WO2019103300A1

WO2019103300A1 - Mirna-containing composition for treating wounds and improving skin

Info

Publication number: WO2019103300A1
Application number: PCT/KR2018/011320
Authority: WO
Inventors: 서민구; 윤상원; 박은주; 이원종; 최은욱
Original assignee: (주)프로스테믹스
Priority date: 2017-11-27
Filing date: 2018-09-21
Publication date: 2019-05-31
Also published as: KR102189991B1; KR20190062159A

Abstract

The present invention relates to a multi-purpose composition which comprises microRNA (miRNA) as an active ingredient so as to have the effect of wound treatment and skin improvement; particularly, to a composition which comprises, as an active ingredient, miRNA comprising a seed sequence represented by any one of base sequences SEQ ID: 1 to 9; an expression vector comprising same; or a transformant transformed by the expression vector.

Description

Composition for wound healing or skin improvement comprising MIRNA

The present invention relates to a composition comprising microRNAs (miRNAs) and having a variety of uses with wound healing and skin-improving effects.

miRNA is a small non-coding RNA composed of 18-25 nucleotides (nt), which binds to the 3'-untranslated region (UTR) of the target gene to regulate gene expression (Bartel DP, et al. , Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), intron, exon or intergenic region (Rodriguez A , et al., Genome Res 14: 1902-1910, 2004). First, miRNAs are transcribed by RNA polymerases into early miRNA molecules containing thousands of nucleotides (pri-miRNA). The pri-miRNA is then used as a microprocessor (DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8) to form approximately 70 nt trunk loop intermediates, known as miRNA precursors. (Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci USA A100: 9779-9784, 2003). The pre-miRNA is then transferred from the nucleus to the cytoplasm via exoportin-5 (Exportin-5, EXP5) and the cofactor Ran-GTP, where the pre-miRNA is expressed by RNase endonuclease Dicer 18-25 nt mature miRNA duplexes (Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev 28: 369-378, 2009). Mature miRNA duplexes are integrated as single-stranded RNA with Argonaute protein into an RNA-induced silencing complex (RISC), which induces either truncation or translational inhibition of the target mRNA (Diederichs S, et al., Cell 131: 1097-1108, 2007; Hammond SM, et al., Nature 404: 293-296,2000; Martinez et al., Cell 110: 563-574, 2002).

On the other hand, a wound is also called a wound, and it is divided into a blind spot, a blind spot, a blind spot, an acuity, a fissure, a blind spot, and a prospect according to its cause. Symptoms of a wound include pain, bleeding, and dysfunction. In the case of a wound, the body exhibits various physiological responses to healing it. In general, the degeneration and death process of injured cells leads to the leakage of the floating cells and tissue fluid from surrounding tissues, and the deposition of fibrils and the granulation tissue are formed to heal wounds.

In general, growth factors such as EGF (Epidermal Growth Factor), FGF (Fibroblast Growth Factor), TGF-α (Transforming Growth Factor-α), TGF-β and IGF- It is known to treat or promote wound healing.

However, even if a specific growth factor such as EGF is isolated and applied to clinical practice, it is difficult to expect satisfactory wound treatment or wound treatment promotion effect. In addition, when stem cells such as MSC are used directly, it is difficult to formulate cells while maintaining high cell survival rate, and it is still difficult to express the desired therapeutic effect in the same manner by showing various object deviations depending on the source of cells .

With the recent improvements in medical technology and public health benefits, an aging society is rapidly emerging. As a result, the quality of life is being improved and the desire for the maintenance of youth is increasing. Much research is underway in various areas to delay and prevent appearance, especially the aging that is first manifested in skin.

The skin consists of the epidermis, the dermis and the subcutaneous tissue. The outer skin of the skin consists of a stratified squamous epithelium, which acts as a protective barrier against the external environment. The epidermis is divided from the outside into stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum and stratum basale. The dermis is the layer between the epidermis and the subcutaneous tissue. It is divided into the papillary dermis and the reticular dermis. The dermis is composed of blood vessels, collagen, elastin fibers, pores, lipids, sebaceous glands, Sensory nerves, fibroblasts, and macrophages, and they occupy the largest portion of the skin.

The dermis consists mainly of collagen and elastin fibers, which play a role in supporting the skin. Therefore, when such a dermis is troubled, wrinkles occur and skin elasticity is lost and the skin ages. Collagen is known to play the most important role in skin regeneration, skin moisture content, wound healing and wrinkle improvement, and is produced from fibroblasts. Collagen has a function to contain a large amount of water, and serves to supply moisture to the dermis. When aging occurs, collagen's water-containing function is deteriorated and wrinkles are increased. Collagen also causes wound healing by filling the wound with continuous collagen production of fibroblasts when a wound is developed.

It is an object of the present invention to provide a composition for treating wounds having an excellent wound healing effect.

Another object of the present invention is to provide a composition for skin improvement which is excellent in skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement and aging prevention.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

The inventors of the present invention found that hsa-miR-328-3p, hsa-miR-6514-5p, hsa-miR-503-3p, hsa-miR-4665-5p, hsa- miRNAs of hsa-miR-6879-5p, hsa-miR-4484 and hsa-miR-619-5p are excellent in skin permeability and when absorbed into the skin, they can be used for wound healing, skin moisturization, skin whitening, , Wrinkle improvement, anti-aging, and the like, leading to the present invention.

According to an embodiment of the present invention, there is provided a miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a composition for improving or treating a wound comprising the transformant transformed with the expression vector as an active ingredient.

In the present invention, the nucleotide sequence (UGGCCCU) represented by SEQ ID NO: 1 may be a seed sequence of hsa-miR-328-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 10 (CUGGCCCUCUCUGCCCUUCCGU).

In the present invention, the nucleotide sequence (AUGGAGU) represented by SEQ ID NO: 2 may be a seed sequence of hsa-miR-6514-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 11 (UAUGGAGUGGACUUUCAGCUGGC).

In the present invention, the nucleotide sequence (GGGUAUU) represented by SEQ ID NO: 3 may be a seed sequence of hsa-miR-503-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 12 (GGGGUAUUGUUUCCGCUGCCAGG).

In the present invention, the nucleotide sequence (UGGGGGA) of SEQ ID NO: 4 may be a seed sequence of hsa-miR-4665-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 13 (CUGGGGGACGCGUGAGCGCGAGC).

In the present invention, the nucleotide sequence (GUGACUU) of SEQ ID NO: 5 may be a seed sequence of hsa-miR-6820-3p miRNA represented by the nucleotide sequence of SEQ ID NO: 14 (UGUGACUUCUCCCCUGCCACAG).

In the present invention, the nucleotide sequence (CUCCCUU) represented by SEQ ID NO: 6 may be a seed sequence of hsa-miR-4287 miRNA represented by the nucleotide sequence of SEQ ID NO: 15 (UCUCCCUUGAGGGCACUUU).

In the present invention, the nucleotide sequence (AGGGCAG) of SEQ ID NO: 7 may be a seed sequence of hsa-miR-6879-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 16 (CAGGGCAGGGAAGGUGGGAGAG).

In the present invention, the nucleotide sequence of SEQ ID NO: 8 (AAAGGCG) may be a seed sequence of hsa-miR-4484 miRNA represented by the nucleotide sequence of SEQ ID NO: 17 (AAAAGGCGGGAGAAGCCCCA).

