue, and further suggests that it can help damaged skin recover its original function. It is obvious that the cosmetic composition containing the FoxN1 mutation of the present invention can be used for skin regeneration purposes.
  • the cosmetic composition includes solution, external ointment, cream, foam, nourishing lotion, softening lotion, pack, softening water, emulsion, makeup base, essence, soap, liquid cleanser, bath agent, sunscreen cream, sun oil, suspension, emulsion, It can be prepared in a formulation selected from the group consisting of paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, patch and spray, but is not limited thereto.
  • the cosmetic composition may further include one or more cosmetically acceptable carriers that are blended with general skin cosmetics, and common ingredients include, for example, oil, water, surfactant, moisturizer, lower alcohol, thickener, Chelating agents, pigments, preservatives, fragrances, etc. may be appropriately mixed, but are not limited thereto.
  • Cosmetically acceptable carriers included in the cosmetic composition vary depending on the formulation.
  • the carrier ingredients include animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, and zinc oxide. Or a mixture thereof can be used.
  • lactose, talc, silica, aluminum hydroxide, calcium silcate, polyamide powder, or mixtures thereof may be used as carrier ingredients, and especially in the case of spray, additional May contain propellants such as chlorofluorohydrocarbons, propane/butane or dimethyl ether.
  • a solvent, solubilizing agent, or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, and propylene glycol.
  • 1,3-butyl glycol oil can be used, in particular cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan. You can.
  • the carrier component includes water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.
  • a liquid diluent such as ethanol or propylene glycol
  • a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester
  • Microcrystalline cellulose aluminum metahydroxide, bentonite, agar, or tracant may be used.
  • the formulation of the cosmetic composition is soap, alkali metal salts of fatty acids, hemiester salts of fatty acids, fatty acid protein hydrolysates, isethionates, lanolin derivatives, fatty alcohols, vegetable oils, glycerol, sugars, etc. are used as carrier ingredients. It can be.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a food composition for fat filling or skin regeneration.
  • the food composition may be used in the form of a health functional food, but is not limited thereto, and may include foodologically acceptable food supplements in addition to the active ingredients.
  • “food supplement” refers to a component that can be added to food as an auxiliary ingredient, and can be appropriately selected and used by a person skilled in the art as it is added to manufacture each type of health functional food.
  • food supplements include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, and protective colloidal thickeners. , pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc., but the types of food supplements of the present invention are not limited to the above examples.
  • the food composition of the present invention may include health functional foods.
  • health functional food refers to food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, and pills using raw materials or ingredients with functional properties useful to the human body.
  • functionality means controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes, such as physiological effects.
  • the health functional food can be manufactured by a method commonly used in the industry, and can be manufactured by adding raw materials and ingredients commonly added in the industry. Additionally, the formulation of the health functional food can also be manufactured without limitation as long as it is a formulation recognized as a health functional food.
  • the food composition of the present invention can be manufactured in various types of formulations, and unlike general drugs, it is made from food as a raw material and has the advantage of not having side effects that may occur when taking the drug for a long period of time, and is excellent in portability, so the present invention Health functional foods can be consumed as supplements to enhance fat replenishment and skin regeneration effects.
  • the health functional food of the present invention can take, and it can include all foods in the conventional sense, and can be used interchangeably with terms known in the art, such as functional food.
  • the health functional food of the present invention can be prepared by mixing known additives with other appropriate auxiliary ingredients that can be included in the food according to the selection of a person skilled in the art. Examples of foods that can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and There are vitamin complexes, etc., and they can be manufactured by adding the active ingredient according to the present invention to juice, tea, jelly, juice, etc. It also includes foods used as feed for animals.
  • composition containing the active ingredient of the present invention can be used as a quasi-drug composition.
  • the quasi-drug composition contains the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Alternatively, a quasi-drug composition for fat filling or skin regeneration containing a FoxN1 protein variant encoded by the FoxN1 mutant gene may be provided.
  • FoxN1 Formhead-box N1
  • a vector containing the FoxN1 mutant gene Alternatively, a quasi-drug composition for fat filling or skin regeneration containing a FoxN1 protein variant encoded by the FoxN1 mutant gene may be provided.
  • the quasi-drug composition may further include pharmaceutically acceptable carriers, excipients, or diluents as needed.
  • the pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effect of the present invention, and includes, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc. It can be included.
  • Representative examples of pharmaceutically acceptable carriers, excipients or diluents of the quasi-drug composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, gelatin, glycerin, gum acacia, alginate, calcium phosphate, Calcium carbonate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, propylene glycol, polyethylene glycol, vegetable.
  • the quasi-drug when used as a quasi-drug, it may additionally contain one or more active ingredients that exhibit the same or similar functions.
  • it may include known lipofilling, fat filling, skin regeneration, or skin moisturizing ingredients. If additional skin moisturizing ingredients are included, the fat filling or skin regeneration effect of the quasi-drug composition of the present invention can be further increased.
  • skin safety due to combined use, ease of formulation, and stability of the active ingredients can be taken into consideration.
  • the quasi-drug composition of the present invention may include, but is not limited to, disinfectant cleaner, shower foam, ointment, wet tissue, coating agent, etc., and the formulation method, dosage, usage method, and components of the quasi-drug are known in the technical field. It can be appropriately selected from conventional techniques.
  • the present invention provides an external skin preparation.
  • the present invention relates to the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Alternatively, an external skin preparation for fat filling or skin regeneration containing a FoxN1 protein variant encoded by the FoxN1 mutant gene may be provided.
  • FoxN1 FoxNhead-box N1
  • the term "external preparation” refers to preparations provided for external use, including external acid, external tablet, external solution, ointment, warning agent, suppository, etc.
  • External preparations refer to those spread on zinc starch, etc., erosions and ulcers of the skin mucous membrane
  • external tablets refer to dissolved tablets or vaginal tablets
  • external solution preparations refer to liquids containing water, ethanol, oil, etc. as solvents. It is a preparation and is used for gargling, compressing, washing, eye drops, nasal drops, etc.
  • ointments are semi-solid preparations of appropriate consistency to be applied to the skin
  • ointments are solid at room temperature and are applied to the skin that softens with body temperature
  • suppositories are preparations to be applied to the anus, vagina, and urethra.
  • the “external skin preparation” refers to a preparation that acts on the skin externally among external preparations.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene;
  • it refers to an external skin preparation containing the FoxN1 protein variant encoded by the FoxN1 mutant gene as an active ingredient.
  • external skin preparations include, but are not limited to, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment preparations, pasta preparations, or cataplasma preparations that can be manufactured and used as drugs or quasi-drugs in the form of external skin preparations. No.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a pharmaceutical composition for treating wounds or inhibiting scar formation, and a cosmetic composition for improving scars.
  • composition of the present invention induces the expression of characteristics from fibroblasts, which play an important role in wound healing, to myofibroblasts by Foxn1 p.L19M of the present invention, so the cosmetic composition containing the FoxN1 mutation of the present invention helps in wound healing and scar formation. It is clear that it can be used for suppression and scar improvement purposes.
  • the present invention provides the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; Provided is a method for treating wounds or inhibiting scar formation, comprising the step of administering to a subject a pharmaceutical composition for treating wounds or inhibiting scar formation, comprising as an active ingredient. .
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a pharmaceutical composition for preventing or treating fibrosis.
  • the fibrosis is present in the lungs, kidneys, liver, heart, brain, blood vessels, joints, intestines, skin, soft tissues, bone marrow, penis, peritoneum, lance, muscles, spine, testes, ovaries, breasts, thyroid, eardrums, pancreas, gallbladder, and bladder. and the prostate, preferably in an organ selected from the group consisting of pulmonary fibrosis, uterine fibroids, myelofibrosis, liver fibrosis, heart fibrosis, and multiple lesions.
  • cirrhosis selected from the group consisting of cirrhosis, kidney fibrosis, cystic fibrosis, neutropenia, skeletal muscle fibrosis, scleroderma, dermatomyositis, mediastinal fibrosis, and splenic fibrosis due to sickle cell anemia.
  • cirrhosis kidney fibrosis, cystic fibrosis, neutropenia, skeletal muscle fibrosis, scleroderma, dermatomyositis, mediastinal fibrosis, and splenic fibrosis due to sickle cell anemia.
  • neutropenia neutropenia
  • skeletal muscle fibrosis skeletal muscle fibrosis
  • scleroderma scleroderma
  • dermatomyositis dermatomyositis
  • mediastinal fibrosis mediastinal fibrosis
  • splenic fibrosis due to sickle cell anemia
  • the FoxN1 mutant gene of the present invention A vector containing the FoxN1 mutant gene; Or, when using a FoxN1 protein variant encoded by the FoxN1 mutant gene, fibrosis can be effectively treated or inhibited by transdifferentiating fibroblasts that cause fibrosis into other cells, such as preadipocytes or adipocytes. .
  • the present invention provides the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; It provides a method of treating fibrosis, comprising the step of administering to a subject a pharmaceutical composition for preventing or treating fibrosis, which contains as an active ingredient.
  • a pharmaceutical composition for preventing or treating fibrosis which contains as an active ingredient.
  • the term "comprising an active ingredient” refers to the FoxN1 mutant gene, which is an active ingredient of the present invention;
  • it means containing the FoxN1 protein variant encoded by the FoxN1 variant gene in an amount sufficient to achieve a predetermined efficacy or activity. They can be administered in a pharmaceutically effective amount, and the effective dose level can be determined depending on the type and age of the individual, gender, sensitivity to the drug, treatment period, drugs used simultaneously, and other medical factors.
  • composition according to one embodiment of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with existing therapeutic agents.
  • the daily dosage of the pharmaceutical composition may be 0.01 to 500 mg/kg, and may be administered once to several times a day, depending on the patient's weight, age, gender, health status, diet, administration time, administration method, Considering the excretion rate, severity of disease, etc., the amount that can achieve maximum effect without side effects can be easily determined by a person skilled in the art.
  • the pharmaceutical composition can be administered through various routes, such as orally, subcutaneously, intraperitoneally, intrapulmonary, intranasally, intramuscularly, intravenously, and arterially.
  • composition of the present invention may be formulated to include pharmaceutically acceptable carriers, excipients, and/or diluents in addition to the active ingredients.
  • the pharmaceutical preparation may be formulated in the form of oral dosage forms such as powders, granules, tablets, coated tablets, capsules, suspensions, emulsions, syrups, suppositories, aerosols, external preparations, suppositories, or injections, but is not limited thereto. .
  • the pharmaceutical preparation may be prepared by additionally mixing one or more excipients, such as starch, lactose, gelatin, sucrose, lubricant, preservative, flavoring agent, sweetener, etc.
  • excipients such as starch, lactose, gelatin, sucrose, lubricant, preservative, flavoring agent, sweetener, etc.
  • composition of the present invention may contain one or more known active ingredients that have a preventive or therapeutic effect on fibrosis, the subject of the present invention, along with the active ingredient of the present invention.
  • composition of the present invention may further include pharmaceutically acceptable additives, where the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, and lactose. , mannitol, taffy, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba lead, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, White sugar, etc. may be used.
  • the pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.
  • composition of the present invention can be administered in various oral or parenteral formulations during actual clinical administration.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants are used. It can be prepared, and it is preferable to use suitable preparations known in the art that are disclosed in the literature (Remington's Pharmaceutical Science, recently published by Mack Publishing Company, Easton PA).
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, such as starch, calcium carbonate, sucrose, or It is prepared by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium styrate talc are also used.
  • the liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and in addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. This may be included.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • injectable ester such as ethyl oleate.
  • As a base for suppositories witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.
  • the dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time, and/or administration route of the pharmaceutical composition, and the type and degree of response to be achieved by administration of the pharmaceutical composition. , various factors including the type, age, weight, general health condition, symptoms or degree of disease, gender, diet, excretion, drugs used simultaneously or simultaneously with the subject, other components of the composition, etc. of the subject to be administered, and It may vary depending on similar factors well known in the pharmaceutical field, and a person skilled in the art can easily determine and prescribe an effective dosage for the desired treatment.
  • the pharmaceutical composition of the present invention is preferably administered at a concentration of, for example, 0.01 to 500 mg/kg, but this dosage does not limit the scope of the present invention in any way.
  • the administration route and administration method of the pharmaceutical composition of the present invention may be independent, and are not particularly limited, and any administration route and administration method may be used as long as the pharmaceutical composition can reach the desired area. can be followed.
  • the pharmaceutical composition can be administered orally or parenterally.
  • the parenteral administration method includes, for example, intravenous administration, intraperitoneal administration, intramuscular administration, transdermal administration, or subcutaneous administration.
  • the pharmaceutical composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response regulators for the prevention or treatment of target indications.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a food composition for preventing or improving fibrosis, or a health functional food containing the same.
  • health functional food used in this specification refers to food manufactured and processed using raw materials or ingredients with functional properties useful to the human body.
  • 'functionality' means ingestion for the purpose of controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes such as physiological effects.
  • the food composition includes all types of functional foods, nutritional supplements, health foods, and food additives.
  • the above types can be manufactured in various forms according to conventional methods known in the art.
  • the food composition can be formulated in the same way as the pharmaceutical composition and used as a health functional food, and can be added to various foods.
  • the composition of the present invention when producing a food or beverage, is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw materials. However, when consumed for a long period of time for health and hygiene purposes or health control, it can be added in an amount below the above range. Since there is no problem in terms of safety, the active ingredient can be used in an amount above the above range. there is.
  • the type of food but examples of food to which the ingredients of the present invention can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, and ice cream. It includes dairy products, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc., and includes all health foods in the conventional sense.
  • the food composition of the present invention When the food composition of the present invention is manufactured into a beverage, it may contain additional ingredients such as various flavoring agents or natural carbohydrates, like conventional beverages.
  • the natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame.
  • the natural carbohydrate is included in an amount of 0.01 to 10% by weight, preferably 0.01 to 0.1% by weight, based on the total weight of the food composition of the present invention.
  • the food composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonic acid. It may include carbonating agents used in beverages, and may include pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages, but is not limited thereto. These ingredients can be used independently or in combination.
  • the ratio of the above additives is not greatly limited, but is preferably contained within the range of 0.01 to 0.1% by weight based on the total weight of the food composition of the present invention.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as a cosmetic composition for preventing or improving fibrosis, comprising as an active ingredient.
  • the FoxN1 mutant gene of the present invention A vector containing the FoxN1 mutant gene;
  • fibrosis-inducing fibroblasts are transdifferentiated into other cells, such as preadipocytes or adipocytes, and thus fibrosis can be effectively suppressed.
  • composition of the present invention uses expression of the above-described FoxN1 mutant gene or FoxN1 mutant protein, duplicate content is omitted to avoid excessive complexity of the present specification.
  • the random missense mutant (Foxn1 c.55 C>A(p.L19M)) produced through the CRISPR/Cas9 editing system according to the present invention can be used to transform keratinocytes or fibroblasts into adipocytes or preadipocytes. ) and activating keratinocyte-derived fat differentiation signals to promote fat formation to increase subcutaneous fat, and to induce the expression of fibroblasts, which play an important role in wound healing and hair follicle formation, into myofibroblasts, thereby forming fibrotic cells. Not only can it be applied to disease treatment and skin wound improvement treatment, but it can also improve the aesthetic problems of modern people caused by volume loss and functional decline due to adipose tissue involution by inducing subcutaneous fat in specific areas of the skin.
  • Figure 1 shows B6. It shows obesity accompanied by proliferation of dermal white adipose tissue (dWAT) induced by Foxn1 p.L19M.
  • Figure 1A shows a simplified image of the generation of mice with Forkhead protein N1 (Foxn1) missense mutations.
  • a single guide RNA (sgRNA) binding sequence was selected from the first coding exon of Foxn1.
  • sgRNA single guide RNA
  • nCas9-BE linked to sgRNA and nickase Streptococcus pyogens Cas9 was applied to mouse embryos, and the genotype of the resulting offspring was confirmed by Sanger sequencing.
  • Red alphabet nucleotide substitutions
  • blue alphabet protospacer adjacent motif (PAM) sequence.
  • Figure 1B is B6.
  • Figure 1d shows the results of hematoxylin and eosin staining on skin. After 16 weeks of NC and HFD feeding, dorsal skin was fixed in formalin and stained. Black scale bar: 500 ⁇ m.
  • Figure 1E shows a simplified image for calculating the thickness of the dermal white adipocyte (dWAT) layer and the number of adipocytes.
  • Red square thickness x 500 ⁇ m width
  • Foxn1 L19M/L19M a larger number of adipocytes are observed in the dermal white fat layer than in WT, which means that the Foxn1 p.L19M mutant causes hyperplasia rather than adipocyte enlargement (hypertrophy).
  • Figure 2 shows that Foxn1 p.L19M promotes epithelial-mesenchymal transition (EMT) of keratinocytes.
  • Figure 2a shows the results of Sashimi plot analysis for the Foxn1 gene using RNA sequencing data from newborn epidermal tissues of WT and Foxn1 L19M/L19M , suggesting that alternative splicing of messenger RNA (mRNA) does not occur.
  • Figure 2b shows the results of Foxn1 detection by Western blot using epidermal and dermal tissue proteins, indicating that there is no difference in FOXN1 protein expression in keratinocytes between WT and Foxn1 L19M/L19M .
  • Figure 2c shows the results of detection of Foxn1-positive cells in the skin using immunohistochemistry, showing that Foxn1-positive cells are located at the boundary between the dermis and the fat layer, suggesting the possibility that Foxn1 L19M/L19M keratinocytes have migrated (black) Scale bar: 50 ⁇ m).
  • Figure 2g shows epithelial-mesenchymal-transition (EMT) in epidermal (Epi-; epidermal) tissue, dermal (Der-; dermal) tissue, primary keratinocyte (Kera-; keratinocyte), and dermal fibroblast (DF). Shows the Western blot results confirming the protein level of the intermediate gene.
  • Figure 2h shows the results of immunofluorescence staining of E-cadherin, N-cadherin, and Foxn1 using skin tissue. Green or yellow alphabets indicate the target gene name and detected fluorescence signal color (blue; DAPI. White scale bar: 50 ⁇ m).
  • Figure 2I shows EMT-related gene expression levels in the skin of Foxn1 L19M/L19M .
  • Figure 3 shows the results of Foxn1 p.L19M in keratinocytes activating adipogenic signals in mouse embryonic fibroblast (MEF) cells.
  • Figure 3a shows the results of immunofluorescence staining to detect Foxn1, CD34, or ⁇ SMA (Alpha Smooth Muscle Actin) positive cells in skin tissue. Green or red alphabets indicate the target gene name and detected signal color. blue; DAPI. Black and white scale bar: 50 ⁇ m.
  • Figure 3b shows the results of Western blot analysis to detect CD24, CD34, Sca-1, and ⁇ SMA using proteins from epidermal and dermal tissues, primary keratinocytes, and dermal fibroblasts.
  • Figure 3c shows that Foxn1 p.L19M was expressed in a keratinocyte cell line (Kera-308) and cultured in adipogenic medium, showing that keratinocytes can be differentiated into preadipocytes and adipocytes by transduction of Foxn1 p.L19M.
  • Figure 3d shows the results of analyzing whether Foxn1 p.L19M induces adipogenesis in mouse embryonic fibroblasts (MEF) through signal transduction.
  • MEF mouse embryonic fibroblasts
  • Figure 3f shows that Western blot analysis to compare the expression of Foxn1, ⁇ -catenin, PPAR ⁇ (Peroxisome proliferator-activated receptor gamma), and ⁇ SMA was performed using proteins from MEF cells in the lower well.
  • Figure 3g shows the results of analyzing the effect of Foxn1 p.L19M on adipogenesis in dermal fibroblasts. WT and Foxn1 L19M/L19M skin fibroblasts were seeded and cultured with adipogenic medium for 10 days.
  • Figure 4 shows that the Foxn1 p.L19M trait promotes proliferation of keratinocytes and activates various adipogenic differentiation signals.
  • the coding genes for Foxn1 and Foxn1 p.L19M were overexpressed in a mouse keratinocyte cell line (Kera-308), and then gene expression was changed to Foxn1 L19M/ The expression pattern was compared with that of L19M mice. (Red color: increased relative gene expression, Bule color: decreased relative gene expression)
  • Figure 5 shows that Wnt signaling is involved in Foxn1 p.L19M-mediated EMT and adipogenesis.
  • Figures 5b and 5c show the results of immunohistochemistry and immunofluorescence staining to detect Wnt (Wingless-related integration site)5 ⁇ or Wnt10 ⁇ positive cells in skin tissue. blue; DAPI. Black or white scale bar: 50 ⁇ m.
  • Figures 5d and 5e show Wnt/ ⁇ -catenin signal, Methyl Ethyl Ketone (MEK), extracellular-signal-regulated kinase (ERK), and Signal transducer and activator of transcript 3 (STAT3) using proteins extracted from epidermal and dermal tissues. Shows the results of Western blot analysis for detection.
  • Figure 5h shows the results of Western blot analysis of ⁇ -catenin and E-cadherin to evaluate the induction of adipogenic differentiation and activation of epithelial-mesenchymal transition by Wnt5 ⁇ silencing.
  • Figure 6 shows that Foxn1 p.L19M gain-of-function stimulates migration and adipogenic signaling of keratinocytes and ⁇ SMA expression of fibroblasts.
  • Figure 6a shows the results of evaluating the adipogenic signal of Foxn1 p.L19M using the transwell system. Skin keratin cell line (Kera-308) was seeded in the upper well and MEFs were seeded in the lower well, and then transformed with each plasmid (CAG- Foxn1 -polyA [p Foxn1 ] or CAG- Foxn1 p.L19M-pA [p Foxn1 L19M]). converted.
  • Figure 6c shows the results of cellular wound healing assay after transient Foxn1 p.L19M expression. After culturing Kera-308 as a monolayer, each plasmid was transfected. Twenty-four hours after transfection, crevices were created by scraping, and wound healing density was calculated. Yellow line: initial edge of the gap and black line: edge observed after wound healing.
  • Figures 6e and 6f show the results of Western blot analysis to detect Foxn1, Wnt5 ⁇ , Wnt10 ⁇ , ⁇ -Catenin, E-cadherin, N-cadherin, CD34, and ⁇ SMA in Kera-308 or NIH3T3 cells after transfection with pFoxn1 or pFoxn1 p.L19M. shows. Each point represents the individual value of each culture. Data were expressed as mean ⁇ SEM. Statistical analysis was performed using unpaired Student's t-test (ns: not significant, *: p ⁇ 0.05, **: p ⁇ 0.01, ***: p ⁇ 0.001).
  • Figure 7 shows dWAT adipogenesis and activation of wound healing by Foxn1 p.L19M.
  • Figure 7a is a schematic diagram of an experiment performing in vivo transfection using lipofectamine. Each plasmid mixture was injected into the ear by intradermal injection. Injections were performed twice at two-week intervals.
  • Figure 7b shows H&E results of the ear 4 weeks after in vivo transfection. The thickness of the fat cell layer was measured at 5 locations per mouse, and the average value was used for analysis. Each dot represents data from an individual mouse. Data were expressed as mean ⁇ SEM. Statistical analysis was performed using unpaired Student's t-test. AC: ear cartilage. Scale bar: 50 ⁇ m.
  • Figure 7d shows the mechanism for dWAT adipogenesis in Foxn1 L19M/L19M .
  • the pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA (nSpCas9-BE, addgene ID: 79620) plasmid was obtained from addgene. After linearization by enzymatic digestion with Xba1, mRNA was synthesized using the mMESSAGE mMACHINE T7 Ultra transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). The sgRNA binding site is the third exon of the mouse Foxn1 gene (the first coding exon, House mouse Foxn1 has various alternative splicing mRNAs depending on the promoter signal, and includes the second exon, start codon, based on forkhead box N1 and transcript variant 1. Exon) was selected from sequences having 5'-NGG-3'. sgRNA was synthesized using the Megashortscript T7 Kit (Thermo Fisher Scientific).
  • C57BL/6 (B6) was purchased from Coretech (Pyeongtaek, Korea). After superovulation, B6 female mice were mated with a sperm donor, and embryos were collected the next day. Afterwards, 50ng/ ⁇ l of nSpCas9-BE mRNA and 10ng/ ⁇ l of sgRNA were pronuclear microinjected into the embryo. The manipulated embryos were transferred into the oviduct of mice, and the genotypes of the resulting offspring were analyzed by Sanger sequencing. Sequence information for sgRNA, primers, and shRNA is aligned in Table 1 below. This study was approved by the Animal Care Committee of Seoul National University Animal Hospital (SNU-161031-2 and 200221-1) and was conducted in accordance with the guidelines.
  • mice Four-week-old B6 and Foxn1 L19M/L19M male mice were randomly divided and fed regular chow (Purina Korea, Seongnam, Korea) and 45% HFD (Research Diet Inc., New Brunswick, NJ, USA) for 15 weeks. The body weight of each mouse was measured weekly.
  • mice were anesthetized using 2.5% Avertin and perfused through the heart with phosphate-buffered saline and 4% paraformaldehyde. Skin tissue fixed in formalin was embedded in paraffin and stained. In H&E staining, deparaffinized tissue was stained with 0.1% Mayer's H&E solution. For immunofluorescence and immunohistochemical staining, tissues were blocked with control serum and then incubated with primary and secondary antibodies. Antibody-reactive cells were detected with Cytation 5 (BioTek, Winooski, VT, USA), and the list of antibodies used is listed in Table 2 below. Masson trichrome staining was performed using a Masson trichrome staining kit (Polysciences, Warrington, PA, USA).
  • RNA sequencing and analysis (Sashimi plots, heatmaps, and gene network analysis)
  • HTS High-throughput sequencing
  • qRT-PCR was performed with PowerUp SYBR Green Master Mix and StepOne Plus Real-Time PCR system. All reactions were performed in triplicate and the average value of each sample was used for further analysis. Expression of target genes was normalized to the expression of actin. All reagents and instruments used for qPCR analysis were purchased from Thermo Fisher Scientific. Primer sequences used in this example were aligned in Table 1 above.
  • Immunoreactive proteins were detected using an ECL kit (Abclon, Seoul, Korea) after incubation with horseradish peroxidase-conjugated secondary antibody for 1 hour at room temperature. Information on the antibodies used in this example is arranged in Table 2 above.
  • dermal fibroblast culture dermal tissue was isolated with 200 IU/mg collagenase I (Thermo Fisher Scientific) for 30 minutes at 37°C. After filtration using a strainer with 70 ⁇ m pores, the cells were cultured in DMEM (Dulbecco Modified Eagle Medium) with 15% fetal bovine serum (FBS; Thermo Fisher Scientific).
  • DMEM Dynamic Eagle Medium
  • FBS fetal bovine serum
  • MEF mouse embryonic fibroblast
  • fetal tissues were obtained from female B6 mice at 13.5 days of gestation, and the tissues were dissociated by mincing with 250 IU/mg collagenase IV (Thermo Fisher Scientific) for 30 minutes at 37°C. . After stopping the enzyme reaction using FBS, the cells were cultured using DMEM containing 10% FBS.
  • shRNA plasmids for Foxn1, Wnt5 ⁇ , Wnt5 ⁇ and Wnt10 ⁇ were designed with ITR-U6-shRNA sequence-human PGK promoter-eGFP/Puro-pA-ITR to utilize the PiggyBac system. Additionally, gene expression vectors for Foxn1 and Foxn1 p.L19M were designed with CAG promoter- Foxn or Foxn1 p.L19M coding sequence-pA. Plasmids were constructed by DNA synthesis (VectorBuilder, Chicago, IL, USA).
  • shRNA and PiggyBac transposase plasmid were co-transfected into Kera-308, and a stable cell line was established after antibiotic screening.
  • a single plasmid was transfected into Kera-308. Transfection was performed for 48 hours using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA) according to the manufacturer's manual. Sequence information of shRNA was arranged in Table 1 above.
  • the present inventors sought to develop a novel variant that can be useful for cosmetic purposes and to overcome related skin diseases by inducing EMT (epithelial-mesenchymal transition) and dWAT (dermal white adipose tissue) fat production regardless of whether the skin is damaged or not.
  • EMT epi-mesenchymal transition
  • dWAT skin white adipose tissue
  • cgactggagggcgaacccca agg
  • Exon 2 containing the start codon of Foxn1 was selected as the target site for SNP formation.
  • sgRNA single guide RNA
  • nSpCas9-BE nickase Streptococcus pyogens Cas9 fused base editor
  • the homozygote p.L19M (B6. Foxn1 p.L19M, Foxn1 L19M/L19M ) mouse was found to have an obese phenotype with normal hair growth.
  • Example 1 In order to investigate the cause of obesity of p.L19M (B6. Foxn1 p.L19M, Foxn1 L19M/L19M ) identified in Example 1, the present inventors randomly divided mice and fed them with normal feed (NC) and 45% solid food. A solid diet (HFD) was fed for 15 weeks.
  • NC normal feed
  • HFD solid diet
  • TEC thymic epithelial cells
  • keratinocytes skin changes were analyzed histologically.
  • HFD feeding increased dWAT thickness approximately two-fold compared to the regular feed treatment group in both WT and Foxn1 L19M/L19M, with no difference depending on genotype. Additionally, as shown in Figures 1E, 1F and 1G, HFD feeding did not increase the number of dermal adipocytes in WT and Foxn1 L19M/L19M .
  • the present inventors analyzed the Foxn1 gene expression pattern in the epidermis of Foxn1 L19M/L19M . As a result, as shown in Figure 2A, Foxn1 p.L19M did not induce alternative exon splicing in mice.
  • EMT epidermal-mesenchymal-transition
  • E-cadherin expression of Foxn1 p.L19M was decreased compared to WT in epidermal tissue and primary keratinocytes, and an increase in N-cadherin was observed only in dermal tissue and in primary dermal fibroblasts. It didn't work. This indicates that the EMT of Foxn1 L19M/L19M was limited to epidermal keratinocytes and not dermal fibroblasts.
  • EMT-related genes such as Matrix metalloproteinase-2 and 9, Vimentin, and Fibronectin showed relatively significantly increased expression in the skin of Foxn1 L19M/L19M .
  • the present inventors confirmed the expression locations of CD34 and ⁇ SMA, known as markers of adipocyte precursor cells, through immunofluorescence analysis.
  • CD34-positive cells are known as adipocyte precursor cells that can differentiate into mature adipocytes, and ⁇ SMA-positive myofibroblasts are known to be able to differentiate into adipocytes during wound healing.
  • CD34-positive and ⁇ SMA-positive cells co-expressed Foxn1 and were observed in the dermis-dWAT border area. This indicates that Foxn1 positive cells located in the dermis-dWAT border area can be differentiated into adipocytes.
  • preadipocyte markers CD24, CD34, Sca-1, and ⁇ SMA protein were confirmed through Western blotting.
  • adipocytes such as CD34 and Sca-1 increased in Foxn1 L19M/L19M epidermal tissue.
  • CD24, CD34, Sca-1, and ⁇ SMA increased in dermal tissue.
  • CD34 was highly expressed in Foxn1 L19M/L19M dermal tissue compared to WT, while there was no difference in expression level compared to WT in primary dermal fibroblasts.
  • This increased CD34 expression was derived from epidermal keratinocytes, and as shown in Figure 3c, when Foxn1 p.L19M is overexpressed in keratinocytes, conversion to adipocytes is observed. This means that keratinocytes can differentiate into preadipocytes.
  • the generation and supply of adipocytes is a major mechanism responsible for the induction of dWAT hyperplasia in Foxn1 L19M/L19M .
  • Example 5 Foxn1 Adipogenesis through conversion of dermal fibroblasts to preadipocytes or adipocytes via keratinocyte-derived signaling, induced by p.L19M
  • Foxn1 L19M/L19M is a systemic mutant animal, and dermal fibroblasts have a high level of ⁇ SMA expression (Figure 3b). Accordingly, Foxn1 L19M/L19M and WT dermal fibroblasts were cultured using adipogenic medium ( Figure 3g). Dermal fibroblasts showed adipogenic potential, and there was no difference in the amount of adipogenesis between Foxn1 +/+ and Foxn1 L19M/L19M ( Figure 3h).
  • Foxn1 p.L19M activates the conversion of fibroblasts into preadipocytes or adipocytes that can produce fat.
  • Foxn1 p.L19M To determine whether the increase in adipogenesis and EMT caused by Foxn1 p.L19M was caused by overexpression of Foxn1, the present inventors compared and analyzed the gene expression of epidermal tissue and Foxn1 and keratinocyte lines overexpressed by Foxn1 p.L19M. As shown in Figure 4, Foxn1 p.L19M characteristically increased the expression of cell structure-related genes and proliferation-related genes, which was different from overexpression of the Foxn1 gene. Additionally, genes related to signal transduction related to adipogenic differentiation were also more activated in epidermal tissues of Foxn1 p.L19M overexpression and Foxn1 L19M/L19M .
  • the present inventors analyzed genes related to cell migration and cell differentiation through RNA sequencing data to investigate the mechanism of increased EMT of Foxn1 p.L19M.
  • Wnt5 ⁇ and Wnt10 ⁇ signaling were correlated with Foxn1 in the gene network analysis.
  • Figures 5b and 5c as a result of expression location analysis, Wnt5 ⁇ and Foxn1 were co-located in the border area between the dermis and dWAT in Foxn1 L19M/L19M .
  • Wnt10 ⁇ was mainly expressed in the epidermis of WT, and its expression was reduced in Foxn1 L19M/L19M ( Figure 5b).
  • Wnt5ß increased and Wnt10 ⁇ and ⁇ -catenin decreased in the dermis of Foxn1 L19M/L19M
  • Wnt/ ⁇ -catenin signaling is related to adipogenesis.
  • the Wnt5-Fizzled2 pathway promotes EMT through STAT3 phosphorylation, and increased phosphorylation of MEK and STAT3 in the epidermis was also observed in Foxn1 L19M/L19M .
  • the Wnt5-Fizzled pathway seemed to be involved in the EMT of Foxn1 L19M/L19M .
  • the present inventors sought to confirm the correlation between Wnt5 ⁇ signaling and adipogenesis or EMT through gene silencing experiments.
  • Wnt5 ⁇ inhibition reduced adipogenesis and cell migration to dermal fibroblasts in the lower wells.
  • Wnt5 ⁇ inhibition led to a decrease in ⁇ -catenin and an increase in E-cadherin, identical to that seen in Foxn1L19M/L19M mice.
  • the present inventors analyzed the coding sequences of WT Foxn1 (pCAG- Foxn1 -pA, p Foxn1 ) and Foxn1 p.L19M (pCAG- Foxn1 p.L19M-pA, p Foxn1 p.L19M) in a mouse wild type keratinocyte cell line (Kera-308). After transfection, adipogenesis and cell migration activities were analyzed.
  • the present inventors confirmed WNT ligand activation in keratinocytes and ⁇ SMA expression in fibroblasts.
  • Wnt5 ⁇ was expressed relatively highly in Kera-308 after pFoxn1 or pFoxn1 p.L19M transfection.
  • the expression pattern of Wnt5 ⁇ was similar between Foxn1 L19M/L19M and transfected Kera-308, whereas Wnt10 ⁇ showed an opposite pattern between mice and cells ( Figures 5D and 6E).
  • Wnt5 ⁇ is the main linker for EMT and adipogenesis of Foxn1 p.L19M.
  • Foxn1 p.L19M may increase ⁇ SMA expression in fibroblasts of the lower wells, leading to their differentiation into adipocytes, resulting in higher ⁇ SMA in the dermis of Foxn1 L19M/L19M. Focusing on expression, pFoxn1 and pFoxn1 p.L19M were transfected into a mouse fibroblast cell line (NIH3T3).
  • transient expression of pFoxn1 p.L19M induced increased ⁇ SMA expression in the NIH3T3 cell line, but not pFoxn1 .
  • the present inventors focused on the fact that, as confirmed in Example 8 above, transient pFoxn1 p.L19M expression in Kera-308 can promote cell migration and adipogenesis (FIGS. 6A and 6B), To rule out possible changes in dWAT adipogenesis, the ear was selected as the target organ for in vivo experiments to confirm its in vivo applicability. peGFP, p Foxn1 , and p Foxn1 p.L19M were transfected twice at 2-week intervals, and the thickness of the dermal white fat layer was compared after 4 weeks ( Figure 7a).
  • the healing ability was compared in a wound-induced model to utilize the characteristics of epithelial-mesenchymal transition induced by Foxn1 p.L19M, and Foxn1 L19M/L19M mice showed significantly faster healing than wild type mice. Wound healing ability was induced.
  • EMT epithelial-mesenchymal transition
  • dWAT dermal white adipose tissue
  • Foxn1 p.L19M of the present invention affects skin cell homeostasis, causing keratinocytes to transition into preadipocytes, and induces a fat differentiation signal in keratinocytes to transform subcutaneous preadipocytes into adipocytes. It promoted fat formation and increased subcutaneous fat. On the other hand, wild-type Foxn1 did not promote the formation of subcutaneous fat. In addition, it was confirmed that when introducing Foxn1 p.L19M into normal animals, not only can adipogenesis be induced only in specific areas, but also healthy fat can be obtained by increasing the number of adipocytes. Additionally, Foxn1 p.L19M can be used to obtain healthy fat. It was confirmed that when applied to fibroblasts, it can induce the expression of characteristics into myofibroblasts, which play an important role in wounds and fibrosis.

