WO2021251526A1 - Novel mirna mimics and uses thereof - Google Patents

Novel mirna mimics and uses thereof Download PDF

Info

Publication number
WO2021251526A1
WO2021251526A1 PCT/KR2020/007578 KR2020007578W WO2021251526A1 WO 2021251526 A1 WO2021251526 A1 WO 2021251526A1 KR 2020007578 W KR2020007578 W KR 2020007578W WO 2021251526 A1 WO2021251526 A1 WO 2021251526A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
hsa
mir
seq
analog
Prior art date
Application number
PCT/KR2020/007578
Other languages
French (fr)
Korean (ko)
Inventor
최혜인
박병순
최은욱
Original Assignee
주식회사 프로스테믹스
주식회사 인터셀라
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 프로스테믹스, 주식회사 인터셀라 filed Critical 주식회사 프로스테믹스
Priority to PCT/KR2020/007578 priority Critical patent/WO2021251526A1/en
Publication of WO2021251526A1 publication Critical patent/WO2021251526A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing

Definitions

  • the present invention relates to novel miRNA analogs and various uses thereof.
  • miRNA is a small non-coding RNA composed of 18-25 nucleotides (nucleotide, nt), which binds to the 3'-untranslated region (UTR) of a target gene and regulates gene expression (Bartel DP, et al. , Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005) are processed from introns, exons or intergenic regions (Rodriguez A, et al., Genome Res 14: 1902-1910, 2004).
  • miRNAs are transcribed by RNA polymerase into nascent miRNA (pri-miRNA) molecules containing thousands of nucleotides.
  • pri-miRNA is microprocessor [DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein (DGCR8)) to form an approximately 70 nt stem ring intermediate known as a miRNA precursor. ] (Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci US A100: 9779-9784, 2003). Then, the pre-miRNA is transported from the nucleus to the cytoplasm via exoportin-5 (Exportin-5, EXP5) and the cofactor Ran-GTP, where the pre-miRNA is 18-25 by the RNase endonuclease Dicer.
  • exoportin-5 Exportin-5, EXP5
  • Ran-GTP cofactor Ran-GTP
  • RNA-induced silencing complex RISC
  • Cancer is one of the most common causes of death worldwide. About 10 million new cases occur each year, accounting for about 12% of all deaths, making it the third leading cause of death.
  • breast cancer is the most common malignant tumor that causes more than 40,000 deaths annually in women, and early diagnosis is very important. This has not improved.
  • Chemotherapy which is a representative anti-cancer therapy, is currently used as the most effective treatment for cancer, either alone or in combination with other therapies such as radiotherapy.
  • the efficacy of a cancer treatment drug in chemotherapy depends on its ability to kill cancer cells, but there is a problem that it can act not only on cancer cells but also normal cells when the drug is used.
  • cancer stem cells are cancer cells with unlimited regenerative capacity, and the hypothesis that tumors originate from stem cells was hypothesized in the late 1990s to immunosuppress a group of cells that could become cancer stem cells in acute myeloid leukemia. It was confirmed when it was announced that human leukemia could be reproduced in mice by transplantation into mice, and later, by proving cancer stem cells in breast cancer, he became convinced of the existence of stem cells in solid carcinoma.
  • the diverse heterogeneity of malignant tumors is consistent with the diverse differentiation characteristics of stem cells, and the drug resistance of cancer cells, which is constantly expressed despite many targeted therapies, is consistent with the basic characteristics of stem cells. and cancer stem cells can become a new target therapeutic field.
  • Another object of the present invention is to provide various uses using the above oligonucleotides.
  • an oligonucleotide that is an analog of hsa-miR-503-3p, hsa-miR-328-3p, and hsa-miR-6514-5p.
  • the oligonucleotide has 60% or more and less than 100%, 70% or more and less than 100%, 80% homology to the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1 It may consist of a nucleotide sequence of 100% or more, or 90% or more and less than 100%.
  • the oligonucleotide includes the seed sequence (ggguauu) of the hsa-miR-503-3p represented by SEQ ID NO: 4, and hsa-miR-503-3p represented by SEQ ID NO: 1
  • the nucleotide sequence (gggguauuguuuccgcugccagg) and homology to 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more and less than 100% may consist of a nucleotide sequence.
  • the oligonucleotide comprises the seed sequence (ggguauu) of the hsa-miR-503-3p represented by SEQ ID NO: 4 as the 2nd to 8th sequences from the 5'-end, 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more 100 It may be composed of a base sequence that is less than %.
  • the oligonucleotide has 60% or more and less than 100%, 70% or more and less than 100%, 80 % or more and less than 100%, or 90% or more and less than 100% may consist of a nucleotide sequence.
  • the oligonucleotide includes the seed sequence (uggcccu) of the hsa-miR-328-3p represented by SEQ ID NO: 5, and hsa-miR-328- represented by SEQ ID NO: 2 It may consist of a nucleotide sequence having 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more and less than 100% of the nucleotide sequence of 3p (cuggcccuucugcccuuccgu).
  • the oligonucleotide comprises the seed sequence (uggcccu) of the hsa-miR-328-3p represented by SEQ ID NO: 5 as the 2nd to 8th sequences from the 5'-end, 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more 100 It may be composed of a base sequence that is less than %.
  • the oligonucleotide has 60% or more and less than 100%, 70% or more and less than 100%, 80 % or more and less than 100%, or 90% or more and less than 100% may consist of a nucleotide sequence.
  • the oligonucleotide includes the seed sequence (auggagu) of the hsa-miR-6514-5p represented by SEQ ID NO: 6, and hsa-miR-6514- represented by SEQ ID NO: 3 It may consist of a nucleotide sequence having 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more and less than 100% of the nucleotide sequence of 5p (uauggaguggacuuucagcuggc).
  • the oligonucleotide includes the seed sequence (auggagu) of the hsa-miR-6514-5p represented by SEQ ID NO: 6 as the 2nd to 8th sequences from the 5'-end,
  • the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p represented by SEQ ID NO: 3 is 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more 100% It may consist of less than a base sequence.
  • the base of at least one nucleic acid among the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1 is adenine, guanine, uracil (uracil) and cytosine (cytosine) may be substituted with another type.
  • the base of at least one nucleic acid among the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p represented by SEQ ID NO: 2 is adenine, guanine, uracil (uracil) and cytosine (cytosine) may be substituted with another type.
  • the base of at least one nucleic acid among the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p represented by SEQ ID NO: 3 is adenine, guanine, uracil (uracil) and cytosine (cytosine) may be substituted with another type of base.
  • a nucleic acid substituted with a different type refers to, for example, a case in which the base of the nucleic acid is adenine, and the base is substituted with guanine, uracil or cytosine instead of adenine.
  • the base of the nucleic acid when the base of the nucleic acid is guanine, it means that the base is not guanine, but is substituted with adenine, uracil or cytosine, and as another example, when the base of the nucleic acid is uracil, This means that the base is substituted with adenine, guanine or cytosine instead of uracil, and as another example, when the base of the nucleic acid is cytosine, it means the case where the base is substituted with adenine, guanine, or uracil.
  • the base (guanine) of the first nucleic acid at the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the second nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the third nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the fourth nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (uracil) of the 5th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
  • the base (adenine) of the 6th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is guanine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (uracil) of the 7th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
  • the base (uracil) of the 8th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
  • the base (guanine) of the ninth nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (uracil) of the 10th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
  • the base (uracil) of the 11th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
  • the base (uracil) of the 12th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
  • the base (cytosine) of the 13th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
  • the base (cytosine) of the 14th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
  • the base (guanine) of the 15th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (cytosine) of the 16th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
  • the base (uracil) of the 17th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
  • the base (guanine) of the 18th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (cytosine) of the 19th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
  • the base (cytosine) of the 20th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
  • the base (adenine) of the 21st nucleic acid at the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is guanine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the 22nd nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the 23rd nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
  • the oligonucleotide is the 9th, 13th, 15th to 21st nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1. At least one of the bases of the nucleic acid may be substituted with a base of another type among adenine, guanine, uracil, and cytosine.
  • the base (cytosine) of the first nucleic acid at the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (uracil) of the second nucleic acid at the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
  • the base (guanine) of the third nucleic acid at the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p represented by SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the fourth nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (cytosine) of the 5th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (cytosine) of the 6th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (cytosine) of the 7th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (uracil) of the 8th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
  • the base (cytosine) of the ninth nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (uracil) of the 10th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
  • the base (cytosine) of the 11th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (uracil) of the 12th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
  • the base (guanine) of the 13th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (cytosine) of the 14th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (cytosine) of the 15th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (cytosine) of the 16th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (uracil) of the 17th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p represented by SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
  • the base (uracil) of the 18th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine
  • guanine or cytosine may be substituted.
  • the base (cytosine) of the 19th nucleic acid from the 5'-end of the nucleotide sequence (cuggccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (cytosine) of the 20th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
  • the base (guanine) of the 21st nucleic acid at the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (uracil) of the 22nd nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine
  • guanine or cytosine may be substituted.
  • the base (uracil) of the first nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine
  • guanine or cytosine may be substituted.
  • the base (adenine) of the second nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is guanine (guanine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (uracil) of the third nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine (adenine) ), guanine or cytosine may be substituted.
  • the base (guanine) of the fourth nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the 5th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (adenine) of the 6th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p represented by SEQ ID NO: 3 is guanine (guanine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the 7th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (uracil) of the 8th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
  • the base (guanine) of the ninth nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the 10th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (adenine) of the 11th nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is guanine (guanine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (cytosine) of the 12th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine
  • guanine or uracil may be substituted.
  • the base (uracil) of the 13th nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
  • the base (uracil) of the 14th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
  • the base (uracil) of the 15th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
  • the base (cytosine) of the 16th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or uracil may be substituted.
  • the base (adenine) of the 17th nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is guanine (guanine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the 18th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (cytosine) of the 19th nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or uracil may be substituted.
  • the base (uracil) of the 20th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
  • the base (guanine) of the 21st nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the base (guanine) of the 22nd nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
  • the nucleotide (cytosine) of the 23rd nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or uracil may be substituted.
  • the oligonucleotide is an analog of hsa-miR-503-3p, and relates to an oligonucleotide comprising a nucleotide sequence represented by the following formula (1).
  • N 1 to N 9 may be each independently selected from the group consisting of adenine, guanine, uracil and cytosine.
  • N 1 is guanine
  • N 2 is cytosine
  • N 3 is guanine
  • N 4 is cytosine
  • N 5 is uracil
  • N 6 is guanine
  • N 7 is cytosine
  • N 8 is cytosine and N 9 is adenine, except for the case.
  • N 1 may be cytosine.
  • N 2 may be guanine.
  • N 3 may be cytosine.
  • N 4 may be guanine.
  • N 5 may be adenine.
  • N 6 may be cytosine.
  • N 7 may be guanine.
  • N 8 may be guanine.
  • N 9 may be uracil.
  • the oligonucleotide is an analog of hsa-miR-503-3p, and may be represented by any one nucleotide sequence of SEQ ID NOs: 7 to 37, but is not limited thereto.
  • the oligonucleotide is an analog of hsa-miR-328-3p, and may be represented by the nucleotide sequence of any one of SEQ ID NOs: 38 to 59, but is not limited thereto.
  • the oligonucleotide is an analog of hsa-miR-6514-5p, and may be represented by any one of nucleotide sequences of SEQ ID NOs: 60 to 82, but is not limited thereto.
  • the oligonucleotides in the present invention may contain naturally occurring or modified, non-naturally occurring bases, and may contain modified sugars, phosphates and/or termini.
  • phosphate modifications include, but are not limited to, methyl phosphonates, phosphorothioates, phosphoramidates (crosslinked or non-crosslinked), phosphotriesters and phosphorodithioates. not, and may be used in any combination.
  • the RNA oligonucleotide has phosphorothioate linkages alone, phosphodiester linkages alone, or a combination of phosphodiester and phosphorothioate linkages.
  • sugar modifications known in the art such as 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA/DNA chimeras and herein Others described may also be prepared and combined with any phosphate modification.
  • base modifications are to C-5 and/or C-6 of cytosine (eg, 5-bromocytosine, 5-chlorocytosine, 5-fluorocytosine, 5-iodocytosine) of the oligonucleotide.
  • an electron-withdrawing moiety and C-5 and/or of uracil eg, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, 5-iodouracil
  • an oligonucleotide of the invention including but not limited to the addition of an electron-withdrawing moiety to C-6.
  • the use of base modifications in the palindromic sequence of the oligonucleotide should not interfere with the self-complementarity of the bases involved for Watson-Crick base pairing. However, outside the palindromic sequence, modified bases can be used without this limitation.
  • 2'-O-methyl-uridine and 2'-O-methyl-cytidine can be used outside the palindromic sequence, whereas 5-bromo-2'-deoxycytidine can be used outside the palindromic sequence. It can be used both inside and outside a grammar sequence.
  • Other modified nucleotides that can be used both inside and outside the palindromic sequence include 7-deaza-8-aza-dG, 2-amino-dA, and 2-thio-dT.
  • the oligonucleotide may include a phosphate-modified oligonucleotide, a part of which is known to stabilize the oligonucleotide. Accordingly, some embodiments of the invention include stabilized oligonucleotides.
  • the synthesis of oligonucleotides containing modified phosphate linkages or non-phosphate linkages is also known in the art (see, e.g., Matteucci "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (DJ Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY, 1997).
  • Phosphorus derivatives that may be attached to a sugar or sugar analog moiety in an oligonucleotide include monophosphate, diphosphate, triphosphate, alkylphosphonate, phosphorothioate, phosphorodithioate, phospho formamidate and the like.
  • phosphorothioate oligonucleotides is similar to that described above for naturally occurring oligonucleotides, except that the oxidation step is replaced by a sulfiding step (Zon "Oligonucleoside Phosphorothioates" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190, 1993).
  • the oligonucleotide may include one or more ribonucleotides (either alone or containing ribose as the main sugar component), deoxyribonucleotides (containing deoxyribose as the main sugar component), modified sugars or sugar analogs.
  • the sugar moiety can be a pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxose, and sugar analog cyclopentyl group.
  • Sugars may exist in either pyranosyl or furanosyl forms.
  • the sugar moiety is preferably a furanoside of ribose, deoxyribose, arabinose or 2'-O-alkyl (eg methyl, ethyl)ribose, and the sugar is each heterocyclic It can be attached in an anomeric configuration to a base.
  • Sugar modifications include 2'-alkoxy (eg, methoxy, ethoxy)-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-RNA, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA/DNA chimeras.
  • heterocyclic bases, or nucleic acid bases incorporated into the oligonucleotides include naturally occurring major purine and pyrimidine bases (i.e., uracil, thymine, cytosine, adenine and guanine as mentioned above) as well as those of the major bases. It can be naturally occurring and synthetically modified. Accordingly, the oligonucleotide of the present invention may comprise one or more of inosine, 2'-deoxyuridine and 2-amino-2'-deoxyadenosine.
  • the oligonucleotides of the invention can be modified using a variety of strategies known in the art to produce a variety of effects, including, for example, improved potency and stability in vitro and in vivo.
  • artificial nucleic acids such as 2'-0-methyl-substituted RNA; 2'-fluoro-2'-deoxy RNA, peptide nucleic acid (PNA); morpholino; locked nucleic acid (LNA); unlocked nucleic acids (UNA); cross-linked nucleic acids (BNA); glycol nucleic acids (GNA); and threose nucleic acid (TNA);
  • analog nucleobases confer different base pairing and base stacking properties, among other things. Examples thereof include universal bases capable of pairing with four canon bases. Examples of phosphate-sugar backbone analogs include PNA. Morpholino-based oligomeric compounds are described in Braasch et al., Biochemistry, 41(14):4503-4510 (2002) and US Pat. Nos. 5,539,082, 5,714,331, 5,719,262 and 5,034,506.
  • the oligonucleotide may be modified by substitution with a chemical functional group at the terminal end. Substitutions may be made at the 3' or 5' end of the oligonucleotide, preferably, but not always, at the 3' end of both the sense and antisense strands of the monomer.
  • Chemical functional groups are, for example, sulfhydryl groups (-SH), carboxyl groups (-COOH), amine groups (-NH2), hydroxy groups (-OH), formyl groups (-CHO), carbonyl groups ( -CO-), an ether group (-O-), an ester group (-COO-), a nitro group (-NO2), an azide group (-N3) or a sulfonic acid group (-SO3H).
  • an expression vector comprising the oligonucleotide provided by the present invention; or to a host cell transformed from the expression vector.
  • the expression vector of the present invention encodes the oligonucleotide of the present invention, preferably in an expressible form.
  • the term "in an expressible form” means that the vector expresses the molecule when introduced into a host cell.
  • the expression vector includes regulatory elements necessary for expression of the oligonucleotide.
  • the expression vector of the present invention can be used for production of the oligonucleotide of the present invention, or can be directly used as an active ingredient for cancer treatment, skin improvement or wound treatment.
  • the expression vector of the present invention can be used in a method of cloning a CX sequence into an expression vector in which the regulatory sequence is functionally linked to the CX sequence, for example, in a method that allows expression of both strands (by transcription of a DNA molecule). by (Lee NS et al., Nat Biotechnol 2002 May, 20(5):500-5).
  • an RNA molecule that is the antisense strand of the oligonucleotide is transcribed by a first promoter (eg, a promoter sequence adjacent to the 3' end of the cloned DNA), and an RNA molecule that is the sense strand is transcribed by a second promoter ( eg, a promoter sequence flanking the 5' end of the cloned DNA).
  • a first promoter eg, a promoter sequence adjacent to the 3' end of the cloned DNA
  • a second promoter eg, a promoter sequence flanking the 5' end of the cloned DNA
  • the sense strand and the anti-sense strand hybridize in vivo and generate an oligonucleotide molecular construct that silencing the corresponding gene.
  • the cloned sequence may encode a construct having a secondary structure (eg a hairpin).
  • the expression vector of the present invention can be used to stably insert into the genome of a target cell (for a description of a homologous recombination cassette vector, see Thomas KR & Capecchi MR, Cell 1987,51:503-12). See, eg, Wolff et al., Science 1990,247:1465-8, US Pat. No. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; and WO98/04720.
  • DNA-based delivery technologies include “naked DNA”, facilitative (bupivicaine, polymer, peptide-mediated) delivery, cationic lipid complexes and particle- mediated) [”gene gun”] or pressure-mediated delivery (see, eg, US Pat. No. 5,922,687).
  • the expression vector is preferably a non-viral vector or a viral vector
  • the non-viral vector is preferably a plasmid DNA
  • the viral vector is a lentivirus, a retrovirus, Adenovirus (adenovirus), herpes virus (herpes virus) and avipox virus (avipox virus) vectors and the like may be used, but is not limited thereto.
  • the expression vector preferably further includes a selection marker to facilitate selection of transformed cells.
  • a selection marker to facilitate selection of transformed cells.
  • Markers that confer selectable phenotypes such as, for example, drug resistance, auxotrophy, resistance to cytotoxic agents or expression of surface proteins, such as green fluorescent protein, puromycin, neomycin, hygromycin, Histidinol dehydrogenase (hisD) and guanine phosphoribosyltransferase (Gpt) can be exemplified.
  • the host cell is preferably a mammalian somatic cell, including a human, and more preferably a cell of a tissue site targeted for human treatment, or a cancer cell or cancer stem cell of that site, but is not limited thereto.
  • G-fectin, Mirus TrasIT-TKO lipid affinity reagent, lipofectin, lipofectamine, cellfectin (cellfectin), cationic phospholipid nanoparticles It may be introduced into cells together with a delivery reagent including a cationic polymer, cationic micelles, cationic emulsion or liposome, or may be conjugated to a biocompatible polymer such as polyethylene glycol to increase intracellular absorption, but is not limited thereto.
  • compositions for preventing, improving or treating cancer comprising the oligonucleotide, expression vector or transformed host cell provided in the present invention as an active ingredient, a composition for inhibiting growth of cancer stem cells to provide.
  • composition for preventing, improving or treating cancer metastasis comprising the oligonucleotide, expression vector or transformed host cell provided in the present invention as an active ingredient.
  • the composition for preventing, improving or treating cancer can be used for various purposes, such as a pharmaceutical composition or a food composition. .
  • the step of administering an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention to a subject in need of treatment It relates to a method for preventing, ameliorating or treating cancer, including.
  • an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention is administered to a subject in need of treatment. It relates to a method for preventing, ameliorating or treating cancer metastasis, comprising the steps of.
  • the "subject in need of treatment” means cancer or cancer metastasis, which is symptomatic or suspected, and requires prevention, improvement or treatment of cancer or cancer metastasis by inhibiting the growth or proliferation of cancer or cancer stem cells. It may be an object.
  • the oligonucleotide, expression vector or transformed host cell provided in the present invention can inhibit the proliferation or death of cancer cells or cancer stem cells, or inhibit the stemness of cancer stem cells.
  • the expression of at least one of nanog and OCT4, which are stemness-related markers, is suppressed, and the expression of at least one of CK18 and KRT20, the expression of which is suppressed in cancer stem cells, is increased This can lead to loss of stem cell function.
  • cancer stem cells refers to cancer cells in a comprehensive sense that have the ability to self-renew or differentiate, which is a unique ability of stem cells.
  • cancer refers to or refers to a physiological condition typically characterized by unregulated cell growth in mammals. Cancers to be treated and prevented are melanoma, breast cancer, colorectal cancer, uterine cancer, fallopian tube cancer, ovarian cancer, stomach cancer, brain cancer, rectal cancer, small intestine cancer, rectal cancer, esophageal cancer, lymph gland cancer, gallbladder cancer, lung cancer, and skin cancer depending on the site of occurrence.
  • Cancer stem cells capable of differentiating into these cancer cells exist in 1 to 2% of malignant tumor tissues, and have the characteristic of normal stem cells: self-renewal and pluripotent ability to differentiate into other cells.
  • self-renewal and pluripotent ability to differentiate into other cells have the characteristic of normal stem cells: self-renewal and pluripotent ability to differentiate into other cells.
  • self-regulatory function which increases the number of cells by activation of cell division and differentiates itself into malignant tumor cells.
  • cancer stem cells Since the existence of cancer stem cells in leukemia was revealed in 1997 (Blood, 1997), breast cancer (PNAS, 2003), brain tumor (Nature, 2004), prostate cancer (Cancer Res, 2005), colorectal cancer (Nature) , 2007) and melanoma (Nature, 2008) also provided evidence of the presence of cancer stem cells. A small number of cancer stem cells contained in tumors have emerged as the main cause of tumor malignancy, anticancer resistance, and recurrence.
  • Cancer stem cells have markers that distinguish them from other cancer cells, and various cancer stem cell markers specific to cancer are known as cancer stem cell markers as shown in Table 1 below. have.
  • the cancer stem cells that are the target of growth inhibition may include all of the above-listed cancer stem cells, but in particular may be breast cancer stem cells, melanoma stem cells, lung cancer stem cells or colorectal cancer stem cells.
  • the above-described cancer stem cells constantly self-renew, can make tumors with a small number of less than a thousand cells in an experimental animal model, and have the ability as malignant tumor cells.
  • chemotherapy and radiation therapy which are cancer treatments
  • the removal of cancer stem cells is increasingly recognized as a barometer that can measure the success or failure of cancer treatment.
  • cancer can recur from the remaining cancer stem cells even if cancer cells are killed using various existing treatment methods such as surgery, radiation therapy, and chemotherapy.
  • interest in chemotherapy targeting cancer stem cells having the ability to regenerate tumors and development of a treatment protocol for treating cancer based on the chemotherapy is increasing.
  • cancer stem cells in normal tissues regulate cell growth and differentiation by a self-renewal mechanism, but cancer stem cells are affected by tumor microenvironmental factors around tumor cells, resulting in abnormal self-renewal and It is suggested that by activating the maintenance pathway, it rapidly accumulates, becomes malignant, acquires resistance to chemotherapy, and ultimately causes cancer recurrence.
  • a detailed study of the mechanism of interaction with the entity of the tumor microenvironmental factors that control the accumulation and maintenance of cancer stem cells has not yet been conducted.
  • prevention may include, without limitation, any action that blocks cancer symptoms or suppresses or delays cancer symptoms using the pharmaceutical composition of the present invention.
  • treatment may include, without limitation, any action in which cancer symptoms are improved or beneficial using the pharmaceutical composition of the present invention.
  • oligonucleotide, expression vector, transformant or pharmaceutical composition of the present invention may be additionally administered in combination with other anticancer agents, thereby further enhancing the growth inhibitory effect on cancer cells and cancer stem cells.
  • the anticancer agent is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib , restautinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, viscumalbum, asparaginase, tretinoin, hydroxycarbamide, da satinib, estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, al
  • the oligonucleotide, expression vector, transformant or pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the oligonucleotides, expression vectors, transformation
  • the body or pharmaceutical composition may be characterized in that it targets humans.
  • composition for preventing, improving or treating degenerative neurodegenerative diseases comprising the oligonucleotide, expression vector or transformed host cell provided in the present invention as an active ingredient.
  • the composition for preventing, improving or treating neurodegenerative diseases may be used for various purposes, such as pharmaceutical compositions or food compositions.
  • it relates to a method for preventing or treating a neurodegenerative disease, comprising administering to a target subject an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention.
  • the "target individual” means an individual who has or has a high probability of developing a neurodegenerative disease.
  • the neurodegenerative diseases include stroke, stroke, memory loss, memory impairment, dementia, forgetfulness, Parkinson's disease, Alzheimer's disease, Pick's disease, Creutzfeld-Kacob's disease, Huntington's disease and Lou Gehrig's disease. It may be selected from the group consisting of, but is not limited thereto.
  • composition for preventing, improving or treating an immune-related disease comprising the oligonucleotide, expression vector or transformed host cell provided by the present invention as an active ingredient.
  • the composition for preventing, improving or treating immune-related diseases can be used for various purposes, such as pharmaceutical compositions, cosmetic compositions, and food compositions.
  • a method for preventing, ameliorating or treating an immune-related disease comprising administering an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention to a target subject. it's about
  • the "target individual” means an individual who has or is highly likely to develop an immune-related disease.
  • the immune-related disease is Behcet's disease, polymyositis/dermatomyositis, autoimmune cytopenia, autoimmune myocarditis, atopic dermatitis, asthma, primary liver cirrhosis, dermatomyositis, Goodpeitzer syndrome, autoimmune meningitis, Sjogren's syndrome , systemic lupus erythematosus, Addison's disease, alopecia areata, ankylosing myelitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, insulin-dependent diabetes mellitus, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves disease, Guillain-Barré syndrome, Hashimoto disease, hemolytic anemia, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumato
  • composition for preventing, improving or treating a wound comprising the oligonucleotide, expression vector or transformed host cell provided by the present invention as an active ingredient.
  • the composition for preventing, improving or treating wounds can be used for various purposes such as pharmaceutical compositions, cosmetic compositions, external preparations for skin, food compositions, etc. due to the skin wound healing activity.
  • it relates to a method for preventing, ameliorating or treating a wound, comprising administering an effective amount of an oligonucleotide, an expression vector, or a transformed host cell provided by the present invention to a target subject. .
  • the "target individual” refers to an individual having a skin injury or a high probability of occurrence.
  • the wounds are wounds, bedsores, burns, abrasions, puncture ulcerative wounds, cuts, chronic skin wounds caused by active oxygen, bruises, cuts, cuts in the throat or oral mucosa, lacerations, diabetic ulcers, lower extremity ulcers, hypertension It may be selected from the group consisting of ischemic ulcers, venous ulcers and foot ulcers, but is not limited thereto.
  • composition for improving skin comprising the oligonucleotide, expression vector or transformed host cell provided in the present invention as an active ingredient.
  • the composition for improving skin can be used for various purposes, such as pharmaceutical compositions, cosmetic compositions, external preparations for skin, food compositions, etc. due to the skin condition improvement activity.
  • it relates to a method for improving skin, comprising administering to a target subject an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention.
  • the "target subject” means an individual in need of improvement of skin conditions such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement, or anti-aging.
  • the skin improvement refers to a function of improving skin conditions such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement, or anti-aging, but is not limited thereto.
  • the composition for improving skin can be very usefully used as a composition for cosmetic or therapeutic purposes, more specifically, a composition for filler injection due to the skin condition improvement activity, and as a specific example, A composition for filling or replacement, a composition for filling wrinkle, remodeling of the face or an increase in lip volume, rejuvenation of the skin by mesotherapy It can be usefully used as a composition for use in rehydration treatment.
  • the oligonucleotide, expression vector, host cell, or pharmaceutical composition of the present invention is not limited thereto, but oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, etc., external preparations, suppositories, and sterilizations, respectively, according to conventional methods. It may be formulated in the form of an injection solution and used.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, fragrances, etc., in the case of oral administration, and in the case of injections, buffers, preservatives, pain relief
  • a topical agent, solubilizer, isotonic agent, stabilizer, etc. can be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. can be used.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • oral administration in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used.
  • it may further include a filler, an anti-agglomeration agent, a lubricant, a wetting agent, a flavoring agent, an emulsifier, a preservative, and the like.
  • the route of administration of the oligonucleotide, expression vector, host cell or pharmaceutical composition according to the present invention is, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal. Oral or parenteral administration is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
  • the oligonucleotide, expression vector, host cell or pharmaceutical composition of the present invention may contain the activity, age, weight, general health, sex, diet, administration time, administration route, excretion rate, drug formulation, and the specific compound to be prevented or treated of the specific compound used. It may vary depending on several factors including the severity of the disease, and the dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art. and may be administered at 0.0001 to 50 mg/kg or 0.001 to 50 mg/kg per day. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
  • an expression vector containing the oligonucleotide of the present invention specifically contains 0.01 to 500 mg, more specifically 0.1 to 300 mg, and in the case of a recombinant virus containing the miRNA of the present invention, specifically 10 3 ⁇ Contains 10 12 IU (10 to 10 10 PFU), more specifically 10 5 to 10 10 IU, but is not limited thereto.
  • a host cell transformed with the expression vector of the present invention it specifically contains 10 3 to 10 8 , and more specifically contains 10 4 to 10 7 , but is not limited thereto.
  • the effective dose of the expression vector containing the oligonucleotide of the present invention or the composition containing the transformed host cell as an active ingredient is 0.05 to 12.5 mg/kg in the case of the vector per kg body weight, and 10 in the case of the recombinant virus. 7 to 10 11 virus particles (10 5 to 10 9 IU)/kg, 10 3 to 10 6 cells/kg for cells, specifically 0.1 to 10 mg/kg for vector, 10 for recombinant virus 8 to 10 10 particles (10 6 to 10 8 IU)/kg, and 10 2 to 10 5 cells/kg in the case of cells, and may be administered 2-3 times a day.
  • the composition as described above is not necessarily limited thereto, and may vary depending on the condition of the patient and the degree of onset of the disease.
  • Suitable delivery reagents for administration in combination with the oligonucleotide of the present invention include Mirus Transit TKO lipophilic reagent, LipoTrust SR, lipofectin, lipofectamine, cellfectin. ) or polycations (eg poly lysine), liposomes, collagen or atelocollagen.
  • a preferred delivery reagent is a liposome.
  • the liposome of the present invention can assist delivery of oligonucleotides to specific tissues such as retina or tumor tissue, and can also increase the half-life of the oligonucleotides in blood.
  • Liposomes suitable for use in the present invention are formed from standard vesicle-forming lipids and are generally neutral or negatively charged phospholipids and sterols such as cholesterol. ) is included. The selection of lipids is usually determined in consideration of factors such as the size of a desired liposome and the half-life of the liposome in blood circulation.
  • a variety of methods for preparing liposomes are known, see, eg, Szoka et al., Ann Rev Biophys Bioeng 1980, 9:467; US Pat. No. 4,235,871; No. 4,501,728; 4,837,028; No. 5,019,369 is incorporated herein by reference in its entirety.
  • the expression vector expressing the oligonucleotide of the present invention is, directly or, Mirus Transit LT1 fat-soluble reagent, LipoTrustTMSR, lipofectin, lipofectamine, cellfectin (cellfectin), polycation (polycation) ( For example, poly lysine) or ribosomes or collagen, atelocollagen, etc. may be administered in combination with an appropriate delivery reagent.
  • Methods of delivering a recombinant viral vector expressing an oligonucleotide of the present invention to a cancer region of a patient are within the skill of the art.
  • the oligonucleotides of the present invention may be administered to a subject by any method suitable for delivery of the oligonucleotides to a cancer region.
  • the oligonucleotides can be administered by gene gun, electroporation, or other suitable parenteral or enteral route of administration.
  • suitable enteral administration routes include oral, rectal or intranasal delivery.
  • suitable parenteral routes of administration include intravenous administration (eg, intravenous bolus injection, intravenous infusion), intra-arterial bolus injection, and intravenous infusion (intravenous injection).
  • peri- and intra-tissue injections eg peri- and intra-tumoral injections, intra-retinal injections or sub-retinal injections
  • subcutaneous injections or subcutaneous injections deposition such as by means of an osmotic pump
  • direct treatment around the area or site of cancer such as a catheter or other means of installation (eg, retinal pellet) , suppositories or implants containing porous, non-porous or gelatinous materials), and inhalation.
  • Injection or injection of oligonucleotides or expression vectors is preferably administered to or around the cancer site. do.
  • the oligonucleotide of the present invention may be administered in a single dose or in multiple doses. Where the oligonucleotides of the present invention are to be infused, the infusion may be administered by a single sustained dose or by multiple infusion. Injection of the drug directly into the tissue may be performed at or around the cancer site; at or around a nerve; blood; at or around the wound; or the area where the skin is to be improved; etc. are preferable. Multiple injections to the site are particularly preferred.
  • the cosmetic composition includes lotion, nutritional lotion, nutritional essence, massage cream, cosmetic bath water additive, body lotion, body milk, bath oil, baby oil, baby powder, shower gel, shower cream, sunscreen lotion, sunscreen cream, Suntan cream, skin lotion, skin cream, sunscreen cosmetics, cleansing milk, depilatory makeup, face and body lotion, face and body cream, skin whitening cream, hand lotion, hair lotion, cosmetic cream, jasmine oil, bath soap , water soap, beauty soap, shampoo, hand sanitizer (hand cleaner), medicated soap, medical, cream soap, facial wash, body cleaner, scalp cleaner, hair rinse, cosmetic soap, tooth whitening gel, toothpaste, etc.
  • the composition of the present invention may further include a solvent or an appropriate carrier, excipient or diluent commonly used in the preparation of cosmetic compositions.
  • the type of solvent that can be further added to the cosmetic composition of the present invention is not particularly limited, but for example, water, saline, DMSO, or a combination thereof may be used, and as a carrier, excipient or diluent, purified water, oil, wax , fatty acids, fatty alcohols, fatty acid esters, surfactants, humectants, thickeners, antioxidants, viscosity stabilizers, chelating agents, buffers, lower alcohols, and the like.
  • it may include a whitening agent, a moisturizer, a vitamin, a sunscreen, a perfume, a dye, an antibiotic, an antibacterial agent, an antifungal agent.
  • Hydrogenated vegetable oil castor oil, cottonseed oil, olive oil, palm oil, jojoba oil, and avocado oil may be used as the oil.
  • the wax beeswax, spermaceti, carnauba, candelilla, montan, ceresin, liquid paraffin, and lanolin may be used. can be used
  • fatty acid stearic acid, linoleic acid, linolenic acid, and oleic acid
  • fatty acid alcohol cetyl alcohol, octyl dodecanol, oleyl alcohol, panthenol, lanolin alcohol, stearyl alcohol, and hexadecanol
  • fatty acid ester isopropyl myristate, isopropyl palmitate, and butyl stearate may be used.
  • surfactant cationic surfactants, anionic surfactants and nonionic surfactants known in the art can be used, and surfactants derived from natural products are preferred as far as possible.
  • it may include a desiccant, a thickener, an antioxidant, etc. widely known in the cosmetic field, and the types and amounts thereof are as known in the art.
  • the food composition of the present invention may be prepared in the form of various foods, for example, beverages, gums, tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, and the like. Since the food composition of the present invention is composed of a plant extract having little toxicity and side effects, it can be safely used even when taken for a long period of time for prophylactic purposes.
  • the amount may be added in a proportion of 0.1 to 50% of the total weight.
  • the food composition when the food composition is prepared in the form of a beverage, there is no particular limitation other than containing the food composition in the indicated ratio, and it may contain various flavoring agents or natural carbohydrates as additional ingredients like a conventional beverage. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, polysaccharides such as sucrose, and common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol are included. can do.
  • monosaccharides such as glucose
  • disaccharides such as fructose
  • polysaccharides such as sucrose
  • common sugars such as dextrin and cyclodextrin
  • sugar alcohols such as xylitol, sorbitol and erythritol
  • flavoring agent examples include natural flavoring agents (taumartin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
  • the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners , pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
  • These components may be used independently or in combination.
  • the proportion of these additives is not critical, but is generally selected in the range of 0.1 to about 50 parts by weight per 100 parts by weight of the composition of the present invention.
  • the oligonucleotide provided by the present invention can be stably introduced into the human body to effectively inhibit the growth of cancer cells to prevent and/or treat cancer, and furthermore, to prevent cancer resistance, metastasis and recurrence.
  • the oligonucleotide provided by the present invention can effectively prevent, improve or treat neurodegenerative diseases.
  • the oligonucleotide provided by the present invention can be used for various immune-related diseases related thereto by effectively suppressing an immune response.
  • the oligonucleotide provided by the present invention has excellent wound healing or wound healing promoting activity by promoting cell migration to a wound site.
  • the oligonucleotide provided in the present invention has excellent skin permeability and has excellent skin improvement effects such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, anti-wrinkle improvement, and anti-aging when absorbed, as well as irritation or irritation to the skin. It has no side effects and is safe.
  • FIG. 1 is a graph showing the results of confirming the survival rate of lung cancer cells after transforming lung cancer cells with oligonucleotides of hsa-miR-503-3p (PSI-501) and its analogs 1 to 23 in Experimental Example 1. .
  • FIG. 2 is a graph showing the results of confirming the survival rate of lung cancer cells after transforming lung cancer cells with oligonucleotides of hsa-miR-503-3p (PSI-501) and its analogs 24 to 31 in Experimental Example 1. .
  • FIG. 3 shows the size of a tumor when hsa-miR-503-3p (PSI-501) and its analogues 28 and 31 oligonucleotides were administered in an animal model transplanted with lung cancer cells in Experimental Example 3.
  • One object of the present invention is to provide a novel oligonucleotide that is an analog of hsa-miR-503-3p, hsa-miR-328-3p, and hsa-miR-6514-5p.
  • Oligoribonucleotide types base sequence hsa-miR-503-3p-analog 1 cggguauuguuuccgcugccagg (SEQ ID NO: 7) hsa-miR-503-3p-analog 2 gcgguauuguuuccgcugccagg (SEQ ID NO: 8) hsa-miR-503-3p-analog 3 ggcguauuguuuccgcugccagg (SEQ ID NO: 9) hsa-miR-503-3p-analog 4 gggcuauuguuuccgcugccagg (SEQ ID NO: 10) hsa-miR-503-3p-analog 5 ggggaauuguuuccgcugccagg (SEQ ID NO: 11) hsa-miR-503-3p-analog 6 gggguuuuguuuccgcugccagg (SEQ ID NO: 12) hsa-mi
  • the effect of the oligonucleotide on lung cancer cell lines was confirmed, and the results are shown in FIGS. 1 and 2 .
  • the lung cancer cell line was analyzed using NCI-H460 (ATCC, HTB-177) and RPMI-1640 (Hyclone, USA) containing 10% FBS (Hyclone, USA) and 1% penicillin/streptomycin (WELGENE, Korea) cultured in Cells were cultured in 5% CO 2 ,37° C. cell incubator. Then, 3000 cells of NCI-H460 cells were dispensed in a 96-well plate, and cultured overnight (over-night) followed by transformation (transfection).
  • hsa-miR-503-3p 20 nM of hsa-miR-503-3p (PSI-503) was transformed into cells using Lipofectamine 2000 (Invitrogen, CA). After 72 hours of treatment with each oligonucleotide, the amount of cells was measured using a cell counting kit-8 (Dojindo, Japan), and the absorbance was measured after reaction at 450 nm wavelength for 1 hour.
  • the average drug sensitivity was measured in the NCI-H460 cell line, and the results are shown in Table 3. Specifically, the average of 50% growth inhibition values (GI50) in the NCI-H460 cell line was calculated. Data are presented as molar concentrations representing GI50 values. These values were determined using the optimal concentration range for each endpoint. Percent growth inhibition was calculated using 7 absorbance measurements [time zero (Tz), growth control (C), growth test at 5 drug concentration levels (Ti)] as follows:
  • a lung cancer cell line NCI-H460
  • Cells to be used for the test were thawed, placed in a cell culture flask, and cultured in an incubator at 37° C., 5% CO 2 (incubator MCO-170M, Panasonic, Japan).
  • the cells cultured on the day of cell line transplantation were placed in a centrifuge tube and recovered, and then centrifuged (125 x g, 5 min) to discard the supernatant and prepare a cell suspension (5 ⁇ 10 7 cells/mL) with PBS. .
  • the cell line was transplanted. After measuring the body weight the next day after the completion of the acclimatization period , it was dispensed with a cell suspension (1 ⁇ 10 7 cells/0.05 mL) prepared for healthy animals, and 0.05 mL Matrigel matrix phenol red-free (Matrigel matrix phenol red-free) ( 356237, BD, USA) was added and the prepared solution was filled in a disposable syringe, and 0.1 mL/head was administered subcutaneously to the right back of the animal. The number of transplanted cells was 5x10 6 cells/head. After transplantation of the cell line, general symptoms were observed once daily during the engraftment and growth period.
  • Matrigel matrix phenol red-free Matrigel matrix phenol red-free
  • the tumor volume was measured for an animal without any abnormality, and 60 individuals with an average tumor volume of about 80 to 120 mm 3 were selected.
  • the selected animals were divided into 6 groups, 10 animals per group, to be as uniform as possible based on the tumor volume and body weight.
  • test substance was administered intratumorally, and intratumoral administration was administered using an insulin syringe (BD, U.S.A.) (QD).
  • BD insulin syringe
  • QD insulin syringe
  • analog 31 had a particularly remarkable tumor suppressive effect compared to the control group and other examples.
  • the present invention relates to novel miRNA analogs and various uses thereof.
  • SEQ ID NO: 4 seed sequence of hsa-miR-503-3p
  • SEQ ID NO: 5 seed sequence of hsa-miR-328-3p
  • SEQ ID NO: 6 seed sequence of hsa-miR-6514-5p
  • SEQ ID NO: 8 hsa-miR-503-3p analog
  • SEQ ID NO: 12 hsa-miR-503-3p analog
  • SEQ ID NO: 17 hsa-miR-503-3p analog
  • SEQ ID NO: 18 hsa-miR-503-3p analog
  • SEQ ID NO: 26 hsa-miR-503-3p analog
  • SEQ ID NO: 27 hsa-miR-503-3p analog
  • SEQ ID NO: 28 hsa-miR-503-3p analog
  • SEQ ID NO: 36 hsa-miR-503-3p analog
  • SEQ ID NO: 48 hsa-miR-328-3p analog
  • SEQ ID NO: 65 hsa-miR-6514-5p analog
  • SEQ ID NO: 68 hsa-miR-6514-5p analog
  • SEQ ID NO: 70 hsa-miR-6514-5p analog
  • SEQ ID NO: 72 hsa-miR-6514-5p analog
  • SEQ ID NO: 75 hsa-miR-6514-5p analog
  • SEQ ID NO: 80 hsa-miR-6514-5p analog