In the present invention, the nucleotide sequence of SEQ ID NO: 9 (CUGGGAU) may be a seed sequence of hsa-miR-619-5p miRNA represented by the nucleotide sequence of SEQ ID NO: 18 (GCUGGGAUUACAGGCAUGAGCC).

The term " seed sequence " in the present invention means a nucleotide sequence of a partial region of a miRNA that binds with complete complementarity when a miRNA recognizes a target, And is a region that has a substantially effective function.

Accordingly, in the present invention, the miRNA may be a polynucleotide represented by any one of SEQ ID NOS: 1 to 9, or a miRNA including the polynucleotide. Preferably, the polynucleotide represented by any one of SEQ ID NOS: 1 to 9 is present in the form of a nucleic acid molecule which functions as a wound healing, wherein the total nucleic acid molecule has a length of 19 to 25 nt, more preferably 21, 22 or 23 nt Lt; RTI ID = 0.0 > miRNA < / RTI > More preferably, in the present invention, the miRNA is selected from the group consisting of (a) hsa-miR-328-3p, hsa-miR-6514-5p, hsa- One or more miRNAs selected from the group consisting of 6820-3p, hsa-miR-4287, hsa-miR-6879-5p, hsa-miR-4484 and hsa-miR-619-5p; And (b) a miRNA comprising the nucleotide sequence of any one of SEQ ID NOS: 1 to 9, wherein the nucleotide sequence is at least 80% homologous to the nucleotide sequence of (a), or at least 90% or at least 95% ; Or the like.

As described above, the miRNAs used in the present invention may be functionally equivalent to the miRNA nucleic acid molecule even if a functional equivalent of the nucleic acid molecule constituting the miRNA molecule, for example, a part of the base sequence of the miRNA nucleic acid molecule is modified by deletion, substitution or insertion And a variant capable of performing an equivalent action. For example, the miRNA of the present invention may exhibit at least 80% homology with the nucleotide sequence of each corresponding SEQ ID NO, and preferably at least 90%, more preferably at least 95%. Such homology can be readily determined by comparing the sequence of the nucleotide with the corresponding portion of the target gene using computer algorithms well known in the art, for example Align or BLAST algorithms.

Also, in the present invention, the miRNA may be a mature miRNA as described above, but may be a miRNA precursor, a miRNA precursor in the form of a primary miRNA (pri-miRNA) or a plasmid. However, in the present invention, the nucleic acid molecule constituting the miRNA precursor or the primary miRNA may have a length of 50 to 100 nt, more preferably 65 to 95 nt.

Also, in the present invention, the miRNA may exist in a single stranded or double stranded form. Although mature miRNA molecules are predominantly single stranded, precursor miRNA molecules may contain a partial self-complementary structure (e.g., a stem-loop structure) that can form double strands.

Also, at least one of the nucleic acid molecules constituting the miRNA of the present invention includes a phosphorothiolate structure in which a phosphate backbone structure is substituted with a sulfur element; DNA, a form substituted with PNA (petide nucleic acids) or LNA (locked nucleic acid) molecules; Or a form wherein the 2 ' hydroxyl group of the sugar is replaced by a methylated, methoxylated or fluorinated structure.

The miRNA of the present invention can be isolated or prepared using standard molecular biology techniques such as chemical synthesis methods or recombinant methods, or commercially available miRNAs can be used.

In the present invention, as described above, the miRNA nucleic acid molecule can be provided in a form contained in an expression vector.

The expression vectors of the invention preferably encode miRNAs of the invention in an expressible form. An " in an expressible form " in the present invention means that when the vector is introduced into a host cell, the vector expresses the molecule. Preferably, the vector may comprise regulatory elements necessary for expression of the miRNA. The vectors of the present invention may be used in the production of miRNAs of the invention, or may be used as active ingredients for direct wound healing or skin improvement.

The expression vectors of the present invention can be used to stably insert into the genome of a target cell (see Thomas KR & Capecchi MR, Cell 1987, 51: 503-12 for a description of homologous recombinant cassette vectors). See, for example, Wolff et al., Science 1990, 247: 1465-8, U.S. Patent 5,580,859; 5,589, 466; 5,804, 566; 5,739,118; 5,736,524; 5,679,647; And WO 98/04720. Examples of DNA-based delivery techniques include delivery of "naked DNA", facilitating (bupivicaine, polymer, peptide-mediated) delivery, cationic lipid complexes and particle- mediated ["gene gun"] or pressure-mediated delivery (see, for example, U.S. Patent No. 5,922,687).

In the present invention, the expression vector is preferably a non-viral vector or a viral vector. Preferably, the non-viral vector is a plasmid DNA. Examples of the viral vector include lentivirus, retrovirus, But are not limited to, adenovirus, herpes virus, and avipox virus vectors.

In addition, in the present invention, it is preferable that the expression vector further comprises a selection marker in order to facilitate selection of the transformed cells. Markers conferring selectable phenotypes such as, for example, drug resistance, resistance to nutritional requirements, cytotoxic agents or expression of surface proteins, such as green fluorescent protein, puromycin, neomycin, hygromycin, Histidine dehydrogenase (hisD) and guanine phosphoribosyltransferase (Gpt).

In the present invention, the expression vector may be introduced into a host cell and transformed into a transformant.

In the present invention, the host cell is preferably a somatic cell of a mammal including a human. Preferably, the host cell is a cell of a tissue site intended for human treatment, for example, a skin cell, but is not limited thereto.

Also, in the present invention, the method for introducing the expression vector into the host cell may include a method of introducing the expression vector into the host cell by using a method such as G-fectin, Mirus TrasIT-TKO lipophilic reagent, lipofectin, lipofectamine, cellfectin, But are not limited to, cationic polymers, cationic micelles, cationic emulsions, or delivery reagents including liposomes, or may be introduced into cells or conjugated with biocompatible polymers such as polyethylene glycol to increase intracellular absorption.

The composition of the present invention may contain a cell culture containing the miRNA as an active ingredient, or the miRNA may be isolated from the cell culture and included as an active ingredient.

In the present invention, the cell may be a stem cell. Here, the type of the stem cells is not limited. Preferably, the stem cells may be fat, bone marrow, umbilical cord or cord blood-derived stem cells, and more preferably, adipose-derived stem cells. The type of adipose-derived stem cells is not limited as long as it does not cause the risk of infection by a pathogen and does not cause an immune rejection reaction, but it may be most preferably a stem cell derived from human adipose.

In addition, in the present invention, the culture medium used for the cell culture is a culture medium containing in vivo an essential component for growth and proliferation of cells such as sugar, amino acid, various nutrients, serum, growth factor, &Lt; / RTI > and the like. Mediums that can be used in the present invention include DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI1640, DMEM / F-10 (Dulbecco's Modified Eagle's Medium: Nutrient Mixture F- , Α-MEM (α-Minimal Essential Medium), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Isocove's Modified Dulbecco's Medium) and KnockOut DMEM , Or an artificially synthesized medium such as, but not limited to, < RTI ID = 0.0 >

In the present invention, the method for separating miRNA from the cell culture is not particularly limited and may be carried out by a method generally used in the art. For example, a method of separating miRNA using a phenol compound or a method using a column ) Can be used to perform the separation.

In addition, the composition of the present invention may contain an exosome containing the miRNA as an active ingredient, or the miRNA may be isolated from the exosome and include the miRNA as an active ingredient.