Abstract

The random missense mutant (Foxn1 c.55 C>A(p.L19M)) constructed through the CRISPR/Cas9 editing system according to the present invention promotes lipogenesis to increase subcutaneous fat by converting keratinocytes or fibroblasts into adipocytes or preadipocytes and induces the characteristic expression of fibroblasts, which play a crucial role in wound healing and fibrosis, into myofibroblasts. Thus, the mutant can be applied not only in the treatment of fibrotic diseases and the palliation of skin wounds, but also in alleviating aesthetic and health issues caused by volume reduction and functional impairment due to fat tissue atrophy in modern people through subcutaneous fat induction in specific areas of the skin.

Description

신규한 FOXN1 변이체 및 이의 용도Novel FOXN1 variants and their uses
본 발명은 신규한 Foxn1 변이체 및 이의 용도에 관한 것이다.The present invention relates to novel Foxn1 variants and uses thereof.
지방은 과다섭취된 에너지를 트리글라이세라이드(Triglyceride)의 형태로 저작하여 에너지의 항상성을 유지하는 역할을 한다. 지방은 복부, 피하, 피부, 골수 및 근육 등 피부의 다양한 부위에 축적된다. 피하지방은 베이지지방 (beige adipocyte)로 분화될 수 있으며 최근 대사질환의 주요 타겟으로 간주된다. 진피 백색 지방조직은 (dWAT; dermal white adipose tissue) 피하지방과 기원 및 기능에서 차이가 있는 다른 형태의 지방이다.Fat plays a role in maintaining energy homeostasis by chewing excessively consumed energy in the form of triglyceride. Fat accumulates in various areas of the skin, including the abdomen, subcutaneous tissue, skin, bone marrow, and muscle. Subcutaneous fat can be differentiated into beige adipocytes and is recently considered a major target for metabolic diseases. Dermal white adipose tissue (dWAT) is another type of fat that differs from subcutaneous fat in origin and function.
진피 백색 지방조직은 단순한 기계적 쿠션 역할을 하는 것으로 간주되어져 왔으나, 최근의 연구결과는 피부 면역반응, 상처치유, 흉터 형성, 모낭의 형성 및 체온조절에 관여하는 것으로 밝혀졌다. 대략적으로 1) 진피 백색 지방조직의 발달은 모낭세포주기와 동기화되어 모낭형성기 (anagen stage)에 진피 백색 지방조직이 증가하며, 2) 진피 백색 지방조직의 결손은 외부 세균감염을 대응하지 못하며, 3) 노화 시기에 진피 피부지방 세포의 소실이 피부 탄력성 감소와 관련되어 있다. 진피 백색지방세포 선택적 분화 또는 증식에 대한 기전은 여전히 규명되어 있지 않았다.Dermal white adipose tissue has been considered to function as a simple mechanical cushion, but recent studies have shown that it is involved in skin immune response, wound healing, scar formation, hair follicle formation, and thermoregulation. Roughly 1) the development of dermal white adipose tissue is synchronized with the hair follicle cell cycle, and dermal white adipose tissue increases in the hair follicle formation stage (anagen stage); 2) the defect of dermal white adipose tissue is unable to respond to external bacterial infection; 3 ) Loss of dermal skin fat cells during aging is associated with decreased skin elasticity. The mechanism for selective differentiation or proliferation of dermal white adipocytes has not yet been identified.
Foxn1(Forkhead-box N1)은 Forkhead box 유전자 패밀리 구성원으로서, 흉선 상피 세포(TEC; thymic epithelial cell)와 표피 각질 세포의 기저층에서 발현되며, TEC-유래 T 세포 분화, 교육 및 선별의 전사인자이자 주요 조절자이다. 또한, 피부에서 Foxn1은 피부 발달, 표피 증식의 항상성, 진피 백색 지방 조직(dWAT; dermal white adipose tissue) 지방 생성, 분화 및 상처 치유를 조절하며, 이 유전자의 돌연변이는 T 세포 면역결핍, 피부 질환, 선천성 탈모, 손톱의 영양 장애 발생 및 치매 등의 발생과 상관 관계가 있는 것으로 알려져 있다. 상처 회복 및 모낭주기에서의 진피피부지방의 증식에서 나타나는 Foxn1 유전자의 발현 변화는, Foxn1 유전자와 진피피부지방 분화와의 연관성을 제시하지만, 상처회복 등의 특수한 환경에서만 관찰되는 제한된 현상이다.Foxn1 (Forkhead-box N1) is a Forkhead box gene family member, expressed in the basal layer of thymic epithelial cells (TEC) and epidermal keratinocytes, and is a transcription factor and key player in TEC-derived T cell differentiation, education, and selection. It is an adjuster. Additionally, in the skin, Foxn1 regulates skin development, homeostasis of epidermal proliferation, dermal white adipose tissue (dWAT) adipogenesis, differentiation, and wound healing, and mutations in this gene can cause T cell immunodeficiency, skin diseases, It is known to be correlated with congenital hair loss, nail dystrophy, and dementia. Changes in the expression of the Foxn1 gene that occur in wound recovery and proliferation of dermal skin fat in the hair follicle cycle suggest a relationship between the Foxn1 gene and dermal skin fat differentiation, but are limited phenomena observed only in special environments such as wound recovery.
한편, 단백질 코딩 유전자의 전사해독틀 중 염기의 과오 돌연변이, 무의미한 돌연변이 및 프레임 시프트 돌연변이가 이의 단백질 생성물의 아미노산 서열 일급 구조 변화를 일으킬 수 있기 때문에, 일반적으로 단백질 코딩 유전자의 엑손 부위에 발생한 돌연변이만이 단백질 생성물 성능의 비교적 큰 개변을 일으킬 수 있다. 이러한 돌연변이는 기능의 소실 (loss of function) 또는 새로운 기능의 획득 (gain of function)을 유도할 수 있으며, 무작위 돌연변이 유도 및 표현형 분석을 통하여 새로운 유용 형질을 발굴할 수 있다. 따라서, Foxn1 유전자의 돌연변이를 인위적으로 유도하여 진피 피부 지방의 증식을 유도할 수 있다면, 관련 질환 및 미용적인 면에서도 효과적이고 새로운 치료 및 적용법이 될 수 있을 것이다.On the other hand, since missense mutations, nonsense mutations, and frame shift mutations of bases in the transcription frame of protein-coding genes can cause changes in the primary structure of the amino acid sequence of their protein products, generally only mutations that occur in the exon region of protein-coding genes This can lead to relatively large changes in protein product performance. These mutations can lead to loss of function or gain of function, and new useful traits can be discovered through random mutation induction and phenotypic analysis. Therefore, if it is possible to induce the proliferation of dermal skin fat by artificially inducing a mutation in the Foxn1 gene, it could be an effective new treatment and application method for related diseases and cosmetic aspects.
이러한 상황 하에서, 본 발명자들은 선택적 진피 백색 지방 조직의 선택적 분화 및 증식을 유도할 수 있는 방법을 개발하고자 예의 연구 노력하였다. 결과, CRISPR/Cas9 base editor 편집 시스템을 통해 무작위 미스센스 돌연변이를 유도하여 Foxn1 c.55 C>A(p.L19M) 변이체를 최초 동정하였고, 상기 신규한 Foxn1 L19M 변이체에 의해 피부각질세포(keratinocyte)의 간엽형 세포로의 전환, 간엽형 세포의 지방 전구세포로의 전환, 각질세포 유래의 지방 형성 신호 활성화, 진피 백색지방 조직 생성 증대 및 섬유아세포에서 근섬유아세포로의 세포 이행과 같은 전환이 달성됨을 규명함으로써, 본 발명을 완성하였다.Under these circumstances, the present inventors made intensive research efforts to develop a method that can induce selective differentiation and proliferation of dermal white adipose tissue. As a result, the Foxn1 c.55 C>A(p.L19M) variant was first identified by inducing random missense mutations through the CRISPR/Cas9 base editor editing system, and the novel Foxn1 L19M variant resulted in the formation of keratinocytes. The conversion of mesenchymal-type cells into mesenchymal-type cells, conversion of mesenchymal-type cells into preadipocytes, activation of keratinocyte-derived adipogenic signals, increased dermal white adipose tissue production, and cell transition from fibroblasts to myofibroblasts are achieved. Through this investigation, the present invention was completed.
따라서, 본 발명의 일 목적은, FoxN1(Forkhead-box N1) 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체를 제공하는 데 있다.Accordingly, one object of the present invention is to provide a FoxN1 protein variant encoded by a FoxN1 (Forkhead-box N1) variant gene.
또한, 본 발명의 다른 목적은, FoxN1 단백질 변이체를 이용하여 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)로부터 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로의 인 비트로(in vitro) 전환 유도 방법을 제공하는 데 있다.In addition, another object of the present invention is to provide a method for inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes using a FoxN1 protein variant. It is to provide.
또한, 본 발명의 또 다른 목적은, FoxN1 단백질 변이체를 포함하는 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)로부터 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로의 인 비트로(in vitro) 전환 유도용 조성물을 제공하는 데 있다.In addition, another object of the present invention is to induce in vitro conversion from keratinocytes or fibroblasts containing FoxN1 protein variants to preadipocytes or adipocytes. To provide a composition.
또한, 본 발명의 또 다른 목적은, FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 포함하는 지방충전 또는 피부재생용 화장료 조성물을 제공하는 데 있다.In addition, another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; The object is to provide a cosmetic composition for fat filling or skin regeneration comprising; or a FoxN1 protein variant encoded by the FoxN1 mutant gene.
또한, 본 발명의 또 다른 목적은, FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 포함하는 지방충전 또는 피부재생용 식품 조성물을 제공하는 데 있다.In addition, another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; The object is to provide a food composition for fat filling or skin regeneration comprising; or a FoxN1 protein variant encoded by the FoxN1 mutant gene.
또한, 본 발명의 또 다른 목적은, FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 포함하는 상처 치료 또는 흉터 생성 억제용 약학적 조성물을 제공하는 데 있다.In addition, another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a pharmaceutical composition for treating wounds or inhibiting scar formation, including.
또한, 본 발명의 또 다른 목적은, FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 포함하는 흉터 개선용 화장료 조성물을 제공하는 데 있다.In addition, another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a cosmetic composition for improving scars comprising a.
또한, 본 발명의 또 다른 목적은, FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 포함하는 섬유증(fibrosis)의 예방 또는 치료용 약학적 조성물을 제공하는 데 있다. In addition, another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a pharmaceutical composition for the prevention or treatment of fibrosis, including.
또한, 본 발명의 또 다른 목적은, FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 포함하는 섬유증의 예방 또는 개선용 식품 조성물을 제공하는 데 있다.In addition, another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a food composition for preventing or improving fibrosis comprising a.
또한, 본 발명의 또 다른 목적은, FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 포함하는 섬유증의 예방 또는 개선용 화장료 조성물을 제공하는 데 있다.In addition, another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a cosmetic composition for preventing or improving fibrosis comprising a.
또한, 본 발명의 또 다른 목적은, FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 상처 치료 또는 흉터 생성 억제용 약학적 조성물을 대상에게 투여하는 단계를 포함하는, 상처 치료 또는 흉터 생성 억제 방법을 제공하는 데 있다.In addition, another object of the present invention is the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; providing a method for treating wounds or inhibiting scar formation, comprising administering to a subject a pharmaceutical composition for treating wounds or inhibiting scar formation, comprising as an active ingredient It is there.
또한, 본 발명의 또 다른 목적은, FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 섬유증(fibrosis)의 예방 또는 치료용 약학적 조성물을 대상에게 투여하는 단계를 포함하는, 섬유증 치료 방법을 제공하는 데 있다.In addition, another object of the present invention is the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a method for treating fibrosis, comprising administering to a subject a pharmaceutical composition for preventing or treating fibrosis, which contains as an active ingredient. .
본 명세서에서 사용한 용어는 단지 설명을 목적으로 사용된 것으로, 한정하려는 의도로 해석되어서는 안된다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 명세서에서, "포함하다" 또는 "가지다" 등의 용어는 명세서 상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.The terms used herein are for descriptive purposes only and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly dictates otherwise. In this specification, terms such as “comprise” or “have” are intended to designate the presence of features, numbers, steps, operations, components, parts, or combinations thereof described in the specification, but are not intended to indicate the presence of one or more other features. It should be understood that this does not exclude in advance the possibility of the existence or addition of elements, numbers, steps, operations, components, parts, or combinations thereof.
다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 실시예가 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥 상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by a person of ordinary skill in the technical field to which the embodiments belong. Terms defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related technology, and unless explicitly defined in the present application, should not be interpreted in an ideal or excessively formal sense. No.
이하, 본 발명에 대하여 보다 상세히 설명한다.Hereinafter, the present invention will be described in more detail.
본 발명의 일 양태에 따르면, 본 발명은, 단일염기변이(Single Nucleotide variant: SNV), 삽입 또는 결실(Indel; Insertion or Deletion) 및 유전자 복제수 변이(Copy-number variation, CNV)로 구성된 군에서 선택되는 1 종 이상의 뉴클레오티드 변이를 포함하는 FoxN1(Forkhead-box N1) 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체를 제공한다.According to one aspect of the present invention, the present invention, in the group consisting of Single Nucleotide variant (SNV), Indel (Insertion or Deletion), and Gene Copy-number variation (CNV) Provided is a FoxN1 protein variant encoded by a FoxN1 (Forkhead-box N1) variant gene comprising one or more selected nucleotide mutations.
또한, 본 발명은 FoxN1 변이 유전자 또는 이의 단편, 및 상기 FoxN1 변이 유전자가 포함된 벡터로 목적세포에 형질전환된 형질전환 세포주를 제공할 수 있다.Additionally, the present invention can provide a transformed cell line in which a target cell is transformed with a FoxN1 mutant gene or a fragment thereof, and a vector containing the FoxN1 mutant gene.
상기 FoxN1 변이 유전자는, 변이가 발생한 FoxN1 유전자를 의미하며, 예를 들어 상기 변이는 단일염기변이(Single Nucleotide variant: SNV), 삽입 또는 결실(Indel) 및 유전자 복제수 변이(Copy-number variation, CNV)로 구성된 군에서 선택되는 어느 하나 이상일 수 있으나, 이에 제한되는 것은 아니며, 통상의 기술자에게 인식되는 모든 유전자 변이를 의미한다.The FoxN1 mutant gene refers to a FoxN1 gene in which a mutation has occurred. For example, the mutation may include a single nucleotide variant (SNV), insertion or deletion (Indel), and copy-number variation (CNV). ), but is not limited thereto, and refers to all genetic mutations recognized by those skilled in the art.
본 발명자들은 FoxN1 유전자의 신규 변이 c.55 C>A를 최초로 제작하였다. The present inventors first produced a new mutation c.55 C>A of the FoxN1 gene.
바람직하게는, 본 발명의 상기 FoxN1 변이 유전자는, 서열번호 1로 기재되는 염기서열을 갖는 야생형 FoxN1(Forkhead-box N1) 유전자의 엑손 1 내지 3으로 이루어진 군으로부터 선택된 1 종 이상의 엑손에서 뉴클레오티드 변이가 존재하는 것이다.Preferably, the FoxN1 mutant gene of the present invention has a nucleotide mutation in one or more exons selected from the group consisting of exons 1 to 3 of the wild-type FoxN1 (Forkhead-box N1) gene having the base sequence shown in SEQ ID NO: 1. It exists.
보다 바람직하게는, 상기 뉴클레오티드 변이는, 야생형 FoxN1 단백질의 19 번째 위치의 류신이 메티오닌으로 치환되는 아미노산 변화(p.L19M)를 초래하는, 엑손 2에서의 뉴클레오티드 변이로서, 서열번호 1의 염기서열에서 55번 위치의 시토신(C)이 아데닌(A)으로 치환된 변이 유전자(c.55 C>A)이다.More preferably, the nucleotide mutation is a nucleotide mutation in exon 2, which results in an amino acid change (p.L19M) in which leucine at the 19th position of the wild-type FoxN1 protein is replaced with methionine, in the base sequence of SEQ ID NO: 1. It is a mutant gene (c.55 C>A) in which cytosine (C) at position 55 is replaced with adenine (A).
또한, 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 변이 단백질(FoxN1 단백질 변이체)은, 서열번호 1의 염기서열에서 57번 위치의 시토신(C)이 티민(T)으로 치환된 변이 유전자(c.57C>T)에 의해 코딩되는 변이 단백질(Foxn1 p.L19M)이며, 서열번호 2로 기재되는 아미노산 서열을 갖는다.In addition, the FoxN1 mutant protein (FoxN1 protein variant) encoded by the FoxN1 mutant gene is a mutant gene (c.57C> in which cytosine (C) at position 57 is replaced with thymine (T) in the base sequence of SEQ ID NO: 1. It is a mutant protein (Foxn1 p.L19M) encoded by T) and has the amino acid sequence shown in SEQ ID NO: 2.
본 명세서에서 야생형을 언급하면서 이용되는 용어 "FoxN1 유전자"는, 인간을 포함하는 모든 동물에서 발견되는 상동성이 있는 유전자를 모두 포함하며, 본 발명의 FoxN1 정상 유전자의 염기서열은 예컨대, 서열번호 1(MGI: 102949)과 같으나, 이에 제한되는 것은 아니다.The term "FoxN1 gene" used herein while referring to the wild type includes all homologous genes found in all animals, including humans, and the base sequence of the FoxN1 normal gene of the present invention is, for example, SEQ ID NO: 1 (MGI: 102949), but is not limited thereto.
즉, 통상의 기술자라면 상기 등록 번호를 이용하여 변이의 위치, 뉴클레오티드 서열 및 아미노산 서열을 용이하게 확인할 수 있을 것이다. UCSC genome browser 또는 진뱅크(GenBank)에 등록되어 있는 번호에 해당하는 구체적인 서열은 시간이 지남에 따라 다소 변경될 수 있다. 본 발명의 범위가 상기 변경된 서열에도 미치는 것은 통상의 기술자에게 자명할 것이다.That is, a person skilled in the art will be able to easily confirm the location of the mutation, nucleotide sequence, and amino acid sequence using the registration number. The specific sequence corresponding to the number registered in the UCSC genome browser or GenBank may change somewhat over time. It will be apparent to those skilled in the art that the scope of the present invention also extends to the above altered sequences.
본 명세서에서 사용되는 용어 "단일염기변이(Single Nucleotide Variant, SNV)"는 단일-뉴클레오타이드 변이(single-nucleotide alteration)라고도 하며, 유전체상의 변이 중 단일염기서열이 다른 차이를 보이는 변이를 의미하고, 단일염기다형성(single nucleotide polymorphism, SNP)과 점돌연변이(point mutation)가 여기에 포함된다. 단일염기다형성은 다른 개체의 유전체의 같은 위치에서 특정 염기서열 하나가 다른 염기로 변화되어 다른 형질로 표현되는 것을 의미하며, 유전체 상에 가장 많이 존재하는 형태의 유전자 변이이다. 단일염기다형성은 일반적으로 집단의 1% 이상의 빈도로 나타나며, 1% 이하일 경우는 돌연변이라고 분류한다. 점돌연변이는 하나의 염기서열이 치환, 삽입 또는 결실되어 나타나며 특정 단백질의 생성을 막거나 변형시킬 수 있다.The term "Single Nucleotide Variant (SNV)" used in this specification is also called a single-nucleotide alteration, and refers to a mutation that shows a difference in a single base sequence among mutations in the genome. These include single nucleotide polymorphism (SNP) and point mutations. Single nucleotide polymorphism means that a specific base sequence is changed to a different base at the same location in the genome of another individual, resulting in a different trait. It is the most common form of genetic mutation in the genome. Single nucleotide polymorphisms generally occur at a frequency of more than 1% of the population, and when less than 1% occur, they are classified as mutations. A point mutation occurs when a single base sequence is substituted, inserted, or deleted and can prevent or modify the production of a specific protein.
단일염기변이는 유전체 상에 존재하는 위치와 기능에 따라 분류된다. 또한, 아미노산 서열 변이의 유무에 따라 아미노산의 서열 변이를 일으키지 않는 synonymous SNV(sSNV)와 아미노산의 서열 변이를 일으키는 nonsynonymous SNV(nsSNV)로 분류된다. 단일염기변이 중 Indel의 경우 치환보다 더 심각한 변이를 유발할 수 있다. Indel의 경우 아미노산 염기서열 배열의 격자이동(frame shift)이 유발되어 SNV 뒤에 번역되는 아미노산이 바뀌게 된다.Single nucleotide mutations are classified according to their location and function in the genome. In addition, depending on the presence or absence of amino acid sequence variation, it is classified into synonymous SNV (sSNV), which does not cause amino acid sequence variation, and nonsynonymous SNV (nsSNV), which causes amino acid sequence variation. Among single base mutations, indels can cause more serious mutations than substitutions. In the case of indels, a frame shift in the amino acid sequence occurs, causing the amino acid translated after the SNV to change.
유전체상에 존재하는 위치에 따라 암호화하는 exon 부위에 존재하는 SNV를 coding SNV(cSNV)라 하고, intron, 5'과 3' 말단 비전사지역(5' and 3' untranslated region; UTR)과 같은 비암호화 부위에 존재하는 SNV를 noncoding SNV(ncSNV)라 한다.SNVs that exist in the coding exon region according to their location on the genome are called coding SNVs (cSNVs), and non-translated regions such as introns and 5' and 3' untranslated regions (UTRs) are called coding SNVs (cSNVs). SNVs present in the coding region are called noncoding SNVs (ncSNVs).
본 발명에서, "SNP" 및 "SNV"는 상호호환적으로 사용될 수 있으며, "FoxN1 유전자의 SNV" 또는 "FoxN1 유전자의 SNP"와 같이 동일한 의미로 사용될 수 있으며, 단일염기가 폴리뉴클레오타이드 서열에 변화(대체), 제거(결실) 또는 첨가(삽입)될 수 있고, SNP는 번역 프레임의 변화(inframe shift)를 유발할 수 있다.In the present invention, “SNP” and “SNV” can be used interchangeably, and can be used with the same meaning, such as “SNV of the FoxN1 gene” or “SNP of the FoxN1 gene”, and can be used with the same meaning as “SNP of the FoxN1 gene”, where a single base changes in the polynucleotide sequence. (replacement), removal (deletion), or addition (insertion), SNPs can cause a change in the translation frame (inframe shift).
"삽입 또는 결실(Indel; Insertion or Deletion)"은 유전자에 1개 이상의 뉴클레오타이드가 삽입(insertion) 또는 결실(deletion) 된 것을 의미한다. SNV에서의 Indel은 1개의 뉴클레오타이드가 삽입 또는 결실된 것을 의미하며, "삽입 또는 결실(Indel)"은 이를 포함하는 의미로 사용될 수 있다.“Indel (Insertion or Deletion)” means the insertion or deletion of one or more nucleotides into a gene. Indel in SNV means insertion or deletion of one nucleotide, and “insertion or deletion (Indel)” can be used to include this.
"유전자 복제수 변이(Copy-number variation, CNV)"는 유전자의 일정 섹션의 반복이 개체마다 다른 현상을 의미한다. 상기 반복은 0배 내지 n배로 반복될 수 있다. 0배로 반복되는 경우, 해당 유전자의 기능이 상실되며, 1배 초과로 반복되는 경우 해당 유전자의 기능이 증폭되는 것이 일반적이나, 이에 제한되는 것은 아니다.“Copy-number variation (CNV)” refers to a phenomenon in which the repetition of a certain section of a gene varies from individual to individual. The repetition may be repeated 0 to n times. When repeated 0-fold, the function of the gene is lost, and when repeated more than 1-fold, the function of the gene is generally amplified, but is not limited to this.
본 발명의 FoxN1 단백질 변이체(Foxn1 p.L19M)는 피부세포 항상성에 영향을 끼쳐, 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)를 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로 전환(transition)시켰으며, 이에 따라, 지방 형성이 촉진되어, 피하지방을 증가시켰다. The FoxN1 protein variant (Foxn1 p.L19M) of the present invention affects skin cell homeostasis, converting keratinocytes or fibroblasts into preadipocytes or adipocytes. As a result, fat formation was promoted and subcutaneous fat increased.
본 발명에서 사용되는 용어 "전환(transition)"은 "전환분화(Direct Reprogramming/Direct Conversion/Transdifferentiation)"를 의미할 수 있으며, 이는, 고등생물에서 전혀 다른 세포타입을 가지는 성숙한 (분화가 끝난) 세포 간의 전환을 유도하는 과정으로서, 본 명세서에서 EMT를 포함한다.The term “transition” used in the present invention may mean “Direct Reprogramming/Direct Conversion/Transdifferentiation,” which refers to mature (completely differentiated) cells with completely different cell types in higher organisms. As a process that induces liver transformation, EMT is included herein.
따라서, 본 발명의 FoxN1 단백질 변이체(Foxn1 p.L19M)는, 특정부위에서의 지방 형성을 유도할 수 있을 뿐만 아니라, 섬유화 요인인 섬유아세포에 적용할 경우 다른 세포로의 전환을 유도할 수 있으므로, 섬유증과 같은 관련 질환에도 적용할 수 있다.Therefore, the FoxN1 protein variant (Foxn1 p.L19M) of the present invention can not only induce fat formation in a specific area, but can also induce conversion to other cells when applied to fibroblasts, which are a factor in fibrosis. It can also be applied to related diseases such as fibrosis.
또한, 본 발명의 다른 양태에 따르면, 본 발명은, 다음 단계를 포함하는 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)로부터 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로의 인 비트로(in vitro) 전환 유도 방법을 제공한다:In addition, according to another aspect of the present invention, the present invention provides an in vitro method of converting keratinocytes or fibroblasts into preadipocytes or adipocytes, including the following steps: Provides ways to drive conversions:
(a) 상기 FoxN1(Forkhead-box N1) 변이 유전자를 포함하는 벡터를 제작하는 단계; 및(a) constructing a vector containing the FoxN1 (Forkhead-box N1) mutant gene; and
(b) 상기 벡터를 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)에 형질전환시키는 단계.(b) Transforming the vector into keratinocytes or fibroblasts.
상기 벡터는, 본 발명의 목적, 즉, 변이 유발을 달성할 수 있는 한, 당업계에 공지된 임의의 방법을 이용할 수 있으며, 예를 들어, 상동성 재조합(Homologous recombination), TALEN, ZFN 및 CRISPR-Cas9 벡터로 이루어진 군으로부터 선택될 수 있으나, 이에 한정되는 것은 아니다.The vector can be prepared by any method known in the art, for example, homologous recombination, TALEN, ZFN, and CRISPR, as long as it can achieve the purpose of the present invention, that is, mutagenesis. -Can be selected from the group consisting of Cas9 vectors, but is not limited thereto.
상기 세포에 벡터의 도입은 형질전환(transfection), 전기천공(electroporation), 형질도입(transduction), 미세주입(microinjection) 또는 총알식 도입(ballistic introduction) 방법이 모두 이용가능하다.For the introduction of vectors into the cells, transfection, electroporation, transduction, microinjection, or ballistic introduction can all be used.
상기 벡터는 CRISPR-Cas9 기술을 이용하는 것이 바람직하고, FoxN1 유전자에 표적 염기서열을 정하여 디자인하고, PAM(protospacer adjacent motif) 염기서열을 인식하여 표적 염기서열을 절단하도록 Cas9 단백질을 포함한 벡터를 제작하여 사용하는 것이 바람직하다. 또한, 이로 인해 위치-특이적으로 Cas9 단백질이 지정한 위치의 FoxN1 유전자에 변이가 발생하도록 유도한다.The vector is preferably designed using CRISPR-Cas9 technology, and a vector containing the Cas9 protein is designed to recognize the PAM (protospacer adjacent motif) base sequence and cleave the target base sequence. It is desirable to do so. In addition, this causes location-specific mutations in the FoxN1 gene at the location designated by the Cas9 protein.
본 발명의 일 실시예에서는, 흉선 발달 및 케라틴 세포 분화에 연관된 FoxN1 유전자를 타겟으로 선택하여 CRISPR/Cas9 base editor를 이용하여 새로운 SNP를 발굴하고 Foxn1 SNP 변이체의 기능을 확인하고자, 서열번호 1로 기재되는 FoxN1 유전자의 1 번째 코딩 엑손(exon) 19번째 amino acid의 전사 염기서열에 대한 무작위 SNP을 유도하기 위해 도 1a과 같이 FoxN1 돌연변이를 발현하는 표적 벡터로서 sgRNA 표적 디자인하였고, 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)를 형질전환시켰을 때, 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로의 전환시키고, 각질 세포유래의 지방 분화 신호를 활성화 함으로써 진피피부지방의 증식 (hyperplasia)를 유도할 수 있으며, 각질세포의 상피간엽이행을 촉진함으로써 상처치유 및 피부 재생을 가속화시킨다.In one embodiment of the present invention, the FoxN1 gene associated with thymus development and keratinocyte differentiation is selected as a target to discover new SNPs using a CRISPR/Cas9 base editor and to confirm the function of the Foxn1 SNP variant, listed as SEQ ID NO: 1. In order to induce a random SNP for the transcription sequence of the 19th amino acid of the first coding exon of the FoxN1 gene, an sgRNA target was designed as a targeting vector expressing the FoxN1 mutation as shown in Figure 1a, and was targeted to keratinocytes or When fibroblasts are transformed, they are converted into preadipocytes or adipocytes and the proliferation of dermal fat (hyperplasia) can be induced by activating the adipogenic differentiation signal derived from keratinocytes. , Accelerates wound healing and skin regeneration by promoting epithelial-mesenchymal transition of keratinocytes.