Abstract

The present invention relates to an oligonucleotide, which is a mimic of hsa-miR-503-3p, hsa-miR-328-3p, or hsa-miR-6514-5p. The oligonucleotide provided in the present invention is stably introduced into the human body to effectively inhibit the growth of cancer cells, thereby preventing and/or treating cancer. In addition, the oligonucleotide has wound healing or wound healing promoting activity, and, when administered into the skin, not only exhibits excellent skin improvement effects such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement, and anti-aging, but also has no skin irritation or side effects and is safe.

Description

신규한 MIRNA 유사체 및 이의 용도Novel MIRNA analogs and uses thereof
본 발명은 신규한 miRNA 유사체와 이의 다양한 용도에 관한 것이다.The present invention relates to novel miRNA analogs and various uses thereof.
miRNA는 18-25 뉴클레오티드(nucleotide, nt)로 구성된 작은 비-암호화 RNA로서, 표적 유전자의 3'-비번역 부위(untranslated region, UTR)에 결합하여 유전자 발현을 조절하고(Bartel DP, et al., Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005) 인트론(intron), 엑손(exon) 또는 유전자 간 부위(intergenic region)로부터 공정된다(Rodriguez A, et al., Genome Res14: 1902-1910, 2004). 첫째로, miRNA는 수천 개의 뉴클레오티드를 포함하는 초기 miRNA(pri-miRNA) 분자 내로 RNA 폴리머라아제에 의해 전사된다. 그런 다음, pri-miRNA는 miRNA 전구체로 알려진 대략 70 nt 줄기 고리 중간체를 형성하기 위해 마이크로프로세서[DroshaRNase 엔도뉴클레아제 및 디조지증후군 부위 유전자 8 단백질(DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8)]에 의해 연속적으로 공정된다(Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci U S A100: 9779-9784, 2003). 그런 다음, pre-miRNA는 엑소폴틴-5(Exportin-5, EXP5)와 공동인자 Ran-GTP를 통해 핵으로부터 세포질로 이동되고, 여기서 pre-miRNA는 RNase 엔도뉴클레아제 다이서에 의해 18-25 nt 성숙 miRNA 듀플렉스(duplexe)로 공정된다(Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev28: 369-378, 2009). 성숙 miRNA 듀플렉스는 RNA-유도 침묵 복합체(RNA-induced silencing complex, RISC) 내로 아르고노트(Argonaute) 단백질과 단일 가닥 RNA로서 통합되고, 이는 표적 mRNA의 절단 또는 번역 억제 중 어느 하나를 유도한다(Diederichs S, et al., Cell131: 1097-1108, 2007; Hammond SM, et al., Nature404: 293-296, 2000; Martinez et al., Cell 110: 563-574, 2002).miRNA is a small non-coding RNA composed of 18-25 nucleotides (nucleotide, nt), which binds to the 3'-untranslated region (UTR) of a target gene and regulates gene expression (Bartel DP, et al. , Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005) are processed from introns, exons or intergenic regions (Rodriguez A, et al., Genome Res 14: 1902-1910, 2004). First, miRNAs are transcribed by RNA polymerase into nascent miRNA (pri-miRNA) molecules containing thousands of nucleotides. Then, pri-miRNA is microprocessor [DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein (DGCR8)) to form an approximately 70 nt stem ring intermediate known as a miRNA precursor. ] (Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci US A100: 9779-9784, 2003). Then, the pre-miRNA is transported from the nucleus to the cytoplasm via exoportin-5 (Exportin-5, EXP5) and the cofactor Ran-GTP, where the pre-miRNA is 18-25 by the RNase endonuclease Dicer. nt mature miRNA duplexes (Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev28: 369-378, 2009). The mature miRNA duplex is integrated as single-stranded RNA with Argonaute protein into an RNA-induced silencing complex (RISC), which induces either cleavage or translational inhibition of the target mRNA (Diederichs S, et al., Cell131: 1097-1108, 2007; Hammond SM, et al., Nature 404: 293-296, 2000; Martinez et al., Cell 110: 563-574, 2002).
암은 전세계적으로 가장 보편적인 사망 원인 중의 하나이다. 약 천만 건의 새로운 케이스가 매년 발생하며, 전체 사망 원인의 약 12%를 차지하여 세 번째로 많은 사망의 원인이 되고 있다.Cancer is one of the most common causes of death worldwide. About 10 million new cases occur each year, accounting for about 12% of all deaths, making it the third leading cause of death.
암 중에서도 유방암은 여성에게 있어서 매년 40,000명 이상의 사망의 원인이 되는 가장 보편적인 악성 종양으로서 조기 진단이 매우 중요하나, 이미 알려져 있는 많은 항암 치료제의 치료에도 불구하고 암이 많이 진행된 경우나 전이된 경우 생존율이 향상되지 못한 실정이다.Among cancers, breast cancer is the most common malignant tumor that causes more than 40,000 deaths annually in women, and early diagnosis is very important. This has not improved.
대표적인 항암 요법인 화학요법(chemotherapy)은, 단독으로 또는 방사능 요법과 같은 다른 치료법과 조합하여 현재 암을 치료하기 위한 가장 효율적인 치료법으로 사용되고 있다. 그러나, 화학 요법에서 암 치료 약물의 효능은 암 세포를 죽일 수 있는 능력에 따르나, 약물 사용시 암 세포뿐만 아니라 일반적인 세포에도 작용할 수 있다는 문제가 있다.Chemotherapy, which is a representative anti-cancer therapy, is currently used as the most effective treatment for cancer, either alone or in combination with other therapies such as radiotherapy. However, the efficacy of a cancer treatment drug in chemotherapy depends on its ability to kill cancer cells, but there is a problem that it can act not only on cancer cells but also normal cells when the drug is used.
한편, 암 줄기세포(cancer stem cell)는 무제한 재생 능력을 가진 암 세포로서 줄기세포에서 종양이 기원할 것이라는 가설은, 90년대 말 급성 골수성 백혈병에서 암 줄기세포가 될 수 있는 일단의 세포를 면역억제 쥐에 이식하여 사람의 백혈병이 쥐에서 재현됨이 발표되면서 확고하게 되었고, 이후 유방암에서 암 줄기세포를 증명하면서 고형 암종에서도 줄기세포의 존재를 확신하게 되었다.On the other hand, cancer stem cells are cancer cells with unlimited regenerative capacity, and the hypothesis that tumors originate from stem cells was hypothesized in the late 1990s to immunosuppress a group of cells that could become cancer stem cells in acute myeloid leukemia. It was confirmed when it was announced that human leukemia could be reproduced in mice by transplantation into mice, and later, by proving cancer stem cells in breast cancer, he became convinced of the existence of stem cells in solid carcinoma.
악성 종양이 보이는 다양한 이질성이 줄기세포의 다양한 분화성과 일치하며, 많은 표적치료에도 불구하고 끊임없이 발현되는 암 세포의 약물 저항성은 줄기세포의 기본 특성과 일치하는데 이로써 종양의 발생과 줄기세포를 연관지어 생각할 수 있으며, 암 줄기세포는 새로운 표적 치료 분야가 될 수 있다.The diverse heterogeneity of malignant tumors is consistent with the diverse differentiation characteristics of stem cells, and the drug resistance of cancer cells, which is constantly expressed despite many targeted therapies, is consistent with the basic characteristics of stem cells. and cancer stem cells can become a new target therapeutic field.
암 줄기세포 가설에 근거하여 여러 치료 방법들이 고안되었는데, 그 중 많이 알려진 방법은 암 줄기세포의 자가 재생 경로를 이용하는 방법이다. 이러한 치료에서 중요한 점은 정상 줄기세포의 자가 재생은 유지하면서 암 줄기세포의 자가 재생만을 표적으로 해야 하는 것이다. 예로서 Notch 신호는 감마 세크레타제(gamma secretase)라는 효소에 의해 진행되는데, 이에 대한 억제제(gamma secretase inhibitor)를 Notch1이 과발현된 유방암에 사용하면 종양 억제 효과를 달성할 수 있다. Hedgehog 신호체계를 표적으로 할 경우에도 항암효과를 보인다는 최근 보고가 있는데, Hedgehog 억제제인 사이클로파민(cyclopamine)을 종양을 이종이식(tumor xenograft)한 동물에 투여했을 때 극적으로 종양이 위축되었다는 것이다. 그 밖에도, PI3K/AKT, MAPK, JAK2/STAT3 신호 기전(signaling pathway)과 관련 있다고 알려져 있다.Several treatment methods have been devised based on the cancer stem cell hypothesis, and the most well-known method is a method using the self-renewal pathway of cancer stem cells. An important point in such treatment is to target only the self-renewal of cancer stem cells while maintaining the self-renewal of normal stem cells. For example, Notch signaling is performed by an enzyme called gamma secretase, and if a gamma secretase inhibitor is used for breast cancer in which Notch1 is overexpressed, a tumor suppressive effect can be achieved. There has been a recent report that it shows anticancer effects even when targeting the Hedgehog signaling system. When the Hedgehog inhibitor cyclopamine was administered to tumor xenografted animals, tumor atrophy was dramatically reduced. In addition, it is known to be involved in the PI3K/AKT, MAPK, and JAK2/STAT3 signaling pathways.
그러나, 지금까지 암 줄기세포에 대한 연구에는 제한성도 많고, 종양의 형성이나 유지에서의 역할에 대해서는 아직까지 확실하게 밝혀진 것은 없다. 정상 줄기세포에는 손상을 주지 않으면서 암 줄기세포만을 표적으로 하는 치료를 효율적으로 수행하기 위해서는 암 줄기세포의 유지와 조절에 중요한 분자생물학적인 특성이나 그 조절 경로에 대한 지식과 이해가 필요하다.However, studies on cancer stem cells so far have many limitations, and their role in the formation or maintenance of tumors has not yet been clearly elucidated. In order to efficiently perform a treatment that targets only cancer stem cells without damaging normal stem cells, knowledge and understanding of molecular biological properties important for the maintenance and control of cancer stem cells or their regulatory pathways are required.
현재까지 암 줄기세포를 직접적으로 타겟팅하는 항암제나 천연물 유래 추출물의 연구는 거의 없는 실정이다. 종래의 기술은 암 줄기세포의 직접적인 타겟 유전자를 억제하는 실험으로 암 줄기세포를 억제하거나 암 줄기세포의 상위 신호전달 단백질을 억제하여 암 줄기세포를 억제하는 연구들이 진행되었다. 그러나 많은 종양 환자에 있어서 종양 유전자의 변이나 단백질의 변이로 이러한 타겟팅 실험이 어려움이 많다. Until now, there have been few studies of anticancer drugs or natural extracts that directly target cancer stem cells. In the prior art, as an experiment to suppress direct target genes of cancer stem cells, studies have been conducted to suppress cancer stem cells by inhibiting cancer stem cells or by suppressing high-level signaling proteins of cancer stem cells. However, in many tumor patients, such targeting experiments are difficult due to oncogene mutations or protein mutations.
따라서, 암 줄기세포에 대한 약물의 선택성을 개선하는 것은 항암 약물에 의한 화학 요법의 효능을 증가시킴으로써 약물을 더 낮은 용량으로 사용하게 하는 것을 분명히 가능하게 할 것이다. 그러므로 암 치료 및 예방을 위하여 암 줄기세포의 성장을 선택적으로 억제할 수 있는 개선된 접근법이 요구된다.Therefore, improving the selectivity of drugs for cancer stem cells will obviously make it possible to use lower doses of drugs by increasing the efficacy of chemotherapy with anticancer drugs. Therefore, there is a need for an improved approach capable of selectively inhibiting the growth of cancer stem cells for cancer treatment and prevention.
본 발명의 일 목적은 hsa-miR-503-3p, hsa-miR-328-3p, hsa-miR-6514-5p의 유사체인 신규한 올리고뉴클레오티드를 제공하는 것을 목적으로 한다. It is an object of the present invention to provide novel oligonucleotides that are analogs of hsa-miR-503-3p, hsa-miR-328-3p, and hsa-miR-6514-5p.
본 발명의 다른 목적은 상기한 올리고뉴클레오티드를 이용한 다양한 용도를 제공하는 것을 목적으로 한다. Another object of the present invention is to provide various uses using the above oligonucleotides.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.
본 발명의 일 구현 예에 따르면, hsa-miR-503-3p, hsa-miR-328-3p, hsa-miR-6514-5p의 유사체인 올리고뉴클레오티드에 관한 것이다. According to one embodiment of the present invention, it relates to an oligonucleotide that is an analog of hsa-miR-503-3p, hsa-miR-328-3p, and hsa-miR-6514-5p.
본 발명의 일 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)과 상동성이 60% 이상 100% 미만, 70% 이상 100% 미만, 80% 이상 100% 미만, 또는 90% 이상 100% 미만인 염기 서열로 이루어진 것일 수 있다. In one embodiment of the present invention, the oligonucleotide has 60% or more and less than 100%, 70% or more and less than 100%, 80% homology to the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1 It may consist of a nucleotide sequence of 100% or more, or 90% or more and less than 100%.
본 발명의 다른 구체예에서 상기 올리고뉴클레오티드는, 서열번호 4로 표시되는 상기 hsa-miR-503-3p의 종자 서열(ggguauu)을 포함하며, 상기 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)과 상동성이 60% 이상 100% 미만, 70% 이상 100% 미만, 80% 이상 100% 미만, 또는 90% 이상 100% 미만인 염기 서열로 이루어진 것일 수 있다.In another embodiment of the present invention, the oligonucleotide includes the seed sequence (ggguauu) of the hsa-miR-503-3p represented by SEQ ID NO: 4, and hsa-miR-503-3p represented by SEQ ID NO: 1 The nucleotide sequence (gggguauuguuuccgcugccagg) and homology to 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more and less than 100% may consist of a nucleotide sequence.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는, 5'-말단에서 2번째 내지 8번째 서열로, 서열번호 4로 표시되는 상기 hsa-miR-503-3p의 종자 서열(ggguauu)을 포함하며, 상기 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)과 상동성이 60% 이상 100% 미만, 70% 이상 100% 미만, 80% 이상 100% 미만, 또는 90% 이상 100% 미만인 염기 서열로 이루어진 것일 수 있다.In another embodiment of the present invention, the oligonucleotide comprises the seed sequence (ggguauu) of the hsa-miR-503-3p represented by SEQ ID NO: 4 as the 2nd to 8th sequences from the 5'-end, 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more 100 It may be composed of a base sequence that is less than %.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)과 상동성이 60% 이상 100% 미만, 70% 이상 100% 미만, 80% 이상 100% 미만, 또는 90% 이상 100% 미만인 염기 서열로 이루어진 것일 수 있다. In another embodiment of the present invention, the oligonucleotide has 60% or more and less than 100%, 70% or more and less than 100%, 80 % or more and less than 100%, or 90% or more and less than 100% may consist of a nucleotide sequence.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는, 서열번호 5로 표시되는 상기 hsa-miR-328-3p의 종자 서열(uggcccu)을 포함하며, 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)과 상동성이 60% 이상 100% 미만, 70% 이상 100% 미만, 80% 이상 100% 미만, 또는 90% 이상 100% 미만인 염기 서열로 이루어진 것일 수 있다.In another embodiment of the present invention, the oligonucleotide includes the seed sequence (uggcccu) of the hsa-miR-328-3p represented by SEQ ID NO: 5, and hsa-miR-328- represented by SEQ ID NO: 2 It may consist of a nucleotide sequence having 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more and less than 100% of the nucleotide sequence of 3p (cuggcccuucugcccuuccgu).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는, 5'-말단에서 2번째 내지 8번째 서열로, 서열번호 5로 표시되는 상기 hsa-miR-328-3p의 종자 서열(uggcccu)을 포함하며, 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)과 상동성이 60% 이상 100% 미만, 70% 이상 100% 미만, 80% 이상 100% 미만, 또는 90% 이상 100% 미만인 염기 서열로 이루어진 것일 수 있다.In another embodiment of the present invention, the oligonucleotide comprises the seed sequence (uggcccu) of the hsa-miR-328-3p represented by SEQ ID NO: 5 as the 2nd to 8th sequences from the 5'-end, 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more 100 It may be composed of a base sequence that is less than %.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)과 상동성이 60% 이상 100% 미만, 70% 이상 100% 미만, 80% 이상 100% 미만, 또는 90% 이상 100% 미만인 염기 서열로 이루어진 것일 수 있다. In another embodiment of the present invention, the oligonucleotide has 60% or more and less than 100%, 70% or more and less than 100%, 80 % or more and less than 100%, or 90% or more and less than 100% may consist of a nucleotide sequence.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는, 서열번호 6으로 표시되는 상기 hsa-miR-6514-5p의 종자 서열(auggagu)을 포함하며, 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)과 상동성이 60% 이상 100% 미만, 70% 이상 100% 미만, 80% 이상 100% 미만, 또는 90% 이상 100% 미만인 염기 서열로 이루어진 것일 수 있다.In another embodiment of the present invention, the oligonucleotide includes the seed sequence (auggagu) of the hsa-miR-6514-5p represented by SEQ ID NO: 6, and hsa-miR-6514- represented by SEQ ID NO: 3 It may consist of a nucleotide sequence having 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more and less than 100% of the nucleotide sequence of 5p (uauggaguggacuuucagcuggc).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는, 5'-말단에서 2번째 내지 8번째 서열로 서열번호 6으로 표시되는 상기 hsa-miR-6514-5p의 종자 서열(auggagu)을 포함하며, 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)과 상동성이 60% 이상 100% 미만, 70% 이상 100% 미만, 80% 이상 100% 미만, 또는 90% 이상 100% 미만인 염기 서열로 이루어진 것일 수 있다.In another embodiment of the present invention, the oligonucleotide includes the seed sequence (auggagu) of the hsa-miR-6514-5p represented by SEQ ID NO: 6 as the 2nd to 8th sequences from the 5'-end, The nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p represented by SEQ ID NO: 3 is 60% or more and less than 100%, 70% or more and less than 100%, 80% or more and less than 100%, or 90% or more 100% It may consist of less than a base sequence.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg) 중 적어도 하나의 핵산의 염기가 아데닌(adenine), 구아닌(guanine), 우라실(uracil), 시토신(cytosine) 중 다른 종류로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base of at least one nucleic acid among the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1 is adenine, guanine, uracil (uracil) and cytosine (cytosine) may be substituted with another type.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu) 중 적어도 하나의 핵산의 염기가 아데닌(adenine), 구아닌(guanine), 우라실(uracil), 시토신(cytosine) 중 다른 종류로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base of at least one nucleic acid among the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p represented by SEQ ID NO: 2 is adenine, guanine, uracil (uracil) and cytosine (cytosine) may be substituted with another type.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc) 중 적어도 하나의 핵산의 염기가 아데닌(adenine), 구아닌(guanine), 우라실(uracil), 시토신(cytosine) 중 다른 종류의 염기로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base of at least one nucleic acid among the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p represented by SEQ ID NO: 3 is adenine, guanine, uracil (uracil) and cytosine (cytosine) may be substituted with another type of base.
본 발명에서 상기 "핵산의 염기가 다른 종류로 치환된 것"이라 함은, 일 예시로, 해당 핵산의 염기가 아데닌인 경우, 상기 염기가 아데닌이 아닌, 구아닌, 우라실 또는 시토신으로 치환된 경우를 의미하고, 다른 예시로, 해당 핵산의 염기가 구아닌인 경우, 상기 염기가 구아닌이 아닌, 아데닌, 우라실 또는 시토신으로 치환된 경우를 의미하며, 또 다른 예시로, 해당 핵산의 염기가 우라실인 경우, 상기 염기가 우라실이 아닌, 아데닌, 구아닌 또는 시토신으로 치환된 경우를 의미하며, 또 다른 예시로, 해당 핵산의 염기가 시토신인 경우, 상기 염기가 아데닌, 구아닌 또는 우라실로 치환된 경우를 의미한다. In the present invention, the term "a nucleic acid substituted with a different type" refers to, for example, a case in which the base of the nucleic acid is adenine, and the base is substituted with guanine, uracil or cytosine instead of adenine. As another example, when the base of the nucleic acid is guanine, it means that the base is not guanine, but is substituted with adenine, uracil or cytosine, and as another example, when the base of the nucleic acid is uracil, This means that the base is substituted with adenine, guanine or cytosine instead of uracil, and as another example, when the base of the nucleic acid is cytosine, it means the case where the base is substituted with adenine, guanine, or uracil.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 1번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the first nucleic acid at the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 2번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the second nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 3번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the third nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 4번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the fourth nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 5번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 5th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 6번째 핵산의 염기(아데닌)가 구아닌(guanine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (adenine) of the 6th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is guanine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 7번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다.In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 7th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 8번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 8th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 9번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the ninth nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 10번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다.In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 10th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 11번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 11th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 12번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 12th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 13번째 핵산의 염기(시토신)가 아데닌(adenine), 구아닌(guanine) 또는 우라실(uracil)로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 13th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 14번째 핵산의 염기(시토신)가 아데닌(adenine), 구아닌(guanine) 또는 우라실(uracil)로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 14th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 15번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 15th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 16번째 핵산의 염기(시토신)가 아데닌(adenine), 구아닌(guanine) 또는 우라실(uracil)로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 16th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 17번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다.In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 17th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or cytosine.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 18번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 18th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 19번째 핵산의 염기(시토신)가 아데닌(adenine), 구아닌(guanine) 또는 우라실(uracil)로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 19th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 20번째 핵산의 염기(시토신)가 아데닌(adenine), 구아닌(guanine) 또는 우라실(uracil)로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 20th nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , may be substituted with guanine or uracil.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 21번째 핵산의 염기(아데닌)가 구아닌(guanine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (adenine) of the 21st nucleic acid at the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is guanine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 22번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 22nd nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 23번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 23rd nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p shown in SEQ ID NO: 1 is adenine , uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 서열번호 1로 표시되는 hsa-miR-503-3p의 염기 서열(gggguauuguuuccgcugccagg)의 5'-말단에서 9번째, 13번째, 15번째 내지 21번째의 핵산 중 적어도 하나의 핵산의 염기가 아데닌, 구아닌, 우라실, 시토신 중 다른 종류의 염기로 치환된 것일 수 있다.In another embodiment of the present invention, the oligonucleotide is the 9th, 13th, 15th to 21st nucleic acid from the 5'-end of the nucleotide sequence (gggguauuguuuccgcugccagg) of hsa-miR-503-3p represented by SEQ ID NO: 1. At least one of the bases of the nucleic acid may be substituted with a base of another type among adenine, guanine, uracil, and cytosine.