In the present invention, the term "exosome" refers to a small follicle having a membrane structure secreted from various cells, and is also defined as a nanobeicle. The exosome has a diameter of about 30 to 1,000 nm, preferably an average diameter of 100 to 300 nm, and refers to a follicle which is fused with the plasma membrane and released into the extracellular environment.

In the present invention, the exosome may be derived from a stem cell culture, and the type of the stem cell is not limited, but it may be a fat, a bone marrow, an umbilical cord or a cord blood-derived stem cell, Derived stem cells. The type of adipose-derived stem cells is not limited as long as it does not cause the risk of infection by a pathogen and does not cause an immune rejection reaction, but it may be most preferably a stem cell derived from human adipose.

In the present invention, the method for isolating exosome from the cell culture is not particularly limited and may be carried out by a method generally used in the art. For example, in the culture medium, centrifugation, ultracentrifugation, Separation by gel filtration chromatography, pre-flow electrophoresis, capillary electrophoresis, separation using a polymer, and the like, or a combination thereof, preferably centrifugation / ultracentrifugation . At this time, the centrifugation / ultracentrifugation is preferably carried out at 4 ° C, 3,000-100,000 g for 10 minutes to 5 hours.

In the present invention, the method for isolating miRNA from the exosome is not particularly limited and may be carried out by a method generally used in the related art. For example, the exosome may be hemolyzed using a hemolysis reagent, , Or a method of separating using a column. The miRNA, expression vector or transformant provided by the present invention can effectively treat skin wounds.

In the present invention, the above-mentioned " comprising as an active ingredient " may mean an effective amount of the skin wound treatment effective.

In the present invention, the miRNA can be used for various purposes such as a pharmaceutical composition, a cosmetic composition, a skin external preparation, a food composition, etc. due to the skin wound healing activity.

According to another embodiment of the present invention, there is provided a miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with the expression vector as an active ingredient.

In the present invention, the term " skin improvement " means a function of improving skin conditions such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement or aging prevention.

In the present invention, the miRNA may be a polynucleotide represented by any one of SEQ ID NOS: 1 to 9, or a miRNA including the polynucleotide. Preferably, a polynucleotide represented by any one of SEQ ID NOS: 1 to 9 is present in the form of a nucleic acid molecule having a skin improving function such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement or aging prevention , And the total nucleic acid molecule may be in the form of a mature miRNA of 19 to 25 nt, more preferably 21, 22 or 23 nt in length. More preferably, in the present invention, the miRNA is selected from the group consisting of (a) hsa-miR-328-3p, hsa-miR-6514-5p, hsa- One or more miRNAs selected from the group consisting of 6820-3p, hsa-miR-4287, hsa-miR-6879-5p, hsa-miR-4484 and hsa-miR-619-5p; And (b) an miRNA comprising the nucleotide sequence of any one of SEQ ID NOS: 1 to 9, wherein the miRNA comprises a nucleotide sequence having 80% or more, 90% or more, or 95% or more homology with the nucleotide sequence of (a) Or the like.

The expression vectors of the present invention can be used to stably insert into the genome of a target cell (see Thomas KR & Capecchi MR, Cell 1987, 51: 503-12 for a description of homologous recombinant cassette vectors). See, for example, Wolff et al., Science 1990, 247: 1465-8, U.S. Patent 5,580,859; 5,589, 466; 5,804, 566; 5,739,118; 5,736,524; 5,679,647; And WO 98/04720. Examples of DNA-based delivery techniques include delivery of "naked DNA", facilitating (bupivicaine, polymer, peptide-mediated) delivery, cationic lipid complexes and particle- mediated delivery (see, for example, U.S. Patent No. 5,922,687). In the present invention, the expression vector is a non-viral vector Or a viral vector. Preferably, the non-viral vector is a plasmid DNA. Examples of the viral vector include a lentivirus, a retrovirus, an adenovirus, a herpes virus ) And an avipox virus vector, but the present invention is not limited thereto.

In the present invention, the exosome has a diameter of about 30 to 1,000 nm, preferably an average diameter of 100 to 300 nm, and refers to a follicle which is fused with the plasma membrane and released into the extracellular environment

In the present invention, the method for separating exosome from the cell culture is not particularly limited and may be carried out by a method generally used in the related art. For example, in the culture, centrifugation, ultracentrifugation, Separation by gel filtration, gel filtration chromatography, pre-flow electrophoresis, capillary electrophoresis, separation using a polymer, and the like, or a combination thereof, preferably centrifugation / ultracentrifugation. At this time, the centrifugation / ultracentrifugation is preferably carried out at 4 ° C, 3,000-100,000 g for 10 minutes to 5 hours.

In addition, the method for isolating miRNA from the exosome in the present invention is not particularly limited and may be carried out by a method commonly used in the related art. For example, a method of hemolyzing exosomes using a hemolysis reagent, A method of separating using a system compound or a method of separating using a column can be performed.

The miRNA, expression vector or transformant provided by the present invention has excellent skin permeability and is excellent in skin improving effect upon absorption, and is free from irritation or side effects to the skin and is safe. Herein, the skin improving effect may be at least one of skin protection, skin condition improvement, skin whitening, skin elasticity improvement, prevention or improvement of skin aging and wrinkle, reduction of inflammation reaction of skin, improvement of skin barrier function, And can have all the beneficial effects on the skin such as regeneration ability, antioxidant ability, collagen synthesis promoting ability and the like.

In the present invention, the term " comprising as an active ingredient " means an effective amount of an effective amount capable of exhibiting a skin improving effect, such as an anti-inflammatory activity, collagen synthesis associated with wrinkle- It can mean.

In the present invention, the miRNA may be used for various purposes such as pharmaceutical composition, cosmetic composition, external preparation for skin and food composition due to the skin improving activity.

In addition, the miRNA in the present invention can be very usefully used as a composition for a filler for cosmetic or therapeutic purposes, and more particularly, as a composition for injecting a filler due to the skin improving activity. As a specific example, Compositions for substitution, filling wrinkles, compositions for increasing remodeling of the face or lip volume, rehydration of the skin by mesotherapy, ), And the like.

In the present invention, " treatment " and " improvement " may include without limitation any act that improves or alleviates wound or skin condition using the composition of the present invention.

The treatment concentration of the miRNA in the composition for various uses of the present invention is not particularly limited, but may be 1 nM to 1 μM, preferably 1 nM to 100 nM, more preferably 1 nM to 10 nM.

For the expression vector comprising the miRNA of the invention More specifically, it contains 0.01 to 500 mg, and containing 0.1 to 300 mg and more specifically, in the case of a recombinant virus comprising the miRNA of the invention, in particular 10 ³ to 10 ¹² IU (10-10 ¹⁰ PFU), more specifically 10 ⁵ to 10 ¹⁰ IU, but is not limited thereto.

In addition, in the case of the transformant containing the miRNA of the present invention, specifically, it contains 10 ³ to 10 ⁸ , more specifically, 10 ⁴ to 10 ⁷ , but is not limited thereto.

The effective dose of the composition containing the miRNA-containing expression vector or the transformant as an active ingredient of the present invention is 0.05 to 12.5 mg / kg in the case of the vector per 1 kg of body weight, 10 ⁷ to 10 for the ¹¹ virus-like particles (10 ⁵ to 10 ⁹ IU) / ㎏, cells 10 ³ to 10 ⁶ cells / ㎏ and, specifically, if the vector is 0.1 to 10 ㎎ / ㎏, when the recombinant virus is 10 ⁸ to 10 in the case of ¹⁰ particles (10 ⁶ to 10 ⁸ IU) / ㎏, cells, and 10 ² to 10 ⁵ cells / ㎏, it may be administered twice or three times a day. Such composition is not necessarily limited to this, and may vary depending on the condition of the patient and the severity of the disease.