본 발명에서, 용어 "전구세포"는 위탁줄기세포라고 하며, 자손에 해당되는 세포(X)가 특정한 분화형성 발현이 밝혀진 경우, 분화형질을 발현하지 않은 미분화 친(親)세포를 X의 전구세포라고 부른다. 또한, "지방전구세포"는 지방세포로의 분화형성 발현이 밝혀진 전구세포를 의미한다.In the present invention, the term "progenitor cell" is referred to as a committed stem cell, and when a cell corresponding to a descendant (X) is found to express specific differentiation, an undifferentiated parental cell that does not express differentiation traits is used as a progenitor cell of It is called. Additionally, “preadipocyte” refers to a progenitor cell that has been shown to differentiate into adipocytes.
또한, 본 발명은, 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 포함하는, 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)로부터 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로의 인 비트로(in vitro) 전환 유도용 조성물을 제공한다.In addition, the present invention provides the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; or a FoxN1 protein variant encoded by the FoxN1 mutant gene; inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes. Provides a composition for
본 발명에서 용어, "지방전구세포 또는 지방세포로의 전환"은 동물, 구체적으로는 포유동물의 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)가 FoxN1(Forkhead-box N1) 변이에 의해 지방전구세포 또는 지방세포로 분화하는 것을 의미한다. 본 발명에서 용어, "전환 유도용 조성물"은 초기 단계의 세포가 각 조직으로서의 특성을 갖게 되는 과정을 유도할 수 있는 조성물을 의미하며, 본 발명의 목적상 각질세포 또는 섬유아세포를 상기 지방전구세포 또는 지방세포로 분화 유도할 수 있는 조성물을 의미한다. 구체적으로는, 상기 전환 유도용 조성물은 FoxN1 변이 유전자 또는 FoxN1 단백질 변이체의 발현을 촉진하여 지방세포의 분화를 유도할 수 있다. 또한, 상기 조성물은 지방세포의 형성을 촉진시켜, 피부 손상 또는 노화 등으로 인해 퇴축된 피부 지방 충전을 유도할 수 있다.In the present invention, the term "conversion to preadipocytes or adipocytes" means that keratinocytes or fibroblasts of animals, specifically mammals, are preadipocytes or fibroblasts due to FoxN1 (Forkhead-box N1) mutation. This means differentiating into fat cells. In the present invention, the term "composition for inducing conversion" refers to a composition capable of inducing the process by which cells in the early stages acquire the characteristics of each tissue, and for the purpose of the present invention, keratinocytes or fibroblasts are converted into preadipocytes. Alternatively, it refers to a composition that can induce differentiation into adipocytes. Specifically, the composition for inducing conversion can induce differentiation of adipocytes by promoting the expression of the FoxN1 mutant gene or FoxN1 protein mutant. In addition, the composition can promote the formation of fat cells and induce refilling of skin fat that has degenerated due to skin damage or aging.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 지방충전 또는 피부재생용 화장료 조성물을 제공한다.In addition, according to another aspect of the present invention, the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as a cosmetic composition for fat filling or skin regeneration, comprising as an active ingredient.
본 발명에 있어서, "지방충전"이란 피부 내의 지방조직이 퇴축되어 지방 조직의 부피가 저하된 정도를 완화, 개선 또는 충전시켜주는 것을 의미하는 것으로, 지방이 충전됨으로써 진피 백색피부 지방 매개의 피부 재생을 포함하여 피부의 볼륨이 개선되는 것을 의미한다.In the present invention, “fat filling” means alleviating, improving, or filling the degree to which fat tissue in the skin has degenerated and the volume of the fat tissue has decreased. By filling with fat, dermal white skin fat-mediated skin regeneration is achieved. This means that the volume of the skin is improved.
본 발명에서 용어, "피부재생"이란 심하게 손상된 피부가 원래의 기능을 회복하도록 하는 것을 의미하고, 피부탄력 또는 주름개선을 포함할 수 있다. 구체적으로 이에 제한된 것은 아니나, 피부재생은 피부가 쳐지거나 늘어지는 정도를 완화시켜주거나, 피부 지방충전 또는 지방 조직 부피 저하로 인하여 감소된 피부 탄력과 강도 하락으로 인한 구조적인 붕괴를 지방을 충전함으로써 피부 탄력이 유지되는 것을 포함할 수 있다. 또한, 그 외에도 피부에 주름이 생성되는 것을 억제 또는 저해하거나, 이미 생성된 주름을 완화시키는 것을 포함할 수 있다.In the present invention, the term "skin regeneration" means allowing severely damaged skin to recover its original function, and may include skin elasticity or wrinkle improvement. Although not specifically limited to this, skin regeneration relieves the degree of sagging or sagging skin, or replenishes the skin with fat to compensate for structural collapse caused by decreased skin elasticity and strength due to skin fat filling or decrease in fat tissue volume. This may include maintaining elasticity. In addition, it may include suppressing or inhibiting the formation of wrinkles on the skin or alleviating wrinkles that have already been formed.
본 발명의 FoxN1 변이에 의한 지방형성은 피부 지방조직의 부피가 저하된 정도를 완화, 개선 또는 충전시킬 수 있음을 시사하는 것이므로, 본 발명의 화장료 조성물이 지방충전 용도로 사용될 수 있음을 나타내는 것이다.Fat formation by the FoxN1 mutation of the present invention suggests that the degree of reduction in the volume of skin adipose tissue can be alleviated, improved, or filled, and thus the cosmetic composition of the present invention can be used for fat filling purposes.
또한, 본 발명의 조성물은 퇴축된 지방조직의 부피를 완화 또는 개선시킴으로써, 피부의 탄력 및 주름을 증진 또는 개선시키며, 더 나아가 손상된 피부가 원래의 기능을 회복할 수 있도록 도울 수 있음을 시사하므로, 본 발명의 FoxN1 변이를 포함하는 화장료 조성물이 피부재생 용도로 사용될 수 있음이 자명하다.In addition, the composition of the present invention improves or improves skin elasticity and wrinkles by alleviating or improving the volume of degenerated fatty tissue, and further suggests that it can help damaged skin recover its original function. It is obvious that the cosmetic composition containing the FoxN1 mutation of the present invention can be used for skin regeneration purposes.
상기 화장료 조성물은 용액, 외용연고, 크림, 폼, 영양화장수, 유연화장수, 팩, 유연수, 유액, 메이크업베이스, 에센스, 비누, 액체 세정료, 입욕제, 선 스크린크림, 선오일, 현탁액, 유탁액, 페이스트, 겔, 로션, 파우더, 비누, 계면활성제-함유 클린싱, 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션, 패취 및 스프레이로 구성된 군으로부터 선택되는 제형으로 제조할 수 있으나, 이에 제한된 것은 아니다.The cosmetic composition includes solution, external ointment, cream, foam, nourishing lotion, softening lotion, pack, softening water, emulsion, makeup base, essence, soap, liquid cleanser, bath agent, sunscreen cream, sun oil, suspension, emulsion, It can be prepared in a formulation selected from the group consisting of paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, patch and spray, but is not limited thereto.
또한, 상기 화장료 조성물은 일반 피부 화장료에 배합되는 화장품학적으로 허용 가능한 담체를 1 종 이상 추가로 포함할 수 있으며, 통상의 성분으로 예를 들면 유분, 물, 계면활성제, 보습제, 저급 알콜, 증점제, 킬레이트제, 색소, 방부제, 향료 등을 적절히 배합할 수 있으나, 이에 제한되는 것은 아니다.In addition, the cosmetic composition may further include one or more cosmetically acceptable carriers that are blended with general skin cosmetics, and common ingredients include, for example, oil, water, surfactant, moisturizer, lower alcohol, thickener, Chelating agents, pigments, preservatives, fragrances, etc. may be appropriately mixed, but are not limited thereto.
상기 화장료 조성물에 포함되는 화장품학적으로 허용 가능한 담체는 제형에 따라 다양하다.Cosmetically acceptable carriers included in the cosmetic composition vary depending on the formulation.
상기 화장료 조성물의 제형이 연고, 페이스트, 크림 또는 젤인 경우에는, 담체 성분으로서 동물성 유, 식물성유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크, 산화아연 또는 이들의 혼합물이 이용될 수 있다.When the formulation of the cosmetic composition is ointment, paste, cream or gel, the carrier ingredients include animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, and zinc oxide. Or a mixture thereof can be used.
상기 화장료 조성물의 제형이 파우더 또는 스프레이인 경우에는, 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록사이드, 칼슘 실케이트, 폴리아미드 파우더 또는 이들의 혼합물이 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진제를 포함할 수 있다.When the formulation of the cosmetic composition is powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silcate, polyamide powder, or mixtures thereof may be used as carrier ingredients, and especially in the case of spray, additional May contain propellants such as chlorofluorohydrocarbons, propane/butane or dimethyl ether.
상기 화장료 조성물의 제형이 용액 또는 유탁액인 경우에는, 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되며, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알콜, 벤질 벤조에이트, 프로필렌글리콜, 1,3-부틸글리콜 오일이 이용될 수 있으며, 특히, 목화씨 오일, 땅콩 오일, 옥수수 배종 오일, 올리브오일, 피마자 오일 및 참깨 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 이용될 수 있다.When the formulation of the cosmetic composition is a solution or emulsion, a solvent, solubilizing agent, or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, and propylene glycol. , 1,3-butyl glycol oil can be used, in particular cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan. You can.
상기 화장료 조성물의 제형이 현탁액인 경우에는, 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화 이소스테아릴 알콜, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.When the formulation of the cosmetic composition is a suspension, the carrier component includes water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.
상기 화장료 조성물의 제형이 비누인 경우에는 담체 성분으로서 지방산의 알칼리 금속 염, 지방산 헤미에스테르염, 지방산 단백질 히드롤리제이트, 이세티오네이트, 라놀린 유도체, 지방족 알콜, 식물성 유, 글리세롤, 당 등이 이용될 수 있다.When the formulation of the cosmetic composition is soap, alkali metal salts of fatty acids, hemiester salts of fatty acids, fatty acid protein hydrolysates, isethionates, lanolin derivatives, fatty alcohols, vegetable oils, glycerol, sugars, etc. are used as carrier ingredients. It can be.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 지방충전 또는 피부재생용 식품 조성물을 제공한다.In addition, according to another aspect of the present invention, the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a food composition for fat filling or skin regeneration.
상기 식품 조성물은 건강기능식품의 형태로 사용될 수 있으나, 이에 제한되는 것은 아니며, 유효성분 이외에 식품학적으로 허용 가능한 식품보조첨가제를 포함할 수 있다.The food composition may be used in the form of a health functional food, but is not limited thereto, and may include foodologically acceptable food supplements in addition to the active ingredients.
본 발명에 있어서, "식품보조첨가제"란 식품에 보조적으로 첨가될 수 있는 구성요소를 의미하며, 각 제형의 건강기능식품을 제조하는데 첨가되는 것으로서 당업자가 적절히 선택하여 사용할 수 있다. 식품보조첨가제의 예로는 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 충진제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등이 포함되지만, 상기 예들에 의해 본 발명의 식품보조첨가제의 종류가 제한되는 것은 아니다.In the present invention, “food supplement” refers to a component that can be added to food as an auxiliary ingredient, and can be appropriately selected and used by a person skilled in the art as it is added to manufacture each type of health functional food. Examples of food supplements include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, and protective colloidal thickeners. , pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc., but the types of food supplements of the present invention are not limited to the above examples.
상기 본 발명의 식품 조성물에는 건강기능식품이 포함될 수 있다. 본 발명에 있어서, "건강기능식품"이란 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 정제, 캅셀, 분말, 과립, 액상 및 환 등의 형태로 제조 및 가공한 식품을 말한다. 여기서 "기능성"이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻는 것을 의미한다. 상기 건강기능식품은 당업계에서 통상적으로 사용되는 방법에 의하여 제조 가능하며, 상기 제조시에는 당업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 건강기능식품의 제형 또한 건강기능식품으로 인정되는 제형이면 제한 없이 제조될 수 있다. 상기 본 발명의 식품 조성물은 다양한 형태의 제형으로 제조될 수 있으며, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나, 본 발명의 건강기능식품은 지방충전, 피부재생 효과를 증진시키기 위한 보조제로 섭취가 가능하다.The food composition of the present invention may include health functional foods. In the present invention, “health functional food” refers to food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, and pills using raw materials or ingredients with functional properties useful to the human body. Here, “functionality” means controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes, such as physiological effects. The health functional food can be manufactured by a method commonly used in the industry, and can be manufactured by adding raw materials and ingredients commonly added in the industry. Additionally, the formulation of the health functional food can also be manufactured without limitation as long as it is a formulation recognized as a health functional food. The food composition of the present invention can be manufactured in various types of formulations, and unlike general drugs, it is made from food as a raw material and has the advantage of not having side effects that may occur when taking the drug for a long period of time, and is excellent in portability, so the present invention Health functional foods can be consumed as supplements to enhance fat replenishment and skin regeneration effects.
상기 본 발명의 건강기능식품이 취할 수 있는 형태에는 제한이 없으며, 통상적인 의미의 식품을 모두 포함할 수 있고, 기능성 식품 등 당업계에 알려진 용어와 혼용 가능하다. 아울러, 상기 본 발명의 건강기능식품은 당업자의 선택에 따라 식품에 포함될 수 있는 적절한 기타 보조성분과 공지의 첨가제를 혼합하여 제조할 수 있다. 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 본 발명에 따른 유효성분을 주성분으로 하여 제조한 즙, 차, 젤리 및 주스 등에 첨가하여 제조할 수 있다. 또한 동물을 위한 사료로 이용되는 식품도 포함한다.There is no limit to the form that the health functional food of the present invention can take, and it can include all foods in the conventional sense, and can be used interchangeably with terms known in the art, such as functional food. In addition, the health functional food of the present invention can be prepared by mixing known additives with other appropriate auxiliary ingredients that can be included in the food according to the selection of a person skilled in the art. Examples of foods that can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and There are vitamin complexes, etc., and they can be manufactured by adding the active ingredient according to the present invention to juice, tea, jelly, juice, etc. It also includes foods used as feed for animals.
또 다른 하나의 실시 양태로서, 본 발명의 유효성분을 포함하는 조성물은 의약외품 조성물로 사용할 수 있다.In another embodiment, a composition containing the active ingredient of the present invention can be used as a quasi-drug composition.
또한, 구체적으로, 상기 의약외품 조성물은 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체를 포함하는 지방충전용 또는 피부재생용 의약외품 조성물을 제공할 수 있다.Additionally, specifically, the quasi-drug composition contains the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Alternatively, a quasi-drug composition for fat filling or skin regeneration containing a FoxN1 protein variant encoded by the FoxN1 mutant gene may be provided.
상기 의약외품 조성물에는 상기 성분 외에 필요에 따라 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 더욱 포함할 수 있다. 상기 약학적으로 허용 가능한 담체, 부형제 또는 희석제는 본 발명의 효과를 해하지 않는 한 제한되지 않으며, 예를 들어 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제, 윤활제, 감미제, 방향제, 보존제 등을 포함할 수 있다.In addition to the above ingredients, the quasi-drug composition may further include pharmaceutically acceptable carriers, excipients, or diluents as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effect of the present invention, and includes, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc. It can be included.
상기 의약외품 조성물의 약학적으로 허용 가능한 담체, 부형제 또는 희석제의 대표적인 예로는, 락토즈, 덱스트로스, 슈크로스, 솔비톨, 만니톨, 자일리톨, 말티톨, 전분, 젤라틴, 글리세린, 아카시아 고무, 알지네이트, 칼슘포스페이트, 칼슘카보네이트, 칼슘실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유, 프로필렌글리콜, 폴리에틸렌글리콜, 식물성 오일, 주사가능한 에스테르, 위텝솔, 마크로골, 트윈 61, 카카오지, 라우리지 등을 들 수 있다.Representative examples of pharmaceutically acceptable carriers, excipients or diluents of the quasi-drug composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, gelatin, glycerin, gum acacia, alginate, calcium phosphate, Calcium carbonate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, propylene glycol, polyethylene glycol, vegetable. Examples include oils, injectable esters, Wetepsol, Macrogol, Tween 61, Cacao, Lauridge, etc.
또한, 의약외품으로 사용하는 경우, 추가로 동일 또는 유사한 기능을 나타내는 유효성분을 1종 이상 함유할 수 있다. 예컨대, 공지의 리포필링(lipofilling) 또는 지방충전, 피부재생, 또는 피부 보습 성분을 포함할 수 있을 것이다. 추가적인 피부 보습 성분을 포함하게 되면 본 발명의 의약외품 조성물의 지방충전 또는 피부재생 효과는 더욱 증가될 수 있을 것이다. 상기 성분 추가 시에는 복합 사용에 따른 피부 안전성, 제형화의 용이성, 유효성분들의 안정성을 고려할 수 있다.Additionally, when used as a quasi-drug, it may additionally contain one or more active ingredients that exhibit the same or similar functions. For example, it may include known lipofilling, fat filling, skin regeneration, or skin moisturizing ingredients. If additional skin moisturizing ingredients are included, the fat filling or skin regeneration effect of the quasi-drug composition of the present invention can be further increased. When adding the above ingredients, skin safety due to combined use, ease of formulation, and stability of the active ingredients can be taken into consideration.
상기 본 발명의 의약외품 조성물은 소독 청결제, 샤워폼, 연고액, 물티슈, 코팅제 등을 예시할 수 있으나 이에 제한되는 것이 아니며, 의약외품의 제제화 방법, 용량, 이용방법, 구성성분 등은 기술분야에 공지된 통상의 기술로부터 적절히 선택될 수 있다.The quasi-drug composition of the present invention may include, but is not limited to, disinfectant cleaner, shower foam, ointment, wet tissue, coating agent, etc., and the formulation method, dosage, usage method, and components of the quasi-drug are known in the technical field. It can be appropriately selected from conventional techniques.
또 다른 하나의 실시 양태로서, 본 발명은 피부 외용제를 제공한다.As another embodiment, the present invention provides an external skin preparation.
또한, 구체적으로, 본 발명은 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체를 포함하는 지방충전용 또는 피부 재생용 피부 외용제를 제공할 수 있다.Additionally, specifically, the present invention relates to the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Alternatively, an external skin preparation for fat filling or skin regeneration containing a FoxN1 protein variant encoded by the FoxN1 mutant gene may be provided.
본 발명에서 용어, "외용제"는 외용으로 제공되는 제제로 외용산제, 외용정제, 외용액제, 연고제, 경고제, 좌제 등이 있다. 외용제제란 아연화(亞鉛華)전분 등, 피부점막의 미란, 궤양 등에 산포하는 것을 의미하고, 외용정제는 용해정 또는 질정을 의미하며, 외용액제는 물, 에탄올, 유류 등을 용매로 하는 액상제제이고, 양치질, 습포, 세척, 점안, 점비(点鼻) 등에 사용한다. 또한, 연고제는 피부에 바르는 적당한 조도의 반고형제, 경고는 상온고형, 체온으로 연화하는 피부적용제이고, 좌제는 항문, 질, 요도에 적용하는 제제이다.In the present invention, the term "external preparation" refers to preparations provided for external use, including external acid, external tablet, external solution, ointment, warning agent, suppository, etc. External preparations refer to those spread on zinc starch, etc., erosions and ulcers of the skin mucous membrane, external tablets refer to dissolved tablets or vaginal tablets, and external solution preparations refer to liquids containing water, ethanol, oil, etc. as solvents. It is a preparation and is used for gargling, compressing, washing, eye drops, nasal drops, etc. In addition, ointments are semi-solid preparations of appropriate consistency to be applied to the skin, ointments are solid at room temperature and are applied to the skin that softens with body temperature, and suppositories are preparations to be applied to the anus, vagina, and urethra.
상기 "피부 외용제"는 외용제 중에서도 피부 외용에 작용하는 제제를 의미하는 것으로 본 발명에서는 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체를 유효성분으로 함유하는 피부 외용제를 의미한다. 구체적으로, 피부 외용제에는 크림, 젤, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제의 피부 외용제 형태의 의약품 또는 의약외품으로 제조하여 사용할 수 있으나, 이에 제한되지 않는다.The "external skin preparation" refers to a preparation that acts on the skin externally among external preparations. In the present invention, the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Alternatively, it refers to an external skin preparation containing the FoxN1 protein variant encoded by the FoxN1 mutant gene as an active ingredient. Specifically, external skin preparations include, but are not limited to, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment preparations, pasta preparations, or cataplasma preparations that can be manufactured and used as drugs or quasi-drugs in the form of external skin preparations. No.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 상처 치료 또는 흉터 생성 억제용 약학적 조성물 및 흉터 개선용 화장료 조성물을 제공한다.In addition, according to another aspect of the present invention, the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a pharmaceutical composition for treating wounds or inhibiting scar formation, and a cosmetic composition for improving scars.
본 발명의 조성물은 본 발명의 Foxn1 p.L19M에 의해 상처치유에 중요한 역할을 하는 섬유아세포에서 근섬유아세포로의 특성 발현을 유도하므로, 본 발명의 FoxN1 변이를 포함하는 화장료 조성물이 상처 치료, 흉터 생성 억제 및 흉터 개선 용도로 사용될 수 있음이 자명하다.The composition of the present invention induces the expression of characteristics from fibroblasts, which play an important role in wound healing, to myofibroblasts by Foxn1 p.L19M of the present invention, so the cosmetic composition containing the FoxN1 mutation of the present invention helps in wound healing and scar formation. It is clear that it can be used for suppression and scar improvement purposes.
따라서, 본 발명은 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 상처 치료 또는 흉터 생성 억제용 약학적 조성물을 대상에게 투여하는 단계를 포함하는, 상처 치료 또는 흉터 생성 억제 방법을 제공한다.Therefore, the present invention provides the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; Provided is a method for treating wounds or inhibiting scar formation, comprising the step of administering to a subject a pharmaceutical composition for treating wounds or inhibiting scar formation, comprising as an active ingredient. .
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 섬유증(fibrosis)의 예방 또는 치료용 약학적 조성물을 제공한다.In addition, according to another aspect of the present invention, the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a pharmaceutical composition for preventing or treating fibrosis.
상기 섬유증은 폐, 신장, 간, 심장, 뇌, 혈관, 관절, 장, 피부, 연조직, 골수, 음경, 복막, 랜즈, 근육, 척추, 고환, 난소, 유방, 갑상선, 고막, 췌장, 담낭, 방광 및 전립선으로 이루어진 군 중에서 선택되는 기관에서 발병할 수 있으며, 바람직하게는, 폐섬유증(Pulmonary fibrosis), 자궁근종, 골수섬유증(Myelofibrosis), 간섬유증(Liver fibrosis), 심장섬유증(Heart fibrosis), 다발성 경화증, 신장섬유증(Kidney fibrosis), 낭포성섬유증(Cystic fibrosis), 호중구감소증, 골격근섬유증, 피부 경화증, 피부근염, 종격동 섬유증(Mediastinal fibrosis) 및 겸상 적혈구 빈혈증에 의한 비장 섬유증으로 구성된 군으로부터 선택되는 1종 이상일 수 있다.The fibrosis is present in the lungs, kidneys, liver, heart, brain, blood vessels, joints, intestines, skin, soft tissues, bone marrow, penis, peritoneum, lance, muscles, spine, testes, ovaries, breasts, thyroid, eardrums, pancreas, gallbladder, and bladder. and the prostate, preferably in an organ selected from the group consisting of pulmonary fibrosis, uterine fibroids, myelofibrosis, liver fibrosis, heart fibrosis, and multiple lesions. 1 selected from the group consisting of cirrhosis, kidney fibrosis, cystic fibrosis, neutropenia, skeletal muscle fibrosis, scleroderma, dermatomyositis, mediastinal fibrosis, and splenic fibrosis due to sickle cell anemia. There may be more than one species.
즉, 본 발명의 FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 이용할 경우, 섬유화를 유발하는 섬유아세포를, 다른 세포, 예컨대, 지방전구세포 또는 지방세포로의 전환분화시킴으로써, 섬유증을 효과적으로 치료 또는 억제할 수 있다.That is, the FoxN1 mutant gene of the present invention; A vector containing the FoxN1 mutant gene; Or, when using a FoxN1 protein variant encoded by the FoxN1 mutant gene, fibrosis can be effectively treated or inhibited by transdifferentiating fibroblasts that cause fibrosis into other cells, such as preadipocytes or adipocytes. .
따라서, 본 발명은, 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 섬유증(fibrosis)의 예방 또는 치료용 약학적 조성물을 대상에게 투여하는 단계를 포함하는, 섬유증 치료 방법을 제공한다.Therefore, the present invention provides the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; It provides a method of treating fibrosis, comprising the step of administering to a subject a pharmaceutical composition for preventing or treating fibrosis, which contains as an active ingredient.
본 발명에서 사용되는 용어 "유효성분으로 포함하는"이란, 본 발명의 유효 성분인 FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체를 소정의 효능 또는 활성을 달성하는 데 충분한 양으로 포함하는 것을 의미한다. 이들은 약학적으로 유효한 양으로 투여할 수 있으며, 유효 용량수준은 개체의 종류 및 연령, 성별, 약물에 대한 민감도, 치료 기간, 동시에 사용되는 약물 및 기타 의학적 요소에 따라 결정될 수 있다. As used in the present invention, the term "comprising an active ingredient" refers to the FoxN1 mutant gene, which is an active ingredient of the present invention; A vector containing the FoxN1 mutant gene; Alternatively, it means containing the FoxN1 protein variant encoded by the FoxN1 variant gene in an amount sufficient to achieve a predetermined efficacy or activity. They can be administered in a pharmaceutically effective amount, and the effective dose level can be determined depending on the type and age of the individual, gender, sensitivity to the drug, treatment period, drugs used simultaneously, and other medical factors.
본 발명의 일 실시예에 따른 약학적 조성물은 개별 치료제로 투여하거나, 다른 치료제와 병용하여 투여될 수 있으며, 기존 치료제와는 순차적 또는 동시에 투여될 수 있다. The pharmaceutical composition according to one embodiment of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with existing therapeutic agents.
상기 약학적 조성물의 일일 투여량은 0.01 내지 500 mg/kg일 수 있으며, 하루 1 회 내지 수 회 나누어 투여할 수 있으나, 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율, 질환의 중증도 등을 고려하여, 부작용이 없고 최대 효과를 얻을 수 있는 양으로 통상의 기술자에 의해 용이하게 결정될 수 있다. The daily dosage of the pharmaceutical composition may be 0.01 to 500 mg/kg, and may be administered once to several times a day, depending on the patient's weight, age, gender, health status, diet, administration time, administration method, Considering the excretion rate, severity of disease, etc., the amount that can achieve maximum effect without side effects can be easily determined by a person skilled in the art.
상기 약학적 조성물은 경구, 피하, 복강 내, 폐 내, 비강 내, 근육 내, 정맥 내 및 동맥 등 다양한 경로로 투여될 수 있다.The pharmaceutical composition can be administered through various routes, such as orally, subcutaneously, intraperitoneally, intrapulmonary, intranasally, intramuscularly, intravenously, and arterially.