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 1번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다.In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the first nucleic acid at the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 2번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the second nucleic acid at the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 3번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the third nucleic acid at the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p represented by SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 4번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the fourth nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 5번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 5th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 6번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 6th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 7번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 7th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 8번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다.In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 8th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 9번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the ninth nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 10번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 10th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 11번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 11th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 12번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 12th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 13번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 13th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 14번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 14th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 15번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 15th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 16번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다.In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 16th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 17번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 17th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p represented by SEQ ID NO: 2 is adenine (adenine) ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 18번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 18th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 19번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 19th nucleic acid from the 5'-end of the nucleotide sequence (cuggccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 20번째 핵산의 염기(시토신)가 아데닌(adenine), 우라실(uracil) 또는 구아닌(guanine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 20th nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or guanine (guanine) may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 21번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 21st nucleic acid at the 5'-end of the nucleotide sequence (cuggcccucucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine (adenine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 2로 표시되는 hsa-miR-328-3p의 염기 서열(cuggcccucucugcccuuccgu)의 5'-말단에서 22번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 22nd nucleic acid from the 5'-end of the nucleotide sequence (cuggcccuucugcccuuccgu) of hsa-miR-328-3p shown in SEQ ID NO: 2 is adenine ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 1번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다.In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the first nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 2번째 핵산의 염기(아데닌)가 구아닌(guanine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (adenine) of the second nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is guanine (guanine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 3번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the third nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine (adenine) ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 4번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the fourth nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 5번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 5th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 6번째 핵산의 염기(아데닌)가 구아닌(guanine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (adenine) of the 6th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p represented by SEQ ID NO: 3 is guanine (guanine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 7번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 7th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 8번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다.In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 8th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 9번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the ninth nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 10번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 10th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 11번째 핵산의 염기(아데닌)가 구아닌(guanine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (adenine) of the 11th nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is guanine (guanine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 12번째 핵산의 염기(시토신)가 아데닌(adenine), 구아닌(guanine) 또는 우라실(uracil)로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 12th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or uracil may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 13번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 13th nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 14번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 14th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 15번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다.In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 15th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 16번째 핵산의 염기(시토신)가 아데닌(adenine), 구아닌(guanine) 또는 우라실(uracil)로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 16th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or uracil may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 17번째 핵산의 염기(아데닌)가 구아닌(guanine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (adenine) of the 17th nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is guanine (guanine) ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 18번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 18th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 19번째 핵산의 염기(시토신)가 아데닌(adenine), 구아닌(guanine) 또는 우라실(uracil)로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (cytosine) of the 19th nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or uracil may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 20번째 핵산의 염기(우라실)가 아데닌(adenine), 구아닌(guanine) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (uracil) of the 20th nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or cytosine may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 21번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 21st nucleic acid at the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 22번째 핵산의 염기(구아닌)가 아데닌(adenine), 우라실(uracil) 또는 시토신(cytosine)으로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the base (guanine) of the 22nd nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), uracil (uracil) or may be substituted with cytosine (cytosine).
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 상기 서열번호 3으로 표시되는 hsa-miR-6514-5p의 염기 서열(uauggaguggacuuucagcuggc)의 5'-말단에서 23번째 핵산의 염기(시토신)가 아데닌(adenine), 구아닌(guanine) 또는 우라실(uracil)로 치환된 것일 수 있다. In another embodiment of the present invention, in the oligonucleotide, the nucleotide (cytosine) of the 23rd nucleic acid from the 5'-end of the nucleotide sequence (uauggaguggacuuucagcuggc) of hsa-miR-6514-5p shown in SEQ ID NO: 3 is adenine ), guanine or uracil may be substituted.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 hsa-miR-503-3p 의 유사체로서, 하기 식 1로 표시되는 염기 서열로 이루어지는 올리고뉴클레오티드에 관한 것이다.In another embodiment of the present invention, the oligonucleotide is an analog of hsa-miR-503-3p, and relates to an oligonucleotide comprising a nucleotide sequence represented by the following formula (1).
[식 1][Equation 1]
gggguauuN1uuuN2cN3N4N5N6N7N8N9gggggguauuN 1 uuuN 2 cN 3 N 4 N 5 N 6 N 7 N 8 N 9 gg
상기 식 1에서, In Equation 1 above,
N1내지 N9는 각각 독립적으로 아데닌(adenine), 구아닌(guanine), 우라실(uracil) 및 시토신(cytosine)으로 이루어진 군에서 선택될 수 있다. N 1 to N 9 may be each independently selected from the group consisting of adenine, guanine, uracil and cytosine.
단, 상기 올리고뉴클레오티드는 상기 식 1에서 N1이 구아닌이고, N2가 시토신이며, N3가 구아닌이고, N4가 시토신이며, N5가 우라실이고, N6가 구아닌이고, N7이 시토신이고, N8이 시토신이며, N9이 아데닌인 경우는 제외한다. However, in the oligonucleotide, in Formula 1, N 1 is guanine, N 2 is cytosine, N 3 is guanine, N 4 is cytosine, N 5 is uracil, N 6 is guanine, and N 7 is cytosine. and N 8 is cytosine and N 9 is adenine, except for the case.
본 발명의 일 예시로서, 상기 식 1에서 N1은 시토신일 수 있다. As an example of the present invention, in Formula 1, N 1 may be cytosine.
본 발명의 다른 예시로서, 상기 식 1에서 N2는 구아닌일 수 있다. As another example of the present invention, in Formula 1, N 2 may be guanine.
본 발명의 다른 예시로서, 상기 식 1에서 N3은 시토신일 수 있다. As another example of the present invention, in Formula 1, N 3 may be cytosine.
본 발명의 다른 예시로서, 상기 식 1에서 N4는 구아닌일 수 있다. As another example of the present invention, in Formula 1, N 4 may be guanine.
본 발명의 다른 예시로서, 상기 식 1에서 N5는 아데닌일 수 있다.As another example of the present invention, in Formula 1, N 5 may be adenine.
본 발명의 다른 예시로서, 상기 식 1에서 N6은 시토신일 수 있다.As another example of the present invention, in Formula 1, N 6 may be cytosine.
본 발명의 다른 예시로서, 상기 식 1에서 N7은 구아닌일 수 있다.As another example of the present invention, in Formula 1, N 7 may be guanine.
본 발명의 다른 예시로서, 상기 식 1에서 N8은 구아닌일 수 있다.As another example of the present invention, in Formula 1, N 8 may be guanine.
본 발명의 다른 예시로서, 상기 식 1에서 N9는 우라실일 수 있다.As another example of the present invention, in Formula 1, N 9 may be uracil.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 hsa-miR-503-3p의 유사체로서, 서열번호 7 내지 37 중 어느 하나의 염기 서열로 표시될 수 있으나, 이에 제한되는 것은 아니다. In another embodiment of the present invention, the oligonucleotide is an analog of hsa-miR-503-3p, and may be represented by any one nucleotide sequence of SEQ ID NOs: 7 to 37, but is not limited thereto.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 hsa-miR-328-3p의 유사체로서, 서열번호 38 내지 59 중 어느 하나의 염기 서열로 표시될 수 있으나, 이에 제한되는 것은 아니다. In another embodiment of the present invention, the oligonucleotide is an analog of hsa-miR-328-3p, and may be represented by the nucleotide sequence of any one of SEQ ID NOs: 38 to 59, but is not limited thereto.
본 발명의 또 다른 구체예에서 상기 올리고뉴클레오티드는 hsa-miR-6514-5p의 유사체로서, 서열번호 60 내지 82 중 어느 하나의 염기 서열로 표시될 수 있으나, 이에 제한되는 것은 아니다. In another embodiment of the present invention, the oligonucleotide is an analog of hsa-miR-6514-5p, and may be represented by any one of nucleotide sequences of SEQ ID NOs: 60 to 82, but is not limited thereto.
본 발명에서 상기 올리고뉴클레오티드는 자연 발생 또는 변형된, 비-자연 발생 염기를 함유할 수 있고, 변형된 당, 포스페이트 및/또는 말단을 함유할 수 있다. 예를 들어, 포스포디에스테르 연결 이외에도, 포스페이트 변형은 메틸 포스포네이트, 포스포로티오에이트, 포스포르아미데이트 (가교 또는 비-가교), 포스포트리에스테르 및 포스포로디티오에이트를 포함하나, 이에 제한되지는 않고, 임의의 조합으로 사용될 수 있다. 일부 실시 양태에서, 상기 RNA 올리고뉴클레오티드는 포스포로티오에이트 연결 단독, 포스포디에스테르 연결 단독, 또는 포스포디에스테르 및 포스포로티오에이트 연결의 조합을 갖는다.The oligonucleotides in the present invention may contain naturally occurring or modified, non-naturally occurring bases, and may contain modified sugars, phosphates and/or termini. For example, in addition to phosphodiester linkages, phosphate modifications include, but are not limited to, methyl phosphonates, phosphorothioates, phosphoramidates (crosslinked or non-crosslinked), phosphotriesters and phosphorodithioates. not, and may be used in any combination. In some embodiments, the RNA oligonucleotide has phosphorothioate linkages alone, phosphodiester linkages alone, or a combination of phosphodiester and phosphorothioate linkages.
관련 기술분야에 공지된 당 변형, 예컨대 2'-알콕시-RNA 유사체, 2'-아미노-RNA 유사체, 2'-플루오로-DNA, 및 2'-알콕시- 또는 아미노-RNA/DNA 키메라 및 본원에 기재된 다른 것이 또한 제조되고 임의의 포스페이트 변형과 조합될 수 있다. 염기 변형의 예는 상기 올리고뉴클레오티드의 시토신 (예를 들어, 5-브로모시토신, 5-클로로시토신, 5-플루오로시토신, 5-아이오도시토신)의 C-5 및/또는 C-6에 대한 전자-끄는 모이어티의 첨가 및 본 발명의 올리고뉴클레오티드의 우라실 (예를 들어, 5-브로모우라실, 5-클로로우라실, 5-플루오로우라실, 5-아이오도우라실)의 C-5 및/또는 C-6에 대한 전자-끄는 모이어티의 첨가를 포함하나 이에 제한되지는 않는다. 상기 언급된 바와 같이, 상기 올리고뉴클레오티드의 회문식 서열에서의 염기 변형의 사용은 왓슨-크릭 염기 쌍형성을 위해 수반된 염기의 자기-상보성을 방해하여서는 안 된다. 그러나, 회문식 서열의 외부에서, 변형된 염기는 이러한 제한 없이 사용될 수 있다. 예를 들어, 2'-O-메틸-우리딘 및 2'-O-메틸-시티딘은 회문식 서열의 외부에서 사용될 수 있는 반면에, 5-브로모-2'-데옥시시티딘은 회문식 서열 내부 및 외부 둘 다에서 사용될 수 있다. 회문식 서열의 내부 및 외부 둘 다에서 사용될 수 있는 다른 변형된 뉴클레오티드는 7-데아자-8-아자-dG, 2-아미노-dA, 및 2-티오-dT를 포함한다.sugar modifications known in the art, such as 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA/DNA chimeras and herein Others described may also be prepared and combined with any phosphate modification. Examples of base modifications are to C-5 and/or C-6 of cytosine (eg, 5-bromocytosine, 5-chlorocytosine, 5-fluorocytosine, 5-iodocytosine) of the oligonucleotide. Addition of an electron-withdrawing moiety and C-5 and/or of uracil (eg, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, 5-iodouracil) of an oligonucleotide of the invention including but not limited to the addition of an electron-withdrawing moiety to C-6. As mentioned above, the use of base modifications in the palindromic sequence of the oligonucleotide should not interfere with the self-complementarity of the bases involved for Watson-Crick base pairing. However, outside the palindromic sequence, modified bases can be used without this limitation. For example, 2'-O-methyl-uridine and 2'-O-methyl-cytidine can be used outside the palindromic sequence, whereas 5-bromo-2'-deoxycytidine can be used outside the palindromic sequence. It can be used both inside and outside a grammar sequence. Other modified nucleotides that can be used both inside and outside the palindromic sequence include 7-deaza-8-aza-dG, 2-amino-dA, and 2-thio-dT.
본 발명에서 상기 올리고뉴클레오티드는 포스페이트-변형된 올리고뉴클레오티드를 포함할 수 있으며, 그의 일부는 올리고뉴클레오티드를 안정화시키는 것으로 공지되어 있다. 따라서, 본 발명의 일부 실시 양태는 안정화된 올리고뉴클레오티드를 포함한다. 변형된 포스페이트 연결 또는 비-포스페이트 연결을 함유하는 올리고뉴클레오티드의 합성은 또한 관련 기술분야에 공지되어 있다 (예를 들어, 문헌 [Matteucci "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (D.J. Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY, 1997] 참조). 올리고뉴클레오티드에서 당 또는 당 유사체 모이어티에 부착될 수 있는 인 유도체 (또는 변형된 포스페이트 기)는, 모노포스페이트, 디포스페이트, 트리포스페이트, 알킬포스포네이트, 포스포로티오에이트, 포스포로디티오에이트, 포스포르아미데이트 등일 수 있다. 상기-언급된 포스페이트 유사체의 제조 및 뉴클레오티드, 변형된 뉴클레오티드 및 올리고뉴클레오티드로의 그의 혼입은 이미 그 자체로 널리 기재되어 있다 (예를 들어, 문헌 [Peyrottes et al., Nucleic Acids Res, 24:1841-1848, 1996; Chaturvedi et al., Nucleic Acids Res, 24:2318-2323, 1996; 및 Schultz et al., Nucleic Acids Res, 24:2966-2973, 1996] 참조). 예를 들어, 포스포로티오에이트 올리고뉴클레오티드의 합성은 산화 단계가 황화 단계에 의해 대체된다는 것을 제외하고는 자연 발생 올리고뉴클레오티드에 대해 상기 기재된 것과 유사하다 (Zon "Oligonucleoside Phosphorothioates" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190, 1993).In the present invention, the oligonucleotide may include a phosphate-modified oligonucleotide, a part of which is known to stabilize the oligonucleotide. Accordingly, some embodiments of the invention include stabilized oligonucleotides. The synthesis of oligonucleotides containing modified phosphate linkages or non-phosphate linkages is also known in the art (see, e.g., Matteucci "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (DJ Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY, 1997). Phosphorus derivatives (or modified phosphate groups) that may be attached to a sugar or sugar analog moiety in an oligonucleotide include monophosphate, diphosphate, triphosphate, alkylphosphonate, phosphorothioate, phosphorodithioate, phospho formamidate and the like. The preparation of the above-mentioned phosphate analogs and their incorporation into nucleotides, modified nucleotides and oligonucleotides have already been widely described per se (see, e.g., Peyrottes et al., Nucleic Acids Res, 24:1841- 1848, 1996; Chaturvedi et al., Nucleic Acids Res, 24:2318-2323, 1996; and Schultz et al., Nucleic Acids Res, 24:2966-2973, 1996). For example, the synthesis of phosphorothioate oligonucleotides is similar to that described above for naturally occurring oligonucleotides, except that the oxidation step is replaced by a sulfiding step (Zon "Oligonucleoside Phosphorothioates" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190, 1993).
본 발명에서 상기 올리고뉴클레오티드는 하나 이상의 리보뉴클레오티드 (단독 또는 주요 당 성분으로서 리보스 함유), 데옥시리보뉴클레오티드 (주요 당 성분으로서 데옥시리보스 함유), 변형된 당 또는 당 유사체를 포함할 수 있다. 따라서, 리보스 및 데옥시리보스 이외에도, 당 모이어티는 펜토스, 데옥시펜토스, 헥소스, 데옥시헥소스, 글루코스, 아라비노스, 크실로스, 릭소스, 및 당 유사체 시클로펜틸기일 수 있다. 당은 피라노실 또는 푸라노실 형태로 존재할 수 있다. 본 발명의 상기 올리고뉴클레오티드에서, 당 모이어티는 바람직하게는 리보스, 데옥시리보스, 아라비노스 또는 2'-O-알킬(예: 메틸, 에틸)리보스의 푸라노시드이고, 당은 각 헤테로시클릭 염기에 아노머 배위로 부착될 수 있다. 당 변형은 2'-알콕시(예: 메톡시, 에톡시)-RNA 유사체, 2'-아미노-RNA 유사체, 2'-플루오로-RNA, 2'-플루오로-DNA, 및 2'-알콕시- 또는 아미노-RNA/DNA 키메라를 포함하나, 이에 제한되지는 않는다. 이들 당 또는 당 유사체 및 이러한 당 또는 유사체가 그 자체로 헤테로시클릭 염기 (핵산 염기)에 부착되는 각 뉴클레오시드의 제조는 공지되어 있고, 따라서 여기서 기재될 필요는 없다. 당 변형은 또한 본 발명의 올리고뉴클레오티드의 제조에서 제조되고 임의의 포스페이트 변형과 조합될 수 있다.In the present invention, the oligonucleotide may include one or more ribonucleotides (either alone or containing ribose as the main sugar component), deoxyribonucleotides (containing deoxyribose as the main sugar component), modified sugars or sugar analogs. Thus, in addition to ribose and deoxyribose, the sugar moiety can be a pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxose, and sugar analog cyclopentyl group. Sugars may exist in either pyranosyl or furanosyl forms. In the oligonucleotide of the present invention, the sugar moiety is preferably a furanoside of ribose, deoxyribose, arabinose or 2'-O-alkyl (eg methyl, ethyl)ribose, and the sugar is each heterocyclic It can be attached in an anomeric configuration to a base. Sugar modifications include 2'-alkoxy (eg, methoxy, ethoxy)-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-RNA, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA/DNA chimeras. The preparation of these sugars or sugar analogs and the respective nucleosides in which such sugars or analogs are themselves attached to a heterocyclic base (nucleic acid base) are known and therefore need not be described herein. Sugar modifications can also be made in the preparation of the oligonucleotides of the invention and combined with any phosphate modifications.
본 발명에서 상기 올리고뉴클레오티드에 혼입된 헤테로시클릭 염기, 또는 핵산 염기는 자연 발생 주요 퓨린 및 피리미딘 염기 (즉 상기 언급된 바와 같은 우라실, 티민, 시토신, 아데닌 및 구아닌) 뿐만 아니라, 상기 주요 염기의 자연 발생 및 합성 변형일 수 있다. 따라서, 본 발명의 올리고뉴클레오티드는 이노신, 2'-데옥시우리딘 및 2-아미노-2'-데옥시아데노신 중 하나 이상을 포함할 수 있다.In the present invention, heterocyclic bases, or nucleic acid bases incorporated into the oligonucleotides include naturally occurring major purine and pyrimidine bases (i.e., uracil, thymine, cytosine, adenine and guanine as mentioned above) as well as those of the major bases. It can be naturally occurring and synthetically modified. Accordingly, the oligonucleotide of the present invention may comprise one or more of inosine, 2'-deoxyuridine and 2-amino-2'-deoxyadenosine.
본 발명의 올리고뉴클레오티드는 예를 들면 시험관 내 및 생체 내 개선된 효력 및 안정성을 포함한 각종 효과를 생성하는 것으로 당업계에 공지된 다양한 전략을 사용하여 변형될 수 있다. 그러한 전략 중에서 인공 핵산, 예를 들면 2'-O-메틸-치환된 RNA; 2'-플루오로-2'-데옥시 RNA, 펩티드 핵산(PNA); 모르폴리노; 로킹된 핵산(LNA); 비로킹된 핵산(UNA); 가교된 핵산(BNA); 글리콜 핵산(GNA); 및 트레오스 핵산(TNA); 보다 일반적으로 핵산 유사체, 예를 들면 비시클릭 및 트리시클릭 뉴클레오시드 유사체이며, 이는 천연 발생 RNA 및 DNA와 구조적으로 유사하지만, 천연 발생 분자의 포스페이트 백본, 당 또는 핵염기 부분 중 하나 이상에서의 변형을 갖는다. 통상적으로, 유사체 핵염기는 무엇보다도 상이한 염기쌍 형성 및 염기 적층 성질을 부여한다. 그의 예는 4종의 캐논(canon) 염기와 쌍을 형성할 수 있는 보편적인 염기를 포함한다. 포스페이트-당 백본 유사체의 예는 PNA를 포함한다. 모르폴리노계 올리고머 화합물은 문헌[Braasch et al., Biochemistry, 41(14): 4503-4510 (2002)] 및 미국 특허 제5,539,082호, 제5,714,331호, 제5,719,262호 및 제5,034,506호에 기재되어 있다.The oligonucleotides of the invention can be modified using a variety of strategies known in the art to produce a variety of effects, including, for example, improved potency and stability in vitro and in vivo. Among such strategies are artificial nucleic acids such as 2'-0-methyl-substituted RNA; 2'-fluoro-2'-deoxy RNA, peptide nucleic acid (PNA); morpholino; locked nucleic acid (LNA); unlocked nucleic acids (UNA); cross-linked nucleic acids (BNA); glycol nucleic acids (GNA); and threose nucleic acid (TNA); More generally are nucleic acid analogs, such as bicyclic and tricyclic nucleoside analogs, which are structurally similar to naturally occurring RNA and DNA, but modifications in one or more of the phosphate backbone, sugar or nucleobase portion of the naturally occurring molecule. has Typically, analog nucleobases confer different base pairing and base stacking properties, among other things. Examples thereof include universal bases capable of pairing with four canon bases. Examples of phosphate-sugar backbone analogs include PNA. Morpholino-based oligomeric compounds are described in Braasch et al., Biochemistry, 41(14):4503-4510 (2002) and US Pat. Nos. 5,539,082, 5,714,331, 5,719,262 and 5,034,506.
본 발명에서 상기 올리고뉴클레오티드는 말단 단부에서 화학적 작용성 기로의 치환에 의하여 변형될 수 있다. 치환은 올리고뉴클레오티드의 3' 또는 5' 단부에서 수행될 수 있으며, 단량체의 센스 및 안티센스 가닥 둘다의 3' 단부에서 수행되는 것이 바람직하지만, 항상 이에 제한되는 것은 아니다. 화학적 작용기는 예를 들면 술프히드릴 기(-SH), 카르복실 기(-COOH), 아민 기(-NH2), 히드록시 기(-OH), 포르밀 기(-CHO), 카르보닐 기(-CO-), 에테르 기(-O-), 에스테르 기(-COO-), 니트로 기(-NO2), 아지드 기(-N3) 또는 술폰산 기(-SO3H)를 포함할 수 있다.In the present invention, the oligonucleotide may be modified by substitution with a chemical functional group at the terminal end. Substitutions may be made at the 3' or 5' end of the oligonucleotide, preferably, but not always, at the 3' end of both the sense and antisense strands of the monomer. Chemical functional groups are, for example, sulfhydryl groups (-SH), carboxyl groups (-COOH), amine groups (-NH2), hydroxy groups (-OH), formyl groups (-CHO), carbonyl groups ( -CO-), an ether group (-O-), an ester group (-COO-), a nitro group (-NO2), an azide group (-N3) or a sulfonic acid group (-SO3H).
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드를 포함하는 발현 벡터; 또는 상기 발현 벡터로부터 형질 전환된 숙주 세포에 관한 것이다. According to another embodiment of the present invention, an expression vector comprising the oligonucleotide provided by the present invention; or to a host cell transformed from the expression vector.
본 발명의 발현 벡터는, 바람직하게는 발현 가능한 형태로 본 발명의 올리고뉴클레오티드를 암호화한다. 본 명세서에 있어서, 용어 "발현 가능한 형태(in an expressible form)"는 숙주 세포에 도입할 경우, 그 벡터가 그 분자를 발현되는 것을 의미한다. 바람직한 일 예시로, 상기 발현 벡터는 올리고뉴클레오티드의 발현에 필요한 조절 요소를 포함한다. 본 발명의 발현 벡터는 본 발명의 올리고뉴클레오티드의 생산에 사용되거나, 직접 암 치료, 피부 개선 또는 상처 치료를 위한 활성 성분으로서 사용될 수 있다.The expression vector of the present invention encodes the oligonucleotide of the present invention, preferably in an expressible form. As used herein, the term "in an expressible form" means that the vector expresses the molecule when introduced into a host cell. In a preferred embodiment, the expression vector includes regulatory elements necessary for expression of the oligonucleotide. The expression vector of the present invention can be used for production of the oligonucleotide of the present invention, or can be directly used as an active ingredient for cancer treatment, skin improvement or wound treatment.