In the case of the exosome containing the miRNA of the present invention, it may be contained in an amount of 0.001 to 1000 μg / ml, 0.01 to 100 μg / ml, or 0.1 to 50 μg / ml based on the amount of protein, 10 ⁸ / ml to 1 X 10 ¹⁴ atoms / ml, 1 X 10 ⁹ number / ml to 1 X 10 ¹³ atoms / ml, 1 X 10 ¹⁰ atoms / ml to 1 X 10 ¹² atoms / be contained in an amount of ml But is not limited thereto.

In addition, in the case of a cell culture containing the miRNA of the present invention, it may be contained in an amount of 0.001 to 1000 μg / ml, 0.01 to 100 μg / ml, or 0.1 to 50 μg / ml, based on the amount of protein, but is not limited thereto.

In the present invention, the pharmaceutical composition may be in the form of a capsule, a tablet, a granule, an injection, an ointment, a powder or a drink, and the pharmaceutical composition may be a human.

The pharmaceutical composition of the present invention may be formulated in the form of oral preparations such as powders, granules, capsules, tablets, aqueous suspensions, etc., external preparations, suppositories and sterilized injection solutions according to a conventional method, . The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be a binder, a lubricant, a disintegrant, an excipient, a solubilizing agent, a dispersing agent, a stabilizer, a suspending agent, a coloring matter, a perfume or the like in the case of oral administration. A solubilizing agent, an isotonic agent, a stabilizer and the like may be mixed and used. In the case of topical administration, a base, an excipient, a lubricant, a preservative and the like may be used. Formulations of the pharmaceutical compositions of the present invention may be prepared in a variety of ways by mixing with a pharmaceutically acceptable carrier as described above. For example, oral administration may be in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. In the case of injections, they may be formulated in unit dosage ampoules or in multiple dosage forms have. Other, solutions, suspensions, tablets, capsules, sustained-release preparations and the like.

Examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltoditol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil. Further, it may further include a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent, an antiseptic, and the like.

The route of administration of the pharmaceutical composition according to the present invention may be, but is not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, , Sublingual or rectal. Oral or parenteral administration is preferred.

In the present invention, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical compositions of the present invention may also be administered in the form of suppositories for rectal administration.

The pharmaceutical composition of the present invention may be administered orally or parenterally depending on various factors including the activity of the specific compound used, age, weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination, And the dose of the pharmaceutical composition may be appropriately selected by a person skilled in the art depending on the condition of the patient, the body weight, the degree of disease, the mode of administration, the route of administration and the period of time, and is preferably from 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg. The administration may be carried out once a day or divided into several times. The dose is not intended to limit the scope of the invention in any way. The pharmaceutical composition according to the present invention can be formulated into pills, dragees, capsules, solutions, gels, syrups, slurries, suspensions.

The cosmetic composition according to the present invention may be used in cosmetics, nutritional lotions, nutritional essences, massage creams, cosmetic bath additives, body lotions, body milks, bath oils, baby oils, baby powders, shower gels, shower creams, sunscreen lotions, Face and Body Cream, Face and Body Cream, Skin Whitening Cream, Hand Lotion, Hair Lotion, Cosmetic Cream, Jasmine Oil, Face Cream, Skin Cream, Skin Cream, Sunscreen Cosmetics, Bath soap, water soap, soap, shampoo, hand cleanser, medicinal soap {non-medical use}, cream soap, facial wash, whole body cleanser, scalp cleanser, hair rinse, cosmetic soap, tooth whitening gel, . &Lt; / RTI > To this end, the composition of the present invention may further comprise a solvent commonly used in the production of a cosmetic composition, or a suitable carrier, excipient or diluent.

For example, water, saline solution, DMSO, or a combination thereof may be used. Examples of the carrier, excipient or diluent include purified water, oil, wax But are not limited to, fatty acids, fatty acid alcohols, fatty acid esters, surfactants, humectants, thickeners, antioxidants, viscosity stabilizers, chelating agents, buffers, lower alcohols and the like. Further, if necessary, it may contain a whitening agent, a moisturizing agent, a vitamin, an ultraviolet screening agent, a perfume, a dye, an antibiotic, an antibacterial agent, and an antifungal agent.

As the oil, hydrogenated vegetable oil, castor oil, cottonseed oil, olive oil, palm oil, jojoba oil and avocado oil may be used. Examples of the wax include wax, wax, carnauba, candelilla, montan, ceresin, liquid paraffin, Can be used.

As the fatty acid, stearic acid, linoleic acid, linolenic acid and oleic acid may be used. As the fatty acid alcohol, cetyl alcohol, octyldodecanol, oleyl alcohol, panthenol, lanolin alcohol, stearyl alcohol and hexadecanol may be used As fatty acid esters, isopropyl myristate, isopropyl palmitate, and butyl stearate may be used. As the surfactant, a cationic surfactant, an anionic surfactant and a nonionic surfactant known in the art can be used, and a surfactant derived from a natural material is preferably used.

In addition, it may contain a hygroscopic agent, a thickening agent, an antioxidant and the like widely known in the field of cosmetics, and the kind and amount thereof are well known in the art.

The food composition of the present invention may be prepared in the form of various foods such as beverage, gum, tea, vitamin complex, powder, granule, tablet, capsule, confection, rice cakes, bread and the like. Since the food composition of the present invention is composed of a plant extract having little toxicity and side effects, it can be safely used for prolonged use even for prophylactic purposes.

When the miRNA, expression vector or transformant of the present invention is contained in the food composition, the amount thereof may be added in a proportion of 0.1 to 50% of the total weight.

Here, when the food composition is prepared in a beverage form, there are no particular limitations other than those containing the food composition at the indicated ratios and may contain various flavors or natural carbohydrates such as ordinary beverages as an additional ingredient. That is, natural carbohydrates include monosaccharides such as glucose, disaccharides such as fructose, sucrose and the like and sugar sugars such as polysaccharide, dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol can do. Examples of the above-mentioned flavors include natural flavors (such as tau martin and stevia extract (for example, rebaudioside A and glycyrrhizin) and synthetic flavors (for example, saccharine and aspartame).

In addition, the food composition of the present invention can be used as a flavoring agent such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants, pectic acid and its salts, alginic acid and its salts, , a pH adjusting agent, a stabilizer, a preservative, a glycerin, an alcohol, a carbonating agent used in a carbonated drink, and the like.

These components may be used independently or in combination. The proportion of such additives is not so critical, but is generally selected in the range of 0.1 to about 50 parts by weight per 100 parts by weight of the composition of the present invention.

According to another embodiment of the present invention, there is provided a method for treating a wound, comprising administering to a subject an miRNA, an expression vector or a transformant, or a composition for improving or treating a wound provided by the present invention, Or a method of treatment.

In the present invention, the above-mentioned " object of interest " means an individual having a wound on skin or having a high possibility of developing the skin.

In the method of the present invention, a cell culture containing the miRNA may be administered to the desired individual, or the miRNA may be isolated from the cell culture.

In addition, in the method of the present invention, the exosome containing the miRNA may be administered to the subject, or the miRNA may be isolated from the exosome and administered.