또한, 본 발명의 약학적 조성물은 상기 유효성분 이외에 약학적으로 허용 가능한 담체, 부형제 및/또는 희석제를 포함하여 제제화할 수 있다.Additionally, the pharmaceutical composition of the present invention may be formulated to include pharmaceutically acceptable carriers, excipients, and/or diluents in addition to the active ingredients.
상기 약학제제는 산제, 과립제, 정제, 피복정, 캡슐제, 현탁액, 에멀젼, 시럽, 좌제, 에어로졸 등의 경구형 제형, 외용제, 좌제 또는 주사제의 형태로 제형화될 수 있으나, 이에 한정되는 것은 아니다. The pharmaceutical preparation may be formulated in the form of oral dosage forms such as powders, granules, tablets, coated tablets, capsules, suspensions, emulsions, syrups, suppositories, aerosols, external preparations, suppositories, or injections, but is not limited thereto. .
상기 약학제제는 하나 이상의 부형제, 예를 들어, 전분, 락토오스, 젤라틴, 수크로오스, 윤활제, 보존제, 방향제, 감미제 등을 추가로 혼합하여 조제될 수 있다. The pharmaceutical preparation may be prepared by additionally mixing one or more excipients, such as starch, lactose, gelatin, sucrose, lubricant, preservative, flavoring agent, sweetener, etc.
본 발명의 조성물은 본 발명의 유효성분와 함께 본 발명의 대상 섬유증에 대하여 예방 또는 치료 효과를 갖는 공지의 유효성분을 1 종 이상 함유할 수 있다.The composition of the present invention may contain one or more known active ingredients that have a preventive or therapeutic effect on fibrosis, the subject of the present invention, along with the active ingredient of the present invention.
본 발명의 조성물은 약학적으로 허용 가능한 첨가제를 더 포함할 수 있으며, 이때 약학적으로 허용 가능한 첨가제로는 전분, 젤라틴화 전분, 미결정셀룰로오스, 유당, 포비돈, 콜로이달실리콘디옥사이드, 인산수소칼슘, 락토스, 만니톨, 엿, 아라비아고무, 전호화전분, 옥수수전분, 분말셀룰로오스, 히드록시프로필셀룰로오스, 오파드라이, 전분글리콜산나트륨, 카르나우바납, 합성규산알루미늄, 스테아린산, 스테아린산마그네슘, 스테아린산알루미늄, 스테아린산칼슘, 백당 등이 사용될 수 있다. 본 발명에 따른 약학적으로 허용 가능한 첨가제는 상기 조성물에 대해 0.1 ~ 90 중량부 포함되는 것이 바람직하나 이에 한정되는 것은 아니다.The composition of the present invention may further include pharmaceutically acceptable additives, where the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, and lactose. , mannitol, taffy, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba lead, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, White sugar, etc. may be used. The pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.
본 발명의 조성물은 실제 임상투여 시에 경구 또는 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제할 수 있으며, 당해 기술 분야에 알려진 적합한 제제는 문헌 (Remington's Pharmaceutical Science, 최근, Mack Publishing Company, Easton PA)에 개시되어 있는 것을 이용하는 것이 바람직하다.The composition of the present invention can be administered in various oral or parenteral formulations during actual clinical administration. When formulated, diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants are used. It can be prepared, and it is preferable to use suitable preparations known in the art that are disclosed in the literature (Remington's Pharmaceutical Science, recently published by Mack Publishing Company, Easton PA).
상기 경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘 카보네이트(Calcium carbonate), 수크로스 (Sucrose) 또는 락토오스(Lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 또한, 상기 경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, such as starch, calcium carbonate, sucrose, or It is prepared by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium styrate talc are also used. In addition, the liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and in addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. This may be included.
상기 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜(Propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.
본 발명의 약학적 조성물의 투여량은 상기 약학적 조성물의 제제화 방법, 투여 방식, 투여 시간 및/또는 투여 경로 등에 의해 다양해질 수 있으며, 상기 약학적 조성물의 투여로 달성하고자 하는 반응의 종류와 정도, 투여 대상이 되는 개체의 종류, 연령, 체중, 일반적인 건강 상태, 질병의 증세나 정도, 성별, 식이, 배설, 해당 개체에 동시 또는 이시에 함께 사용되는 약물 기타 조성물의 성분 등을 비롯한 여러 인자 및 의약 분야에서 잘 알려진 유사 인자에 따라 다양해질 수 있으며, 당해 기술 분야에서 통상의 지식을 가진 자는 목적하는 치료에 효과적인 투여량을 용이하게 결정하고 처방할 수 있다.The dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time, and/or administration route of the pharmaceutical composition, and the type and degree of response to be achieved by administration of the pharmaceutical composition. , various factors including the type, age, weight, general health condition, symptoms or degree of disease, gender, diet, excretion, drugs used simultaneously or simultaneously with the subject, other components of the composition, etc. of the subject to be administered, and It may vary depending on similar factors well known in the pharmaceutical field, and a person skilled in the art can easily determine and prescribe an effective dosage for the desired treatment.
본 발명의 약학적 조성물의 투여량은 예를 들어, 0.01 내지 500 mg/kg의 농도로 투여되는 것이 바람직하나, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.The pharmaceutical composition of the present invention is preferably administered at a concentration of, for example, 0.01 to 500 mg/kg, but this dosage does not limit the scope of the present invention in any way.
본 발명의 약학적 조성물의 투여 경로 및 투여 방식은 각각 독립적일 수 있으며, 그 방식에 있어 특별히 제한되지 아니하며, 목적하는 해당 부위에 상기 약학적 조성물이 도달할 수 있는 한 임의의 투여 경로 및 투여 방식에 따를 수 있다. The administration route and administration method of the pharmaceutical composition of the present invention may be independent, and are not particularly limited, and any administration route and administration method may be used as long as the pharmaceutical composition can reach the desired area. can be followed.
상기 약학적 조성물은 경구 투여 또는 비경구 투여 방식으로 투여할 수 있다. 상기 비경구 투여 방식으로는 예를 들어 정맥 내 투여, 복강 내 투여, 근육 내 투여, 경피 투여 또는 피하 투여 등이 포함된다.The pharmaceutical composition can be administered orally or parenterally. The parenteral administration method includes, for example, intravenous administration, intraperitoneal administration, intramuscular administration, transdermal administration, or subcutaneous administration.
본 발명의 약학적 조성물은 대상 적응증의 예방 또는 치료를 위하여 단독으로, 또는 수술, 방사선 치료, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.The pharmaceutical composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response regulators for the prevention or treatment of target indications.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 섬유증의 예방 또는 개선용 식품 조성물 또는 이를 함유하는 건강기능식품을 제공한다.In addition, according to another aspect of the present invention, the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a food composition for preventing or improving fibrosis, or a health functional food containing the same.
본 명세서에서 사용되는 용어 "건강기능식품"은 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 의미한다. 여기서, '기능성'이란 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건 용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미한다. The term “health functional food” used in this specification refers to food manufactured and processed using raw materials or ingredients with functional properties useful to the human body. Here, 'functionality' means ingestion for the purpose of controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes such as physiological effects.
상기 식품 조성물은 기능성 식품(functional food), 영양보조제(nutritional supplement), 건강식품(health food) 및 식품첨가제(food additives) 등의 모든 형태를 포함한다. 상기 유형들은 당업계에 공지된 통상적인 방법에 따라 다양한 형태로 제조할 수 있다.The food composition includes all types of functional foods, nutritional supplements, health foods, and food additives. The above types can be manufactured in various forms according to conventional methods known in the art.
상기 식품 조성물은 상기 약학적 조성물과 동일한 방식으로 제제화되어 건강기능식품으로 이용될 수 있으며, 각종 식품에 첨가될 수 있다. The food composition can be formulated in the same way as the pharmaceutical composition and used as a health functional food, and can be added to various foods.
구체적인 예로, 식품 또는 음료의 제조 시에는 본 발명의 조성물은 원료에 대하여 15중량% 이하, 바람직하게는 10중량% 이하의 양으로 첨가된다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하여 장기간 섭취할 경우에는 상기 범위 이하의 양으로 첨가될 수 있으며, 안전성 면에서 아무런 문제가 없기 때문에 유효성분은 상기 범위 이상의 양으로도 사용될 수 있다. 상기 식품의 종류에는 특별한 제한은 없으나, 본 발명의 성분을 첨가할 수 있는 식품의 예로는 육류, 소시지, 빵, 초콜릿, 캔디류, 스낵류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 수프, 음료수, 차, 드링크제, 알코올 음료, 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강식품을 모두 포함한다.As a specific example, when producing a food or beverage, the composition of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw materials. However, when consumed for a long period of time for health and hygiene purposes or health control, it can be added in an amount below the above range. Since there is no problem in terms of safety, the active ingredient can be used in an amount above the above range. there is. There is no particular limitation on the type of food, but examples of food to which the ingredients of the present invention can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, and ice cream. It includes dairy products, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc., and includes all health foods in the conventional sense.
본 발명의 식품 조성물이 음료로 제조될 경우 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등의 추가 성분을 포함할 수 있다. 상기 천연 탄수화물로는 포도당, 과당 등의 모노사카라이드, 말토오스, 수크로오스 등의 디사카라이드, 덱스트린, 사이클로덱스트린 등의 천연 감미제, 사카린, 아스파르탐 등의 합성 감미제 등이 사용될 수 있다. 상기 천연 탄수화물은 본 발명의 식품 조성물 총 중량에 대하여 0.01 내지 10중량%, 바람직하게는 0.01 내지 0.1중량%로 포함된다.When the food composition of the present invention is manufactured into a beverage, it may contain additional ingredients such as various flavoring agents or natural carbohydrates, like conventional beverages. The natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame. The natural carbohydrate is included in an amount of 0.01 to 10% by weight, preferably 0.01 to 0.1% by weight, based on the total weight of the food composition of the present invention.
본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 포함할 수 있으며, 천연 과일주스, 과일주스 음료 및 야채 음료의 제조를 위한 과육을 포함할 수 있으나 이에 제한되지 않는다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 상기의 첨가제 비율은 크게 제한되지는 않으나, 본 발명의 식품 조성물 총 중량에 대하여 0.01 내지 0.1중량% 범위내로 포함되는 것이 바람직하다.The food composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonic acid. It may include carbonating agents used in beverages, and may include pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages, but is not limited thereto. These ingredients can be used independently or in combination. The ratio of the above additives is not greatly limited, but is preferably contained within the range of 0.01 to 0.1% by weight based on the total weight of the food composition of the present invention.
또한, 본 발명의 또 다른 양태에 따르면, 본 발명은 상기 FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 섬유증의 예방 또는 개선용 화장료 조성물을 제공한다.In addition, according to another aspect of the present invention, the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as a cosmetic composition for preventing or improving fibrosis, comprising as an active ingredient.
본 발명에 따르면, 본 발명의 FoxN1 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 이용할 경우, 섬유화를 유발하는 섬유아세포를, 다른 세포, 예컨대, 지방전구세포 또는 지방세포로의 전환분화시키므로, 섬유증을 효과적으로 억제할 수 있다.According to the present invention, the FoxN1 mutant gene of the present invention; A vector containing the FoxN1 mutant gene; When using a FoxN1 protein variant encoded by the FoxN1 mutant gene, fibrosis-inducing fibroblasts are transdifferentiated into other cells, such as preadipocytes or adipocytes, and thus fibrosis can be effectively suppressed.
본 발명의 조성물은 상술한 FoxN1 변이 유전자 또는 FoxN1 변이 단백질의 발현을 이용하므로, 이와 중복된 내용은 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.Since the composition of the present invention uses expression of the above-described FoxN1 mutant gene or FoxN1 mutant protein, duplicate content is omitted to avoid excessive complexity of the present specification.
본 발명에 따른 CRISPR/Cas9 편집 시스템을 통해 제작된 무작위 미스센스 돌연변이체(Foxn1 c.55 C>A(p.L19M))는 각질세포(keratinocyte) 또는 섬유아세포를 지방세포 또는 지방전구세포(preadipocyte)로의 전환과 각질세포유래의 지방분화 신호 활성화를 통해 지방 형성을 촉진하여 피하지방을 증가시키고, 상처치유 및 모낭형성에 중요한 역할을 하는 섬유아세포의 근섬유아세포로의 특성 발현을 유도하므로, 섬유성 질환 치료, 피부 상처 개선 치료에 적용할 수 있을 뿐만 아니라, 피부에서 특정 부위의 피하지방 유도를 통해 지방 조직 퇴축으로 인한 부피 감소와 기능 저하로 유발되는 현대인들의 미적 문제를 개선할 수 있다.The random missense mutant (Foxn1 c.55 C>A(p.L19M)) produced through the CRISPR/Cas9 editing system according to the present invention can be used to transform keratinocytes or fibroblasts into adipocytes or preadipocytes. ) and activating keratinocyte-derived fat differentiation signals to promote fat formation to increase subcutaneous fat, and to induce the expression of fibroblasts, which play an important role in wound healing and hair follicle formation, into myofibroblasts, thereby forming fibrotic cells. Not only can it be applied to disease treatment and skin wound improvement treatment, but it can also improve the aesthetic problems of modern people caused by volume loss and functional decline due to adipose tissue involution by inducing subcutaneous fat in specific areas of the skin.
도 1은 B6.Foxn1 p.L19M에 의해 유발된 피부 백색 지방 조직(dermal white adipose tissue, dWAT) 증식 동반 비만형을 보여준다. 도 1a는 Forkhead protein N1(Foxn1) 미스센스(missense) 돌연변이가 있는 마우스 제작에 대한 간략한 이미지를 보여준다. 단일 가이드 RNA(sgRNA) 결합 서열은 Foxn1의 첫번째 코딩 엑손에서 선택되었다. sgRNA 및 nickase Streptococcus pyogens Cas9와 연결된 base editor(nCas9-BE)를 마우스 배아에 적용하고 얻은 새끼를 Sanger 시퀀싱으로 유전자형을 확인하였다. 빨간색 알파벳: 뉴클레오티드 치환, 파란색 알파벳: 프로토스페이서 인접 모티프(PAM) 서열. 도 1b는 B6.Foxn1 p.L19M (Foxn1 L19M/L19M, L19M) 및 C57BL/6 (Foxn1+/+, WT)에서 정상 모발 형성을 보여준다. 도 1c는 24℃에서 정상 먹이(NC) 및 45% 고지방식이(HFD)로 15주 동안 급여한 4주령 수컷 마우스의 성장 곡선 분석 결과를 보여준다(각 그룹의 n = 5). 도 1d는 피부에서의 헤마톡실린 및 에오신 염색 결과를 보여준다. NC 및 HFD 공급 16주 후, 등쪽 피부는 포르말린으로 고정되고 염색되었다. 검은색 눈금 막대: 500 μm. 도 1e는 진피 백색 지방 세포(dWAT) 층의 두께 및 지방 세포 수를 계산하기 위한 간략한 이미지를 보여준다. 빨간색 사각형(두께 x 500 μm 너비): 지방 세포 수를 계산하는 영역. 도 1f 및 1g는 NC 또는 HFD 공급 16주 후 마우스당 5개의 다른 부위에서 dWAT 두께와 지방 세포 수를 측정하고 평균값을 사용하여 분석한 결과를 보여준다(각 그룹의 n = 4). 각 점은 개별 마우스의 데이터를 나타낸다. Foxn1 L19M/L19M은 WT에 비하여 많은 숫자의 지방세포가 진피 백색지방층에서 관찰되며, 이는 Foxn1 p.L19M 변이체에 의하여 지방세포 증대(hypertrophy)가 아닌 증식(hyperplasia)가 유발되었음을 의미한다. 데이터는 평균 ± 평균의 표준 오차(SEM)로 표시된다. 통계 분석은 unpaired Student's t-test(ns: 유의하지 않음, *: p < 0.05, **: p < 0.01, ***: p < 0.001 및 ****:p < 0.0001)를 사용하여 수행되었다.Figure 1 shows B6. It shows obesity accompanied by proliferation of dermal white adipose tissue (dWAT) induced by Foxn1 p.L19M. Figure 1A shows a simplified image of the generation of mice with Forkhead protein N1 (Foxn1) missense mutations. A single guide RNA (sgRNA) binding sequence was selected from the first coding exon of Foxn1. A base editor (nCas9-BE) linked to sgRNA and nickase Streptococcus pyogens Cas9 was applied to mouse embryos, and the genotype of the resulting offspring was confirmed by Sanger sequencing. Red alphabet: nucleotide substitutions, blue alphabet: protospacer adjacent motif (PAM) sequence. Figure 1B is B6. Shows normal hair formation in Foxn1 p.L19M ( Foxn1 L19M/L19M , L19M) and C57BL/6 (Foxn1 +/+ , WT). Figure 1c shows the results of growth curve analysis of 4-week-old male mice fed normal chow (NC) and 45% high-fat diet (HFD) for 15 weeks at 24°C (n = 5 in each group). Figure 1d shows the results of hematoxylin and eosin staining on skin. After 16 weeks of NC and HFD feeding, dorsal skin was fixed in formalin and stained. Black scale bar: 500 μm. Figure 1E shows a simplified image for calculating the thickness of the dermal white adipocyte (dWAT) layer and the number of adipocytes. Red square (thickness x 500 μm width): area for counting fat cells. Figures 1F and 1G show dWAT thickness and adipocyte number measured at five different sites per mouse after 16 weeks of NC or HFD feeding and analyzed using the mean values (n = 4 in each group). Each dot represents data from an individual mouse. In Foxn1 L19M/L19M , a larger number of adipocytes are observed in the dermal white fat layer than in WT, which means that the Foxn1 p.L19M mutant causes hyperplasia rather than adipocyte enlargement (hypertrophy). Data are expressed as mean ± standard error of the mean (SEM). Statistical analysis was performed using unpaired Student's t-test (ns: not significant, *: p < 0.05, **: p < 0.01, ***: p < 0.001 and ****:p < 0.0001) .
도 2는 Foxn1 p.L19M이 각질세포의 상피간엽이행(EMT)을 촉진함을 보여준다. 도 2a는 WT 및 Foxn1 L19M/L19M의 신생 표피 조직의 RNA 시퀀싱 데이터를 사용한 Foxn1 유전자에 대한 사시미 플롯 분석 결과이며, 메신저 RNA (mRNA)의 선택적 스플라이싱 (alternative splicing)이 일어나지 않음을 제시한다. 도 2b는 표피 및 진피 조직 단백질을 이용한 웨스턴 블롯에 의한 Foxn1 검출 결과를 보여주며 각질세포에서의 FOXN1 단백질 발현에 WT와 Foxn1 L19M/L19M 상호간 차이가 없음을 의미한다. 도 2c는 면역조직화학을 이용한 피부의 Foxn1 양성 세포 검출 결과를 보여주며, Foxn1 양성 세포가 진피와 지방층 경계에 위치함을 나타나며, 이는 Foxn1 L19M/L19M의 각질세포가 이동하였을 가능성을 제시한다(검정 스케일 바: 50 μm). 도 2d는 WT와 비교하여 Foxn1 L19M/L19M에서 상대적으로 상향 또는 하향 조절된 유전자의 DAVID 기능 주석 클러스터 분석 결과를 보여준다(선택된 유전자의 n= 605, fold change = 1.3). 도 2e는 선택된 유전자(선택된 유전자의 n=50, L19M/WT fold change = 4)를 사용한 히트맵 분석 결과를 보여준다(파란색: 발현 감소, 빨간색: 발현 증가). 유전자 발현 분석은 Foxn1 L19M/L19M 각질세포의 분화는 감소되고 증식이 증가함을 의미한다. 도 2f는 WT 및 Foxn1 L19M/L19M의 일차 각질세포를 사용하여 실시한 세포 상처 치유 실험 결과를 보여준다. 각질세포를 단층으로 배양한 후 긁어서 틈을 만들었다. 상처 치유 밀도를 매일 분석하였다(각 그룹의 n = 6). 상처 후 72시간에 상처 긁힘은 모든 그룹에서 거의 회복되었다. 즉, FoxnL19M/L19M의 각질세포의 분화능력이 WT에 비하여 높으며, 상피간엽이행의 높은 가능성을 제시한다. 데이터는 평균 ± SEM으로 표시되었다. 통계 분석은 unpaired Student's t-test(*:p < 0.05 및 **: p < 0.01)를 사용하여 수행되었다. 도 2g는 표피(Epi-; epidermal) 조직, 진피(Der-; dermal) 조직, 일차 각질세포(Kera-; keratinocyte) 및 진피 섬유아세포(DF; dermal fibroblast)에서의 EMT(epithelial-mesenchymal-transition) 매개 유전자의 단백질 수준을 확인한 웨스턴 블롯 결과를 보여준다. 도 2h는 피부조직을 이용한 E-cadherin, N-cadherin 및 Foxn1의 면역형광염색 결과를 보여준다. 녹색 또는 노란색 알파벳은 대상 유전자 이름과 감지된 형광신호 색상을 나타낸다(파란색; DAPI. 백색 스케일 바: 50 μm). 도 2i는 Foxn1 L19M/L19M의 피부에서의 EMT 관련 유전자 발현 수준을 보여준다. Figure 2 shows that Foxn1 p.L19M promotes epithelial-mesenchymal transition (EMT) of keratinocytes. Figure 2a shows the results of Sashimi plot analysis for the Foxn1 gene using RNA sequencing data from newborn epidermal tissues of WT and Foxn1 L19M/L19M , suggesting that alternative splicing of messenger RNA (mRNA) does not occur. Figure 2b shows the results of Foxn1 detection by Western blot using epidermal and dermal tissue proteins, indicating that there is no difference in FOXN1 protein expression in keratinocytes between WT and Foxn1 L19M/L19M . Figure 2c shows the results of detection of Foxn1-positive cells in the skin using immunohistochemistry, showing that Foxn1-positive cells are located at the boundary between the dermis and the fat layer, suggesting the possibility that Foxn1 L19M/L19M keratinocytes have migrated (black) Scale bar: 50 μm). Figure 2D shows the results of DAVID functional annotation cluster analysis of genes that were relatively up- or down-regulated in Foxn1 L19M/L19M compared to WT (n = 605 of selected genes, fold change = 1.3). Figure 2e shows the results of heatmap analysis using selected genes (n = 50 of selected genes, L19M/WT fold change = 4) (blue: decreased expression, red: increased expression). Gene expression analysis indicates that differentiation of Foxn1 L19M/L19M keratinocytes is reduced and proliferation is increased. Figure 2f shows the results of a cellular wound healing experiment conducted using WT and Foxn1 L19M/L19M primary keratinocytes. Keratinocytes were cultured as a monolayer and then scratched to create a gap. Wound healing density was analyzed daily (n = 6 in each group). At 72 hours after wounding, wound scraping had almost recovered in all groups. In other words, the differentiation ability of keratinocytes of Foxn L19M/L19M is higher than that of WT, suggesting a high possibility of epithelial-mesenchymal transition. Data were expressed as mean ± SEM. Statistical analysis was performed using unpaired Student's t-test (*: p < 0.05 and **: p < 0.01). Figure 2g shows epithelial-mesenchymal-transition (EMT) in epidermal (Epi-; epidermal) tissue, dermal (Der-; dermal) tissue, primary keratinocyte (Kera-; keratinocyte), and dermal fibroblast (DF). Shows the Western blot results confirming the protein level of the intermediate gene. Figure 2h shows the results of immunofluorescence staining of E-cadherin, N-cadherin, and Foxn1 using skin tissue. Green or yellow alphabets indicate the target gene name and detected fluorescence signal color (blue; DAPI. White scale bar: 50 μm). Figure 2I shows EMT-related gene expression levels in the skin of Foxn1 L19M/L19M .
도 3은 각질세포의 Foxn1 p.L19M가 마우스 배아 섬유아세포(MEF) 세포의 지방 생성 신호를 활성화시키는 결과를 보여준다. 도 3a는 피부 조직에서 Foxn1, CD34 또는 αSMA(Alpha Smooth Muscle Actin) 양성 세포를 검출하기 위한 면역형광 염색 결과를 보여준다. 녹색 또는 빨간색 알파벳은 대상 유전자 이름과 감지된 신호 색상을 나타낸다. 파란색; DAPI. 흑백 스케일 바: 50 μm. 도 3b는 표피 및 진피 조직, 일차 각질세포 및 진피 섬유아세포의 단백질을 사용하여 CD24, CD34, Sca-1 및 αSMA를 검출하기 위한 웨스턴 블롯 분석 결과를 보여준다. 도 3c는 각질세포주 (Kera-308)에 Foxn1 p.L19M을 발현 및 지방형성 배지에 배양하여, 각질세포가 Foxn1 p.L19M의 형질유도에 의하여 지방전구세포 및 지방세포로 분화될 수 있음을 보여준다. 도 3d는 Foxn1 p.L19M이 신호 전달을 통해 마우스 배아 섬유아세포(MEF)의 지방 생성을 유도하는 지 분석한 결과를 보여준다. 0.4 μm pore 크기의 트랜스웰 시스템을 사용하여 WT와 Foxn1 L19M/L19M의 1차 각질세포를 완전배지(DMEM with 10% Fetal bovine serum)와 함께 상부 웰에 배양하고 WT의 MEF를 지방생성 배지로 배양하였다. 도 3e는 오일 레드(oil red) o 염색 결과를 보여준다(dark red: oil red o 염색된 lipid droplet), 오일 레드 o 염색 및 isopropanol 추출 후 490 nm에서 optical density(OD) 값을 측정하여 지방 생성량을 정량화하였다(각각의 n 그룹 = 3). 도 3f는 Foxn1, β-catenin, PPARγ (Peroxisome proliferator-activated receptor gamma) 및 αSMA의 발현을 비교하기 위한 Western blot analysis는 하부 웰의 MEF 세포의 단백질을 이용하여 수행하였다. 도 3g는 Foxn1 p.L19M이 진피 섬유아세포의 지방 생성에 미치는 영향을 분석한 결과를 보여준다. WT 및 Foxn1 L19M/L19M의 피부 섬유아세포를 파종하고 지방 생성 배지로 10일 동안 배양했다. 도 3h는 오일 레드 o 염색 후, 지방 생성을 정량화했다(각 그룹의 n = 3). 각 점은 각 배양의 개별 OD 값을 잘 나타낸다. 데이터는 평균 ± SEM으로 표시되었다. 통계적 분석은 unpaired Student's t-test(ns: 유의하지 않음 및 ****: p < 0.0001)를 사용하여 수행되었다.Figure 3 shows the results of Foxn1 p.L19M in keratinocytes activating adipogenic signals in mouse embryonic fibroblast (MEF) cells. Figure 3a shows the results of immunofluorescence staining to detect Foxn1, CD34, or αSMA (Alpha Smooth Muscle Actin) positive cells in skin tissue. Green or red alphabets indicate the target gene name and detected signal color. blue; DAPI. Black and white scale bar: 50 μm. Figure 3b shows the results of Western blot analysis to detect CD24, CD34, Sca-1, and αSMA using proteins from epidermal and dermal tissues, primary keratinocytes, and dermal fibroblasts. Figure 3c shows that Foxn1 p.L19M was expressed in a keratinocyte cell line (Kera-308) and cultured in adipogenic medium, showing that keratinocytes can be differentiated into preadipocytes and adipocytes by transduction of Foxn1 p.L19M. . Figure 3d shows the results of analyzing whether Foxn1 p.L19M induces adipogenesis in mouse embryonic fibroblasts (MEF) through signal transduction. Using a transwell system with a 0.4 μm pore size, WT and Foxn1 L19M/L19M primary keratinocytes were cultured in the upper well with complete medium (DMEM with 10% Fetal bovine serum), and WT MEFs were cultured with adipogenic medium. did. Figure 3e shows the results of oil red o staining (dark red: oil red o stained lipid droplet). After oil red o staining and isopropanol extraction, the optical density (OD) value was measured at 490 nm to determine the amount of fat produced. Quantification was performed (each n group = 3). Figure 3f shows that Western blot analysis to compare the expression of Foxn1, β-catenin, PPARγ (Peroxisome proliferator-activated receptor gamma), and αSMA was performed using proteins from MEF cells in the lower well. Figure 3g shows the results of analyzing the effect of Foxn1 p.L19M on adipogenesis in dermal fibroblasts. WT and Foxn1 L19M/L19M skin fibroblasts were seeded and cultured with adipogenic medium for 10 days. Figure 3h quantifies adipogenesis after Oil Red O staining (n = 3 in each group). Each point represents the individual OD value of each culture. Data were expressed as mean ± SEM. Statistical analysis was performed using unpaired Student's t-test (ns: not significant and ****: p < 0.0001).
도 4는 Foxn1 p.L19M의 형질이 각질세포의 증식(proliferation)을 촉진하며, 다양한 지방분화 신호를 활성화시킴을 보여준다. Foxn1 p.L19M의 형질에 의한 지방분화 및 각질세포 증식의 기전을 확인하기 위하여, 마우스 각질세포주 (Kera-308)에 Foxn1 및 Foxn1 p.L19M의 코딩유전자를 과발현 시킨 뒤, 유전자 발현을 Foxn1 L19M/L19M 마우스의 발현 패턴과 비교하였다. (Red color: 상대적 유전자 발현 증가, Bule color: 상대적 유전자 발현 감소)Figure 4 shows that the Foxn1 p.L19M trait promotes proliferation of keratinocytes and activates various adipogenic differentiation signals. To confirm the mechanism of fat differentiation and keratinocyte proliferation caused by the trait of Foxn1 p.L19M, the coding genes for Foxn1 and Foxn1 p.L19M were overexpressed in a mouse keratinocyte cell line (Kera-308), and then gene expression was changed to Foxn1 L19M/ The expression pattern was compared with that of L19M mice. (Red color: increased relative gene expression, Bule color: decreased relative gene expression)