본 발명의 발현 벡터는, 예를 들면, 양쪽 가닥의 발현을 허용하는 방법으로(DNA 분자의 전사에 의해), 조절 서열이 CX 서열에 기능적으로 연결되어 있는 발현 벡터 내로 CX 서열을 클로닝하는 방법에 의해, 제작될 수 있다(Lee NS et al., Nat Biotechnol 2002 May ,20(5):500-5). 예를 들면, 올리고뉴클레오티드 중 안티센스 가닥인 RNA 분자는 제1 프로모터(예를 들면, 클로닝된 DNA의 3' 말단에 인접하는 프로모터 서열)에 의해 전사되고, 센스 가닥인 RNA 분자는, 제2 프로모터(예를 들면, 클로닝된 DNA의 5' 말단에 인접하는 프로모터 서열)에 의해 전사된다. 센스 가닥과 안티 센스 가닥은, 생체 내에서 혼성화하고, 해당 유전자를 침묵(silencing)하는 올리고뉴클레오티드 분자 구조물을 생성한다. 게다가, 클로닝된 서열은 ２차구조(예를 들면 헤어핀)를 갖는 구조물을 암호화할 수 있다. The expression vector of the present invention can be used in a method of cloning a CX sequence into an expression vector in which the regulatory sequence is functionally linked to the CX sequence, for example, in a method that allows expression of both strands (by transcription of a DNA molecule). by (Lee NS et al., Nat Biotechnol 2002 May, 20(5):500-5). For example, an RNA molecule that is the antisense strand of the oligonucleotide is transcribed by a first promoter (eg, a promoter sequence adjacent to the 3' end of the cloned DNA), and an RNA molecule that is the sense strand is transcribed by a second promoter ( eg, a promoter sequence flanking the 5' end of the cloned DNA). The sense strand and the anti-sense strand hybridize in vivo and generate an oligonucleotide molecular construct that silencing the corresponding gene. In addition, the cloned sequence may encode a construct having a secondary structure (eg a hairpin).
본 발명의 발현 벡터는, 표적 세포의 게놈에 안정적으로 삽입시키기 위해서 이용될 수 있다(상동적 재조합 카세트 벡터의 설명에 관해서 Thomas KR & Capecchi MR, Cell 1987,51:503-12 참조). 예를 들면, Wolff et al., Science 1990,247:1465-8, 미국 특허 제5,580,859호; 제5,589,466호; 제5,804,566호; 제5,739,118호; 제5,736,524호; 제5,679,647호; 및 WO98/04720을 참조할 수 있다. DNA 베이스의 송달 기술의 예는, 「naked DNA」, 촉진성 [부피비카인(bupivicaine), 폴리머, 펩티드 매개(peptide-mediated)] 송달, 양이온의 지방질 복합체(cationic lipid complexes) 및 입자매개(particle-mediated) ["유전자총(gene gun)"] 또는 압력 매개 전달(pressure-mediated delivery) (예를 들면, 미국 특허 제5,922,687호를 참조)을 포함한다.The expression vector of the present invention can be used to stably insert into the genome of a target cell (for a description of a homologous recombination cassette vector, see Thomas KR & Capecchi MR, Cell 1987,51:503-12). See, eg, Wolff et al., Science 1990,247:1465-8, US Pat. No. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; and WO98/04720. Examples of DNA-based delivery technologies include "naked DNA", facilitative (bupivicaine, polymer, peptide-mediated) delivery, cationic lipid complexes and particle- mediated) ["gene gun"] or pressure-mediated delivery (see, eg, US Pat. No. 5,922,687).
본 발명에서 상기 발현 벡터는 비바이러스성 벡터 또는 바이러스성 벡터인 것이 바람직하고, 비바이러스성 벡터로는 플라스미드 DNA인 것이 바람직하며, 바이러스성 벡터로는 렌티바이러스(lentivirus), 레트로바이러스(retrovirus), 아데노바이러스(adenovirus), 허피스바이러스(herpes virus) 및 아비폭스바이러스(avipox virus) 벡터 등을 사용할 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the expression vector is preferably a non-viral vector or a viral vector, the non-viral vector is preferably a plasmid DNA, and the viral vector is a lentivirus, a retrovirus, Adenovirus (adenovirus), herpes virus (herpes virus) and avipox virus (avipox virus) vectors and the like may be used, but is not limited thereto.
또한, 본 발명에서 상기 발현 벡터는, 형질 전환된 세포의 선별을 용이하게 하기 위하여 선별 마커를 추가로 포함하는 것이 바람직하다. 예를 들어, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 단백질의 발현과 같은 선택가능 표현형을 부여하는 마커들, 예를 들어 녹색 형광 단백질, 퓨로마이신, 네오마이신, 하이그로마이신, 히스티디놀 디하이드로게나제(hisD) 및 구아닌 포스포리보실트랜스퍼라제(Gpt) 등을 예시할 수 있다.In addition, in the present invention, the expression vector preferably further includes a selection marker to facilitate selection of transformed cells. Markers that confer selectable phenotypes, such as, for example, drug resistance, auxotrophy, resistance to cytotoxic agents or expression of surface proteins, such as green fluorescent protein, puromycin, neomycin, hygromycin, Histidinol dehydrogenase (hisD) and guanine phosphoribosyltransferase (Gpt) can be exemplified.
본 발명에서 숙주 세포는 인간을 포함한 포유류의 체세포인 것이 바람직하고, 인간의 치료를 목적하는 조직 부위의 세포이거나, 그 부위의 암 세포 또는 암 줄기세포인 것이 더욱 바람직하나 이에 한정되지 않는다.In the present invention, the host cell is preferably a mammalian somatic cell, including a human, and more preferably a cell of a tissue site targeted for human treatment, or a cancer cell or cancer stem cell of that site, but is not limited thereto.
또한, 본 발명에서 상기 발현 벡터를 숙주 세포에 도입하기 위한 방법으로는 G-fectin, Mirus TrasIT-TKO 지질친화성 시약, 리포펙틴, 리포펙타민, 셀펙틴(cellfectin), 양이온성 인지질 나노입자, 양이온성 고분자, 양이온성 미셀, 양이온성 에멀젼 또는 리포좀을 포함하는 전달 시약과 함께 세포 내로 도입되거나, 폴리에틸렌글리콜과 같은 생체적합성 고분자를 접합하여 세포 내 흡수를 증가시킬 수 있으나, 이에 제한되는 것은 아니다.In addition, as a method for introducing the expression vector into a host cell in the present invention, G-fectin, Mirus TrasIT-TKO lipid affinity reagent, lipofectin, lipofectamine, cellfectin (cellfectin), cationic phospholipid nanoparticles, It may be introduced into cells together with a delivery reagent including a cationic polymer, cationic micelles, cationic emulsion or liposome, or may be conjugated to a biocompatible polymer such as polyethylene glycol to increase intracellular absorption, but is not limited thereto.
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 포함하는 암의 예방, 개선 또는 치료용 조성물, 암 줄기세포의 성장 억제용 조성물을 제공한다. According to another embodiment of the present invention, a composition for preventing, improving or treating cancer comprising the oligonucleotide, expression vector or transformed host cell provided in the present invention as an active ingredient, a composition for inhibiting growth of cancer stem cells to provide.
본 발명의 또 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 포함하는 암의 전이의 예방, 개선 또는 치료용 조성물에 관한 것이다.According to another embodiment of the present invention, it relates to a composition for preventing, improving or treating cancer metastasis, comprising the oligonucleotide, expression vector or transformed host cell provided in the present invention as an active ingredient.
본 발명에서 상기 암의 예방, 개선 또는 치료용 조성물, 암 줄기세포의 성장 억제용 조성물 또는 상기 암의 전이의 예방, 개선 또는 치료용 조성물은 약학적 조성물 또는 식품 조성물 등 다양한 용도로 활용될 수 있다.In the present invention, the composition for preventing, improving or treating cancer, the composition for inhibiting the growth of cancer stem cells, or the composition for preventing, improving or treating cancer metastasis can be used for various purposes, such as a pharmaceutical composition or a food composition. .
본 발명의 또 다른 구현 예에 따르면, 암을 예방, 개선 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효량으로 투여하는 단계를 포함하는, 암의 예방, 개선 또는 치료 방법에 관한 것이다.According to another embodiment of the present invention, in order to prevent, ameliorate or treat cancer, the step of administering an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention to a subject in need of treatment It relates to a method for preventing, ameliorating or treating cancer, including.
본 발명의 또 다른 구현 예에 따르면, 암의 전이를 예방, 개선 또는 치료하기 위하여, 치료를 필요로 하는 대상체에 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효량으로 투여하는 단계를 포함하는, 암의 전이의 예방, 개선 또는 치료 방법에 관한 것이다.According to another embodiment of the present invention, in order to prevent, ameliorate or treat cancer metastasis, an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention is administered to a subject in need of treatment. It relates to a method for preventing, ameliorating or treating cancer metastasis, comprising the steps of.
본 발명에서 상기 "치료를 필요로하는 대상체"란 암 또는 암 전이의 증상이 있거나 의심되어, 암 또는 암 줄기세포의 성장 또는 증식을 억제하는 등으로 암 또는 암 전이를 예방, 개선 또는 치료가 필요한 대상체일 수 있다.In the present invention, the "subject in need of treatment" means cancer or cancer metastasis, which is symptomatic or suspected, and requires prevention, improvement or treatment of cancer or cancer metastasis by inhibiting the growth or proliferation of cancer or cancer stem cells. It may be an object.
본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포는 암 세포 또는 암 줄기세포의 증식을 억제하거나 사멸을 유도할 수 있고, 혹은 암 줄기세포의 줄기세포능(stemness)을 억제할 수 있으며, 구체적으로는 암 줄기세포에 있어서 줄기세포능(stemness) 관련 마커인 nanog 및 OCT4 중 적어도 하나의 발현을 억제하고, 암 줄기세포에서 그 발현이 억제되는 CK18 및 KRT20 중 적어도 하나의 발현은 증가시켜 줄기세포능을 상실하도록 유도할 수 있다. The oligonucleotide, expression vector or transformed host cell provided in the present invention can inhibit the proliferation or death of cancer cells or cancer stem cells, or inhibit the stemness of cancer stem cells. Specifically, in cancer stem cells, the expression of at least one of nanog and OCT4, which are stemness-related markers, is suppressed, and the expression of at least one of CK18 and KRT20, the expression of which is suppressed in cancer stem cells, is increased This can lead to loss of stem cell function.
일반적으로 "암 줄기세포"란 줄기세포 특유의 능력인 자가재생이나 분화능력을 가지고 있는 포괄적인 의미의 암 세포를 의미한다.In general, "cancer stem cells" refers to cancer cells in a comprehensive sense that have the ability to self-renew or differentiate, which is a unique ability of stem cells.
본 발명에서 상기 "암"은 포유류에서 전형적으로 조절되지 않는 세포 성장으로 특징 지어진 생리적 상태를 나타내거나 가리킨다. 치료 및 예방 대상이 되는 암은 그 발생 부위에 따라 흑색종, 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 직장암, 소장암, 직장암, 식도암, 임파선암, 담낭암, 폐암, 피부암, 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암, 간암 등 일 수 있으나, 바람직하게는 흑색종 또는 폐암일 수 있으며, 종양의 분화 및/또는 증식 등 암의 진행이 본 발명에서 기술하는 암 줄기세포에 의존적인 암의 종류라면 이에 제한되지 않는다.In the present invention, the term “cancer” refers to or refers to a physiological condition typically characterized by unregulated cell growth in mammals. Cancers to be treated and prevented are melanoma, breast cancer, colorectal cancer, uterine cancer, fallopian tube cancer, ovarian cancer, stomach cancer, brain cancer, rectal cancer, small intestine cancer, rectal cancer, esophageal cancer, lymph gland cancer, gallbladder cancer, lung cancer, and skin cancer depending on the site of occurrence. , kidney cancer, bladder cancer, blood cancer, pancreatic cancer, prostate cancer, thyroid cancer, endocrine adenocarcinoma, oral cancer, liver cancer, etc., but may preferably be melanoma or lung cancer, and the progression of cancer such as tumor differentiation and / or proliferation It is not limited thereto as long as it is a cancer stem cell-dependent type of cancer described in the present invention.
이러한 암 세포로 분화할 수 있는 암 줄기세포는 악성 종양 조직 내에 1 ~ 2% 정도로 존재하며 정상줄기세포의 특성인 자가복제 능력 (self-renewal)과 다른 세포로 분화할 수 있는 전분화능 (pluripotent)을 가지고 있으나 자가 조절 기능에 이상이 있어 세포분열 활성화로 세포 수를 증가하게 되고 스스로 악성 종양 세포로 분화하는 것으로 보고되었다. Cancer stem cells capable of differentiating into these cancer cells exist in 1 to 2% of malignant tumor tissues, and have the characteristic of normal stem cells: self-renewal and pluripotent ability to differentiate into other cells. However, it has been reported that there is an abnormality in the self-regulatory function, which increases the number of cells by activation of cell division and differentiates itself into malignant tumor cells.
1997년 백혈병에서 암 줄기세포(cancer stem cell)의 존재가 밝혀진 이래로 (Blood, 1997), 유방암 (PNAS, 2003), 뇌종양 (Nature, 2004), 전립선암 (Cancer Res, 2005), 대장암 (Nature, 2007), 흑색종 (Nature, 2008)에서도 암 줄기세포가 존재한다는 증거들이 제시되었고. 종양에 포함되어있는 소수의 암 줄기세포가 종양의 악성화, 항암저항성 및 재발의 주된 원인으로 부각되었다.Since the existence of cancer stem cells in leukemia was revealed in 1997 (Blood, 1997), breast cancer (PNAS, 2003), brain tumor (Nature, 2004), prostate cancer (Cancer Res, 2005), colorectal cancer (Nature) , 2007) and melanoma (Nature, 2008) also provided evidence of the presence of cancer stem cells. A small number of cancer stem cells contained in tumors have emerged as the main cause of tumor malignancy, anticancer resistance, and recurrence.
암 줄기세포들은 다른 암 세포들과 구별되는 표지 인자(marker)가 존재하며, 암 줄기세포의 표지 인자(cancer stem cell marker)로는 하기 표 1과 같이 다양한 암 종 특이적인 암 줄기세포 표지 인자가 알려져 있다.Cancer stem cells have markers that distinguish them from other cancer cells, and various cancer stem cell markers specific to cancer are known as cancer stem cell markers as shown in Table 1 below. have.
암종carcinoma 암 줄기세포 표지인자Cancer stem cell markers 출처source
교모세포종glioblastoma CD133CD133
신장암kidney cancer CD105, CD133CD105, CD133 Contemp Oncol (Pozn). 2015; 19(1A): A44-A51Contemp Oncol (Pozn). 2015; 19(1A): A44-A51
갑상선암thyroid cancer ABCG2, MRP1, LRP 및 CXCR4ABCG2, MRP1, LRP and CXCR4 J Clin Pathol. 2014 Feb;67(2):125-33J Clin Pathol. 2014 Feb;67(2):125-33
급성골수성백혈병 (AMM)Acute myeloid leukemia (AMM) CD34+/CD38-CD34+/CD38-
다발성골수종 (multiple myeloma)multiple myeloma CD133-CD133-
유방암breast cancer CD44+/CD24-/lowCD44+/CD24-/low Breast Cancer Res. 2007; 9(3): 303Breast Cancer Res. 2007; 9(3): 303
대장암colorectal cancer CD133+CD133+
전립선암prostate cancer CD44+/α2β1hi/CD133+CD44+/α2β1hi/CD133+
흑색종 (melanoma)melanoma ABCB5+ABCB5+
폐암(Lung)Lung cancer CD44, CD90, CD133, ALDHCD44, CD90, CD133, ALDH Transl Lung Cancer Res. 2016 Jun; 5(3): 272-279.Transl Lung Cancer Res. 2016 Jun; 5(3): 272-279.
본 발명에서 성장 억제의 대상이 되는 암 줄기세포로는 상기 열거된 암의 줄기세포를 모두 포함할 수 있지만, 특히 유방암 줄기세포, 흑색종 줄기세포, 폐암 줄기세포 또는 대장암 줄기세포일 수 있다.In the present invention, the cancer stem cells that are the target of growth inhibition may include all of the above-listed cancer stem cells, but in particular may be breast cancer stem cells, melanoma stem cells, lung cancer stem cells or colorectal cancer stem cells.
상기한 암 줄기세포들은 끊임없이 자기 재생(self-renewal)을 하며, 실험 동물 모델에서 천개 미만의 적은 세포수로도 종양을 만들 수 있으며 악성 종양 세포로서의 능력을 보유하고 있다. 또한 암 치료법인 항암제 치료와 방사선 치료에 놀라울 정도로 저항성을 가지고 있어, 암 줄기세포의 제거는 암 치료의 성패를 가늠할 수 있는 바로미터로 점차 인식되고 있다. 최근에는 수술, 방사선 치료, 항암화학요법 등 기존의 여러 치료방법을 이용해 암 세포들을 사멸시키더라도 암 줄기세포들을 모두 사멸시키지 못한다면 남아있는 암 줄기세포들로부터 다시 암이 재발할 수 있다는 것으로 인식되고 있다. 이러한 암의 재발을 방지하기 위하여 종양을 재생성할 수 있는 능력을 가진 암 줄기세포를 타겟으로 하는 화학요법 및 이를 바탕으로 암을 치료하고자 하는 치료프로토콜 개발에 관심이 높아지고 있다.The above-described cancer stem cells constantly self-renew, can make tumors with a small number of less than a thousand cells in an experimental animal model, and have the ability as malignant tumor cells. In addition, as they have surprisingly resistance to chemotherapy and radiation therapy, which are cancer treatments, the removal of cancer stem cells is increasingly recognized as a barometer that can measure the success or failure of cancer treatment. Recently, it is recognized that cancer can recur from the remaining cancer stem cells even if cancer cells are killed using various existing treatment methods such as surgery, radiation therapy, and chemotherapy. . In order to prevent the recurrence of such cancer, interest in chemotherapy targeting cancer stem cells having the ability to regenerate tumors and development of a treatment protocol for treating cancer based on the chemotherapy is increasing.
정상 조직에서의 줄기세포는 자가 재생 (self-renewal) 기전에 의해 세포 성장과 분화를 조절하지만, 암 줄기세포는 종양세포 주변의 종양 미세환경 인자에 영향을 받아 비정상적인 자가분열(Self-renewal) 및 유지(maintenance) 경로를 활성화하여 급격히 집적됨으로서 악성화 되고 항암치료에 대한 저항성을 획득하게 되며 궁극적으로 암의 재발을 야기한다고 제시되고 있다. 그러나 아직까지 암 줄기세포의 집적 및 유지를 조절하는 종양 미세 환경 인자의 실체와 상호작용에 대한 구체적인 기전 연구는 진행되지 못하고 있다.Stem cells in normal tissues regulate cell growth and differentiation by a self-renewal mechanism, but cancer stem cells are affected by tumor microenvironmental factors around tumor cells, resulting in abnormal self-renewal and It is suggested that by activating the maintenance pathway, it rapidly accumulates, becomes malignant, acquires resistance to chemotherapy, and ultimately causes cancer recurrence. However, a detailed study of the mechanism of interaction with the entity of the tumor microenvironmental factors that control the accumulation and maintenance of cancer stem cells has not yet been conducted.
본 발명에서, "예방"은 본 발명의 약학적 조성물을 이용하여 암 증상을 차단하거나, 암 증상의 억제 또는 지연시키는 모든 행위라면 제한없이 포함할 수 있다. In the present invention, "prevention" may include, without limitation, any action that blocks cancer symptoms or suppresses or delays cancer symptoms using the pharmaceutical composition of the present invention.
본 발명에서, "치료"는 본 발명의 약학적 조성물을 이용하여 암 증상이 호전되거나 이롭게 되는 모든 행위라면 제한없이 포함할 수 있다. In the present invention, "treatment" may include, without limitation, any action in which cancer symptoms are improved or beneficial using the pharmaceutical composition of the present invention.
본 발명의 올리고뉴클레오티드, 발현 벡터, 형질 전환체 또는 약학적 조성물은 다른 항암제와도 추가로 병용 투여할 수 있으며, 이를 통해서 암 세포 및 암 줄기세포에 대한 성장 억제 효과를 더욱 증강시킬 수 있다.The oligonucleotide, expression vector, transformant or pharmaceutical composition of the present invention may be additionally administered in combination with other anticancer agents, thereby further enhancing the growth inhibitory effect on cancer cells and cancer stem cells.
여기서 상기 항암제로는 나이트로젠 머스타드, 이마티닙, 옥살리플라틴, 리툭시맙, 엘로티닙, 네라티닙, 라파티닙, 제피티닙, 반데타닙, 니로티닙, 세마사닙, 보수티닙, 악시티닙, 세디라닙, 레스타우르티닙, 트라스투주맙, 게피티니브, 보르테조밉, 수니티닙, 카보플라틴, 베바시주맙, 시스플라틴, 세툭시맙, 비스쿰알붐, 아스파라기나제, 트레티노인, 하이드록시카바마이드, 다사티닙, 에스트라머스틴, 겜투주맵오조가마이신, 이브리투모맙튜세탄, 헵타플라틴, 메칠아미노레불린산, 암사크린, 알렘투주맙, 프로카르바진, 알프로스타딜, 질산홀뮴 키토산, 젬시타빈, 독시플루리딘, 페메트렉세드, 테가푸르, 카페시타빈, 기메라신, 오테라실, 아자시티딘, 메토트렉세이트, 우라실, 시타라빈, 플루오로우라실, 플루다가빈, 에노시타빈, 플루타미드, 데시타빈, 머캅토푸린, 티오구아닌, 클라드리빈, 카르모퍼, 랄티트렉세드, 도세탁셀, 파클리탁셀, 이리노테칸, 벨로테칸, 토포테칸, 비노렐빈, 에토포시드, 빈크리스틴, 빈블라스틴, 테니포시드, 독소루비신, 이다루비신, 에피루비신, 미톡산트론, 미토마이신, 블레로마이신, 다우노루비신, 닥티노마이신, 피라루비신, 아클라루비신, 페프로마이신, 템시롤리무스, 테모졸로마이드, 부설판, 이포스파미드, 사이클로포스파미드, 멜파란, 알트레트민, 다카바진, 치오테파, 니무스틴, 클로람부실, 미토락톨, 레우코보린, 트레토닌, 엑스메스탄, 아미노글루테시미드, 아나그렐리드, 나벨빈, 파드라졸, 타목시펜, 토레미펜, 테스토락톤, 아나스트로졸, 레트로졸, 보로졸, 비칼루타미드, 로무스틴 및 카르무스틴으로 이루어진 군에서 선택된 1종 이상을 사용할 수 있으나, 이에 제한되는 것은 아니다. Here, the anticancer agent is nitrogen mustard, imatinib, oxaliplatin, rituximab, erlotinib, neratinib, lapatinib, gefitinib, vandetanib, nirotinib, semasanib, bosutinib, axitinib, cediranib , restautinib, trastuzumab, gefitinib, bortezomib, sunitinib, carboplatin, bevacizumab, cisplatin, cetuximab, viscumalbum, asparaginase, tretinoin, hydroxycarbamide, da satinib, estramustine, gemtuzumab ozogamicin, ibritumomab tuccetan, heptaplatin, methylaminolevulinic acid, amsacrine, alemtuzumab, procarbazine, alprostadil, holmium nitrate chitosan, gemsi Tabine, doxyfluridine, pemetrexed, tegafur, capecitabine, gimeracin, oteracil, azacitidine, methotrexate, uracil, cytarabine, fluorouracil, fludabine, enocitabine, flu Tamide, decitabine, mercaptopurine, thioguanine, cladribine, carmopher, raltitrexed, docetaxel, paclitaxel, irinotecan, belotecan, topotecan, vinorelbine, etoposide, vincristine, vinblastine, teniposide, doxorubicin, idarubicin, epirubicin, mitoxantrone, mitomycin, bleromycin, daunorubicin, dactinomycin, pyrarubicin, aclarubicin, pepromycin, temsirolimus, temozolomide, busulfan, ifosfamide, cyclophosphamide, melparan, altretmine, dacarbazine, thiotepa, nimustine, chlorambucil, mitolactol, leucovorin, tretonin, exemestane, From the group consisting of aminoglutethimide, anagrelide, nabelbine, padrazole, tamoxifen, toremifene, testolactone, anastrozole, letrozole, vorozole, bicalutamide, lomustine and carmustine One or more selected types may be used, but the present invention is not limited thereto.
본 발명에 있어서, 상기 올리고뉴클레오티드, 발현 벡터, 형질 전환체 또는 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 올리고뉴클레오티드, 발현 벡터, 형질 전환체 또는 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.In the present invention, the oligonucleotide, expression vector, transformant or pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the oligonucleotides, expression vectors, transformation The body or pharmaceutical composition may be characterized in that it targets humans.
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 포함하는 퇴행성 신경 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다.According to another embodiment of the present invention, it relates to a composition for preventing, improving or treating degenerative neurodegenerative diseases comprising the oligonucleotide, expression vector or transformed host cell provided in the present invention as an active ingredient.
본 발명에서 상기 퇴행성 신경 질환의 예방, 개선 또는 치료용 조성물은 약학적 조성물 또는 식품 조성물 등 다양한 용도로 활용될 수 있다.In the present invention, the composition for preventing, improving or treating neurodegenerative diseases may be used for various purposes, such as pharmaceutical compositions or food compositions.
본 발명의 다른 구현 예에 따르면, 목적하는 개체에 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효량으로 투여하는 단계를 포함하는, 퇴행성 신경 질환의 예방 또는 치료 방법에 관한 것이다. According to another embodiment of the present invention, it relates to a method for preventing or treating a neurodegenerative disease, comprising administering to a target subject an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention. .
본 발명에서 상기 "목적하는 개체"란, 퇴행성 신경 질환이 발병하였거나, 발병 가능성이 높은 개체를 의미한다. In the present invention, the "target individual" means an individual who has or has a high probability of developing a neurodegenerative disease.
본 발명에서 상기 퇴행성 신경 질환은 뇌졸중, 중풍, 기억력 상실, 기억력 손상, 치매, 건망증, 파킨슨병, 알츠하이머병, 피크(Pick)병, 크로이츠펠트-야콥(Creutzfeld-Kacob)병, 헌팅턴병 및 루게릭병으로 이루어진 군으로부터 선택된 것일 수 있으나, 이에 제한되지 않는다.In the present invention, the neurodegenerative diseases include stroke, stroke, memory loss, memory impairment, dementia, forgetfulness, Parkinson's disease, Alzheimer's disease, Pick's disease, Creutzfeld-Kacob's disease, Huntington's disease and Lou Gehrig's disease. It may be selected from the group consisting of, but is not limited thereto.
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 포함하는 면역 관련 질환의 예방, 개선 또는 치료용 조성물에 관한 것이다.According to another embodiment of the present invention, it relates to a composition for preventing, improving or treating an immune-related disease comprising the oligonucleotide, expression vector or transformed host cell provided by the present invention as an active ingredient.
본 발명에서 상기 면역 관련 질환의 예방, 개선 또는 치료용 조성물은 약학적 조성물, 화장료 조성물, 식품 조성물 등 다양한 용도로 활용될 수 있다.In the present invention, the composition for preventing, improving or treating immune-related diseases can be used for various purposes, such as pharmaceutical compositions, cosmetic compositions, and food compositions.
본 발명의 다른 구현 예에 따르면, 목적하는 개체에 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효량으로 투여하는 단계를 포함하는, 면역 관련 질환의 예방, 개선 또는 치료 방법에 관한 것이다. According to another embodiment of the present invention, there is provided a method for preventing, ameliorating or treating an immune-related disease, comprising administering an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention to a target subject. it's about
본 발명에서 상기 "목적하는 개체"란, 면역 관련 질환이 발병하였거나, 발병 가능성이 높은 개체를 의미한다. In the present invention, the "target individual" means an individual who has or is highly likely to develop an immune-related disease.
본 발명에서 상기 면역 관련 질환은 베체트병, 다발성 근육염/피부 근육염, 자가면역 혈구감소증, 자가면역 심근염, 아토피성 피부염, 천식, 일차성간경변, 피부근염, 굿파이처 증후군, 자가면역 뇌수막염, 쇼그렌 증후군, 전신 홍반성 루프스, 에디슨병, 원형 탈모증, 강직성 척수염, 자가면역성 간염, 자가면역성 이하선염, 크론병, 인슐린 의존성 당뇨병, 이영양성 수포성 표피박리증, 부고환염, 사구체 신염, 그레이브스병, 길랑바레 증후군, 하시모토병, 용혈성 빈혈, 다발성 경화증, 중증 근무력증, 심상천포창, 건선, 류마티스열, 류마티스 관절염, 유육종증, 피부 경화증, 척추관절증, 갑상선염, 혈관염, 백반증, 점액수종, 악성빈혈 및 궤양성 대장염으로 구성된 군으로부터 선택된 것일 수 있으나, 이에 제한되지 않는다.In the present invention, the immune-related disease is Behcet's disease, polymyositis/dermatomyositis, autoimmune cytopenia, autoimmune myocarditis, atopic dermatitis, asthma, primary liver cirrhosis, dermatomyositis, Goodpeitzer syndrome, autoimmune meningitis, Sjogren's syndrome , systemic lupus erythematosus, Addison's disease, alopecia areata, ankylosing myelitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, insulin-dependent diabetes mellitus, dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves disease, Guillain-Barré syndrome, Hashimoto disease, hemolytic anemia, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, spondyloarthropathies, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia and ulcerative colitis may be, but is not limited thereto.