In the present invention, the miRNA, expression vector, transformant, cell culture, exosome, and composition for improving or treating wound overlap with those described above and will not be described in detail below.

According to another embodiment of the present invention, there is provided a skin improvement method comprising administering to a subject an miRNA, an expression vector or a transformant, or a skin improving composition provided by the present invention provided by the present invention .

In the present invention, the above-mentioned "object" means an individual requiring improvement of the skin condition such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement or aging prevention.

In addition, in the method of the present invention, the exosome containing the miRNA may be administered to the subject, or the miRNA may be isolated from the exosome and administered. In the present invention, the miRNA, the expression vector, the transformant, the cell culture, the exosome and the composition for improving skin are overlapped with each other as described above, and detailed description will be omitted.

The dosage, schedule and route of administration of the miRNA, expression vector or transformant provided herein can be determined according to the size and condition of the individual, and according to standard pharmaceutical practice. Exemplary routes of administration include intravenous, intraarterial, intraperitoneal, intrapulmonary, intravascular, intramuscular, intratracheal, subcutaneous, intrathecal, intrathecal, or transdermal.

The dosage of the miRNA, expression vector or transformant administered to the subject in the method of the present invention may vary depending on, for example, the particular type of miRNA, expression vector or transformant administered, the route of administration, It can vary depending on the particular type of skin and stage. The amount should be sufficient to bring about the desired response, such as a therapeutic response to the wound or skin improvement, without severe toxic or adverse events. The effect can be scaled using standard methods such as in vitro assays with purified enzyme, cell-based assays, animal models or human experiments.

For example, in the method of the present invention, the administration concentration of the miRNA is not particularly limited, but may be 1 nM to 1 μM, preferably 1 nM to 100 nM, more preferably 1 nM to 10 nM .

In the method of the present invention, the expression vector containing the miRNA may be specifically administered in an amount of 0.01 to 500 mg, more specifically, in an amount of 0.1 to 300 mg, In the case of a recombinant virus, specifically, it may be administered in an amount of 10 ³ to 10 ¹² IU (10 to 10 ¹⁰ PFU), more specifically, in an amount of 10 ⁵ to 10 ¹⁰ IU, but is not limited thereto.

In addition, in the case of a transformant containing the miRNA of the present invention, it may be administered in an amount of 10 ³ to 10 ⁸ , more specifically, in an amount of 10 ⁴ to 10 ⁷ , but is not limited thereto .

In the method of the present invention, the effective dose of the miRNA-containing expression vector or the transformant is 0.05 to 12.5 mg / kg in the case of the vector per 1 kg of body weight, 10 ⁷ to 10 ¹¹ viral particles in the case of the recombinant virus 10 ⁵ to 10 ⁹ IU) / ㎏, if the cells 10 ³ to 10 ⁶ cells / ㎏ and, specifically, if the vector is 0.1 to 10 ㎎ / ㎏, when the recombinant virus is 10 ⁸ to 10 ¹⁰ particles (10 ⁶ to 10 ⁸ IU) / kg, and in the case of cells, 10 ² to 10 ⁵ cells / kg, and can be administered 2 to 3 times a day. Such composition is not necessarily limited to this, and may vary depending on the condition of the patient and the severity of the disease.

In the method of the present invention, the miRNA, expression vector or transformant may be respectively formulated in the form of oral preparations such as powders, granules, capsules, tablets and aqueous suspensions, external preparations, suppositories and sterilized injection solutions, .

In addition, in the present invention, a pharmaceutically acceptable carrier may be administered together with the miRNA, the expression vector or the transformant. The pharmaceutically acceptable carrier may be a binder, a lubricant, a disintegrant, an excipient, a solubilizing agent, a dispersing agent, a stabilizer, a suspending agent, a coloring matter, a perfume or the like in the case of oral administration. A solubilizing agent, an isotonic agent, a stabilizer and the like may be mixed and used. In the case of topical administration, a base, an excipient, a lubricant, a preservative and the like may be used. In addition, in the present invention, the secretory protease can be mixed with a pharmaceutically acceptable carrier and variously manufactured. For example, oral administration may be in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. In the case of injections, they may be formulated in unit dosage ampoules or in multiple dosage forms have. Other, solutions, suspensions, tablets, capsules, sustained-release preparations and the like.

The miRNA, expression vector or transformant provided by the present invention promotes cell migration to a wound site and has excellent wound healing or wound healing promoting activity.

In addition, the miRNA, expression vector or transformant provided by the present invention is excellent in skin permeability and has excellent skin improving effects such as skin moisturization, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement and aging prevention In addition, there is no stimulation or side effects on the skin and it is safe.

FIG. 1A is a graph showing changes in mRNA expression level of type 1 collagen (Collagen type 1), a skin regeneration-associated gene, in human embryo-derived fibroblasts treated with different concentrations of exosomes derived from human adipose- .

Fig. 1B shows the result of measuring the change in mRNA expression level of Elastin, a skin regeneration-related gene, after treating human fibroblast-derived fibroblasts derived from human adipose-derived stem cells at different concentrations in Example 1 will be.

FIG. 1c shows the results of culturing human fibroblast-derived fibroblasts treated with human fat-derived stem cell-derived exosomes at different concentrations in Example 1, and then measuring the mRNA expression level of keratinocyte growth factor (KGF) And the results are shown in FIG.

FIG. 1D shows the results of measurement of changes in the level of mRNA expression of CD34, a skin regeneration-associated gene, in human embryo-derived fibroblasts treated with different concentrations of exosomes derived from human adipose-derived stem cells in Example 1.

FIG. 1 (e) is a graph showing changes in mRNA expression level of vascular endothelial growth factor (VEGF) associated with skin regeneration after treating human fibroblast-derived fibroblasts from human adipose-derived stem cells at different concentrations in Example 1 And the results are shown in FIG.

Fig. 2 shows the result of examining the migration rate of the human dermis-derived fibroblasts treated with human adipose-derived stem cell-derived exosomes at different concentrations in Example 1. Fig.

Fig. 3 shows the results of examining the ratio of cells belonging to each cell cycle after treating human fibroblast-derived fibroblasts from human adipose-derived stem cell-derived exosomes at different concentrations in Example 1. Fig.

Fig. 4 shows the results of comparing the expression levels of miRNAs in human adipose-derived stem cells and the exosome secreted therefrom using the microarray in Example 2. Fig.

FIG. 5 shows the results of classification of target genes of 10 miRNAs whose expression levels were increased in exosomes secreted from human adipose-derived stem cells in Example 2. FIG.

FIG. 6 shows the expression levels of hsa-miR-619-5p, hsa-miR-4484 and hsa-miR-6879-5p and their associated genes in exosomes secreted from human adipose-derived stem cells in Example 2 The results are as follows.

7 is a graph showing the effect of hsa-miR-328-3p (P1), hsa-miR-6514-5p (P2), hsa-miR-503-3p (P3), hsa-miR Hsa-miR-4484 (P8) and hsa-miR-4279 (P6), hsa-miR- miR-619-5p (P9). The results are shown in Fig.

Fig. 8A is a graph showing the effect of hsa-miR-328-3p (P1), hsa-miR-4287 (P6), hsa-miR-6879-5p (Collagen I), which is a gene related to skin regeneration, after treatment with hsa-miR-619-5p (P8) and hsa-miR-619-5p (P9).