도 5는 Wnt 신호 전달이 Foxn1 p.L19M 매개 EMT 및 지방 생성에 관여함을 보여준다. 도 5a는 세포 분화 또는 RNA 시퀀싱으로부터의 이동과 관련된 선택된 84개 유전자를 사용한 유전자 네트워크 분석 결과를 보여준다(WT와 Foxn1 L19M/L19M 간의 발현 배율 = 1.4, p = 0.05). 도 5b 및 5c는 피부 조직에서 Wnt(Wingless-related integration site)5β 또는 Wnt10β 양성 세포를 검출하기 위한 면역조직화학 및 면역형광 염색 결과를 보여준다. 파란색; DAPI. 검은색 또는 흰색 눈금 막대: 50 μm. 도 5d 및 5e는 Wnt/β-catenin 신호, Methyl Ethyl Ketone(MEK), extracellular-signal-regulated kinase(ERK), Signal transducer and activator of transcript 3(STAT3)를 표피 및 진피 조직에서 추출한 단백질을 사용하여 검출하기 위한 Western blot 분석 결과를 보여준다. 도 5f는 트랜스웰 시스템을 사용하여 Wnt5β 침묵 후 지방 생성 신호를 평가한 결과를 보여준다. Kera-308은 완전배지를 이용하여 배양하였고, MEF는 지방생성배지를 이용하여 배양하였다. 지방 생성의 정량화는 10일 후에 수행되었다(각 그룹의 n = 3). 각 점은 각 배양의 개별 OD 값을 잘 나타낸다. 도 5g는 안정적인 Wnt5β 침묵에 의한 각질세포의 이동 가능성을 평가하기 위한 세포 상처 치유 분석 결과를 보여준다. Kera-308을 단층으로 배양한 후, 각 플라스미드를 형질감염시켰다. 긁어서 틈을 만들고 영상분석을 통해 상처치유밀도를 매일 계산하였다. 노란색 선: 갭의 초기 가장자리 및 검은색 선: 상처 치유 후 관찰된 가장자리(각 그룹의 n = 6). 데이터는 평균 ± SEM으로 표시되었다. 통계 분석은 unpaired Student's t-test(ns: 유의하지 않음 및 ***: p < 0.001)를 사용하여 수행되었다. 도 5h는 Wnt5β 침묵에 의한 지방분화 유도 및 상피간엽이행을 활성화를 평가하기 위한 β-catenin과 E-cadherin에 대한 Western blot 분석결과를 보여준다. Figure 5 shows that Wnt signaling is involved in Foxn1 p.L19M-mediated EMT and adipogenesis. Figure 5A shows the results of gene network analysis using selected 84 genes involved in cell differentiation or migration from RNA sequencing (expression fold between WT and Foxn1 L19M/L19M = 1.4, p = 0.05). Figures 5b and 5c show the results of immunohistochemistry and immunofluorescence staining to detect Wnt (Wingless-related integration site)5β or Wnt10β positive cells in skin tissue. blue; DAPI. Black or white scale bar: 50 μm. Figures 5d and 5e show Wnt/β-catenin signal, Methyl Ethyl Ketone (MEK), extracellular-signal-regulated kinase (ERK), and Signal transducer and activator of transcript 3 (STAT3) using proteins extracted from epidermal and dermal tissues. Shows the results of Western blot analysis for detection. Figure 5f shows the results of evaluating adipogenic signals after Wnt5β silencing using the transwell system. Kera-308 was cultured using complete medium, and MEF was cultured using adipogenic medium. Quantification of adipogenesis was performed after 10 days (n = 3 in each group). Each point represents the individual OD value of each culture. Figure 5g shows the results of a cellular wound healing assay to evaluate the migration potential of keratinocytes by stable Wnt5β silencing. After culturing Kera-308 as a monolayer, each plasmid was transfected. Gaps were created by scratching, and wound healing density was calculated daily through image analysis. Yellow line: initial edge of the gap and black line: edge observed after wound healing (n = 6 in each group). Data were expressed as mean ± SEM. Statistical analysis was performed using unpaired Student's t-test (ns: not significant and ***: p < 0.001). Figure 5h shows the results of Western blot analysis of β-catenin and E-cadherin to evaluate the induction of adipogenic differentiation and activation of epithelial-mesenchymal transition by Wnt5β silencing.
도 6는 Foxn1 p.L19M 기능 획득(gain-of-function)이 각질세포의 이동 및 지방생성 시그널링, 섬유아세포의 αSMA 발현을 자극함을 보여준다. 도 6a는 트랜스웰 시스템을 사용하여 Foxn1 p.L19M의 지방 생성 신호를 평가한 결과를 보여준다. 상부 웰에 피부 각질 세포주(Kera-308) 및 하부 웰에 MEF를 파종한 후, 각 플라스미드(CAG-Foxn1-polyA [pFoxn1] 또는 CAG-Foxn1 p.L19M-pA [pFoxn1 L19M])로 형질전환되었다. 지방 생성의 정량화는 플라스미드 형질감염 10일 후에 수행되었다(각 그룹의 n = 4). 도 6b는 각질세포의 직접적인 지방형성을 확인한 결과를 보여준다. 플라스미드는 Kear-308 파종 후 24시간에 형질감염되었고 10일 동안 지방생성 배지로 배양되었다. 지방 생성의 정량화를 수행했다(각 그룹의 n = 3). 도 6c는 일시적인 Foxn1 p.L19M 발현 후 세포 상처 치유 분석 결과를 보여준다. Kera-308을 단층으로 배양한 후, 각 플라스미드를 형질감염시켰다. 형질감염 24시간 후 긁어서 틈을 만들고 상처 치유 밀도를 계산했다. 노란색 선: 갭의 초기 가장자리 및 검은색 선: 상처 치유 후 관찰된 가장자리. 도 6d는 상처 치유 밀도를 매일 계산하고 분석했다(각 그룹의 n = 6). 통계 분석; 대조군 pGFP 대 pFoxn1 L19M에 대한 빨간색 문자 및 대조군 pGFP 대 pFoxn1에 대한 파란색 문자. 도 6e 및 6f는 pFoxn1 또는 pFoxn1 p.L19M 형질감염 후 Kera-308 또는 NIH3T3 세포에서 Foxn1, Wnt5β, Wnt10β, β-Catenin, E-cadherin, N-cadherin, CD34 및 αSMA를 검출하기 위한 웨스턴 블롯 분석 결과를 보여준다. 각 점은 각 배양의 개별 값을 잘 나타낸다. 데이터는 평균 ± SEM으로 표시되었다. 통계적 분석은 unpaired Student's t-test(ns: 유의하지 않음, *: p < 0.05, **: p < 0.01, ***: p < 0.001)를 사용하여 수행되었다. Figure 6 shows that Foxn1 p.L19M gain-of-function stimulates migration and adipogenic signaling of keratinocytes and αSMA expression of fibroblasts. Figure 6a shows the results of evaluating the adipogenic signal of Foxn1 p.L19M using the transwell system. Skin keratin cell line (Kera-308) was seeded in the upper well and MEFs were seeded in the lower well, and then transformed with each plasmid (CAG- Foxn1 -polyA [p Foxn1 ] or CAG- Foxn1 p.L19M-pA [p Foxn1 L19M]). converted. Quantification of adipogenesis was performed 10 days after plasmid transfection (n = 4 in each group). Figure 6b shows the results confirming direct lipogenesis of keratinocytes. Plasmids were transfected 24 hours after seeding with Kear-308 and cultured in adipogenic medium for 10 days. Quantification of adipogenesis was performed (n = 3 in each group). Figure 6c shows the results of cellular wound healing assay after transient Foxn1 p.L19M expression. After culturing Kera-308 as a monolayer, each plasmid was transfected. Twenty-four hours after transfection, crevices were created by scraping, and wound healing density was calculated. Yellow line: initial edge of the gap and black line: edge observed after wound healing. Figure 6D shows wound healing density calculated and analyzed daily (n = 6 in each group). statistical analysis; Red letters for control pGFP versus pFoxn1 L19M and blue letters for control pGFP versus pFoxn1. Figures 6e and 6f show the results of Western blot analysis to detect Foxn1, Wnt5β, Wnt10β, β-Catenin, E-cadherin, N-cadherin, CD34, and αSMA in Kera-308 or NIH3T3 cells after transfection with pFoxn1 or pFoxn1 p.L19M. shows. Each point represents the individual value of each culture. Data were expressed as mean ± SEM. Statistical analysis was performed using unpaired Student's t-test (ns: not significant, *: p < 0.05, **: p < 0.01, ***: p < 0.001).
도 7은 Foxn1 p.L19M에 의한 dWAT 지방 생성 및 상처치유 활성화를 보여준다. 도 7a는 리포펙타민을 사용하여 생체내 형질감염을 수행하는 실험의 모식도이다. 각 플라스미드 혼합물을 피내 주사에 의해 귀에 주사하였다. 주사는 2주 간격으로 2회 실시하였다. 도 7b는 생체내 형질감염 4주 후 귀의 H&E 결과를 보여준다. 지방세포층의 두께는 마우스 1마리당 5개소에서 측정하였으며, 평균값을 분석에 사용하였다. 각 점은 개별 마우스의 데이터를 나타낸다. 데이터는 평균 ± SEM으로 표시되었다. 통계 분석은 unpaired Student's t-test를 사용하여 수행되었다. AC: 귀 연골. 스케일 바: 50 μm. 도 7c는 WT 및 Foxn1 L19M/L19M 마우스 등 부분 피부에 whole thickness wound를 형성한 후, 상처 부위의 회복을 4일 간격으로 분석하였다(n=6). 통계분석은 unpaired Student's t-test (ns: 유의하지 않음, *: p < 0.05 및 **: p < 0.01). 도 7d는 Foxn1 L19M/L19M에서의 dWAT 지방 생성에 대한 메커니즘을 보여준다.Figure 7 shows dWAT adipogenesis and activation of wound healing by Foxn1 p.L19M. Figure 7a is a schematic diagram of an experiment performing in vivo transfection using lipofectamine. Each plasmid mixture was injected into the ear by intradermal injection. Injections were performed twice at two-week intervals. Figure 7b shows H&E results of the ear 4 weeks after in vivo transfection. The thickness of the fat cell layer was measured at 5 locations per mouse, and the average value was used for analysis. Each dot represents data from an individual mouse. Data were expressed as mean ± SEM. Statistical analysis was performed using unpaired Student's t-test. AC: ear cartilage. Scale bar: 50 μm. Figure 7c shows that after forming a full thickness wound on the skin of the back of WT and Foxn1 L19M/L19M mice, recovery of the wound area was analyzed at 4-day intervals (n=6). Statistical analysis was performed using unpaired Student's t-test (ns: not significant, *: p < 0.05 and **: p < 0.01). Figure 7d shows the mechanism for dWAT adipogenesis in Foxn1 L19M/L19M .
이하, 본 발명을 실시예를 통하여 더욱 상세히 설명하기로 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrating the present invention in more detail, and the scope of the present invention is not limited to these examples.
실험방법Experiment method
SpCas9-BE mRNA 및 sgRNA 준비SpCas9-BE mRNA and sgRNA preparation
pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA(nSpCas9-BE, addgene ID: 79620) 플라스미드를 addgene으로부터 확보하였다. Xba1로 효소 절단하여 선형화한 후, mMESSAGE mMACHINE T7 Ultra 전사 키트(Thermo Fisher Scientific, Waltham, MA, USA)를 사용하여 mRNA를 합성하였다. sgRNA 결합 부위는 마우스 Foxn1 유전자의 세 번째 엑손(첫 번째 코딩 엑손, House mouse Foxn1은 프로모터 시그널에 따라 다양한 alternative splicing mRNA가 존재하며, forkhead box N1, transcript variant 1 기준으로 2번째 엑손, start codon을 포함하는 엑손)에 5'-NGG-3'를 갖는 서열 중에서 선택하였다. Megashortscript T7 Kit(Thermo Fisher Scientific)를 사용하여 sgRNA를 합성하였다.The pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA (nSpCas9-BE, addgene ID: 79620) plasmid was obtained from addgene. After linearization by enzymatic digestion with Xba1, mRNA was synthesized using the mMESSAGE mMACHINE T7 Ultra transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). The sgRNA binding site is the third exon of the mouse Foxn1 gene (the first coding exon, House mouse Foxn1 has various alternative splicing mRNAs depending on the promoter signal, and includes the second exon, start codon, based on forkhead box N1 and transcript variant 1. Exon) was selected from sequences having 5'-NGG-3'. sgRNA was synthesized using the Megashortscript T7 Kit (Thermo Fisher Scientific).
B6.Foxn1 p.L19M 마우스 제작Construction of B6.Foxn1 p.L19M mouse
C57BL/6(B6)은 코아텍(평택, 한국)에서 구입하였다. 과배란 후 B6 암컷 마우스를 정자 기증자와 교배하고 다음날 배아를 수집하였다. 이후, 배아에 50ng/ ㎕의 nSpCas9-BE mRNA 및 10ng/㎕의 sgRNA를 전핵 미세주입하였다. 조작된 배아를 마우스의 난관으로 옮기고 얻은 새끼의 유전자형을 Sanger 염기서열 분석으로 분석하였다. sgRNA, 프라이머 및 shRNA에 대한 서열 정보는 하기 표 1에 정렬하였다. 본 연구는 서울대학교 동물병원 동물관리위원회(SNU-161031-2 및 200221-1)의 승인을 받았으며 지침에 따라 수행되었다.C57BL/6 (B6) was purchased from Coretech (Pyeongtaek, Korea). After superovulation, B6 female mice were mated with a sperm donor, and embryos were collected the next day. Afterwards, 50ng/μl of nSpCas9-BE mRNA and 10ng/μl of sgRNA were pronuclear microinjected into the embryo. The manipulated embryos were transferred into the oviduct of mice, and the genotypes of the resulting offspring were analyzed by Sanger sequencing. Sequence information for sgRNA, primers, and shRNA is aligned in Table 1 below. This study was approved by the Animal Care Committee of Seoul National University Animal Hospital (SNU-161031-2 and 200221-1) and was conducted in accordance with the guidelines.
[표 1][Table 1]
Figure PCTKR2023004541-appb-img-000001
Figure PCTKR2023004541-appb-img-000001
일반 식단과 고지방식이 급여 후 체중 증가 분석Analysis of weight gain after feeding a normal diet and a high-fat diet
4주령 B6 및 Foxn1 L19M/L19M 수컷 마우스를 무작위로 나누어 일반 사료(Purina Korea, 한국 성남)와 45% HFD(Research Diet Inc., New Brunswick, NJ, USA)를 15주 동안 식이하였다. 각 마우스의 체중을 매주 측정하였다.Four-week-old B6 and Foxn1 L19M/L19M male mice were randomly divided and fed regular chow (Purina Korea, Seongnam, Korea) and 45% HFD (Research Diet Inc., New Brunswick, NJ, USA) for 15 weeks. The body weight of each mouse was measured weekly.
조직학적 분석(H&E, 면역형광, 면역조직화학, Masson trichrome 염색)Histological analysis (H&E, immunofluorescence, immunohistochemistry, Masson trichrome staining)
2.5% 아베르틴을 사용하여 마우스를 마취시키고 인산완충식염수와 4% 파라포름알데히드를 심장을 통해 관류시켰다. 포르말린으로 고정된 피부 조직을 파라핀에 포매하고 조직 염색하였다. H&E 염색에서 탈파라핀화된 조직은 0.1% Mayer's H&E 용액으로 염색되었다. 면역형광 및 면역조직화학 염색을 위해 대조군 혈청으로 조직을 블록킹한 후 일차 및 이차 항체로 인큐베이션하였다. 항체 반응성 세포는 Cytation 5(BioTek, Winooski, VT, USA)로 검출되었으며 사용된 항체 목록은 하기 표 2에 정렬하였다. Masson trichrome 염색 키트(Polysciences, Warrington, PA, USA)를 사용하여 Masson trichrome 염색을 수행하였다.Mice were anesthetized using 2.5% Avertin and perfused through the heart with phosphate-buffered saline and 4% paraformaldehyde. Skin tissue fixed in formalin was embedded in paraffin and stained. In H&E staining, deparaffinized tissue was stained with 0.1% Mayer's H&E solution. For immunofluorescence and immunohistochemical staining, tissues were blocked with control serum and then incubated with primary and secondary antibodies. Antibody-reactive cells were detected with Cytation 5 (BioTek, Winooski, VT, USA), and the list of antibodies used is listed in Table 2 below. Masson trichrome staining was performed using a Masson trichrome staining kit (Polysciences, Warrington, PA, USA).
[표 2][Table 2]
Figure PCTKR2023004541-appb-img-000002
Figure PCTKR2023004541-appb-img-000002
RNA 시퀀싱 및 분석(Sashimi 플롯, 히트맵 및 유전자 네트워크 분석)RNA sequencing and analysis (Sashimi plots, heatmaps, and gene network analysis)
Trizol 시약(Thermo Fisher Scientific)을 사용하여 신생 표피 조직에서 총 RNA를 추출하였다. RNA 정량화 후 NeBNext Ultra II Directional RNA-Seq 키트(New England BioLabs, Ipswich, MA, USA)를 사용하여 총 RNA로부터 라이브러리를 제작하였다. Poly(A) RNA selection 키트(Lexogen, Wien, Austria)를 사용하여 mRNA를 분리한 후 제조사의 메뉴얼에 따라 cDNA 합성 및 전단(shearing)하였다. Illumina index 1-12를 이용하여 indexing 후 Agilent 2100 bioanalyzer(DNA High Sensitivity kit)를 이용하여 라이브러리의 평균 fragment size를 평가하였고, Library quantification kit 및 StepOne Real-Time PCR system(Life Technologies, Carlsbad, CA, USA)를 이용하여 정량하였다. NovaSeq 6000(Illumina, San Diego, CA, USA)을 사용하여 paired-end 100 시퀀싱으로 HTS (High-throughput sequencing)을 수행하였다.Total RNA was extracted from newborn epidermal tissue using Trizol reagent (Thermo Fisher Scientific). After RNA quantification, a library was constructed from total RNA using the NeBNext Ultra II Directional RNA-Seq kit (New England BioLabs, Ipswich, MA, USA). After isolation of mRNA using the Poly(A) RNA selection kit (Lexogen, Wien, Austria), cDNA was synthesized and sheared according to the manufacturer's manual. After indexing using Illumina index 1-12, the average fragment size of the library was evaluated using an Agilent 2100 bioanalyzer (DNA High Sensitivity kit), and the library quantification kit and StepOne Real-Time PCR system (Life Technologies, Carlsbad, CA, USA ) was quantified using . High-throughput sequencing (HTS) was performed using paired-end 100 sequencing using NovaSeq 6000 (Illumina, San Diego, CA, USA).
정량적 RT-PCRQuantitative RT-PCR
Trizole 시약을 사용하여 피부 조직에서 총 RNA를 추출하고 cDNA 합성 키트를 사용하여 cDNA를 합성하였다. qRT-PCR은 PowerUp SYBR Green Master Mix와 StepOne Plus Real-Time PCR 시스템으로 실시되었다. 모든 반응은 3회 수행되었으며 각 샘플의 평균값은 추가 분석에 사용되었다. 표적 유전자의 발현은 액틴의 발현으로 정규화되었다. qPCR 분석에 사용된 모든 시약 및 기기는 Thermo Fisher Scientific에서 구입하였다. 본 실시예에 사용된 프라이머 서열은 상기 표 1에 정렬하였다.Total RNA was extracted from skin tissue using Trizole reagent, and cDNA was synthesized using a cDNA synthesis kit. qRT-PCR was performed with PowerUp SYBR Green Master Mix and StepOne Plus Real-Time PCR system. All reactions were performed in triplicate and the average value of each sample was used for further analysis. Expression of target genes was normalized to the expression of actin. All reagents and instruments used for qPCR analysis were purchased from Thermo Fisher Scientific. Primer sequences used in this example were aligned in Table 1 above.
웨스턴 블로팅western blotting
각 조직 및 세포 펠렛을 수집하고 4℃에서 4시간 동안 프로테이나제 억제제를 함유하는 RIPA 완충액(Intron, 경기도, 한국)에 용해시켰다. SDS-PAGE 후, 단백질을 PVDF(polyvinyl fluoride) 멤브레인(EMD Millipore, Billerica, MA, USA)으로 전기이동시켰다. 멤브레인을 블로킹 버퍼(1x TBS 및 5% w/v 무지방 우유)에서 실온에서 1시간 동안 인큐베이션하였다. 4℃에서 일차 항체와 함께 24-48시간 인큐베이션한 후, 멤브레인을 Tris phosphate-buffered saline으로 세척하였다. 면역반응성 단백질은 상온에서 1시간 동안 양고추냉이 과산화효소가 결합된 이차 항체로 인큐베이션한 후 ECL 키트(Abclon, Seoul, Korea)를 사용하여 검출하였다. 본 실시예에 사용된 항체에 대한 정보는 상기 표 2에 정렬하였다.Each tissue and cell pellet were collected and dissolved in RIPA buffer (Intron, Gyeonggi-do, Korea) containing proteinase inhibitors for 4 h at 4°C. After SDS-PAGE, proteins were electrotransferred to polyvinyl fluoride (PVDF) membrane (EMD Millipore, Billerica, MA, USA). The membrane was incubated in blocking buffer (1x TBS and 5% w/v non-fat milk) for 1 hour at room temperature. After incubation with primary antibodies at 4°C for 24-48 hours, the membrane was washed with Tris phosphate-buffered saline. Immunoreactive proteins were detected using an ECL kit (Abclon, Seoul, Korea) after incubation with horseradish peroxidase-conjugated secondary antibody for 1 hour at room temperature. Information on the antibodies used in this example is arranged in Table 2 above.
일차 세포 배양(각질세포, 진피 섬유아세포 및 MEF)Primary cell culture (keratinocytes, dermal fibroblasts and MEFs)
1-2일령 마우스의 전신 피부를 수집하고, 각질세포 배지 및 Dispase(Roche, Basel, Switzerland)를 사용하여 4℃에서 16시간 동안 인큐베이션하였다. 이어서, 상기 피부를 표피와 진피로 분리하였다. 각질세포(keratinocyte) 배양을 위해, 표피 조직을 분산시키고, 각질세포 배지 EpiLife(Thermo Fisher Scientific) 하에서 Coating Matrix 키트(Thermo Fisher Scientific)로 코팅된 플레이트에 접종하였다. Whole body skin from 1-2 day old mice was collected and incubated for 16 hours at 4°C using keratinocyte medium and Dispase (Roche, Basel, Switzerland). Then, the skin was separated into epidermis and dermis. For keratinocyte culture, epidermal tissue was dispersed and inoculated on plates coated with the Coating Matrix kit (Thermo Fisher Scientific) under keratinocyte medium EpiLife (Thermo Fisher Scientific).
진피 섬유아세포(dermal fibroblast) 배양을 위해, 37℃에서 30분 동안 200IU/mg 콜라게나제 I(Thermo Fisher Scientific)로 진피 조직을 분리하였다. 70μm 기공을 갖는 스트레이너를 사용하여 여과한 후, 세포를 15% 소태아혈청(FBS; Thermo Fisher Scientific)과 함께 DMEM (Dulbecco Modified Eagle Medium)에서 배양하였다. For dermal fibroblast culture, dermal tissue was isolated with 200 IU/mg collagenase I (Thermo Fisher Scientific) for 30 minutes at 37°C. After filtration using a strainer with 70 μm pores, the cells were cultured in DMEM (Dulbecco Modified Eagle Medium) with 15% fetal bovine serum (FBS; Thermo Fisher Scientific).
MEF(mouse embryonic fibroblast) 준비를 위해, 임신 13.5일 B6 마우스 암컷으로부터 태아 조직을 획득하고, 상기 조직을 37℃에서 30분 동안 250 IU/mg 콜라게나제 IV(Thermo Fisher Scientific)로 잘게 쪼개서 분리하였다. FBS를 이용하여 효소 반응을 정지시킨 후, 10% FBS를 포함하는 DMEM을 이용하여 세포를 배양하였다.For mouse embryonic fibroblast (MEF) preparation, fetal tissues were obtained from female B6 mice at 13.5 days of gestation, and the tissues were dissociated by mincing with 250 IU/mg collagenase IV (Thermo Fisher Scientific) for 30 minutes at 37°C. . After stopping the enzyme reaction using FBS, the cells were cultured using DMEM containing 10% FBS.
오일 레드 O 염색Oil Red O Dyeing
PBS로 세척한 후 플레이트 내 세포를 10% 포르말린으로 30분간 고정하였다. 그런 다음, 세포를 증류수로 세척하고 Oil Red O working solution(Sigma Aldrich, Burlington, MA, USA)과 함께 부드럽게 흔들면서 30분 동안 인큐베이션하였다. 100% 이소프로판올로 Oil Red O 염색된 세포를 추출하여 지방 생성의 정량을 수행하고 490nm에서 흡광도를 측정하였다.After washing with PBS, the cells in the plate were fixed with 10% formalin for 30 minutes. Then, cells were washed with distilled water and incubated with Oil Red O working solution (Sigma Aldrich, Burlington, MA, USA) for 30 minutes with gentle shaking. Oil Red O-stained cells were extracted with 100% isopropanol to quantify adipogenesis and absorbance was measured at 490 nm.
세포 상처 치유(Cell wound healing) 분석Cell wound healing analysis
2 x 105개의 Kera-308 세포주를 24-well plate에 접종하고 well을 가로질러 1mm 크기의 SPL Scratcher(SPL Life Sciences, Korea)를 드로잉하여 단층에 스크래치를 만들었다. 상처는 Cytation 5(Bio Tek)를 사용할 때마다 시각화되었다. Image J 소프트웨어(National Institutes of Health, Bethesda, MD)를 사용하여 상처 치유 밀도를 계산하였다. 2 Wounds were visualized each time using Cytation 5 (Bio Tek). Wound healing density was calculated using Image J software (National Institutes of Health, Bethesda, MD).
일시 또는 영구 발현을 위한 Kera-308로의 플라스미드 형질감염Plasmid transfection into Kera-308 for transient or permanent expression
Foxn1, Wnt5α, Wnt5β 및 Wnt10β에 대한 shRNA 플라스미드는 PiggyBac 시스템을 활용하기 위해 ITR-U6-shRNA 서열-인간 PGK 프로모터-eGFP/Puro-pA-ITR로 설계되었다. 또한, Foxn1 및 Foxn1 p.L19M에 대한 유전자 발현 벡터는 CAG 프로모터-Foxn 또는 Foxn1 p.L19M 코딩 서열-pA로 설계되었다. 플라스미드는 DNA 합성(VectorBuilder, Chicago, IL, USA)에 의해 제작되었다. shRNA plasmids for Foxn1, Wnt5α, Wnt5β and Wnt10β were designed with ITR-U6-shRNA sequence-human PGK promoter-eGFP/Puro-pA-ITR to utilize the PiggyBac system. Additionally, gene expression vectors for Foxn1 and Foxn1 p.L19M were designed with CAG promoter- Foxn or Foxn1 p.L19M coding sequence-pA. Plasmids were constructed by DNA synthesis (VectorBuilder, Chicago, IL, USA).
넉다운(knock-down) 세포주 확립을 위해, Kera-308에 shRNA와 PiggyBac transposase 플라스미드를 동시 형질감염시켰고, 항생제 스크리닝 후 안정한 세포주를 확립하였다. 일시적인 유전자 발현을 위해 단일 플라스미드를 Kera-308에 형질감염시켰다. 제조사의 메뉴얼에 따라 Lipofectamine 3000(Invitrogen, Waltham, MA, USA)을 사용하여 48시간 동안 형질감염시켰다. shRNA의 서열 정보는 상기 표 1에 정렬하였다.To establish a knock-down cell line, shRNA and PiggyBac transposase plasmid were co-transfected into Kera-308, and a stable cell line was established after antibiotic screening. For transient gene expression, a single plasmid was transfected into Kera-308. Transfection was performed for 48 hours using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA) according to the manufacturer's manual. Sequence information of shRNA was arranged in Table 1 above.
통계 분석statistical analysis
통계 분석은 GraphPad Prism(Version 8.##, GraphPad, San Diego, CA, USA)을 사용하여 unpaired Student's t-test로 수행되었다.Statistical analysis was performed with unpaired Student's t-test using GraphPad Prism (Version 8.##, GraphPad, San Diego, CA, USA).
실시예 1. CRISPR/Cas9 base-editor를 이용한 Example 1. Using CRISPR/Cas9 base-editor FoxN1FoxN1 유전자에서의 SNP SNPs in genes
본 발명자들은, 피부 손상 여부에 관계없이 EMT(epithelial-mesenchymal transition) 및 dWAT(dermal white adipose tissue) 지방 생성을 유도하여 미용 목적 및 관련 피부 질환 극복하는 데 유용하게 사용될 수 있는 신규한 변이체를 개발하기 위해, 흉선 발달 및 케라틴 세포 분화에 중요한 인자로 알려진 FoxN1(Forkhead-box N1) 유전자 (MGI: 102949)의 1번째 코딩 엑손 중 sgRNA 결합이 가능한 cgactggagggcgaacccca(agg)을 타겟으로 선정하고, CRISPR/Cas9 base editor시스템을 이용하여 무작위 미스센스 돌연변이가 유발된 FoxN1 돌연변이 마우스를 제작하였다. The present inventors sought to develop a novel variant that can be useful for cosmetic purposes and to overcome related skin diseases by inducing EMT (epithelial-mesenchymal transition) and dWAT (dermal white adipose tissue) fat production regardless of whether the skin is damaged or not. For this purpose, cgactggagggcgaacccca (agg), which can bind sgRNA, was selected as a target among the first coding exons of the FoxN1 (Forkhead-box N1) gene (MGI: 102949), which is known to be an important factor in thymus development and keratinocyte differentiation, and CRISPR/Cas9 base FoxN1 mutant mice with random missense mutations were created using the editor system.
간략하게는 다음과 같다: Foxn1의 시작 코돈을 포함하는 2번 엑손을 SNP 형성을 위한 표적 부위로 선택하였다. Foxn1 돌연변이 마우스를 개발하기 위해 단일 가이드 RNA(sgRNA) 및 nSpCas9-BE(nickase Streptococcus pyogens Cas9 fused base editor) mRNA를 마우스 배아에 미세주입하여 새끼를 얻고, 상기 새끼를 Sanger 시퀀싱 분석하였다. Briefly, it is as follows: Exon 2 containing the start codon of Foxn1 was selected as the target site for SNP formation. To develop Foxn1 mutant mice, single guide RNA (sgRNA) and nSpCas9-BE (nickase Streptococcus pyogens Cas9 fused base editor) mRNA were microinjected into mouse embryos to obtain pups, and the pups were analyzed by Sanger sequencing.
그 결과, 도 1a에 나타낸 바와 같이, c.55 C>A(p.L19M)를 갖는 SNP(single nucleotide polymorphism) 마우스가 제조된 것을 확인하였다.As a result, as shown in Figure 1a, it was confirmed that a SNP (single nucleotide polymorphism) mouse with c.55 C>A (p.L19M) was produced.
또한, 도 1b에 나타낸 바와 같이, 상기 동종접합체(homozygote) p.L19M(B6.Foxn1 p.L19M, Foxn1 L19M/L19M) 마우스는 정상 발모 상태의 비만인 표현형을 갖는 것으로 나타났다.Additionally, as shown in Figure 1b, the homozygote p.L19M (B6. Foxn1 p.L19M, Foxn1 L19M/L19M ) mouse was found to have an obese phenotype with normal hair growth.
실시예 2. Example 2. Foxn1Foxn1 p.L19M에 의해 촉진된, 이상증식(hyperplasia)을 통한 진피 지방 생성(dermal adipogenesis) Dermal adipogenesis through hyperplasia promoted by p.L19M
본 발명자들은, 상기 실시예 1에서 확인된 p.L19M(B6.Foxn1 p.L19M, Foxn1 L19M/L19M)의 비만의 원인을 조사하기 위해, 마우스를 무작위로 나누어 일반 사료(NC)와 45% 고지방식이(HFD)를 15주 동안 급여하였다. In order to investigate the cause of obesity of p.L19M (B6. Foxn1 p.L19M, Foxn1 L19M/L19M ) identified in Example 1, the present inventors randomly divided mice and fed them with normal feed (NC) and 45% solid food. A solid diet (HFD) was fed for 15 weeks.
그 결과, 도 1c에 나타낸 바와 같이, 일반사료 식이시 C57BL/6(B6, 야생형; WT)과 동종접합체 B6.Foxn1 p.L19M(Foxn1 L19M/L19M)간 사료 섭취량과 체중 증가에 차이가 없었다. 반면, HFD 식이시 Foxn1 L19M/L19M은 WT와 동일한 양의 사료를 섭취함에도 불구하고, WT보다 훨씬 더 높은 체중 증가를 나타냈다. 이는, Foxn1 L19M/L19M의 비만이 음식 섭취 증가로 인한 것이 아님을 의미한다.As a result, as shown in Figure 1c, when fed with regular feed, C57BL/6 (B6, wild type; WT) and homozygous B6. There was no difference in feed intake and body weight gain between Foxn1 p.L19M ( Foxn1 L19M/L19M ). On the other hand, when fed a HFD, Foxn1 L19M/L19M showed much higher body weight gain than WT despite consuming the same amount of feed as WT. This means that the obesity of Foxn1 L19M/L19M is not due to increased food intake.
한편, Foxn1의 일차 발현 세포는 흉선 상피 세포(TEC; thymic epithelial cell)와 각질세포(keratinocyte)이므로, 피부 변화를 조직학적으로 분석하였다. Meanwhile, since the primary expressing cells of Foxn1 are thymic epithelial cells (TEC) and keratinocytes, skin changes were analyzed histologically.
그 결과, 도 1d에 나타낸 바와 같이, 두 가지 식이 처리군 모두 WT보다 Foxn1 L19M/L19M에서 더 두꺼운 dWAT 층이 있음을 확인할 수 있었다. As a result, as shown in Figure 1d, it was confirmed that both dietary treatment groups had a thicker dWAT layer in Foxn1 L19M/L19M than in WT.
구체적으로, 도 1e 및 1f에 나타낸 바와 같이, Foxn1 L19M/L19M의 전체 dWAT 두께는 일반 사료(p = 0.0007) 처리군에서 WT보다 50%, HFD(p=0.0019) 처리군에서 77% 증가하였다. Specifically, as shown in Figures 1e and 1f, the total dWAT thickness of Foxn1 L19M/L19M increased by 50% compared to WT in the regular feed (p = 0.0007) treatment group and by 77% in the HFD (p = 0.0019) treatment group.
또한, 도 1e 및 1g에 나타낸 바와 같이, Foxn1 L19M/L19M의 dWAT는 WT와 비교하여 500μm 길이당 지방세포 수가 크게 증가하였다(NC; 35.5%, p=0.0227 및 HFD; 39.8%, p=0.0187). Additionally, as shown in Figures 1E and 1G, dWAT of Foxn1 L19M/L19M had a significantly increased number of adipocytes per 500 μm length compared to WT (NC; 35.5%, p=0.0227 and HFD; 39.8%, p=0.0187). .