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 포함하는 상처의 예방, 개선 또는 치료용 조성물에 관한 것이다.According to another embodiment of the present invention, it relates to a composition for preventing, improving or treating a wound comprising the oligonucleotide, expression vector or transformed host cell provided by the present invention as an active ingredient.
본 발명에서 상기 상처의 예방, 개선 또는 치료용 조성물은 상기 피부 상처 치료 활성으로 인해 약학적 조성물, 화장료 조성물, 피부 외용제, 식품 조성물 등 다양한 용도로 활용될 수 있다.In the present invention, the composition for preventing, improving or treating wounds can be used for various purposes such as pharmaceutical compositions, cosmetic compositions, external preparations for skin, food compositions, etc. due to the skin wound healing activity.
본 발명의 다른 구현 예에 따르면, 목적하는 개체에 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효량으로 투여하는 단계를 포함하는, 상처의 예방, 개선 또는 치료 방법에 관한 것이다. According to another embodiment of the present invention, it relates to a method for preventing, ameliorating or treating a wound, comprising administering an effective amount of an oligonucleotide, an expression vector, or a transformed host cell provided by the present invention to a target subject. .
본 발명에서 상기 "목적하는 개체"란, 피부에 상처가 발병하였거나, 발병 가능성이 높은 개체를 의미한다. In the present invention, the "target individual" refers to an individual having a skin injury or a high probability of occurrence.
본 발명에서 상기 상처는 창상, 욕창, 화상, 찰과상, 천자 궤양성 창상, 자상, 활성산소에 의한 만성 피부창상, 타박상, 절상, 인후 또는 구강 점막의 창상, 열상, 당뇨병성 궤양, 하지궤양, 고혈압허혈궤양, 정맥궤양 및 족부궤양으로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the wounds are wounds, bedsores, burns, abrasions, puncture ulcerative wounds, cuts, chronic skin wounds caused by active oxygen, bruises, cuts, cuts in the throat or oral mucosa, lacerations, diabetic ulcers, lower extremity ulcers, hypertension It may be selected from the group consisting of ischemic ulcers, venous ulcers and foot ulcers, but is not limited thereto.
본 발명의 다른 구현 예에 따르면, 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 포함하는 피부 개선용 조성물에 관한 것이다.According to another embodiment of the present invention, it relates to a composition for improving skin comprising the oligonucleotide, expression vector or transformed host cell provided in the present invention as an active ingredient.
본 발명에서 상기 피부 개선용 조성물은 상기 피부 상태 개선 활성으로 인해 약학적 조성물, 화장료 조성물, 피부 외용제, 식품 조성물 등 다양한 용도로 활용될 수 있다.In the present invention, the composition for improving skin can be used for various purposes, such as pharmaceutical compositions, cosmetic compositions, external preparations for skin, food compositions, etc. due to the skin condition improvement activity.
본 발명의 또 다른 구현 예에 따르면, 목적하는 개체에 본 발명에서 제공하는 올리고뉴클레오티드, 발현 벡터 또는 형질 전환된 숙주 세포를 유효량으로 투여하는 단계를 포함하는, 피부 개선 방법에 관한 것이다. According to another embodiment of the present invention, it relates to a method for improving skin, comprising administering to a target subject an effective amount of the oligonucleotide, expression vector or transformed host cell provided by the present invention.
본 발명에서 상기 "목적하는 개체"란, 피부 보습, 피부 미백, 피부 탄력 개선, 피부 재생, 주름 개선 또는 노화 방지 등의 피부 상태의 개선이 필요한 개체를 의미한다.In the present invention, the "target subject" means an individual in need of improvement of skin conditions such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement, or anti-aging.
본 발명에서 상기 "피부 개선"은 피부 보습, 피부 미백, 피부 탄력 개선, 피부 재생, 주름 개선 또는 노화 방지 등의 피부 상태를 개선시키는 기능을 의미하는 것이지만, 이에 제한되는 것은 아니다. In the present invention, the "skin improvement" refers to a function of improving skin conditions such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, wrinkle improvement, or anti-aging, but is not limited thereto.
또한, 본 발명에서 상기 피부 개선용 조성물은 상기 피부 상태 개선 활성으로 인해 미용 또는 치료적 목적의 필러용 조성물, 보다 상세하게는 필러 주사용 조성물로 매우 유용하게 사용될 수 있으며, 구체적인 예시로서 생물학적 조직의 필링(filling) 또는 대체를 위한 조성물, 주름의 필링(filling wrinkle), 안면의 리모델링(remodeling of the face) 또는 입술 용적(lip volume)의 증가를 위한 조성물, 메조테라피(mesotherapy)에 의한 피부의 재수화(rehydration) 치료에 사용하기 위한 조성물 등으로 유용하게 사용될 수 있다.In addition, in the present invention, the composition for improving skin can be very usefully used as a composition for cosmetic or therapeutic purposes, more specifically, a composition for filler injection due to the skin condition improvement activity, and as a specific example, A composition for filling or replacement, a composition for filling wrinkle, remodeling of the face or an increase in lip volume, rejuvenation of the skin by mesotherapy It can be usefully used as a composition for use in rehydration treatment.
본 발명의 올리고뉴클레오티드, 발현 벡터, 숙주 세포 또는 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.The oligonucleotide, expression vector, host cell, or pharmaceutical composition of the present invention is not limited thereto, but oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, etc., external preparations, suppositories, and sterilizations, respectively, according to conventional methods. It may be formulated in the form of an injection solution and used. The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, fragrances, etc., in the case of oral administration, and in the case of injections, buffers, preservatives, pain relief A topical agent, solubilizer, isotonic agent, stabilizer, etc. can be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. can be used. The dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.Meanwhile, examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, it may further include a filler, an anti-agglomeration agent, a lubricant, a wetting agent, a flavoring agent, an emulsifier, a preservative, and the like.
본 발명에 따른 올리고뉴클레오티드, 발현 벡터, 숙주 세포 또는 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. The route of administration of the oligonucleotide, expression vector, host cell or pharmaceutical composition according to the present invention is, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal. Oral or parenteral administration is preferred.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.In the present invention, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
본 발명의 올리고뉴클레오티드, 발현 벡터, 숙주 세포 또는 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약무형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50mg/kg 또는 0.001 내지 50mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.The oligonucleotide, expression vector, host cell or pharmaceutical composition of the present invention may contain the activity, age, weight, general health, sex, diet, administration time, administration route, excretion rate, drug formulation, and the specific compound to be prevented or treated of the specific compound used. It may vary depending on several factors including the severity of the disease, and the dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art. and may be administered at 0.0001 to 50 mg/kg or 0.001 to 50 mg/kg per day. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
본 발명의 올리고뉴클레오티드를 포함하는 발현 벡터의 경우 구체적으로 0.01 내지 500 mg을 함유하고, 보다 구체적으로 0.1 내지 300 mg을 함유하며, 본 발명의 miRNA를 포함하는 재조합 바이러스의 경우, 구체적으로 103~1012 IU(10 내지 1010 PFU)를 함유하고, 보다 구체적으로 105 내지 1010 IU를 함유하나, 이에 한정되지 않는다.In the case of an expression vector containing the oligonucleotide of the present invention, it specifically contains 0.01 to 500 mg, more specifically 0.1 to 300 mg, and in the case of a recombinant virus containing the miRNA of the present invention, specifically 10 3 ~ Contains 10 12 IU (10 to 10 10 PFU), more specifically 10 5 to 10 10 IU, but is not limited thereto.
또한, 본 발명의 발현 벡터가 형질 전환된 숙주 세포의 경우, 구체적으로 103 내지 108 개를 함유하고, 보다 구체적으로 104 내지 107개를 함유하나, 이에 한정되지 않는다.In addition, in the case of a host cell transformed with the expression vector of the present invention, it specifically contains 10 3 to 10 8 , and more specifically contains 10 4 to 10 7 , but is not limited thereto.
또한, 본 발명의 올리고뉴클레오티드를 포함하는 발현 벡터 또는 형질 전환된 숙주 세포를 유효성분으로 함유하는 조성물의 유효 용량은 체중 1 ㎏당 벡터의 경우에는 0.05 내지 12.5 ㎎/㎏, 재조합 바이러스의 경우에는 107 내지 1011 바이러스 입자(105 내지 109 IU)/㎏, 세포의 경우에는 103 내지 106 세포/㎏이고, 구체적으로 벡터의 경우에는 0.1 내지 10 ㎎/㎏, 재조합 바이러스의 경우에는 108 내지 1010 입자(106 내지 108 IU)/㎏, 세포의 경우에는 102 내지 105 세포/㎏이며, 하루 2 내지 3회 투여될 수 있다. 상기와 같은 조성은 반드시 이에 한정되는 것은 아니고, 환자의 상태 및 질환의 발병 정도에 따라 달라질 수 있다.In addition, the effective dose of the expression vector containing the oligonucleotide of the present invention or the composition containing the transformed host cell as an active ingredient is 0.05 to 12.5 mg/kg in the case of the vector per kg body weight, and 10 in the case of the recombinant virus. 7 to 10 11 virus particles (10 5 to 10 9 IU)/kg, 10 3 to 10 6 cells/kg for cells, specifically 0.1 to 10 mg/kg for vector, 10 for recombinant virus 8 to 10 10 particles (10 6 to 10 8 IU)/kg, and 10 2 to 10 5 cells/kg in the case of cells, and may be administered 2-3 times a day. The composition as described above is not necessarily limited thereto, and may vary depending on the condition of the patient and the degree of onset of the disease.
본 발명의 올리고뉴클레오티드로 조합시켜서 투여하기 위한 적절한 전달(delivery) 시약은, Mirus Transit TKO 지방가용성시약(lipophilic reagent), LipoTrustTM SR, 리포펙틴(lipofectin), 리포펙타민(lipofectamine), 셀펙틴(cellfectin) 또는 폴리양이온(polycations) (예를 들면 폴리 라이신(lysine)), 리포솜(liposome), 콜라겐 또는 아텔로콜라겐(atelocollagen)을 포함한다. 바람직한 딜리버리(delivery) 시약은 리포솜(liposome)이다.Suitable delivery reagents for administration in combination with the oligonucleotide of the present invention include Mirus Transit TKO lipophilic reagent, LipoTrust SR, lipofectin, lipofectamine, cellfectin. ) or polycations (eg poly lysine), liposomes, collagen or atelocollagen. A preferred delivery reagent is a liposome.
본 발명의 리포솜(liposome)은, 망막 또는 종양조직 등의 특정한 조직에 올리고뉴클레오티드의 송달을 보조할 수 있고, 올리고뉴클레오티드의 혈액 내 반감기를 증대시킬 수도 있다. 본 발명의 사용에 적합한 리포솜(liposome)은, 표준적인 소포형성 지방질(standard vesicle-forming lipid)로부터 형성되고, 일반적으로 중성 또는 음전하를 띄는 포스포리피드(negatively charged phospholipids) 및 콜레스테롤과 같은 스테롤(sterol)을 포함한다. 지방질의 선택은, 통상, 원하는 리보솜(liposome)의 크기 및 혈액 순환에 있어서의 리보솜(liposome)의 반감기 같은 요소를 고려해서 정해진다. 리보솜(liposome)을 준비하기 위한 각양각색인 방법이 공지되어 있으며, 예를 들면 Szoka et al., Ann Rev Biophys Bioeng 1980,9:467; 미국 특허 제4,235,871호; 제4,501,728호; 제4,837,028호; 제5,019,369호는 그 전체가 참조로 본 명세서에 사용될 수 있다.The liposome of the present invention can assist delivery of oligonucleotides to specific tissues such as retina or tumor tissue, and can also increase the half-life of the oligonucleotides in blood. Liposomes suitable for use in the present invention are formed from standard vesicle-forming lipids and are generally neutral or negatively charged phospholipids and sterols such as cholesterol. ) is included. The selection of lipids is usually determined in consideration of factors such as the size of a desired liposome and the half-life of the liposome in blood circulation. A variety of methods for preparing liposomes are known, see, eg, Szoka et al., Ann Rev Biophys Bioeng 1980, 9:467; US Pat. No. 4,235,871; No. 4,501,728; 4,837,028; No. 5,019,369 is incorporated herein by reference in its entirety.
본 발명의 올리고뉴클레오티드를 발현되는 벡터는 상기에서 기술하였다. 본 발명의 올리고뉴클레오티드를 발현하는 발현 벡터는, 직접 또는, Mirus Transit LT1 지방가용성시약, LipoTrustTMSR, 리포펙틴(lipofectin), 리포펙타민(lipofectamine), 셀펙틴(cellfectin), 폴리야이온(polycation) (예를 들면 폴리 라이신(lysine)) 또는 리보솜(liposome) 또는 콜라겐, 아텔로콜라겐(atelocollagen)등이 적절한 송달(delivery) 시약으로 조합되어서 투여될 수 있다. 본 발명의 올리고뉴클레오티드를 발현하는, 재조합 바이러스 벡터를 환자의 암 영역에 송달하는 방법은, 본 기술분야의 기술의 범위 내이다.Vectors expressing the oligonucleotides of the present invention have been described above. The expression vector expressing the oligonucleotide of the present invention is, directly or, Mirus Transit LT1 fat-soluble reagent, LipoTrustTMSR, lipofectin, lipofectamine, cellfectin (cellfectin), polycation (polycation) ( For example, poly lysine) or ribosomes or collagen, atelocollagen, etc. may be administered in combination with an appropriate delivery reagent. Methods of delivering a recombinant viral vector expressing an oligonucleotide of the present invention to a cancer region of a patient are within the skill of the art.
본 발명의 올리고뉴클레오티드는, 올리고뉴클레오티드를 암 영역에 송달하는데 적합한 어떠한 방법으로 대상에 투여될 수 있다. 예를 들면, 올리고뉴클레오티드는 유전자총, 전기충격법(electroporation) 혹은 다른 적절한 비경구적 또는 장내 투여 경로에 의해 투여될 수 있다.The oligonucleotides of the present invention may be administered to a subject by any method suitable for delivery of the oligonucleotides to a cancer region. For example, the oligonucleotides can be administered by gene gun, electroporation, or other suitable parenteral or enteral route of administration.
본 발명에서 적절한 장내 투여 경로는, 경구, 직장 또는 비강내 송달을 포함한다. 적절한 비경구투여경로는, 정맥내 투여 (예를 들면 정맥내 볼루스 주사(intravenous bolus injection), 정맥주입(intravenous infusion), 동맥내 볼루스 주사(intra-arterial bolus injection), 동맥주입((intra-arterial infusion) 및 맥관구조(vasculature)로 도뇨관 점적(catheter instillation)), 조직 주위 및 조직내 주입 (예를 들면 종양주위 및 종양내 주사, 망막내 주사 또는 망막하주사), 피하 주사 또는 피하주입을 포함하는 침전(deposition)(삼투압 펌프에 의한 것과 같이), 암의 영역 또는 부위주위에의 직접적인 처치, 예를 들면 도뇨관(catheter) 또는 다른 설치 수단 (예를 들면, 망막 소환약(retinal pellet), 좌약(suppository) 또는 다공성, 비다공성 혹은 젤라틴성 물질을 포함하는 임플란트(implant)), 및 흡입을 포함한다. 올리고뉴클레오티드 혹은 발현 벡터의 주사 또는 주입은 암의 부위 혹은 그 주변에 투여하는 것이 바람직하다.In the present invention, suitable enteral administration routes include oral, rectal or intranasal delivery. Suitable parenteral routes of administration include intravenous administration (eg, intravenous bolus injection, intravenous infusion), intra-arterial bolus injection, and intravenous infusion (intravenous injection). -arterial infusion) and catheter instillation into the vasculature), peri- and intra-tissue injections (eg peri- and intra-tumoral injections, intra-retinal injections or sub-retinal injections), subcutaneous injections or subcutaneous injections deposition (such as by means of an osmotic pump), direct treatment around the area or site of cancer, such as a catheter or other means of installation (eg, retinal pellet) , suppositories or implants containing porous, non-porous or gelatinous materials), and inhalation.Injection or injection of oligonucleotides or expression vectors is preferably administered to or around the cancer site. do.
본 발명의 올리고뉴클레오티드는 단일 용량 혹은 복수 용량으로 투여할 수 있다. 본 발명의 올리고뉴클레오티트가 주입되는 경우, 주입은 단일 유지된 용량(single sustained dose) 또는 다중 주입(multiple infusion)에 의해 투여할 수 있다. 조직에의 직접적인 약제의 주사는, 암의 부위 또는 암 주위; 신경 부위 또는 신경 주위; 혈액; 상처 부위 또는 상처 주위; 또는 피부가 개선될 부위; 등이 바람직하다. 상기 부위에 대한 다중 주사는, 특히 바람직하다.The oligonucleotide of the present invention may be administered in a single dose or in multiple doses. Where the oligonucleotides of the present invention are to be infused, the infusion may be administered by a single sustained dose or by multiple infusion. Injection of the drug directly into the tissue may be performed at or around the cancer site; at or around a nerve; blood; at or around the wound; or the area where the skin is to be improved; etc. are preferable. Multiple injections to the site are particularly preferred.
본 발명에서 화장료 조성물은 화장수, 영양로션, 영양에센스, 마사지 크림, 미용 목욕물 첨가제, 바디로션, 바디밀크, 배스오일, 베이비오일, 베이비파우더, 샤워겔, 샤워크림, 선스크린로션, 선스크린크림, 선탠크림, 스킨로션, 스킨크림, 자외선차단용 화장품, 크렌징밀크, 탈모제화장용, 페이스 및 바디로션, 페이스 및 바디크림, 피부미백크림, 핸드로션, 헤어로션, 화장용크림, 쟈스민오일, 목욕비누, 물비누, 미용비누, 샴푸, 손세정제(핸드클리너), 약용비누비의료용, 크림비누, 페이셜 워시, 전신 세정제, 두피 세정제, 헤어린스, 화장비누, 치아미백용 겔, 치약 등의 형태로 제조될 수 있다. 이를 위해 본 발명의 조성물은 화장료 조성물의 제조에 통상적으로 사용하는 용매나, 적절한 담체, 부형제 또는 희석제를 더 포함할 수 있다.In the present invention, the cosmetic composition includes lotion, nutritional lotion, nutritional essence, massage cream, cosmetic bath water additive, body lotion, body milk, bath oil, baby oil, baby powder, shower gel, shower cream, sunscreen lotion, sunscreen cream, Suntan cream, skin lotion, skin cream, sunscreen cosmetics, cleansing milk, depilatory makeup, face and body lotion, face and body cream, skin whitening cream, hand lotion, hair lotion, cosmetic cream, jasmine oil, bath soap , water soap, beauty soap, shampoo, hand sanitizer (hand cleaner), medicated soap, medical, cream soap, facial wash, body cleaner, scalp cleaner, hair rinse, cosmetic soap, tooth whitening gel, toothpaste, etc. can To this end, the composition of the present invention may further include a solvent or an appropriate carrier, excipient or diluent commonly used in the preparation of cosmetic compositions.
본 발명의 화장료 조성물 내에 더 추가될 수 있는 용매의 종류는 특별히 한정하지 않으나, 예를 들어, 물, 식염수, DMSO 또는 이들의 조합을 사용할 수 있고, 담체, 부형제 또는 희석제로는 정제수, 오일, 왁스, 지방산, 지방산 알콜, 지방산 에스테르, 계면활성제, 흡습제(humectant), 증점제, 항산화제, 점도 안정화제, 킬레이팅제, 완충제, 저급 알콜 등이 포함되지만, 이에 제한되는 것은 아니다. 또한, 필요에 따라 미백제, 보습제, 비타민, 자외선 차단제, 향수, 염료, 항생제, 항박테리아제, 항진균제를 포함할 수 있다. The type of solvent that can be further added to the cosmetic composition of the present invention is not particularly limited, but for example, water, saline, DMSO, or a combination thereof may be used, and as a carrier, excipient or diluent, purified water, oil, wax , fatty acids, fatty alcohols, fatty acid esters, surfactants, humectants, thickeners, antioxidants, viscosity stabilizers, chelating agents, buffers, lower alcohols, and the like. In addition, if necessary, it may include a whitening agent, a moisturizer, a vitamin, a sunscreen, a perfume, a dye, an antibiotic, an antibacterial agent, an antifungal agent.
상기 오일로서는 수소화 식물성유, 피마자유, 면실유, 올리브유, 야자인유, 호호바유, 아보카도유가 이용될 수 있으며, 왁스로는 밀랍, 경랍, 카르나우바, 칸델릴라, 몬탄, 세레신, 액체 파라핀, 라놀린이 이용될 수 있다.Hydrogenated vegetable oil, castor oil, cottonseed oil, olive oil, palm oil, jojoba oil, and avocado oil may be used as the oil. As the wax, beeswax, spermaceti, carnauba, candelilla, montan, ceresin, liquid paraffin, and lanolin may be used. can be used
지방산으로는 스테아르산, 리놀레산, 리놀렌산, 올레산이 이용될 수 있고, 지방산 알콜로는 세틸 알콜, 옥틸 도데칸올, 올레일 알콜, 판텐올, 라놀린 알콜, 스테아릴 알콜, 헥사데칸올이 이용될 수 있으며 지방산 에스테르로는 이소프로필 미리스테이트, 이소프로필 팔미테이트, 부틸 스테아레이트가 이용될 수 있다. 계면 활성제로는 당업계에 알려진 양이온 계면활성제, 음이온 계면활성제 및 비이온성 계면활성제가 사용가능하며 가능한 한 천연물 유래의 계면활성제가 바람직하다.As the fatty acid, stearic acid, linoleic acid, linolenic acid, and oleic acid may be used, and as the fatty acid alcohol, cetyl alcohol, octyl dodecanol, oleyl alcohol, panthenol, lanolin alcohol, stearyl alcohol, and hexadecanol may be used. As the fatty acid ester, isopropyl myristate, isopropyl palmitate, and butyl stearate may be used. As the surfactant, cationic surfactants, anionic surfactants and nonionic surfactants known in the art can be used, and surfactants derived from natural products are preferred as far as possible.
그 외에도 화장품 분야에서 널리 알려진 흡습제, 증점제, 항산화제 등을 포함할 수 있으며, 이들의 종류와 양은 당업계에 공지된 바에 따른다. In addition, it may include a desiccant, a thickener, an antioxidant, etc. widely known in the cosmetic field, and the types and amounts thereof are as known in the art.
본 발명의 식품 조성물은 각종 식품류, 예를 들어, 음료, 껌, 차, 비타민 복합제, 분말, 과립, 정제, 캡슐, 과자, 떡, 빵 등의 형태로 제조될 수 있다. 본 발명의 식품 조성물은 독성 및 부작용이 거의 없는 식물추출물로 구성된 것이므로 예방 목적으로 장기간 복용 시에도 안심하고 사용할 수 있다.The food composition of the present invention may be prepared in the form of various foods, for example, beverages, gums, tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, and the like. Since the food composition of the present invention is composed of a plant extract having little toxicity and side effects, it can be safely used even when taken for a long period of time for prophylactic purposes.
본 발명의 올리고뉴클레오티드, 발현 벡터 또는 숙주 세포가 식품 조성물에 포함될 때 그 양은 전체 중량의 0.1 내지 50%의 비율로 첨가할 수 있다.When the oligonucleotide, expression vector or host cell of the present invention is included in the food composition, the amount may be added in a proportion of 0.1 to 50% of the total weight.
여기서, 상기 식품 조성물이 음료 형태로 제조되는 경우 지시된 비율로 상기 식품 조성물을 함유하는 것 외에 특별한 제한점은 없으며 통상의 음료와 같이 여러가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 즉, 천연 탄수화물로서 포도당 등의 모노사카라이드, 과당 등의 디사카라이드, 슈크로스 등의 및 폴리사카라이드, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜 등을 포함할 수 있다. 상기 향미제로서는 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등) 등을 들 수 있다.Here, when the food composition is prepared in the form of a beverage, there is no particular limitation other than containing the food composition in the indicated ratio, and it may contain various flavoring agents or natural carbohydrates as additional ingredients like a conventional beverage. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, polysaccharides such as sucrose, and common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol are included. can do. Examples of the flavoring agent include natural flavoring agents (taumartin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
그 외 본 발명의 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다.In addition, the food composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners , pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like.
이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 그렇게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.1 내지 약 50 중량부의 범위에서 선택되는 것이 일반적이다.These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected in the range of 0.1 to about 50 parts by weight per 100 parts by weight of the composition of the present invention.
본 발명에서 제공하는 올리고뉴클레오티드는 안정적으로 인체 내에 도입되어 암 세포의 성장을 효과적으로 억제해 암을 예방 및/또는 치료할 수 있으며, 더 나아가서는 암의 내성, 전이 및 재발 또한 방지할 수 있다. The oligonucleotide provided by the present invention can be stably introduced into the human body to effectively inhibit the growth of cancer cells to prevent and/or treat cancer, and furthermore, to prevent cancer resistance, metastasis and recurrence.
본 발명에서 제공하는 올리고뉴클레오티드는 퇴행성 신경 질환을 효과적으로 예방, 개선 또는 치료할 수 있다. The oligonucleotide provided by the present invention can effectively prevent, improve or treat neurodegenerative diseases.
본 발명에서 제공하는 올리고뉴클레오티드는 면역 반응을 효과적으로 억제함으로써 이와 연관된 다양한 면역 관련 질환 용도로 이용될 수 있다.The oligonucleotide provided by the present invention can be used for various immune-related diseases related thereto by effectively suppressing an immune response.
본 발명에서 제공하는 올리고뉴클레오티드는 상처 부위로 세포 이동을 촉진하여 우수한 상처 치료 또는 상처 치료 촉진 활성을 갖는다.The oligonucleotide provided by the present invention has excellent wound healing or wound healing promoting activity by promoting cell migration to a wound site.
본 발명에서 제공하는 올리고뉴클레오티드는 피부 투과도가 우수하면서, 흡수 시 피부 보습, 피부 미백, 피부 탄력 개선, 피부 재생, 주름 개선 및 노화 방지 등의 피부 개선 효과가 우수할 뿐만 아니라, 피부에 대한 자극이나 부작용이 없고 안전하다.The oligonucleotide provided in the present invention has excellent skin permeability and has excellent skin improvement effects such as skin moisturizing, skin whitening, skin elasticity improvement, skin regeneration, anti-wrinkle improvement, and anti-aging when absorbed, as well as irritation or irritation to the skin. It has no side effects and is safe.