8B is a graph showing the effect of hsa-miR-328-3p (P1), hsa-miR-4287 (P6), hsa-miR-6879-5p (F8) and hsa-miR-619-5p (P9), and then the change in mRNA expression level of fibroblethectin, a skin regeneration related gene, was measured.

Fig. 8C is a graph showing the effect of hsa-miR-328-3p (P1), hsa-miR-4287 (P6), hsa-miR-6879-5p MRNA expression level of basic fibroblast growth factor (bFGF), a gene related to skin regeneration, after treatment with hsa-miR-619-5p (P8) and hsa-miR-619-5p (P9).

(Hs-miR-4287 (P6), hsa-miR-6879-5p (P7), hsa-miR-4484 MRNA expression level of matrix metalloproteinase-1 (MMP1), a gene related to skin regeneration, after treatment with hsa-miR-619-5p (P8) and hsa-miR-619-5p .

9 is a graph showing the effect of hsa-miR-328-3p (P1), hsa-miR-4287 (P6), hsa-miR-6879-5p (P8) and hsa-miR-619-5p (P9).

10 is a graph showing the effect of hsa-miR-328-3p (P1), hsa-miR-4287 (P6), hsa-miR-6879-5p (P8) and hsa-miR-619-5p (P9), and the number of migrated cells was measured.

Hereinafter, preferred embodiments of the present invention will be described. However, the embodiments of the present invention can be modified into various other forms, and the scope of the present invention is not limited to the embodiments described below. Further, the embodiments of the present invention are provided to more fully explain the present invention to those skilled in the art.

실시예 Example

[Example 1] Isolation of human adipose-derived stem cell exosomes

The human adipose-derived stem cell culture broth was centrifuged, and only the supernatant was recovered, and the exosome was separated therefrom. Transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA) showed typical exosomes with a diameter of 70-150 nm. Thereafter, it was confirmed that exosomal markers HSP70, CD63 and CD9 were expressed in the exosomes, unlike the fat-derived stem cell lysate through Western blotting. Analysis by flow cytometry showed that the exosomes were positive for CD9, CD63 and CD81.

Next, it was confirmed that the components of the exosomes could be transferred to human dermal fibroblasts (HDFs). Specifically, the human dermis-derived fibroblasts were co-cultured with the obtained PKH26-labeled exosomes for 24 hours. As a result, it was confirmed that the red fluorescence of PKH26 was present in the cytoplasm of the human dermis-derived fibroblasts, And it was found that the cells migrated into the human dermis - derived fibroblasts.

The human adipose-derived stem cell-derived exosomes obtained in the above-described manner were treated with the above-obtained human fibroblasts-derived fibroblasts in different amounts, and quantitated real-time PCR was carried out to determine the type 1 collagen type 1), elastin, keratinocyte growth factor (KGF), CD34 and vascular endothelial growth factor (VEGF). As shown in FIG. 1, It was confirmed that the level of expression of the gene was increased in proportion to the amount of the additive.

Furthermore, when the human adipose-derived stem cell-derived exosomes obtained in the above-described human dermis-derived fibroblasts were treated with 5 g / mL and 10 g / mL of the obtained human adipose, It was confirmed that the proliferation rate of the human dermis-derived fibroblast was remarkably increased.

The human dermis-derived fibroblasts were treated with the above-obtained human adipose-derived stem cell-derived exosomes, and the migration rate of the human dermis-derived fibroblasts was examined. As a result, as shown in FIG. 2, It was confirmed that the migration of fibroblasts significantly increased.

Similarly, the obtained human adipose-derived stem cell-derived exosomes were treated with the obtained human dermis-derived fibroblasts, and the cell cycle was analyzed using FACS. As a result, as shown in FIG. 3, And the ratio was remarkably increased.

[Example 2] Differences in miRNAs between human adipose-derived stem cells and exosomes secreted therefrom

The expression levels of microRNAs in the human adipose-derived stem cells and the exosome secreted therefrom obtained in Example 1 were analyzed using a microarray. As shown in FIG. 4, miRNAs differentially expressed in human adipose-derived stem cells and exosomes were selected (> 2-folds), indicating that 292 miRNA expression levels were different among 333 miRNAs . More specifically, unlike the human adipose-derived stem cells, 199 miRNA expression levels were increased in exosomes and 93 miRNA expression levels were decreased.

MiRNAs with different expression levels were identified by function according to miRTarBase ( http: //mirtarbase.mbc.nctu.edu.tw/ ). Representatively, 718 valid gene targets for 10 miRNAs with increased expression levels were classified based on gene ontology (GOTERM_BP_FAT) and enrichment EASE score <0.05 (FIG. 5).

The expression levels of hsa-miR-619-5p, hsa-miR-4484, and hsa-miR-6879-5p in miRNAs expressing the expression level in exosomes were analyzed and the schematic diagram thereof is shown in Fig. . As shown in FIG. 6, it was found that the exosomes isolated from adipose-derived stem cells inhibit genes including NPM1, PDCD4, CCL5 and NUP62, thereby promoting the proliferation of dermal fibroblasts, I could.

That is, the miRNAs of hsa-miR-619-5p, hsa-miR-4484 and hsa-miR-6879-5p according to the present invention have excellent wound healing and skin improving effects.

[Example 3] Confirmation of skin improvement effect of miRNA (1)

Nine miRNAs represented by the nucleotide sequences shown in Table 1 below were synthesized. 3,000 human dermal fibroblasts (HDF) were inoculated into DMEM medium containing 1% FBS, and then lipofectamine was used to infect each of the nine miRNAs shown in Table 1 at a concentration of 2 nM And the cell survival rate (proliferation rate relative to miR-CT) was measured using CCK assay after 48 hours. The results are shown in Table 2 and FIG. 7, respectively.

구분division	miRNA 종류miRNA type	염기서열Base sequence
P1P1	hsa-miR-328-3phsa-miR-328-3p	5'-CUGGCCCUCUCUGCCCUUCCGU-3'(서열번호 10)5'-CUGGCCCUCUCUGCCCUUCCGU-3 '(SEQ ID NO: 10)
P2P2	hsa-miR-6514-5phsa-miR-6514-5p	5'-UAUGGAGUGGACUUUCAGCUGGC-3'(서열번호 11)5'-UAUGGAGUGGACUUUCAGCUGGC-3 '(SEQ ID NO: 11)
P3P3	hsa-miR-503-3phsa-miR-503-3p	5'-GGGGUAUUGUUUCCGCUGCCAGG-3'(서열번호 12)5'-GGGGUAUUGUUUCCGCUGCCAGG-3 '(SEQ ID NO: 12)
P4P4	hsa-miR-4665-5phsa-miR-4665-5p	5'-CUGGGGGACGCGUGAGCGCGAGC-3'(서열번호 13)5'-CUGGGGGACGCGUGAGCGCGAGC-3 '(SEQ ID NO: 13)
P5P5	hsa-miR-6820-3phsa-miR-6820-3p	5'-UGUGACUUCUCCCCUGCCACAG-3'(서열번호 14)5'-UGUGACUUCUCCCCUGCCACAG-3 '(SEQ ID NO: 14)
P6P6	hsa-miR-4287hsa-miR-4287	5'-UCUCCCUUGAGGGCACUUU-3'(서열번호 15)5'-UCUCCCUUGAGGGCACUUU-3 '(SEQ ID NO: 15)
P7P7	hsa-miR-6879-5phsa-miR-6879-5p	5'-CAGGGCAGGGAAGGUGGGAGAG-3'(서열번호 16)5'-CAGGGCAGGGAAGGUGGGAGAG-3 '(SEQ ID NO: 16)
P8P8	hsa-miR-4484hsa-miR-4484	5'-AAAAGGCGGGAGAAGCCCCA-3'(서열번호 17)5'-AAAAGGCGGGAGAAGCCCCA-3 '(SEQ ID NO: 17)
P9P9	hsa-miR-619-5phsa-miR-619-5p	5'-GCUGGGAUUACAGGCAUGAGCC-3'(서열번호 18)5'-GCUGGGAUUACAGGCAUGAGCC-3 '(SEQ ID NO: 18)