또한, HFD 급이는 WT와 Foxn1 L19M/L19M 모두에서 dWAT 두께가 일반 사료 처리군 대비 약 2배 증가하여 유전자형에 따른 차이가 없었다. 또한, 도 1e, 1f 및 1g에 나타낸 바와 같이, HFD 급이는 WT 및 Foxn1 L19M/L19M에서 진피 지방세포 수를 증가시키지 않았다. In addition, HFD feeding increased dWAT thickness approximately two-fold compared to the regular feed treatment group in both WT and Foxn1 L19M/L19M, with no difference depending on genotype. Additionally, as shown in Figures 1E, 1F and 1G, HFD feeding did not increase the number of dermal adipocytes in WT and Foxn1 L19M/L19M .
이는, Foxn1 p.L19M에 의해 진피 백색지방세포의 증식 (hyperplasia)가 나타났음을 의미한다.This means that proliferation (hyperplasia) of dermal white adipocytes occurred due to Foxn1 p.L19M.
실시예 3. Example 3. Foxn1Foxn1 p.L19M에 의해 활성화된, 표피 각질세포의 상피-중간엽 전이(epithelial-mesenchymal transition) Epithelial-mesenchymal transition of epidermal keratinocytes activated by p.L19M
본 발명자들은 Foxn1 L19M/L19M의 표피에서의 Foxn1 유전자 발현 패턴을 분석하였다. 그 결과, 도 2a에 나타낸 바와 같이, Foxn1 p.L19M은 마우스에서 대체 엑손 스플라이싱을 유도하지 않았다. The present inventors analyzed the Foxn1 gene expression pattern in the epidermis of Foxn1 L19M/L19M . As a result, as shown in Figure 2A, Foxn1 p.L19M did not induce alternative exon splicing in mice.
또한, 도 2b에 나타낸 바와 같이, Foxn1 L19M/L19M의 피부에서 Foxn1 단백질 (69kDa) 발현 수준을 분석했을 때, 표피 조직에서는 WT과 Foxn1 p.L19M 간에 차이가 없었으나, 진피 조직에서는 WT에 비해 발현이 감소하였다. In addition, as shown in Figure 2b, when analyzing the expression level of Foxn1 protein (69kDa) in the skin of Foxn1 L19M/L19M , there was no difference between WT and Foxn1 p.L19M in epidermal tissue, but expression was higher compared to WT in dermal tissue. This has decreased.
또한, 도 2c에 나타낸 바와 같이, Foxn1 L19M/L19M의 진피와 dWAT 층 사이의 영역에서 Foxn1-발현 세포가 관찰되었다. Additionally, as shown in Figure 2C, Foxn1-expressing cells were observed in the area between the dermis and dWAT layer of Foxn1 L19M/L19M .
또한, 도 2d 및 2e에 나타낸 바와 같이, 표피 조직을 사용한 RNA 시퀀싱을 기반으로 한 DAVID 기능 주석 클러스터링 및 히트맵 분석 결과, Foxn1 p.L19M가 피부에서 중간(intermediated) 필라멘트의 구조적 분자를 감소시키고 각질세포 분화, 증식 및 각질화를 증가시키는 것으로 나타났다. 감소된 중간 필라멘트는 세포 구조의 변화를 일으키고 세포 간 접합을 느슨하게 하여 세포 이동을 향상시킬 수 있다. 이는 Foxn1 p.L19M의 각질세포가 WT보다 더 높은 이동성을 가짐을 시사한다. Additionally, as shown in Figures 2d and 2e, the results of DAVID functional annotation clustering and heatmap analysis based on RNA sequencing using epidermal tissue showed that Foxn1 p.L19M reduces the structural molecules of intermediate (intermediated) filaments in the skin and keratin. It has been shown to increase cell differentiation, proliferation and keratinization. Reduced intermediate filaments can cause changes in cell structure and loosen intercellular junctions, thereby enhancing cell migration. This suggests that keratinocytes of Foxn1 p.L19M have higher mobility than WT.
이에, 추가적으로 일차(primary) 각질세포를 이용하여 세포 이동 분석을 실시하였고, 그 결과, 도 2f에 나타낸 바와 같이, Foxn1 L19M/L19M이 일관성있게 더 높은 이동 활성을 나타냄을 확인하였다(상처 후 24시간에서 p = 0.043 및 48시간에서 p = 0.009).Accordingly, a cell migration analysis was additionally performed using primary keratinocytes, and as a result, as shown in Figure 2f, it was confirmed that Foxn1 L19M/L19M consistently exhibited higher migration activity (24 hours after wounding) p = 0.043 at and p = 0.009 at 48 hours).
또한, 표피(Epi-; epidermal) 조직, 진피(Der-; dermal) 조직, 일차 각질세포(Kera-; keratinocyte) 및 진피 섬유아세포(DF; dermal fibroblast)에서의 E-cadherin 및 N-cadherin과 같은 EMT(epithelial-mesenchymal-transition) 매개 유전자의 단백질 수준을 검출하기 위해 웨스턴 블롯을 실시하였다.In addition, such as E-cadherin and N-cadherin in epidermal (Epi-; epidermal) tissue, dermal (Der-; dermal) tissue, primary keratinocyte (Kera-; keratinocyte), and dermal fibroblast (DF). Western blot was performed to detect protein levels of EMT (epithelial-mesenchymal-transition) mediating genes.
그 결과, 도 2g에 나타낸 바와 같이, Foxn1 p.L19M의 E-cadherin 발현은 표피 조직과 일차 각질세포에서 WT에 비해 감소하였으며, N-cadherin의 증가는 진피 조직에서만 관찰되고 일차 진피 섬유아세포에서는 관찰되지 않았다. 이는 Foxn1 L19M/L19M의 EMT가 진피 섬유아세포가 아닌 표피 각질세포에 국한되었음을 나타낸다.As a result, as shown in Figure 2g, E-cadherin expression of Foxn1 p.L19M was decreased compared to WT in epidermal tissue and primary keratinocytes, and an increase in N-cadherin was observed only in dermal tissue and in primary dermal fibroblasts. It didn't work. This indicates that the EMT of Foxn1 L19M/L19M was limited to epidermal keratinocytes and not dermal fibroblasts.
또한, 도 2h에 나타낸 바와 같이, 면역 형광 염색에서 E-cadherin/N-cadherin 및 E-cadherin/Foxn1 이중 양성 세포가 Foxn1 L19M/L19M의 진피-dWAT 경계 영역에서 관찰되었으며, 이는 상처 치유 중 EMT에서 보고된 관찰과 동일한 결과이다.Additionally, as shown in Figure 2h, immunofluorescence staining showed that E-cadherin/N-cadherin and E-cadherin/ Foxn1 double positive cells were observed in the dermis-dWAT border region of Foxn1 L19M/L19M , which indicates that they are involved in EMT during wound healing. This result is identical to the reported observation.
또한, 도 2i에 나타낸 바와 같이, Matrix metalloproteinase-2 및 9, Vimentin 및 Fibronectin과 같은 EMT 관련 유전자가 Foxn1 L19M/L19M의 피부에서 상대적으로 유의하게 증가된 발현을 나타냈다. Additionally, as shown in Figure 2i, EMT-related genes such as Matrix metalloproteinase-2 and 9, Vimentin, and Fibronectin showed relatively significantly increased expression in the skin of Foxn1 L19M/L19M .
즉, 이는 Foxn1 p.L19M이 각질세포의 EMT(epithelial-mesenchymal transition)를 활성화함을 입증한다.In other words, this proves that Foxn1 p.L19M activates EMT (epithelial-mesenchymal transition) of keratinocytes.
실시예 4. Example 4. Foxn1Foxn1 p.L19M에 의해 유도된, 각질세포의 지방전구세포로의 전환 Conversion of keratinocytes into preadipocytes induced by p.L19M
본 발명자들은 면역 형광 분석을 통해 지방세포 전구체 세포의 마커로 알려진 CD34 및 αSMA 발현 위치를 확인하였다.The present inventors confirmed the expression locations of CD34 and αSMA, known as markers of adipocyte precursor cells, through immunofluorescence analysis.
CD34-양성 세포는 성숙한 지방 세포로 분화할 수 있는 지방세포 전구체 세포(adipocyte precursor cells)로 알려져 있으며, αSMA-양성 근섬유아세포(myofibroblast)는 상처 치유 동안 지방세포로 분화할 수 있는 것으로 알려져 있다. CD34-positive cells are known as adipocyte precursor cells that can differentiate into mature adipocytes, and αSMA-positive myofibroblasts are known to be able to differentiate into adipocytes during wound healing.
그 결과, 도 3a에 나타낸 바와 같이, CD34-양성 및 αSMA-양성 세포는 Foxn1과 공동-발현되었고 진피-dWAT 경계 영역에서 관찰되었다. 이는, 진피-dWAT 경계 영역에 위치한 Foxn1 양성 세포가 지방세포로 분화될 수 있음을 나타낸다. As a result, as shown in Figure 3A, CD34-positive and αSMA-positive cells co-expressed Foxn1 and were observed in the dermis-dWAT border area. This indicates that Foxn1 positive cells located in the dermis-dWAT border area can be differentiated into adipocytes.
또한, 웨스턴 블롯팅을 통해 지방전구세포 마커인 CD24, CD34, Sca-1 및 αSMA 단백질 발현 수준을 확인하였다. In addition, the expression levels of preadipocyte markers CD24, CD34, Sca-1, and αSMA protein were confirmed through Western blotting.
그 결과, 도 3b에 나타낸 바와 같이, Foxn1 L19M/L19M 표피 조직에서 CD34 및 Sca-1과 같은 지방 전구세포의 발현이 증가하였다. 또한 진피 조직에서는 CD24, CD34, Sca-1 및 αSMA의 발현이 증가하였다. 특히 또한, CD34는 WT 대비 Foxn1 L19M/L19M 진피 조직에서 높게 발현된 반면, 일차 진피 섬유아세포에서는 WT와 발현 수준에 차이가 없었다. 이는 증가된 CD34 발현이 표피 각질세포에서 유래되었고, 도 3c에 나타난 바와 같이 각질세포에 대하여 Foxn1 p.L19M을 과발현 시킬 경우, 지방세포로의 전환이 관찰된다. 이는 각질세포가 지방전구세포로 분화 가능함을 의미한다. 지방 전구세포의 생성 및 공급은 Foxn1L19M/L19M의 dWAT hyperplasia 유도 원인에 대한 주요한 기전이다. As a result, as shown in Figure 3b, the expression of adipocytes such as CD34 and Sca-1 increased in Foxn1 L19M/L19M epidermal tissue. Additionally, the expression of CD24, CD34, Sca-1, and αSMA increased in dermal tissue. In particular, CD34 was highly expressed in Foxn1 L19M/L19M dermal tissue compared to WT, while there was no difference in expression level compared to WT in primary dermal fibroblasts. This increased CD34 expression was derived from epidermal keratinocytes, and as shown in Figure 3c, when Foxn1 p.L19M is overexpressed in keratinocytes, conversion to adipocytes is observed. This means that keratinocytes can differentiate into preadipocytes. The generation and supply of adipocytes is a major mechanism responsible for the induction of dWAT hyperplasia in Foxn1 L19M/L19M .
실시예 5. Example 5. Foxn1Foxn1 p.L19M에 의해 유도된, 각질세포-유래 신호전달을 통한 진피 섬유아세포(fibroblast)에서의 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로의 전환을 통한 지방 생성 Adipogenesis through conversion of dermal fibroblasts to preadipocytes or adipocytes via keratinocyte-derived signaling, induced by p.L19M
지방전구세포의 증가만으로는 진피 백색지방층의 증대를 설명하지 못한다. 지방 분화 신호의 활성화에 대한 기전분석이 필요했으며, 본 발명자들은 각질세포가 진피 백색지방층의 지방 형성 신호를 유도하는 것으로 가정하였다. 이에, 일차 각질세포와 WT 마우스 배아 섬유아세포(MEF)를 사용하여 트랜스웰 지방생성(Transwell adipogenesis) 실험을 실시하였다.The increase in preadipocytes alone does not explain the increase in the dermal white fat layer. A mechanistic analysis of the activation of adipogenic differentiation signals was required, and the present inventors assumed that keratinocytes induce adipogenic signals in the dermal white fat layer. Accordingly, a Transwell adipogenesis experiment was performed using primary keratinocytes and WT mouse embryonic fibroblasts (MEF).
그 결과, 도 3d, 3e 및 3f에 나타낸 바와 같이, Foxn1 L19M/L19M의 각질세포가 신호전달을 통해 섬유아세포에서의 지방생성을 촉진한다는 것을 보여준다. 특히, Foxn1 L19M/L19M 각질세포는 Foxn1 +/+(WT)의 각질세포와 비교하여 하부(lower) 웰의 MEF에서 지방 생성을 약 6배 촉진했다(p <0.0001)(도 3d). As a result, as shown in Figures 3d, 3e, and 3f, Foxn1 L19M/L19M keratinocytes promote adipogenesis in fibroblasts through signal transduction. In particular, Foxn1 L19M/L19M keratinocytes promoted adipogenesis in MEFs of the lower wells approximately 6-fold compared to keratinocytes of Foxn1 +/+ (WT) (p <0.0001) (Figure 3D).
또한, 도 3f에 나타낸 바와 같이, 하부 웰의 MEF에 대한 웨스턴 블롯 분석 결과, β-카테닌의 감소와 PPARγ의 증가를 확인하였다. 또한, 트랜스웰 실험 후 섬유아세포 간의 αSMA 발현에는 차이가 없었다. 이는 각질세포에서 Foxn1 p.L19M 발현이 하부 웰의 섬유아세포에서 αSMA 발현을 향상시키지 않았음을 나타낸다.Additionally, as shown in Figure 3f, Western blot analysis of MEFs in the lower well confirmed a decrease in β-catenin and an increase in PPARγ. Additionally, there was no difference in αSMA expression between fibroblasts after the transwell experiment. This indicates that expression of Foxn1 p.L19M in keratinocytes did not enhance αSMA expression in fibroblasts of the lower well.
한편, Foxn1 L19M/L19M은 전신 돌연변이 동물로서, 진피 섬유아세포는 αSMA 발현 수준이 높다(도 3b). 이에, 지방 생성 배지를 사용하여 Foxn1 L19M/L19M 및 WT의 진피 섬유아세포를 배양하였다(도 3g). 진피 섬유아세포는 지방 생성 가능성을 나타내었으며, Foxn1 +/+와 Foxn1 L19M/L19M 간의 지방 생성 양에는 차이가 없었다(도 3h). Meanwhile, Foxn1 L19M/L19M is a systemic mutant animal, and dermal fibroblasts have a high level of αSMA expression (Figure 3b). Accordingly, Foxn1 L19M/L19M and WT dermal fibroblasts were cultured using adipogenic medium (Figure 3g). Dermal fibroblasts showed adipogenic potential, and there was no difference in the amount of adipogenesis between Foxn1 +/+ and Foxn1 L19M/L19M (Figure 3h).
따라서, Foxn1 p.L19M이 섬유아세포가 지방을 생성할 수 있는 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로의 전환을 활성화함을 알 수 있다.Therefore, it can be seen that Foxn1 p.L19M activates the conversion of fibroblasts into preadipocytes or adipocytes that can produce fat.
실시예 6. Example 6. Foxn1 Foxn1 p.L19M에 의한 세포증식 및 지방분화 신호 활성화Activation of cell proliferation and adipogenic differentiation signals by p.L19M
본 발명자들은 Foxn1 p.L19M에 의한 지방형성 및 EMT 증가가 Foxn1의 과발현에 의한 것인지를 구분하기 위하여 표피조직 및 Foxn1 및 Foxn1 p.L19M으로 과발현된 각질세포주의 유전자 발현을 비교 분석하였다. 도4에 나타나는 바와 같이 Foxn1 p.L19M은 특징적으로 세포구조 관련 유전자 및 증식 관련 유전자의 발현이 증가하였으며, 이는 Foxn1 유전자의 과발현과는 차이가 났다. 또한 지방분화와 관련된 신호전달 관련 유전자 또한 Foxn1 p.L19M 과발현 및 Foxn1L19M/L19M의 표피 조직에서 더 많이 활성화 되었다.To determine whether the increase in adipogenesis and EMT caused by Foxn1 p.L19M was caused by overexpression of Foxn1, the present inventors compared and analyzed the gene expression of epidermal tissue and Foxn1 and keratinocyte lines overexpressed by Foxn1 p.L19M. As shown in Figure 4, Foxn1 p.L19M characteristically increased the expression of cell structure-related genes and proliferation-related genes, which was different from overexpression of the Foxn1 gene. Additionally, genes related to signal transduction related to adipogenic differentiation were also more activated in epidermal tissues of Foxn1 p.L19M overexpression and Foxn1 L19M/L19M .
실시예 7. Example 7. Foxn1 Foxn1 p.L19M 및 Wnt 시그널링의 연관성 확인Confirmation of association between p.L19M and Wnt signaling
본 발명자들은 다양한 유전자 신호 중에서, Foxn1 p.L19M의 EMT 증가 메커니즘을 조사하기 위해 RNA 시퀀싱 데이터를 통해 세포 이동 및 세포 분화와 관련된 유전자를 분석하였다. Among various gene signals, the present inventors analyzed genes related to cell migration and cell differentiation through RNA sequencing data to investigate the mechanism of increased EMT of Foxn1 p.L19M.
그 결과, 도 5a에 나타낸 바와 같이, 유전자 네트워크 분석에서 Wnt5β 및 Wnt10β 시그널링은 Foxn1과 상관관계가 있었다. 도 5b 및 5c에 나타낸 바와 같이, 발현 위치 분석 결과, Wnt5β와 Foxn1은 Foxn1 L19M/L19M에서 진피와 dWAT의 경계 영역에 함께 위치했다. Wnt10β는 주로 WT의 표피에서 발현되며 Foxn1 L19M/L19M에서는 발현이 감소되었다(도 5b). As a result, as shown in Figure 5a, Wnt5β and Wnt10β signaling were correlated with Foxn1 in the gene network analysis. As shown in Figures 5b and 5c, as a result of expression location analysis, Wnt5β and Foxn1 were co-located in the border area between the dermis and dWAT in Foxn1 L19M/L19M . Wnt10β was mainly expressed in the epidermis of WT, and its expression was reduced in Foxn1 L19M/L19M (Figure 5b).
또한, 웨스턴 블롯 분석 결과, 도 5d에 나타낸 바와 같이, Foxn1 L19M/L19M의 진피에서 Wnt5ß는 증가하고 Wnt10β 및 β-카테닌은 감소하였으며, Wnt/β-카테닌 신호전달은 지방 생성과 관련이 있다. 또한, 도 5e에 나타낸 바와 같이, Wnt5-Fizzled2 경로는 STAT3 인산화를 통해 EMT를 촉진하고, Foxn1 L19M/L19M에서도 표피에서 MEK 및 STAT3의 인산화가 증가하는 것이 관찰되었다. 모든 EMT 촉진 경로가 분석되지는 않았지만, Wnt5-Fizzled 경로는 Foxn1 L19M/L19M의 EMT에 관여하는 것으로 보였다.In addition, as a result of Western blot analysis, as shown in Figure 5d, Wnt5ß increased and Wnt10β and β-catenin decreased in the dermis of Foxn1 L19M/L19M , and Wnt/β-catenin signaling is related to adipogenesis. Additionally, as shown in Figure 5e, the Wnt5-Fizzled2 pathway promotes EMT through STAT3 phosphorylation, and increased phosphorylation of MEK and STAT3 in the epidermis was also observed in Foxn1 L19M/L19M . Although not all EMT-promoting pathways were analyzed, the Wnt5-Fizzled pathway seemed to be involved in the EMT of Foxn1 L19M/L19M .
또한, 본 발명자들은 Wnt5β 신호전달과 지방생성 또는 EMT 간의 상관관계를 유전자 침묵 실험을 통해 확인하고자 하였다. Additionally, the present inventors sought to confirm the correlation between Wnt5β signaling and adipogenesis or EMT through gene silencing experiments.
그 결과, 도 5f 및 5g에 나타낸 바와 같이, Wnt5β 억제는 하부 웰의 진피 섬유아세포로의 지방 생성 및 세포 이동을 감소시켰다. 또한 도 5h에 나타나는 바와 같이, Wnt5β 억제는 Foxn1L19M/L19M 마우스에 나타난 것과 동일하게 β-카테닌의 감소와 E-cadherin의 증가를 유도하였다. 이러한 결과는 Foxn1 p.L19M에 의한 증가된 Wnt5β 발현이 지방 생성 및 세포 이동 경로 중 하나임을 나타낸다.As a result, as shown in Figures 5f and 5g, Wnt5β inhibition reduced adipogenesis and cell migration to dermal fibroblasts in the lower wells. Additionally, as shown in Figure 5h, Wnt5β inhibition led to a decrease in β-catenin and an increase in E-cadherin, identical to that seen in Foxn1L19M/L19M mice. These results indicate that increased Wnt5β expression by Foxn1 p.L19M is one of the adipogenic and cell migration pathways.
실시예 8. Example 8. Foxn1Foxn1 p.L19M에 의해 활성화된, 각질세포 이동 및 지방 생성 시그널링 Keratinocyte migration and adipogenic signaling activated by p.L19M
본 발명자들은 WT Foxn1 (pCAG-Foxn1-pA, pFoxn1) 및 Foxn1 p.L19M (pCAG-Foxn1 p.L19M-pA, pFoxn1 p.L19M)의 코딩 서열을 마우스 wild type 각질세포주(Kera-308)에 형질감염시킨 후 지방 생성 및 세포이동 활성을 분석하였다. The present inventors analyzed the coding sequences of WT Foxn1 (pCAG- Foxn1 -pA, p Foxn1 ) and Foxn1 p.L19M (pCAG- Foxn1 p.L19M-pA, p Foxn1 p.L19M) in a mouse wild type keratinocyte cell line (Kera-308). After transfection, adipogenesis and cell migration activities were analyzed.
그 결과, 도 6a에 나타낸 바와 같이, 트랜스웰 내 Kera-308의 Foxn1 p.L19M 일시적인 발현은 Foxn1 L19M/L19M에서 관찰된 것과 유사하게 하부 웰에서 MEF의 지방 생성을 증가시켰다(pFoxn1 vs. pFoxn1 p.L19M, p = 0.042). 또한, 도 6b에 나타낸 바와 같이, Kera-308의 일시적인 Foxn1 p.L19M 발현은 대조군 또는 pFoxn1 그룹(pFoxn1 vs. pFoxn1 p.L19M, p = 0.0053)에 비해 지방 생성을 유의하게 증가시켰다. 이는 각질세포가 직접적인 분화를 통하여 지방전구세포 및 지방세포로의 분화가 가능함을 재확인하는 결과이다.As a result, as shown in Figure 6a, transient expression of Foxn1 p.L19M in Kera-308 in transwells increased adipogenesis of MEFs in the lower wells, similar to that observed in Foxn1 L19M/L19M (p Foxn1 vs. p Foxn1 p.L19M, p = 0.042). Additionally, as shown in Figure 6B, transient Foxn1 p.L19M expression in Kera-308 significantly increased adipogenesis compared to the control or p Foxn1 group (p Foxn1 vs. p Foxn1 p.L19M, p = 0.0053). This result reaffirms that keratinocytes can differentiate into preadipocytes and adipocytes through direct differentiation.
Foxn1 L19M/L19M에서 또 다른 중요한 관찰은 EMT의 증가이다. 도 6c 및 6d에 나타낸 바와 같이, 시험관 내 상처 치유 실험에서, Foxn1 p.L19M 일시적 발현은 대조군과 유사한 세포 이동 활성을 보였고 pFoxn1 일시적 발현에 비해 유의하게 증가하였다(pFoxn1 vs. pFoxn1 p.L19M, p = 0.0013). Another important observation in Foxn1 L19M/L19M is the increase in EMT. As shown in Figures 6C and 6D, in in vitro wound healing experiments, Foxn1 p.L19M transient expression showed cell migration activity similar to the control and significantly increased compared to pFoxn1 transient expression ( pFoxn1 vs. pFoxn1 p. L19M, p = 0.0013).
즉, pFoxn1의 일시적인 발현은 대조군에 비해 지방 생성을 증가시키지 않았으나, 유의하게 감소된 세포 이동 활성을 유도했다(대조군 vs pFoxn1, p = 0.001). 따라서, Foxn1 과발현은 각질세포 분화를 유도하고 세포이동을 감소시킨다. 반면, pFoxn1 p.L19M은 각질세포 이동 잠재력의 변화없이 신호 전달을 통해 지방 생성을 촉진했다. That is, transient expression of pFoxn1 did not increase adipogenesis compared to the control group, but induced significantly reduced cell migration activity (control vs pFoxn1 , p = 0.001). Therefore, Foxn1 overexpression induces keratinocyte differentiation and reduces cell migration. On the other hand, pFoxn1 p.L19M promoted adipogenesis through signaling without changing keratinocyte migration potential.
실시예 9. Example 9. Foxn1Foxn1 p.L19M에 의해 자극된, 각질세포에서의 WNT 리간드 활성화 및 섬유아세포에서의 αSMA 발현 WNT ligand activation in keratinocytes and αSMA expression in fibroblasts stimulated by p.L19M
본 발명자들은 각질세포에서의 WNT 리간드 활성화 및 섬유아세포에서의 αSMA 발현을 확인하였다.The present inventors confirmed WNT ligand activation in keratinocytes and αSMA expression in fibroblasts.
그 결과, 도 6e에 나타낸 바와 같이, Kera-308에 대한 pFoxn1 p.L19M 형질감염은 E-cadherin 및 β-Catenin을 감소시키고 CD34를 증가시켰다. 이는 Foxn1 L19M/L19M에서의 유전자 발현과 유사하였다(도 2g, 3b 및 5d).As a result, as shown in Figure 6e, pFoxn1 p.L19M transfection into Kera-308 decreased E-cadherin and β-Catenin and increased CD34. This was similar to gene expression in Foxn1 L19M/L19M (Figures 2g, 3b and 5d).
또한, Foxn1 L19M/L19M의 EMT 및 진피 지방 생성이 Wnt 신호 전달과 관련된 것으로 나타났기 때문에(도 5d 및 5e), Wnt5β 및 Wnt10β의 발현을 분석하였다.Additionally, because EMT and dermal adipogenesis in Foxn1 L19M/L19M were shown to be associated with Wnt signaling (Figures 5D and 5E), we analyzed the expression of Wnt5β and Wnt10β.
그 결과, 도 6e에 나타낸 바와 같이, Wnt5β는 pFoxn1 또는 pFoxn1 p.L19M 형질감염 후 Kera-308에서 상대적으로 높게 발현되었다. Wnt5β의 발현 패턴은 Foxn1 L19M/L19M과 형질감염된 Kera-308 간 유사했으나, Wnt10β는 마우스와 세포 간에서 반대 패턴을 나타냈다(도 5d 및 6e). As a result, as shown in Figure 6e, Wnt5β was expressed relatively highly in Kera-308 after pFoxn1 or pFoxn1 p.L19M transfection. The expression pattern of Wnt5β was similar between Foxn1 L19M/L19M and transfected Kera-308, whereas Wnt10β showed an opposite pattern between mice and cells (Figures 5D and 6E).
따라서, 이는 Wnt5β가 Foxn1 p.L19M의 EMT 및 지방 생성에 대한 주요 링커임을 의미한다.Therefore, this means that Wnt5β is the main linker for EMT and adipogenesis of Foxn1 p.L19M.
Wnt5β, Wnt10β, β-Catenin 및 E-Cadherin의 유전자 발현 패턴은 pFoxn1과 pFoxn1 p.L19M 간 유사했다. pFoxn1 p.L19M은 pFoxn1보다 더 강력한 유전자 발현 변화 패턴을 유도하고 지방을 생성시켰다(도 6a 및 6e). Gene expression patterns of Wnt5β, Wnt10β, β-Catenin and E-Cadherin were similar between pFoxn1 and pFoxn1p.L19M . pFoxn1 p.L19M induced a stronger pattern of gene expression changes and produced adiposity than pFoxn1 (Figures 6A and 6E).
그럼에도 불구하고, 이러한 결과는 Foxn1 과발현이 각질세포에서 지방 생성 신호를 유도할 수 있음을 시사하므로 Kera-308 실험에서 pFoxn1 형질감염에 의한 증가되지 않은 지방 생성은 설명할 수 없다. Nevertheless, these results suggest that Foxn1 overexpression can induce adipogenic signaling in keratinocytes and therefore cannot explain the non-increased adipogenesis by pFoxn1 transfection in the Kera-308 experiment.
따라서, 지방 생성을 증가시키는 또 다른 요인이 있을 것으로 생각되며, Foxn1 p.L19M이 하부 웰의 섬유아세포에서 αSMA 발현을 증가시켜 지방 세포로 분화할 수 있으므로, Foxn1 L19M/L19M의 진피에서 더 높은 αSMA 발현에 착안하여, pFoxn1 및 pFoxn1 p.L19M을 마우스 섬유아세포 세포주(NIH3T3)에 형질감염시켰다.Therefore, it is thought that there may be another factor that increases adipogenesis, as Foxn1 p.L19M may increase αSMA expression in fibroblasts of the lower wells, leading to their differentiation into adipocytes, resulting in higher αSMA in the dermis of Foxn1 L19M/L19M. Focusing on expression, pFoxn1 and pFoxn1 p.L19M were transfected into a mouse fibroblast cell line (NIH3T3).
그 결과, 도 6f에 나타낸 바와 같이, pFoxn1 p.L19M 일시적인 발현은 NIH3T3 세포주에서 증가된 αSMA 발현을 유도했으나, pFoxn1은 그렇지 않았다.As a result, as shown in Figure 6f, transient expression of pFoxn1 p.L19M induced increased αSMA expression in the NIH3T3 cell line, but not pFoxn1 .
실시예 10. Example 10. Foxn1Foxn1 p.L19M 형질감염에 의해 촉진된, 생체 내 dWAT 지방 생성 In vivo dWAT adipogenesis promoted by p.L19M transfection
본 발명자들은, 상기 실시예 8에서 확인된 바와 같이, Kera-308에서 일시적인 pFoxn1 p.L19M 발현이 세포 이동 및 지방 생성을 촉진할 수 있음(도 6a 및 6b)에 착안하여, 모발 주기에 따른 dWAT 지방 생성의 가능한 변화를 배제하기 위해 생체 내 실험의 표적 기관으로 귀를 선택하여 생체 내 적용 가능성을 확인하였다. peGFP, pFoxn1 및 pFoxn1 p.L19M은 2주 간격으로 2회 형질감염하여 4주후 진피 백색지방층의 두께를 비교하였다 (도 7a). The present inventors focused on the fact that, as confirmed in Example 8 above, transient pFoxn1 p.L19M expression in Kera-308 can promote cell migration and adipogenesis (FIGS. 6A and 6B), To rule out possible changes in dWAT adipogenesis, the ear was selected as the target organ for in vivo experiments to confirm its in vivo applicability. peGFP, p Foxn1 , and p Foxn1 p.L19M were transfected twice at 2-week intervals, and the thickness of the dermal white fat layer was compared after 4 weeks (Figure 7a).
그 결과, 도 7b에 나타낸 바와 같이, pFoxn1 p.L19M 그룹(p=0.02)에서 dWAT 두께의 상대적 증가가 확인되었다. 반면, pFoxn1 형질감염은 WT와 비교하여 dWAT 지방생성을 촉진하지 않았다. 이는 Foxn1 p.L19M의 형질도입을 통해 정상인 동물에서 국소적 진피 백색 피부지방의 증식을 유도할 수 있음을 의미한다.As a result, as shown in Figure 7b, a relative increase in dWAT thickness was confirmed in the pFoxn1 p.L19M group (p=0.02). On the other hand, pFoxn1 transfection did not promote dWAT adipogenesis compared to WT. This means that local dermal white skin fat proliferation can be induced in normal animals through transduction of Foxn1 p.L19M.
또한, 도 6c에 나타낸 바와 같이, Foxn1 p.L19M에 의하여 유도되는 상피간엽이행의 특성 활용을 위하여 상처유발 모델에서 치유 능력을 비교하였으며, Foxn1L19M/L19M 마우스는 wild type 마우스에 비하여 유의적으로 빠른 상처 치유 능력을 유도하였다. In addition, as shown in Figure 6c, the healing ability was compared in a wound-induced model to utilize the characteristics of epithelial-mesenchymal transition induced by Foxn1 p.L19M, and Foxn1 L19M/L19M mice showed significantly faster healing than wild type mice. Wound healing ability was induced.
종합적으로, 본 발명자들은, 흉선 발달 및 케라틴 세포 분화에 중요한 인자로 알려진 Foxn1의 기능 조절을 통해, EMT(epithelial-mesenchymal transition) 및 dWAT(dermal white adipose tissue) 지방 생성의 유용한 기능을 활용할 수 있음에 착안하여, CRISPR/Cas9 편집 시스템을 기반으로, 무작위 미스센스 돌연변이가 유발된 Foxn1 돌연변이 마우스를 제작하였고, 신규한 Foxn1 c.55 C>A(p.L19M) 돌연변이체를 발굴하였다. 이러한 본 발명의 Foxn1 p.L19M은 피부세포 항상성에 영향을 끼쳐, 각질세포가 지방전구세포 (preadipocyte)로 변화(transition)되었으며, 각질세포에서 지방분화 신호를 유도하여 피하의 지방전구세포를 지방세포로 분화시켜 지방 형성을 촉진시켜, 피하지방을 증가시켰다. 반면, 야생형 Foxn1는 피하지방의 형성이 촉진되지 않았다. 또한, 정상 동물에 Foxn1 p.L19M을 도입할 경우, 특정부위에서만 지방형성을 유도할 수 있을 뿐만 아니라, 지방세포 숫자를 증가시켜서 건강한 지방을 획득할 수 있음을 확인하였으며, 추가적으로 Foxn1 p.L19M을 섬유아세포에 적용할 경우 상처 및 섬유화증에 중요한 역할을 하는 근섬유아세포로의 특성 발현을 유도할 수 있음을 확인하였다.Overall, the present inventors demonstrated that the useful functions of epithelial-mesenchymal transition (EMT) and dermal white adipose tissue (dWAT) adipogenesis can be utilized through regulating the function of Foxn1, which is known to be an important factor in thymus development and keratinocyte differentiation. Based on this idea, Foxn1 mutant mice with random missense mutations were created based on the CRISPR/Cas9 editing system, and a novel Foxn1 c.55 C>A(p.L19M) mutant was discovered. Foxn1 p.L19M of the present invention affects skin cell homeostasis, causing keratinocytes to transition into preadipocytes, and induces a fat differentiation signal in keratinocytes to transform subcutaneous preadipocytes into adipocytes. It promoted fat formation and increased subcutaneous fat. On the other hand, wild-type Foxn1 did not promote the formation of subcutaneous fat. In addition, it was confirmed that when introducing Foxn1 p.L19M into normal animals, not only can adipogenesis be induced only in specific areas, but also healthy fat can be obtained by increasing the number of adipocytes. Additionally, Foxn1 p.L19M can be used to obtain healthy fat. It was confirmed that when applied to fibroblasts, it can induce the expression of characteristics into myofibroblasts, which play an important role in wounds and fibrosis.
따라서, 피부 상처 및 흉터에 대한 개선 및 치료 등에 적용할 수 있을 뿐만 아니라, 성숙한 진피 백색 지방세포로의 분화를 촉진하여, 피부에서 특정부위의 피하지방유도를 통해 지방 조직 퇴축으로 인한 부피 감소와 기능 저하로 유발되는 현대인들의 미적, 건강적 문제를 개선할 수 있는 새로운 가능성을 제시할 수 있다.Therefore, not only can it be applied to the improvement and treatment of skin wounds and scars, but it also promotes differentiation into mature dermal white adipocytes, thereby reducing volume and functional decline due to adipose tissue degeneration by inducing subcutaneous fat in specific areas of the skin. It can present new possibilities for improving the aesthetic and health problems of modern people caused by .