도 1은 실험예 1에서 폐암 세포에 hsa-miR-503-3p(PSI-501) 및 이의 유사체1 내지 유사체23의 올리고뉴클레오티드를 형질 전환시킨 뒤 상기 폐암 세포의 생존율을 확인한 결과를 그래프로 나타낸 것이다. 1 is a graph showing the results of confirming the survival rate of lung cancer cells after transforming lung cancer cells with oligonucleotides of hsa-miR-503-3p (PSI-501) and its analogs 1 to 23 in Experimental Example 1. .
도 2는 실험예 1에서 폐암 세포에 hsa-miR-503-3p(PSI-501) 및 이의 유사체24 내지 유사체31의 올리고뉴클레오티드를 형질 전환시킨 뒤 상기 폐암 세포의 생존율을 확인한 결과를 그래프로 나타낸 것이다.2 is a graph showing the results of confirming the survival rate of lung cancer cells after transforming lung cancer cells with oligonucleotides of hsa-miR-503-3p (PSI-501) and its analogs 24 to 31 in Experimental Example 1. .
도 3은 실험예 3에서 폐암 세포를 이식받은 동물 모델에서 hsa-miR-503-3p(PSI-501) 및 이의 유사체28 및 유사체31의 올리고뉴클레오티드를 투여하였을 때 종양의 크기를 나타낸 것이다.3 shows the size of a tumor when hsa-miR-503-3p (PSI-501) and its analogues 28 and 31 oligonucleotides were administered in an animal model transplanted with lung cancer cells in Experimental Example 3.
도 4는 실험예 3에서 폐암 세포를 이식받은 동물 모델에서 hsa-miR-503-3p(PSI-501) 및 이의 유사체28, 유사체31의 올리고뉴클레오티드를 투여하였을 때 투여시점마다 종양의 크기를 확인하여 그래프로 나타낸 것이다.4 shows the size of the tumor at each administration point when hsa-miR-503-3p (PSI-501) and its analogues 28 and 31 oligonucleotides were administered in an animal model transplanted with lung cancer cells in Experimental Example 3, shown graphically.
본 발명의 일 목적은 hsa-miR-503-3p, hsa-miR-328-3p, hsa-miR-6514-5p 의 유사체인 신규한 올리고뉴클레오티드를 제공하는 것을 목적으로 한다. One object of the present invention is to provide a novel oligonucleotide that is an analog of hsa-miR-503-3p, hsa-miR-328-3p, and hsa-miR-6514-5p.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
[실시예[Example ] 올리고리보뉴클레오타이드의 준비] Preparation of oligoribonucleotides
하기 표 2에 나타낸 염기 서열로 표시되는 총 31종의 올리고리보뉴클레오타이드를 합성하였다.A total of 31 oligoribonucleotides represented by the nucleotide sequences shown in Table 2 below were synthesized.
올리고리보뉴클레오타이드 종류Oligoribonucleotide types 염기 서열base sequence
hsa-miR-503-3p-유사체1hsa-miR-503-3p-analog 1 cggguauuguuuccgcugccagg(서열번호 7)cggguauuguuuccgcugccagg (SEQ ID NO: 7)
hsa-miR-503-3p-유사체2hsa-miR-503-3p-analog 2 gcgguauuguuuccgcugccagg(서열번호 8)gcgguauuguuuccgcugccagg (SEQ ID NO: 8)
hsa-miR-503-3p-유사체3hsa-miR-503-3p-analog 3 ggcguauuguuuccgcugccagg(서열번호 9)ggcguauuguuuccgcugccagg (SEQ ID NO: 9)
hsa-miR-503-3p-유사체4hsa-miR-503-3p-analog 4 gggcuauuguuuccgcugccagg(서열번호 10)gggcuauuguuuccgcugccagg (SEQ ID NO: 10)
hsa-miR-503-3p-유사체5hsa-miR-503-3p-analog 5 ggggaauuguuuccgcugccagg(서열번호 11)ggggaauuguuuccgcugccagg (SEQ ID NO: 11)
hsa-miR-503-3p-유사체6hsa-miR-503-3p-analog 6 gggguuuuguuuccgcugccagg(서열번호 12)gggguuuuguuuccgcugccagg (SEQ ID NO: 12)
hsa-miR-503-3p-유사체7hsa-miR-503-3p-analog 7 gggguaauguuuccgcugccagg(서열번호 13)gggguaauguuuccgcugccagg (SEQ ID NO: 13)
hsa-miR-503-3p-유사체8hsa-miR-503-3p-analog 8 gggguauaguuuccgcugccagg(서열번호 14)gggguauaguuuccgcugccagg (SEQ ID NO: 14)
hsa-miR-503-3p-유사체9hsa-miR-503-3p-analog 9 gggguauucuuuccgcugccagg(서열번호 15)gggguauucuuuccgcugccagg (SEQ ID NO: 15)
hsa-miR-503-3p-유사체10hsa-miR-503-3p-analog 10 gggguauugauuccgcugccagg(서열번호 16)gggguauugauuccgcugccagg (SEQ ID NO: 16)
hsa-miR-503-3p-유사체11hsa-miR-503-3p-analog 11 gggguauuguauccgcugccagg(서열번호 17)gggguauuguauccgcugccagg (SEQ ID NO: 17)
hsa-miR-503-3p-유사체12hsa-miR-503-3p-analog 12 gggguauuguuaccgcugccagg(서열번호 18)gggguauuguuaccgcugccagg (SEQ ID NO: 18)
hsa-miR-503-3p-유사체13hsa-miR-503-3p-analog 13 gggguauuguuugcgcugccagg(서열번호 19)gggguauuguuugcgcugccagg (SEQ ID NO: 19)
hsa-miR-503-3p-유사체14hsa-miR-503-3p-analog 14 gggguauuguuucggcugccagg(서열번호 20)gggguauuguuucggcugccagg (SEQ ID NO: 20)
hsa-miR-503-3p-유사체15hsa-miR-503-3p-analog 15 gggguauuguuuccccugccagg(서열번호 21)gggguauuguuucccugccagg (SEQ ID NO: 21)
hsa-miR-503-3p-유사체16hsa-miR-503-3p-analog 16 gggguauuguuuccggugccagg(서열번호 22)gggguauuguuuccggugccagg (SEQ ID NO: 22)
hsa-miR-503-3p-유사체17hsa-miR-503-3p-analog 17 gggguauuguuuccgcagccagg(서열번호 23)gggguauuguuuccgcagccagg (SEQ ID NO: 23)
hsa-miR-503-3p-유사체18hsa-miR-503-3p-analog 18 gggguauuguuuccgcucccagg(서열번호 24)gggguauuguuuccgcucccagg (SEQ ID NO: 24)
hsa-miR-503-3p-유사체19hsa-miR-503-3p-analog 19 gggguauuguuuccgcuggcagg(서열번호 25)gggguauuguuuccgcuggcagg (SEQ ID NO:25)
hsa-miR-503-3p-유사체20hsa-miR-503-3p-analog 20 gggguauuguuuccgcugcgagg(서열번호 26)gggguauuguuuccgcugcgagg (SEQ ID NO: 26)
hsa-miR-503-3p-유사체21hsa-miR-503-3p-analog 21 gggguauuguuuccgcugccugg(서열번호 27)gggguauuguuuccgcugccugg (SEQ ID NO: 27)
hsa-miR-503-3p-유사체22hsa-miR-503-3p-analog 22 gggguauuguuuccgcugccacg(서열번호 28)gggguauuguuuccgcugccacg (SEQ ID NO: 28)
hsa-miR-503-3p-유사체23hsa-miR-503-3p-analog 23 gggguauuguuuccgcugccagc(서열번호 29)gggguauuguuuccgcugccagc (SEQ ID NO: 29)
hsa-miR-503-3p-유사체24hsa-miR-503-3p-analog 24 gggguauuauuuacaaaaaaagg(서열번호 30)gggguauuauuuacaaaaaaagg (SEQ ID NO: 30)
hsa-miR-503-3p-유사체25hsa-miR-503-3p-analog 25 gggguauucuuucccccccccgg(서열번호 31)gggguauucuuucccccccccgg (SEQ ID NO: 31)
hsa-miR-503-3p-유사체26hsa-miR-503-3p-analog 26 gggguauuuuuuucuuuuuuugg(서열번호 32)gggguauuuuuuuuuuuuuuugg (SEQ ID NO: 32)
hsa-miR-503-3p-유사체27hsa-miR-503-3p-analog 27 gggguauuguuugcggggggggg(서열번호 33)gggguauuguuugcgggggggg (SEQ ID NO: 33)
hsa-miR-503-3p-유사체28hsa-miR-503-3p-analog 28 gggguauucuuugccgacggugg(서열번호 34)gggguauucuuugccgacggugg (SEQ ID NO: 34)
hsa-miR-503-3p-유사체29hsa-miR-503-3p-analog29 gggguauuguuuccgcucccugg(서열번호 35)gggguauuguuuccgcucccugg (SEQ ID NO: 35)
hsa-miR-503-3p-유사체30hsa-miR-503-3p-analog 30 uggguauuguuuccgcugccagg(서열번호 36)uggguauuguuuccgcugccagg (SEQ ID NO: 36)
hsa-miR-503-3p-유사체31hsa-miR-503-3p-analog 31 uggguauuguuuccgcucccugg(서열번호 37)uggguauuguuuccgcucccugg (SEQ ID NO: 37)
[실험예 1] 암 치료 효과 확인[Experimental Example 1] Confirmation of cancer treatment effect
폐암 세포주에 대한 상기 올리고뉴클레오티드의 효과를 확인하여 그 결과를 도 1 및 2에 나타내었다. 폐암 세포주는 NCI-H460(ATCC, HTB-177)를 사용해서 분석을 진행하였으며 10% FBS (Hyclone, USA) 1% penicillin/streptomycin (WELGENE, Korea)을 포함하고 있는 RPMI-1640 (Hyclone, USA)에서 배양하였다. 세포들은 5% CO2,37℃세포 배양기에서 배양하였다. 이후, 96 웰(well) 플레이트에 NCI-H460 세포를 3000개 세포씩 분주하였고 밤새(over-night) 배양 후 형질 전환(transfection)을 진행하였다. 20nM의 hsa-miR-503-3p(PSI-503)을 리포펙타민(Lipofectamine) 2000 (Invitrogen, CA)을 이용해서 세포 안으로 형질 전환시켰다. 각 올리고뉴클레오티드의 처리 72시간 후 세포의 양을 세포 계수 키트(cell counting kit)-8 (Dojindo, Japan)을 이용해서 세포 양을 측정하였으며 이때 흡광도는 450nm 파장에서 1시간 반응 후 측정하였다.The effect of the oligonucleotide on lung cancer cell lines was confirmed, and the results are shown in FIGS. 1 and 2 . The lung cancer cell line was analyzed using NCI-H460 (ATCC, HTB-177) and RPMI-1640 (Hyclone, USA) containing 10% FBS (Hyclone, USA) and 1% penicillin/streptomycin (WELGENE, Korea) cultured in Cells were cultured in 5% CO 2 ,37° C. cell incubator. Then, 3000 cells of NCI-H460 cells were dispensed in a 96-well plate, and cultured overnight (over-night) followed by transformation (transfection). 20 nM of hsa-miR-503-3p (PSI-503) was transformed into cells using Lipofectamine 2000 (Invitrogen, CA). After 72 hours of treatment with each oligonucleotide, the amount of cells was measured using a cell counting kit-8 (Dojindo, Japan), and the absorbance was measured after reaction at 450 nm wavelength for 1 hour.
그 결과, 도 1 및 2에서 보는 바와 같이, 본 발명에 따른 올리고뉴클레오티드를 처리한 경우 암 세포의 사멸 효과를 확인할 수 있었다.As a result, as shown in FIGS. 1 and 2 , when the oligonucleotide according to the present invention was treated, the killing effect of cancer cells was confirmed.
[실험예 2] 세포 성장 억제효과[Experimental Example 2] Cell growth inhibitory effect
NCI-H460 세포주에서 평균 약물 민감도를 측정하여 그 결과를 표 3에 나타내었다. 구체적으로는, NCI-H460 세포주에서 50% 성장 억제 값(GI50)의 평균을 계산하였다. 데이터는 GI50값을 나타내는 몰랄 농도로 나타내었다. 이 값들은 각 엔드 포인트에 최적 농도 범위를 사용하여 결정하였다. 퍼센트 성장 억제는 7개의 흡광도 측정 [타임 제로(Tz), 성장 대조군(C), 5개의 약물 농도 수준에서의 성장 테스트(Ti)]을 사용하여 하기와 같이 계산하였다: The average drug sensitivity was measured in the NCI-H460 cell line, and the results are shown in Table 3. Specifically, the average of 50% growth inhibition values (GI50) in the NCI-H460 cell line was calculated. Data are presented as molar concentrations representing GI50 values. These values were determined using the optimal concentration range for each endpoint. Percent growth inhibition was calculated using 7 absorbance measurements [time zero (Tz), growth control (C), growth test at 5 drug concentration levels (Ti)] as follows:
Ti≥Tz 일때의 농도: [(Ti-Tz)/(C-Tz)]x100 공식을 이용하여 계산Concentration when Ti≥Tz: Calculated using the formula [(Ti-Tz)/(C-Tz)]x100
Ti<Tz 일때의 농도: [(Ti-Tz)/Tz]x100 공식을 이용하여 계산Concentration when Ti<Tz: Calculated using the formula [(Ti-Tz)/Tz]x100
50%의 성장 억제(GI50) 값은 [(Ti-Tz)/(C-Tz)]x100 = 50 으로부터 계산했으며, GI50 값은 약물 처리 동안 대조 군 세포에서 순 단백질 증가보다 50% 감소를 나타내는 약물의 농도이다.A growth inhibition (GI50) value of 50% was calculated from [(Ti-Tz)/(C-Tz)]x100 = 50, and the GI50 value was a drug representing a 50% decrease over net protein increase in control cells during drug treatment. is the concentration of
실험 물질test substance GI50(μM)GI50 (μM)
스크램블드 miRNAscrambled miRNA >5>5
PSI-503PSI-503 0.240.24
유사체 18analog 18 0.450.45
유사체 21analogue 21 0.820.82
유사체 26 analog 26 0.080.08
유사체 28analog 28 0.060.06
유사체 29analogue 29 0.160.16
유사체 31analog 31 0.080.08
그 결과 상기 표 3과 같이 hsa-miR-503-3p(PSI-503) 및 그 유사체에서 GI50 농도가 대조군인 스크램블드 miRNA(scrambled miRNA)에 비해 현저히 낮아 항암 효과가 있는 것을 확인하였다.As a result, as shown in Table 3, it was confirmed that the GI50 concentration in hsa-miR-503-3p (PSI-503) and its analogs was significantly lower than that of the control group, scrambled miRNA, to have an anticancer effect.
[실험예 3] 폐암 동물 모델에서의 효능 평가[Experimental Example 3] Efficacy evaluation in lung cancer animal model
hsa-miR-503-3p(PSI-503) 및 유사체 (x-28, x-31)의 항암 효능 시험을 확인하여 그 결과를 도 3 및 4에 나타내었다. BALB/c 누드 마우스에서 폐암 세포주를 이식한 NCI-H460 이종이식 동물 모델에, (i) 음성 대조군(스크램블드 miRNA), 2mg/kg, (ii) hsa-miR-503-3p(PSI-503), 2mg/kg, (iii) PSI-503 x-28, 2mg/kg, (iv) PSI-503 x-31, 2mg/kg를 투여하였고, 구체적인 실험 방법은 하기 (1) 내지 (5)의 과정과 같다.The anticancer efficacy tests of hsa-miR-503-3p (PSI-503) and analogs (x-28, x-31) were confirmed, and the results are shown in FIGS. 3 and 4 . In NCI-H460 xenograft animal model transplanted with lung cancer cell line in BALB/c nude mice, (i) negative control (scrambled miRNA), 2 mg/kg, (ii) hsa-miR-503-3p (PSI-503) , 2mg/kg, (iii) PSI-503 x-28, 2mg/kg, (iv) PSI-503 x-31, 2mg/kg were administered, and the specific experimental method is the procedure of (1) to (5) below. same as
(1) 세포주 배양(1) cell line culture
먼저 폐암 세포주인 NCI-H460를 배양하였다. 시험에 사용할 세포는 해동하여 세포배양용 플라스크에 넣고 37℃, 5% CO2인큐베이터(incubator MCO-170M, Panasonic, Japan)에서 배양하였다. 다음으로 세포주 이식일에 배양된 세포를 원심분리 튜브에 넣은 후 회수한 다음, 원심분리(125 x g, 5 분)하여 상층액을 버리고 PBS로 세포부유액(5 ×107세포/mL)을 제작하였다.First, a lung cancer cell line, NCI-H460, was cultured. Cells to be used for the test were thawed, placed in a cell culture flask, and cultured in an incubator at 37° C., 5% CO 2 (incubator MCO-170M, Panasonic, Japan). Next, the cells cultured on the day of cell line transplantation were placed in a centrifuge tube and recovered, and then centrifuged (125 x g, 5 min) to discard the supernatant and prepare a cell suspension (5 × 10 7 cells/mL) with PBS. .
(2) 세포주 이식(2) cell line transplantation
다음으로 세포주를 이식하였다. 순화기간 종료 후 익일에 체중을 측정한 후, 건강한 동물에 대하여 준비된 세포부유액(1×107세포/0.05mL)로 분주하고 0.05mL 매트리겔 매트릭스 페놀 레드-프리(Matrigel matrix phenol red-free)(356237, BD, U.S.A.)를 가하여 조제한 용액을 일회용 주사기에 충진하여 동물의 우측 등 부위의 피하에 0.1mL/head씩 투여하였다. 이식한 세포수는 5x106세포/head였다. 세포주의 이식 후에는 생착 및 성장기간 동안 매일 1 회 일반증상을 관찰하였다.Next, the cell line was transplanted. After measuring the body weight the next day after the completion of the acclimatization period , it was dispensed with a cell suspension (1×10 7 cells/0.05 mL) prepared for healthy animals, and 0.05 mL Matrigel matrix phenol red-free (Matrigel matrix phenol red-free) ( 356237, BD, USA) was added and the prepared solution was filled in a disposable syringe, and 0.1 mL/head was administered subcutaneously to the right back of the animal. The number of transplanted cells was 5x10 6 cells/head. After transplantation of the cell line, general symptoms were observed once daily during the engraftment and growth period.
(3) 군 분리(3) military segregation
세포를 이식하고 일정 기간 경과 후에 동물의 이상이 없는 동물에 대해 종양의 부피를 측정하여 약 평균 종양 볼륨이 80 ~ 120 mm3에 도달한 개체 60 마리를 선별하였다. 선별된 동물은 종양의 부피 및 체중을 기초로 하여 가능한 균등하도록 군당 10 마리씩, 총 6군으로 군 분리를 하였다.After cell transplantation and a certain period of time elapsed, the tumor volume was measured for an animal without any abnormality, and 60 individuals with an average tumor volume of about 80 to 120 mm 3 were selected. The selected animals were divided into 6 groups, 10 animals per group, to be as uniform as possible based on the tumor volume and body weight.
(4) 약물 투여(4) drug administration
시험 물질은 종양 내(intra tumoral) 투여하였고, 종양 내(intra tumoral) 투여는 인슐린 주사기(insulin syringe, BD, U.S.A.)를 이용하여 투여하였다(QD).The test substance was administered intratumorally, and intratumoral administration was administered using an insulin syringe (BD, U.S.A.) (QD).
도 3에서 보는 바와 같이, 스크램블드 miRNA에 비하여 hsa-miR-503-3p(PSI-503), 유사체 28 및 31을 투여한 경우가 종양이 현저히 감소한 것을 확인할 수 있었다. As shown in FIG. 3 , it was confirmed that the tumor was significantly reduced when hsa-miR-503-3p (PSI-503) and analogs 28 and 31 were administered compared to scrambled miRNA.
또한 도 4에서 보는 바와 같이, 유사체 31의 경우 대조군 및 다른 실시예에 비하여 종양 억제 효과가 특히 현저한 뛰어난 것을 알 수 있었다. In addition, as shown in FIG. 4 , it was found that analog 31 had a particularly remarkable tumor suppressive effect compared to the control group and other examples.
본 발명은 신규한 miRNA 유사체와 이의 다양한 용도에 관한 것이다.The present invention relates to novel miRNA analogs and various uses thereof.
서열번호 1: hsa-miR-503-3pSEQ ID NO: 1: hsa-miR-503-3p
gggguauuguuuccgcugccagggggguauuguuuccgcugccagg
서열번호 2: hsa-miR-328-3pSEQ ID NO: 2: hsa-miR-328-3p
cuggcccucucugcccuuccgucuggcccucucugcccuuccgu
서열번호 3: hsa-miR-6514-5pSEQ ID NO: 3: hsa-miR-6514-5p
uauggaguggacuuucagcuggcuauggaguggacuuucagcuggc
서열번호 4: seed sequence of hsa-miR-503-3pSEQ ID NO: 4: seed sequence of hsa-miR-503-3p
ggguauuggguauu
서열번호 5: seed sequence of hsa-miR-328-3pSEQ ID NO: 5: seed sequence of hsa-miR-328-3p
uggcccuuggcccu
서열번호 6: seed sequence of hsa-miR-6514-5pSEQ ID NO: 6: seed sequence of hsa-miR-6514-5p
auggaguauggagu
서열번호 7: hsa-miR-503-3p 유사체SEQ ID NO: 7: hsa-miR-503-3p analog
cggguauuguuuccgcugccaggcggguauuguuuccgcugccagg
서열번호 8: hsa-miR-503-3p 유사체SEQ ID NO: 8: hsa-miR-503-3p analog
gcgguauuguuuccgcugccagggcgguauuguuuccgcugccagg
서열번호 9: hsa-miR-503-3p 유사체SEQ ID NO: 9: hsa-miR-503-3p analog
ggcguauuguuuccgcugccaggggcguauuguuuccgcugccagg
서열번호 10: hsa-miR-503-3p 유사체SEQ ID NO: 10: hsa-miR-503-3p analog
gggcuauuguuuccgcugccagggggcuauuguuuccgcugccagg
서열번호 11: hsa-miR-503-3p 유사체SEQ ID NO: 11: hsa-miR-503-3p analog
ggggaauuguuuccgcugccaggggggaauuguuuccgcugccagg
서열번호 12: hsa-miR-503-3p 유사체SEQ ID NO: 12: hsa-miR-503-3p analog
gggguuuuguuuccgcugccagggggguuuuguuuccgcugccagg
서열번호 13: hsa-miR-503-3p 유사체SEQ ID NO: 13: hsa-miR-503-3p analog
gggguaauguuuccgcugccagggggguaauguuuccgcugccagg
서열번호 14: hsa-miR-503-3p 유사체SEQ ID NO: 14: hsa-miR-503-3p analog
gggguauaguuuccgcugccagggggguauaguuuccgcugccagg
서열번호 15: hsa-miR-503-3p 유사체SEQ ID NO: 15: hsa-miR-503-3p analog
gggguauucuuuccgcugccagggggguauucuuuccgcugccagg
서열번호 16: hsa-miR-503-3p 유사체SEQ ID NO: 16: hsa-miR-503-3p analog
gggguauugauuccgcugccagggggguauugauuccgcugccagg
서열번호 17: hsa-miR-503-3p 유사체SEQ ID NO: 17: hsa-miR-503-3p analog
GggguauuguauccgcugccaggGggguauuguauccgcugccagg
서열번호 18: hsa-miR-503-3p 유사체SEQ ID NO: 18: hsa-miR-503-3p analog
gggguauuguuaccgcugccagggggguauuguuaccgcugccagg
서열번호 19: hsa-miR-503-3p 유사체SEQ ID NO: 19: hsa-miR-503-3p analog
gggguauuguuugcgcugccagggggguauuguuugcgcugccagg
서열번호 20: hsa-miR-503-3p 유사체SEQ ID NO: 20: hsa-miR-503-3p analog
gggguauuguuucggcugccagggggguauuguuucggcugccagg
서열번호 21: hsa-miR-503-3p 유사체SEQ ID NO: 21: hsa-miR-503-3p analog
gggguauuguuuccccugccagggggguauuguuucccugccagg
서열번호 22: hsa-miR-503-3p 유사체SEQ ID NO: 22: hsa-miR-503-3p analog
gggguauuguuuccggugccagggggguauuguuuccggugccagg
서열번호 23: hsa-miR-503-3p 유사체SEQ ID NO: 23: hsa-miR-503-3p analog
gggguauuguuuccgcagccagggggguauuguuuccgcagccagg
서열번호 24: hsa-miR-503-3p 유사체SEQ ID NO: 24: hsa-miR-503-3p analog
gggguauuguuuccgcucccagggggguauuguuuccgcucccagg
서열번호 25: hsa-miR-503-3p 유사체SEQ ID NO: 25: hsa-miR-503-3p analog
gggguauuguuuccgcuggcagggggguauuguuuccgcuggcagg
서열번호 26: hsa-miR-503-3p 유사체SEQ ID NO: 26: hsa-miR-503-3p analog
gggguauuguuuccgcugcgagggggguauuguuuccgcugcgagg
서열번호 27: hsa-miR-503-3p 유사체SEQ ID NO: 27: hsa-miR-503-3p analog
gggguauuguuuccgcugccugggggguauuguuuccgcugccugg
서열번호 28: hsa-miR-503-3p 유사체SEQ ID NO: 28: hsa-miR-503-3p analog
gggguauuguuuccgcugccacggggguauuguuuccgcugccacg
서열번호 29: hsa-miR-503-3p 유사체SEQ ID NO: 29: hsa-miR-503-3p analog
gggguauuguuuccgcugccagcgggguauuguuuccgcugccagc
서열번호 30: hsa-miR-503-3p 유사체SEQ ID NO: 30: hsa-miR-503-3p analog
gggguauuauuuacaaaaaaagggggguauuauuuaaaaaaaagg
서열번호 31: hsa-miR-503-3p 유사체SEQ ID NO: 31: hsa-miR-503-3p analog
gggguauucuuucccccccccgggggguauucuuucccccccccgg
서열번호 32: hsa-miR-503-3p 유사체SEQ ID NO: 32: hsa-miR-503-3p analog
gggguauuuuuuucuuuuuuugggggguauuuuuuuuuuuuuuugg
서열번호 33: hsa-miR-503-3p 유사체SEQ ID NO: 33: hsa-miR-503-3p analog
gggguauuguuugcggggggggggggguauuguuugcggggggggg
서열번호 34: hsa-miR-503-3p 유사체SEQ ID NO: 34: hsa-miR-503-3p analog
gggguauucuuugccgacggugggggguauucuuugccgacggugg
서열번호 35: hsa-miR-503-3p 유사체SEQ ID NO: 35: hsa-miR-503-3p analog
gggguauuguuuccgcucccugggggguauuguuuccgcucccugg
서열번호 36: hsa-miR-503-3p 유사체SEQ ID NO: 36: hsa-miR-503-3p analog
uggguauuguuuccgcugccagg uggguauuguuuccgcugccagg
서열번호 37: hsa-miR-503-3p 유사체SEQ ID NO: 37: hsa-miR-503-3p analog
uggguauuguuuccgcucccugguggguauuguuuccgcucccugg
서열번호 38: hsa-miR-328-3p 유사체SEQ ID NO: 38: hsa-miR-328-3p analog
guggcccucucugcccuuccguguggcccucucugcccuuccgu
서열번호 39: hsa-miR-328-3p 유사체SEQ ID NO: 39: hsa-miR-328-3p analog
caggcccucucugcccuuccgucaggcccucucugcccuuccgu
서열번호 40: hsa-miR-328-3p 유사체SEQ ID NO: 40: hsa-miR-328-3p analog
cucgcccucucugcccuuccgucucgccccucucugcccuuccgu
서열번호 41: hsa-miR-328-3p 유사체SEQ ID NO: 41: hsa-miR-328-3p analog
cugccccucucugcccuuccgucugccccucucugcccuuccgu
서열번호 42: hsa-miR-328-3p 유사체SEQ ID NO: 42: hsa-miR-328-3p analog
cugggccucucugcccuuccgucugggccucucugcccuuccgu
서열번호 43: hsa-miR-328-3p 유사체SEQ ID NO: 43: hsa-miR-328-3p analog
cuggcgcucucugcccuuccgucuggcgcuucucugcccuuccgu
서열번호 44: hsa-miR-328-3p 유사체SEQ ID NO: 44: hsa-miR-328-3p analog
cuggccgucucugcccuuccgucuggccgucucugcccuuccgu
서열번호 45: hsa-miR-328-3p 유사체SEQ ID NO: 45: hsa-miR-328-3p analog
cuggcccacucugcccuuccgucuggccccacucugcccuuccgu
서열번호 46: hsa-miR-328-3p 유사체SEQ ID NO: 46: hsa-miR-328-3p analog
cuggcccugucugcccuuccgucuggcccugucugcccuuccgu
서열번호 47: hsa-miR-328-3p 유사체SEQ ID NO: 47: hsa-miR-328-3p analog
cuggcccucacugcccuuccgucuggccccucacugcccuuccgu
서열번호 48: hsa-miR-328-3p 유사체SEQ ID NO: 48: hsa-miR-328-3p analog
cuggcccucugugcccuuccgucuggcccucugugcccuuccgu
서열번호 49: hsa-miR-328-3p 유사체SEQ ID NO: 49: hsa-miR-328-3p analog
cuggcccucucagcccuuccgucuggcccucucagcccuuccgu
서열번호 50: hsa-miR-328-3p 유사체SEQ ID NO: 50: hsa-miR-328-3p analog
cuggcccucucuccccuuccgucuggcccucucuccccuuccgu
서열번호 51: hsa-miR-328-3p 유사체SEQ ID NO: 51: hsa-miR-328-3p analog
cuggcccucucuggccuuccgucuggcccucucuggccuuccgu
서열번호 52: hsa-miR-328-3p 유사체SEQ ID NO: 52: hsa-miR-328-3p analog
cuggcccucucugcgcuuccgucuggcccucucugcgcuuccgu
서열번호 53: hsa-miR-328-3p 유사체SEQ ID NO: 53: hsa-miR-328-3p analog
cuggcccucucugccguuccgucuggcccucucugccguuccgu
서열번호 54: hsa-miR-328-3p 유사체SEQ ID NO: 54: hsa-miR-328-3p analog
cuggcccucucugcccauccgucuggcccucucugcccauccgu
서열번호 55: hsa-miR-328-3p 유사체SEQ ID NO: 55: hsa-miR-328-3p analog
cuggcccucucugcccuaccgucuggcccucucugcccuaccgu
서열번호 56: hsa-miR-328-3p 유사체SEQ ID NO: 56: hsa-miR-328-3p analog
cuggcccucucugcccuugcgucuggcccucucugcccuugcgu
서열번호 57: hsa-miR-328-3p 유사체SEQ ID NO: 57: hsa-miR-328-3p analog
cuggcccucucugcccuucggucuggcccucucugcccuucggu
서열번호 58: hsa-miR-328-3p 유사체SEQ ID NO: 58: hsa-miR-328-3p analog
cuggcccucucugcccuucccucuggcccucucugcccuucccu
서열번호 59: hsa-miR-328-3p 유사체SEQ ID NO: 59: hsa-miR-328-3p analog
cuggcccucucugcccuuccgacuggcccucucugcccuuccga
서열번호 60: hsa-miR-6514-5p 유사체SEQ ID NO: 60: hsa-miR-6514-5p analog
aauggaguggacuuucagcuggcaauggaguggacuuucagcuggc
서열번호 61: hsa-miR-6514-5p 유사체SEQ ID NO: 61: hsa-miR-6514-5p analog
uuuggaguggacuuucagcuggcuuuggaguggacuuucagcuggc
서열번호 62: hsa-miR-6514-5p 유사체SEQ ID NO: 62: hsa-miR-6514-5p analog
uaaggaguggacuuucagcuggcuaaggaguggacuuucagcuggc
서열번호 63: hsa-miR-6514-5p 유사체SEQ ID NO: 63: hsa-miR-6514-5p analog
uaucgaguggacuuucagcuggcuaucgaguggacuuucagcuggc
서열번호 64: hsa-miR-6514-5p 유사체SEQ ID NO: 64: hsa-miR-6514-5p analog
uaugcaguggacuuucagcuggcuaugcaguggacuuucagcuggc
서열번호 65: hsa-miR-6514-5p 유사체SEQ ID NO: 65: hsa-miR-6514-5p analog
UaugguguggacuuucagcuggcUaugguguggacuuucagcuggc
서열번호 66: hsa-miR-6514-5p 유사체SEQ ID NO: 66: hsa-miR-6514-5p analog
uauggacuggacuuucagcuggcuauggacuggacuuucagcuggc
서열번호 67: hsa-miR-6514-5p 유사체SEQ ID NO: 67: hsa-miR-6514-5p analog
uauggagaggacuuucagcuggcuauggagaggacuuucagcuggc
서열번호 68: hsa-miR-6514-5p 유사체SEQ ID NO: 68: hsa-miR-6514-5p analog
uauggagucgacuuucagcuggcuauggagucgacuuucagcuggc
서열번호 69: hsa-miR-6514-5p 유사체SEQ ID NO: 69: hsa-miR-6514-5p analog
uauggagugcacuuucagcuggcuauggagugcacuuucagcuggc
서열번호 70: hsa-miR-6514-5p 유사체SEQ ID NO: 70: hsa-miR-6514-5p analog
uauggaguggucuuucagcuggcuauggaguggucuuucagcuggc
서열번호 71: hsa-miR-6514-5p 유사체SEQ ID NO: 71: hsa-miR-6514-5p analog
uauggaguggaguuucagcuggcuauggaguggaguuucagcuggc
서열번호 72: hsa-miR-6514-5p 유사체SEQ ID NO: 72: hsa-miR-6514-5p analog
uauggaguggacauucagcuggcuauggaguggacauucagcuggc
서열번호 73: hsa-miR-6514-5p 유사체SEQ ID NO: 73: hsa-miR-6514-5p analog
uauggaguggacuaucagcuggcuauggaguggacuaucagcuggc
서열번호 74: hsa-miR-6514-5p 유사체SEQ ID NO: 74: hsa-miR-6514-5p analog
uauggaguggacuuacagcuggcuauggaguggacuuacagcuggc
서열번호 75: hsa-miR-6514-5p 유사체SEQ ID NO: 75: hsa-miR-6514-5p analog
uauggaguggacuuugagcuggcuauggaguggacuuugagcuggc
서열번호 76: hsa-miR-6514-5p 유사체SEQ ID NO: 76: hsa-miR-6514-5p analog
uauggaguggacuuucugcuggcuauggaguggacuuucugcuggc
서열번호 77: hsa-miR-6514-5p 유사체SEQ ID NO: 77: hsa-miR-6514-5p analog
uauggaguggacuuucaccuggcuauggaguggacuuucaccuggc
서열번호 78: hsa-miR-6514-5p 유사체SEQ ID NO: 78: hsa-miR-6514-5p analog
uauggaguggacuuucagguggcuauggaguggacuuucaggguggc
서열번호 79: hsa-miR-6514-5p 유사체SEQ ID NO: 79: hsa-miR-6514-5p analog
uauggaguggacuuucagcaggcuauggaguggacuuucagcaggc
서열번호 80: hsa-miR-6514-5p 유사체SEQ ID NO: 80: hsa-miR-6514-5p analog
uauggaguggacuuucagcucgcuauggaguggacuuucagcucgc
서열번호 81: hsa-miR-6514-5p 유사체SEQ ID NO: 81: hsa-miR-6514-5p analog
uauggaguggacuuucagcugccuauggaguggacuuucagcugcc
서열번호 82: hsa-miR-6514-5p 유사체SEQ ID NO: 82: hsa-miR-6514-5p analog
uauggaguggacuuucagcuggguauggaguggacuuucagcuggg