구분division	miRNA 종류miRNA type	세포 증식률(%)Cell proliferation (%)
P1P1	hsa-miR-328-3p miRNAhsa-miR-328-3p miRNA	4040
P2P2	hsa-miR-6514-5p miRNAhsa-miR-6514-5p miRNA	2626
P3P3	hsa-miR-503-3p miRNAhsa-miR-503-3p miRNA	2727
P4P4	hsa-miR-4665-5phsa-miR-4665-5p	3535
P5P5	hsa-miR-6820-3phsa-miR-6820-3p	2525
P6P6	hsa-miR-4287hsa-miR-4287	4949
P7P7	hsa-miR-6879-5phsa-miR-6879-5p	3131
P8P8	hsa-miR-4484hsa-miR-4484	2727
P9P9	hsa-miR-619-5phsa-miR-619-5p	2929

As shown in Table 2 and FIG. 7, when the miRNA according to the present invention was treated with the dermal fibroblast, the proliferation rate of the dermal fibroblast was significantly increased.

[Example 4] Confirmation of skin improvement effect of miRNA (2)

100,000 human dermal fibroblasts (HDF) were inoculated into DMEM serum-free medium, and then 9 kinds of miRNAs synthesized in the above Table 1 in Example 3 were cultured using lipofectamine 2000 (lipofectamine 2000) 2 nM. &Lt; / RTI > After 24 hours, only mRNA was extracted and cDNA was synthesized. Collagen I, fibronectin, basic fibroblast growth factor (bFGF), and matrix metalloproteinase-1 (bFGF), which are genes associated with skin regeneration shown in Table 3 below ; MMP1) primers and amplified with Real-Time PCR system. The quantification of the amplified gene was calculated by Delta-Delta-Ct (ddCt) value. All the samples were leveled by the cDNA amplification result of the housekeeping gene, GAPDH, and the expression level was analyzed. .

프라이머primer	올리고 시퀀스 Oligo sequence

	제1형 콜라겐Type 1 collagen	정방향Forward	5'-GTGGCCATCCAGCTGACC-3'5'-GTGGCCATCCAGCTGACC-3 '
역방향Reverse	제1형 콜라겐Type 1 collagen	5'-AGTGGTAGGTGATGTTCTGGGAG-3'5'-AGTGGTAGGTGATGTTCTGGGAG-3 '
피브로넥틴Fibronectin	정방향Forward	5'-GCCAGATGATGAGCTGCA C-3'5'-GCCAGATGATGAGCTGCA C-3 '
피브로넥틴Fibronectin	역방향Reverse	5'-GAGCAAATGGCACCGAGATA-3'5'-GAGCAAATGGCACCGAGATA-3 '
bFGFbFGF	정방향Forward	5'-AGAGCGACCCTCACATCAAG-3'5'-AGAGCGACCCTCACATCAAG-3 '
bFGFbFGF	역방향Reverse	5'-ACTGCCCAGTTCGTTTCAGT-3'5'-ACTGCCCAGTTCGTTTCAGT-3 '
MMP1MMP1	정방향Forward	5'-CCTAGTCTATTCATAGCTAATCAAGAGGATGT-3'5'-CCTAGTCTATTCATAGCTAATCAAGAGGATGT-3 '
MMP1MMP1	역방향Reverse	5'-AGTGGAGGAAAGCTGTGCATAC-3'5'-AGTGGAGGAAAGCTGTGCATAC-3 '
GAPDHGAPDH	정방향Forward	5'-TTAGGAAAGCCTGCCGGTGA-3'5'-TTAGGAAAGCCTGCCGGTGA-3 '
GAPDHGAPDH	역방향Reverse	5'-GACTGTGGTCATGAGTCCTTCC-3'5'-GACTGTGGTCATGAGTCCTTCC-3 '

As shown in FIG. 8, when the miRNA according to the present invention was treated with the skin fibroblast, the level of expression of collagen I, fibronectin, bFGF and MMP1, which are genes related to skin regeneration, I could confirm.

[Example 5] Confirmation of skin improvement effect of miRNA (3)

5,000 cells / well of human dermal fibroblast (HDF) were inoculated into DMEM serum-free medium containing 1% FBS in a 96-well Cell Migration Assay plate, Each of the nine miRNAs synthesized in Table 1 in Example 3 was introduced into the cells at a concentration of 2 nM using 2000 lipofectamine 2000. After 48 hours, the cells were photographed using IN Cell Developer (1.9.3), the results are shown in FIG. 9, and the number of cells migrated using IN Cell Analyzer 2000 was measured. The results are shown in FIG. 10 The cell migration rate was calculated, and the results are shown in Table 4.

구분division	miRNA 종류miRNA type	이주율(%)Migration rate (%)
P1P1	hsa-miR-328-3p miRNAhsa-miR-328-3p miRNA	3939
P6P6	hsa-miR-4287hsa-miR-4287	6666
P7P7	hsa-miR-6879-5phsa-miR-6879-5p	5353
P8P8	hsa-miR-4484hsa-miR-4484	2323
P9P9	hsa-miR-619-5phsa-miR-619-5p	1818

As shown in FIGS. 9 and 10 and Table 4, when the miRNA according to the present invention was treated with the dermal fibroblast, the migration rate of the dermal fibroblast was remarkably improved.

MiR-4665-5p, hsa-miR-6820-5p, hsa-miR-503-3p, hsa-miR-4665-5p, and hsa-miR- 3p, hsa-miR-4287, hsa-miR-6879-5p, hsa-miR-4484 and hsa-miR-619-5p have excellent effects on wound healing and skin improvement I could confirm.

The present invention relates to a method for treating skin wounds or improving skin using microRNAs (miRNAs).