Claims (18)

  1. 단일염기변이(Single Nucleotide variant: SNV), 삽입 또는 결실(Indel; Insertion or Deletion) 및 유전자 복제수 변이(Copy-number variation, CNV)로 구성된 군에서 선택되는 1 종 이상의 뉴클레오티드 변이를 포함하는 FoxN1(Forkhead-box N1) 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체.FoxN1 (containing one or more nucleotide variations selected from the group consisting of Single Nucleotide variant (SNV), Indel (Insertion or Deletion), and Copy-number variation (CNV) Forkhead-box N1) variant of the FoxN1 protein encoded by the variant gene.
  2. 제1항에 있어서,According to paragraph 1,
    상기 FoxN1 변이 유전자는, 야생형 FoxN1(Forkhead-box N1) 유전자의 엑손 1 내지 3으로 이루어진 군으로부터 선택된 1 종 이상의 엑손에서 상기 뉴클레오티드 변이가 존재하는 것을 특징으로 하는, FoxN1 단백질 변이체.The FoxN1 mutant gene is a FoxN1 protein variant, characterized in that the nucleotide mutation exists in one or more exons selected from the group consisting of exons 1 to 3 of the wild-type FoxN1 (Forkhead-box N1) gene.
  3. 제1항에 있어서,According to paragraph 1,
    상기 뉴클레오티드 변이는, 야생형 FoxN1 단백질의 19 번째 위치의 류신이 메티오닌으로 치환되는 아미노산 변화를 초래하는, 엑손 2에서의 뉴클레오티드 변이를 포함하는 것을 특징으로 하는, FoxN1 단백질 변이체.The nucleotide mutation is a FoxN1 protein variant, characterized in that it includes a nucleotide mutation in exon 2, which results in an amino acid change in which leucine at position 19 of the wild-type FoxN1 protein is replaced with methionine.
  4. 제1항에 있어서,According to paragraph 1,
    상기 FoxN1 단백질 변이체는 서열번호 2로 기재되는 아미노산 서열을 갖는 것을 특징으로 하는, FoxN1 단백질 변이체.The FoxN1 protein variant is characterized in that it has the amino acid sequence shown in SEQ ID NO: 2.
  5. 제1항에 있어서,According to paragraph 1,
    상기 FoxN1 단백질 변이체는, 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)를 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로 전환시키는 것을 특징으로 하는, FoxN1 단백질 변이체.The FoxN1 protein variant is a FoxN1 protein variant, characterized in that it converts keratinocytes or fibroblasts into preadipocytes or adipocytes.
  6. 제1항에 있어서,According to paragraph 1,
    상기 FoxN1 단백질 변이체는, 피하지방을 생성시키는 것을 특징으로 하는, FoxN1 단백질 변이체.The FoxN1 protein variant is a FoxN1 protein variant, characterized in that it generates subcutaneous fat.
  7. 다음 단계를 포함하는, 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)로부터 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로의 인 비트로(in vitro) 전환 유도 방법:A method for inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes, comprising the following steps:
    (a) 단일염기변이(Single Nucleotide variant: SNV), 삽입 또는 결실(Indel; Insertion or Deletion) 및 유전자 복제수 변이(Copy-number variation, CNV)로 구성된 군에서 선택되는 1 종 이상의 뉴클레오티드 변이를 포함하는 FoxN1(Forkhead-box N1) 변이 유전자를 포함하는 벡터를 제작하는 단계; 및(a) Contains one or more nucleotide variations selected from the group consisting of Single Nucleotide variant (SNV), Indel (Insertion or Deletion), and Copy-number variation (CNV) Constructing a vector containing a FoxN1 (Forkhead-box N1) mutant gene; and
    (b) 상기 벡터를 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)에 형질전환시키는 단계. (b) Transforming the vector into keratinocytes or fibroblasts.
  8. 제7항에 있어서,In clause 7,
    상기 벡터는 상동성 재조합(Homologous recombination), TALEN, ZFN 및 CRISPR-Cas9 벡터로 이루어진 군으로부터 선택된 것을 특징으로 하는, 방법.Wherein the vector is selected from the group consisting of homologous recombination, TALEN, ZFN, and CRISPR-Cas9 vectors.
  9. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 포함하는, 각질세포(keratinocyte) 또는 섬유아세포(fibroblast)로부터 지방전구세포(preadipocyte) 또는 지방세포(adipocyte)로의 인 비트로(in vitro) 전환 유도용 조성물.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; or a FoxN1 protein variant encoded by the FoxN1 mutant gene; inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes. Composition for.
  10. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 지방충전 또는 주름개선용 화장료 조성물.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; A cosmetic composition for fat filling or wrinkle improvement, comprising as an active ingredient.
  11. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 지방충전 또는 주름개선용 식품 조성물.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; A food composition for filling fat or improving wrinkles, comprising as an active ingredient.
  12. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 상처 치료 또는 흉터 생성 억제용 약학적 조성물.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; A pharmaceutical composition for treating wounds or inhibiting scar formation, comprising as an active ingredient.
  13. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 상처 치료 또는 흉터 개선용 화장료 조성물.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; A cosmetic composition for treating wounds or improving scars, comprising as an active ingredient.
  14. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 섬유증(fibrosis)의 예방 또는 치료용 약학적 조성물.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; A pharmaceutical composition for preventing or treating fibrosis, comprising as an active ingredient.
  15. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 섬유증의 예방 또는 개선용 식품 조성물.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; A food composition for preventing or improving fibrosis, comprising as an active ingredient.
  16. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 섬유증의 예방 또는 개선용 화장료 조성물.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; A cosmetic composition for preventing or improving fibrosis, comprising as an active ingredient.
  17. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 상처 치료 또는 흉터 생성 억제용 약학적 조성물을 대상에게 투여하는 단계를 포함하는, 상처 치료 또는 흉터 생성 억제 방법.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; A method for treating wounds or inhibiting scar formation, comprising administering to a subject a pharmaceutical composition for treating wounds or inhibiting scar formation, comprising as an active ingredient.
  18. FoxN1(Forkhead-box N1) 변이 유전자; 상기 FoxN1 변이 유전자를 포함하는 벡터; 또는 상기 FoxN1 변이 유전자에 의해 코딩되는 FoxN1 단백질 변이체;를 유효성분으로 포함하는, 섬유증(fibrosis)의 예방 또는 치료용 약학적 조성물을 대상에게 투여하는 단계를 포함하는, 섬유증 치료 방법.Forkhead-box N1 (FoxN1) variant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; A method of treating fibrosis, comprising administering to a subject a pharmaceutical composition for preventing or treating fibrosis, comprising as an active ingredient.
PCT/KR2023/004541 2022-04-06 2023-04-04 Novel foxn1 mutant and use thereof WO2023195749A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220043046A KR20230144171A (en) 2022-04-06 2022-04-06 Novel Forkhead-box N1 Variant and Uses Thereof
KR10-2022-0043046 2022-04-06