Claims (13)

  1. 하기 식 1로 표시되는 염기 서열로 이루어지는 hsa-miR-503-3p 유사체. An hsa-miR-503-3p analog comprising the nucleotide sequence represented by the following formula (1).
    [식 1][Equation 1]
    gggguauuN1uuuN2cN3N4N5N6N7N8N9gggggguauuN 1 uuuN 2 cN 3 N 4 N 5 N 6 N 7 N 8 N 9 gg
    상기 식 1에서, N1 내지 N9는 각각 독립적으로 아데닌(adenine), 구아닌(guanine), 우라실(uracil) 및 시토신(cytosine)으로 이루어진 군에서 선택된다.In Formula 1, N 1 to N 9 are each independently selected from the group consisting of adenine, guanine, uracil and cytosine.
    단, 상기 올리고뉴클레오티드는 상기 식 1에서 N1이 구아닌이고, N2가 시토신이며, N3가 구아닌이고, N4가 시토신이며, N5가 우라실이고, N6가 구아닌이고, N7이 시토신이고, N8이 시토신이며, N9이 아데닌인 경우는 제외한다. However, in the oligonucleotide, in Formula 1, N 1 is guanine, N 2 is cytosine, N 3 is guanine, N 4 is cytosine, N 5 is uracil, N 6 is guanine, and N 7 is cytosine. and N 8 is cytosine and N 9 is adenine, except for the case.
  2. 제1항에 있어서, 상기 유사체는 서열번호 7 내지 37 중 어느 하나의 염기 서열로 표시되는 것을 특징으로 하는 유사체.The analog according to claim 1, wherein the analog is represented by the nucleotide sequence of any one of SEQ ID NOs: 7 to 37.
  3. 제1항에 있어서, 상기 유사체는 서열번호 34 또는 37 중 어느 하나의 염기 서열로 표시되는 것을 특징으로 하는 유사체.The analog according to claim 1, wherein the analog is represented by the nucleotide sequence of any one of SEQ ID NO: 34 or 37.
  4. 제1항에 있어서, 상기 유사체는 서열번호 1의 염기 서열과 상동성이 60% 이상 100% 미만인 염기 서열로 이루어진 것을 특징으로 하는 유사체.The analog of claim 1, wherein the analog comprises a nucleotide sequence having 60% or more and less than 100% homology with the nucleotide sequence of SEQ ID NO: 1.
  5. 제1항의 올리고뉴클레오티드를 포함하는 발현 벡터. An expression vector comprising the oligonucleotide of claim 1.
  6. 제5항의 발현 벡터로부터 형질 전환된 숙주 세포. A host cell transformed from the expression vector of claim 5 .
  7. 제1항 내지 제4항 중 어느 한 항의 유사체를 유효 성분으로 포함하는 약학적 조성물.A pharmaceutical composition comprising an analog of any one of claims 1 to 4 as an active ingredient.
  8. 제5항에 있어서, 상기 약학적 조성물은 암의 예방, 개선 또는 치료용인 것을 특징으로 하는 약학적 조성물.The pharmaceutical composition according to claim 5, wherein the pharmaceutical composition is for the prevention, improvement or treatment of cancer.
  9. 제5항에 있어서, 상기 약학적 조성물은 암 줄기세포의 성장 억제용 또는 사멸용을 특징으로 하는 약학적 조성물.The pharmaceutical composition according to claim 5, wherein the pharmaceutical composition is for inhibiting or killing cancer stem cells.
  10. 제5항에 있어서, 상기 약학적 조성물은 약제학적으로 허용되는 담체, 부형제, 희석제 중 어느 하나 이상을 추가적으로 더 포함하는 것을 특징으로 하는 약학적 조성물.The pharmaceutical composition according to claim 5, wherein the pharmaceutical composition further comprises any one or more of a pharmaceutically acceptable carrier, excipient, and diluent.
  11. 제8항 또는 제9항에 있어서, 상기 암은 흑색종, 유방암, 대장암, 자궁암, 나팔관암, 난소암, 위암, 뇌암, 직장암, 소장암, 직장암, 식도암, 임파선암, 담낭암, 폐암, 피부암, 신장암, 방광암, 혈액암, 췌장암, 전립선암, 갑상선암, 내분비선암, 구강암 및 간암으로 이루어진 군에서 선택되는 것을 특징으로 하는 약학적 조성물. 10. The method of claim 8 or 9, wherein the cancer is melanoma, breast cancer, colorectal cancer, uterine cancer, fallopian tube cancer, ovarian cancer, stomach cancer, brain cancer, rectal cancer, small intestine cancer, rectal cancer, esophageal cancer, lymph adenocarcinoma, gallbladder cancer, lung cancer, skin cancer , renal cancer, bladder cancer, blood cancer, pancreatic cancer, prostate cancer, thyroid cancer, endocrine adenocarcinoma, oral cancer, and a pharmaceutical composition, characterized in that selected from the group consisting of liver cancer.
  12. 제1항 내지 제4항 중 어느 한 항의 유사체를 유효 성분으로 포함하는 조성물을 약학적 유효량으로 대상체에 투여하는 단계를 포함하는 암의 예방, 개선 또는 치료 방법.A method for preventing, ameliorating or treating cancer, comprising administering to a subject a pharmaceutically effective amount of a composition comprising the analog of any one of claims 1 to 4 as an active ingredient.
  13. 제1항 내지 제4항 중 어느 한 항의 유사체를 유효 성분으로 포함하는 조성물을 약학적 유효량으로 대상체에 투여하는 단계를 포함하는 암 줄기세포의 성장을 억제하는 방법.A method for inhibiting the growth of cancer stem cells comprising administering to a subject a composition comprising the analog of any one of claims 1 to 4 as an active ingredient in a pharmaceutically effective amount.
PCT/KR2020/007578 2020-06-11 2020-06-11 Novel mirna mimics and uses thereof WO2021251526A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2020/007578 WO2021251526A1 (en) 2020-06-11 2020-06-11 Novel mirna mimics and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2020/007578 WO2021251526A1 (en) 2020-06-11 2020-06-11 Novel mirna mimics and uses thereof