SEQ ID NO: 1: seed sequence of hsa-miR-328-3p miRNA

UGGCCCU

SEQ ID NO: 2: Seed sequence of hsa-miR-6514-5p miRNA

AUGGAGU

SEQ ID NO: 3: hsa-miR-503-3p miRNA seed sequence

GGGUAUU

SEQ ID NO: 4: hsa-miR-4665-5p miRNA seed sequence

UGGGGGA

SEQ ID NO: 5: hsa-miR-6820-3p miRNA seed sequence

GUGACUU

SEQ ID NO: 6: hsa-miR-4287 miRNA seed sequence

CUCCCUU

SEQ ID NO: 7: hsa-miR-6879-5p miRNA seed sequence

AGGGCAG

SEQ ID NO: 8: hsa-miR-4484 miRNA seed sequence

AAAGGCG

SEQ ID NO: 9: hsa-miR-619-5p miRNA seed sequence

CUGGGAU

SEQ ID NO: 10: hsa-miR-328-3p miRNA sequence

CUGGCCCUCUCUGCCCUUCCGU

SEQ ID NO: 11: hsa-miR-6514-5p miRNA sequence

UAUGGAGUGGACUUUCAGCUGGC

SEQ ID NO: 12: hsa-miR-503-3p miRNA sequence

GGGGUAUUGUUUCCGCUGCCAGG

SEQ ID NO: 13: hsa-miR-4665-5p miRNA sequence

CUGGGGGACGCGUGAGCGCGAGC

SEQ ID NO: 14: hsa-miR-6820-3p miRNA sequence

UGUGACUUCUCCCCUGCCACAG

SEQ ID NO: 15: hsa-miR-4287 miRNA sequence

UCUCCCUUGAGGGCACUUU

SEQ ID NO: 16: hsa-miR-6879-5p miRNA sequence

CAGGGCAGGGAAGGUGGGAGAG

SEQ ID NO: 17: hsa-miR-4484 miRNA sequence

AAAAGGCGGGAGAAGCCCCA

SEQ ID NO: 18: hsa-miR-619-5p miRNA sequence

GCUGGGAUUACAGGCAUGAGCC

Claims

An miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with said expression vector as an active ingredient.
The method according to claim 1,

The miRNA may be,

(a) hsa-miR-328-3p, hsa-miR-6514-5p, hsa-miR-503-3p, hsa-miR-4665-5p, hsa-miR-6820-3p, one or more miRNAs selected from the group consisting of -miR-6879-5p, hsa-miR-4484 and hsa-miR-619-5; And (b) a miRNA comprising the nucleotide sequence of any one of SEQ ID NOS: 1 to 9, wherein the nucleotide sequence is at least 80% homologous to the nucleotide sequence of (a), or at least 90% or at least 95% ; &Lt; / RTI > or a pharmaceutically acceptable salt thereof.
3. The method of claim 2,

The hsa-miR-328-3p miRNA comprises the nucleotide sequence of SEQ ID NO: 10,

The hsa-miR-6514-5p miRNA comprises the nucleotide sequence of SEQ ID NO: 11,

The hsa-miR-503-3p miRNA comprises the nucleotide sequence of SEQ ID NO: 12,

The hsa-miR-4665-5p miRNA comprises the nucleotide sequence of SEQ ID NO: 13,

The hsa-miR-6820-3p miRNA comprises the nucleotide sequence of SEQ ID NO: 14,

The hsa-miR-4287 miRNA comprises the nucleotide sequence of SEQ ID NO: 15,

The hsa-miR-6879-5p miRNA comprises the nucleotide sequence of SEQ ID NO: 16,

The hsa-miR-4484 miRNA comprises the nucleotide sequence of SEQ ID NO: 17,

Wherein the hsa-miR-619-5 miRNA consists of the nucleotide sequence of SEQ ID NO: 18.
The method according to claim 1,

Wherein at least one of the nucleic acid molecules constituting the miRNA comprises

A form including a phosphorothiolate structure in which a phosphate backbone structure is substituted with a sulfur element;

DNA, a form substituted with PNA (petide nucleic acids) or LNA (locked nucleic acid) molecules; or

Wherein the 2 ' hydroxyl group of the sugar is in the form of a methylated, methoxylated or fluorinated structure.
The method according to claim 1,

Wherein the miRNA is a miRNA precursor in the form of a miRNA precursor, a primary miRNA (pri-miRNA) or a plasmid.
The method according to claim 1,

Wherein the miRNA is in the form of a single strand or a double strand.
The method according to claim 1,

Wherein the composition comprises an exosome comprising the miRNA as an active ingredient.
The method according to claim 1,

Wherein the composition comprises a cell culture comprising the miRNA as an active ingredient.
The method according to claim 1,

Wherein the expression vector is a non-viral vector or a viral vector.
The method according to claim 1,

Wherein said pharmaceutical composition promotes the proliferation or migration of human dermal fibroblasts (HDFs).
An miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with said expression vector as an active ingredient.
An miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with said expression vector as an active ingredient.
An miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with said expression vector as an active ingredient.
14. The method of claim 13,

The miRNA may be,

(a) hsa-miR-328-3p, hsa-miR-6514-5p, hsa-miR-503-3p, hsa-miR-4665-5p, hsa-miR-6820-3p, one or more miRNAs selected from the group consisting of -miR-6879-5p, hsa-miR-4484 and hsa-miR-619-5; And (b) a miRNA comprising the nucleotide sequence of any one of SEQ ID NOS: 1 to 9, wherein the nucleotide sequence is at least 80% homologous to the nucleotide sequence of (a), or at least 90% or at least 95% ; &Lt; / RTI >
15. The method of claim 14,

The hsa-miR-328-3p miRNA comprises the nucleotide sequence of SEQ ID NO: 10,

The hsa-miR-6514-5p miRNA comprises the nucleotide sequence of SEQ ID NO: 11,

The hsa-miR-503-3p miRNA comprises the nucleotide sequence of SEQ ID NO: 12,

The hsa-miR-4665-5p miRNA comprises the nucleotide sequence of SEQ ID NO: 13,

The hsa-miR-6820-3p miRNA comprises the nucleotide sequence of SEQ ID NO: 14,

The hsa-miR-4287 miRNA comprises the nucleotide sequence of SEQ ID NO: 15,

The hsa-miR-6879-5p miRNA comprises the nucleotide sequence of SEQ ID NO: 16,

The hsa-miR-4484 miRNA comprises the nucleotide sequence of SEQ ID NO: 17,

Wherein the hsa-miR-619-5 miRNA consists of the nucleotide sequence of SEQ ID NO: 18.
14. The method of claim 13,

Wherein at least one of the nucleic acid molecules constituting the miRNA comprises

A form including a phosphorothiolate structure in which a phosphate backbone structure is substituted with a sulfur element;

DNA, a form substituted with PNA (petide nucleic acids) or LNA (locked nucleic acid) molecules; or

Wherein the sugar 2 ' hydroxyl group is replaced by a methylated, methoxylated or fluorinated structure.
14. The method of claim 13,

Wherein the miRNA is a miRNA precursor in the form of a miRNA precursor, a primary miRNA (pri-miRNA) or a plasmid.
14. The method of claim 13,

Wherein the miRNA is in the form of a single strand or a double strand.
14. The method of claim 13,

Wherein the expression vector is a non-viral vector or a viral vector.
14. The method of claim 13,

Wherein the composition comprises an exosome comprising the miRNA as an active ingredient.
14. The method of claim 13,

Wherein the composition comprises a cell culture comprising the miRNA as an active ingredient.
14. The method of claim 13,

Wherein the composition inhibits the expression of a gene encoding NPM1, PDCD4, CCL5 or NUP62.
14. The method of claim 13,

Wherein the composition promotes the proliferation or migration of human dermis-derived fibroblasts to enhance the regeneration ability of the dermis fibroblasts.
14. The method of claim 13,

Wherein the skin improvement is skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement or aging prevention.
An miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with said expression vector as an active ingredient.
An miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with said expression vector as an active ingredient.
An miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9; An expression vector containing the same; Or a transformant transformed with said expression vector as an active ingredient.
An miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9 in a desired individual; An expression vector containing the same; Or a transformant transformed with said expression vector.
An miRNA comprising a seed sequence represented by any one of SEQ ID NOS: 1 to 9 in a desired individual; An expression vector containing the same; Or a transformant transformed with said expression vector.