Publications (1)

Publication Number Publication Date
WO2023195749A1 true WO2023195749A1 (en) 2023-10-12

Family

ID=88243175

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/004541 WO2023195749A1 (en) 2022-04-06 2023-04-04 Novel foxn1 mutant and use thereof

Country Status (2)

Country Link
KR (1) KR20230144171A (en)
WO (1) WO2023195749A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019179439A1 (en) * 2018-03-19 2019-09-26 Beijing Biocytogen Co., Ltd Foxn1 knockout non-human animal

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019179439A1 (en) * 2018-03-19 2019-09-26 Beijing Biocytogen Co., Ltd Foxn1 knockout non-human animal

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
"Master Thesis", 1 January 2019, DEPARTMENT OF INTERNATIONAL AGRICULTURAL TECHNOLOGY, GRADUATE SCHOOL OF INTERNATIONAL AGRICULTURAL TECHNOLOGY SEOUL NATIONAL UNIVERSITY, Korea, article BAE, JI HYUN: "A Study for Phenotype Analysis with the CRISPR Mediated Mice Model on the Skin Associated Immunity and Metabolism", pages: 1 - 76, XP009550177 *
DATABASE PROTEIN ANONYMOUS : "forkhead box protein N1 isoform X1 [Mus musculus]", XP093097146, retrieved from NCBI *
GAWRONSKA-KOZAK BARBARA, GRABOWSKA ANNA, KUR-PIOTROWSKA ANNA, KOPCEWICZ MARTA: "Foxn1 Transcription Factor Regulates Wound Healing of Skin through Promoting Epithelial-Mesenchymal Transition", PLOS ONE, vol. 11, no. 3, pages e0150635, XP093097148, DOI: 10.1371/journal.pone.0150635 *
WALENDZIK KATARZYNA, KOPCEWICZ MARTA, BUKOWSKA JOANNA, PANASIEWICZ GRZEGORZ, SZAFRANSKA BOZENA, GAWRONSKA-KOZAK BARBARA: "The Transcription Factor FOXN1 Regulates Skin Adipogenesis and Affects Susceptibility to Diet-Induced Obesity", JOURNAL OF INVESTIGATIVE DERMATOLOGY, ELSEVIER, NL, vol. 140, no. 6, 1 June 2020 (2020-06-01), NL , pages 1166 - 1175.e9, XP093097147, ISSN: 0022-202X, DOI: 10.1016/j.jid.2019.11.010 *

Also Published As

Publication number Publication date
KR20230144171A (en) 2023-10-16

Similar Documents

Publication Publication Date Title
WO2019045259A2 (en) Cosmetic composition including dendrobium candidum wallich ex lindley flower extract
WO2017171491A1 (en) Pharmaceutical composition comprising stem cell extract for prevention or treatment of inflammatory disease
WO2017222345A1 (en) Novel autophagy activation-inducing compound for improving skin inflammation or aging
WO2016159567A2 (en) Composition for promoting hair growth or hair restoration and for anti-inflammation
WO2019103300A1 (en) Mirna-containing composition for treating wounds and improving skin
WO2016080796A2 (en) Pharmaceutical composition, containing sesquiterpene compound, for preventing or treating stat3-mediated diseases, and use thereof
WO2015111832A1 (en) Composition for preventing or treating prostate-related diseases, containing poncirus trifoliate extract
WO2023195749A1 (en) Novel foxn1 mutant and use thereof
WO2012134172A2 (en) Composition containing, as an active ingredient, an ethyl acetate fraction of schisandra chinensis baill, or wuweizisu c separated from the fraction, for preventing or treating obesity
WO2019022482A2 (en) Composition for preventing or treating fibrotic diseases comprising dendropanax morbifera extract as active ingredient
WO2013054998A1 (en) Novel chalcone derivative and anticancer composition comprising same as active ingredient
WO2018128479A1 (en) Composition for preventing or treating muscle diseases, comprising suberic acid or pharmaceutically acceptable salt thereof as active ingredient
WO2017146332A1 (en) Novel use of chromone derivative as pharmaceutical composition for preventing and treating fibrosis by using epithelial-mesenchymal transition inhibitory activity thereof
WO2016093515A1 (en) Composition for activating longevity gene
WO2019124803A1 (en) Composition comprising selaginella rossii warb. extract or fractions thereof for preventing or treating metabolic syndromes
WO2021107381A1 (en) Composition comprising ferulic acid and analogs thereof for preventing and treating skin diseases caused by genetic mutation
WO2019103572A1 (en) Composition, comprising mirna, for preventing hair loss or promoting hair restoration
WO2022139524A1 (en) Novel fk506 derivative and composition comprising same for promoting hair growth
WO2021251790A1 (en) Deoxycholic acid-peptide conjugate having anti-obesity activity and use thereof
WO2018155890A1 (en) Asymmetric sirna for inhibiting expression of male pattern hair loss target gene
WO2021002664A1 (en) Composition for preventing, relieving or treating cancer
WO2015190808A2 (en) Whitening ability of small stem cell and use thereof
WO2023146274A1 (en) Composition for preventing, alleviating or treating alopecia or poliosis through aldehyde dehydrogenase 2 regulation
WO2016003120A1 (en) Whitening composition comprising scutellaria alpina extract
WO2021025529A1 (en) Skin whitening composition containing dihydro-5-methylfuran-2(3h)-one derivative

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23784973

Country of ref document: EP

Kind code of ref document: A1