Publications (1)

Publication Number Publication Date
WO2021251526A1 true WO2021251526A1 (en) 2021-12-16

Family

ID=78846168

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/007578 WO2021251526A1 (en) 2020-06-11 2020-06-11 Novel mirna mimics and uses thereof

Country Status (1)

Country Link
WO (1) WO2021251526A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009532392A (en) * 2006-04-03 2009-09-10 サンタリス ファーマ アー／エス Pharmaceutical composition comprising antimiRNA antisense oligonucleotide
JP2010154843A (en) * 2008-06-27 2010-07-15 Keio Gijuku Diagnosis and therapy selection of gynecologic cancer by microrna as biomarker
US20150352055A1 (en) * 2013-01-24 2015-12-10 Pierre Fabre Medicament S.A.S. Composition comprising an encapsulated antagomir
KR20180137435A (en) * 2017-06-16 2018-12-27 (주)프로스테믹스 Pharmaceutical composition for prevention or treatment of cancer
KR20190062159A (en) * 2017-11-27 2019-06-05 (주)프로스테믹스 Composition for wound healing or improving skin comprising miRNA

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009532392A (en) * 2006-04-03 2009-09-10 サンタリス ファーマ アー／エス Pharmaceutical composition comprising antimiRNA antisense oligonucleotide
JP2010154843A (en) * 2008-06-27 2010-07-15 Keio Gijuku Diagnosis and therapy selection of gynecologic cancer by microrna as biomarker
US20150352055A1 (en) * 2013-01-24 2015-12-10 Pierre Fabre Medicament S.A.S. Composition comprising an encapsulated antagomir
KR20180137435A (en) * 2017-06-16 2018-12-27 (주)프로스테믹스 Pharmaceutical composition for prevention or treatment of cancer
KR20190062159A (en) * 2017-11-27 2019-06-05 (주)프로스테믹스 Composition for wound healing or improving skin comprising miRNA

Similar Documents

Publication Publication Date Title
WO2019156365A1 (en) Peptide nucleic acid complex having endosomal escape capacity, and use thereof
AU2012308320B2 (en) Multimeric oligonucleotide compounds
WO2019050071A1 (en) Composition for preventing or treating liver fibrosis, containing exosome or exosome-derived ribonucleic acid
KR20170095230A (en) Antisense-oligonucleotides as inhibitors of tgf-r signaling
WO2019156366A1 (en) Skin-permeating carrier containing nucleic acid complex and use thereof
WO2019225968A1 (en) Amphiregulin gene-specific double-stranded oligonucleotide and composition, for preventing and treating fibrosis-related diseases and respiratory diseases, comprising same
WO2019103300A1 (en) Mirna-containing composition for treating wounds and improving skin
WO2019132547A1 (en) Pharmaceutical composition for preventing or treating cancer metastasis to lung, containing chi3l1 inhibitor as active ingredient
WO2021251526A1 (en) Novel mirna mimics and uses thereof
WO2015005669A1 (en) LIVER CANCER RELATED GENES-SPECIFIC siRNA, DOUBLE-STRANDED OLIGO RNA MOLECULES COMPRISING THE siRNA, AND COMPOSITION FOR PREVENTING OR TREATING CANCER COMPRISING THE SAME
CN111763669B (en) Double-stranded RNA molecule and application thereof
WO2018231034A2 (en) Pharmaceutical composition for preventing or treating cancer
WO2015002512A1 (en) Dengue virus-specific sirna, double helix oligo-rna structure comprising sirna, and composition for suppressing proliferation of dengue virus comprising rna structure
WO2014054927A1 (en) Amphiregulin-specific double-helical oligo-rna, double-helical oligo-rna structure comprising double-helical oligo-rna, and composition for preventing or treating respiratory diseases containing same
WO2021194179A1 (en) Oncolytic virus comprising nucleic acid sequence that bispecifically targets stat3 and mtor
WO2019103572A1 (en) Composition, comprising mirna, for preventing hair loss or promoting hair restoration
WO2021002664A1 (en) Composition for preventing, relieving or treating cancer
WO2016204515A1 (en) Stat3 gene specific sirna, double-helical oligo rna structure including sirna, composition containing same, and use thereof
WO2021033973A1 (en) Composition for inhibiting myeloid-derived suppressor cell comprising mitf inhibitor as active ingredient
WO2016178519A1 (en) Composition for inhibiting muscle aging or treating muscle aging related diseases
EP3228322B1 (en) Adjuvant composition
WO2019103578A1 (en) Oligonucleotide and pharmaceutical composition comprising same for prevention or treatment of cancer
WO2023043220A1 (en) Antisense compound that regulates expression of wfdc2
WO2022131744A1 (en) Composition for preventing or treating pancreatic cancer comprising peptide nucleic acid complex
WO2013115579A1 (en) Shrna for suppressing tgf-β2 expression

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20939997

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20939997

Country of ref document: EP

Kind code of ref document: A1