WO2023195749A1 - Nouveau mutant de foxn1 et son utilisation - Google Patents

Nouveau mutant de foxn1 et son utilisation Download PDF

Info

Publication number
WO2023195749A1
WO2023195749A1 PCT/KR2023/004541 KR2023004541W WO2023195749A1 WO 2023195749 A1 WO2023195749 A1 WO 2023195749A1 KR 2023004541 W KR2023004541 W KR 2023004541W WO 2023195749 A1 WO2023195749 A1 WO 2023195749A1
Authority
WO
WIPO (PCT)
Prior art keywords
foxn1
gene
mutant gene
variant
forkhead
Prior art date
Application number
PCT/KR2023/004541
Other languages
English (en)
Korean (ko)
Inventor
염수청
이건성
Original Assignee
서울대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교 산학협력단 filed Critical 서울대학교 산학협력단
Publication of WO2023195749A1 publication Critical patent/WO2023195749A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0653—Adipocytes; Adipose tissue
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/54—Proteins
    • A23V2250/542—Animal Protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/09—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from epidermal cells, from skin cells, from oral mucosa cells
    • C12N2506/094—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from epidermal cells, from skin cells, from oral mucosa cells from keratinocytes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1307—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from adult fibroblasts

Definitions

  • the present invention relates to novel Foxn1 variants and uses thereof.
  • Fat plays a role in maintaining energy homeostasis by chewing excessively consumed energy in the form of triglyceride. Fat accumulates in various areas of the skin, including the abdomen, subcutaneous tissue, skin, bone marrow, and muscle. Subcutaneous fat can be differentiated into beige adipocytes and is recently considered a major target for metabolic diseases. Dermal white adipose tissue (dWAT) is another type of fat that differs from subcutaneous fat in origin and function.
  • dWAT Dermal white adipose tissue
  • Dermal white adipose tissue has been considered to function as a simple mechanical cushion, but recent studies have shown that it is involved in skin immune response, wound healing, scar formation, hair follicle formation, and thermoregulation. Roughly 1) the development of dermal white adipose tissue is synchronized with the hair follicle cell cycle, and dermal white adipose tissue increases in the hair follicle formation stage (anagen stage); 2) the defect of dermal white adipose tissue is unable to respond to external bacterial infection; 3 ) Loss of dermal skin fat cells during aging is associated with decreased skin elasticity. The mechanism for selective differentiation or proliferation of dermal white adipocytes has not yet been identified.
  • Foxn1 (Forkhead-box N1) is a Forkhead box gene family member, expressed in the basal layer of thymic epithelial cells (TEC) and epidermal keratinocytes, and is a transcription factor and key player in TEC-derived T cell differentiation, education, and selection. It is an adjuster. Additionally, in the skin, Foxn1 regulates skin development, homeostasis of epidermal proliferation, dermal white adipose tissue (dWAT) adipogenesis, differentiation, and wound healing, and mutations in this gene can cause T cell immunodeficiency, skin diseases, It is known to be correlated with congenital hair loss, nail dystrophy, and dementia. Changes in the expression of the Foxn1 gene that occur in wound recovery and proliferation of dermal skin fat in the hair follicle cycle suggest a relationship between the Foxn1 gene and dermal skin fat differentiation, but are limited phenomena observed only in special environments such as wound recovery.
  • TEC thymic epithelial cells
  • missense mutations, nonsense mutations, and frame shift mutations of bases in the transcription frame of protein-coding genes can cause changes in the primary structure of the amino acid sequence of their protein products, generally only mutations that occur in the exon region of protein-coding genes This can lead to relatively large changes in protein product performance. These mutations can lead to loss of function or gain of function, and new useful traits can be discovered through random mutation induction and phenotypic analysis. Therefore, if it is possible to induce the proliferation of dermal skin fat by artificially inducing a mutation in the Foxn1 gene, it could be an effective new treatment and application method for related diseases and cosmetic aspects.
  • the present inventors made intensive research efforts to develop a method that can induce selective differentiation and proliferation of dermal white adipose tissue.
  • the Foxn1 c.55 C>A(p.L19M) variant was first identified by inducing random missense mutations through the CRISPR/Cas9 base editor editing system, and the novel Foxn1 L19M variant resulted in the formation of keratinocytes.
  • mesenchymal-type cells into mesenchymal-type cells
  • conversion of mesenchymal-type cells into preadipocytes activation of keratinocyte-derived adipogenic signals, increased dermal white adipose tissue production, and cell transition from fibroblasts to myofibroblasts are achieved.
  • the present invention was completed.
  • one object of the present invention is to provide a FoxN1 protein variant encoded by a FoxN1 (Forkhead-box N1) variant gene.
  • Another object of the present invention is to provide a method for inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes using a FoxN1 protein variant. It is to provide.
  • Another object of the present invention is to induce in vitro conversion from keratinocytes or fibroblasts containing FoxN1 protein variants to preadipocytes or adipocytes. To provide a composition.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; The object is to provide a cosmetic composition for fat filling or skin regeneration comprising; or a FoxN1 protein variant encoded by the FoxN1 mutant gene.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; The object is to provide a food composition for fat filling or skin regeneration comprising; or a FoxN1 protein variant encoded by the FoxN1 mutant gene.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a pharmaceutical composition for treating wounds or inhibiting scar formation, including.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a cosmetic composition for improving scars comprising a.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a pharmaceutical composition for the prevention or treatment of fibrosis, including.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a food composition for preventing or improving fibrosis comprising a.
  • another object of the present invention is the FoxN1 mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a cosmetic composition for preventing or improving fibrosis comprising a.
  • another object of the present invention is the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; providing a method for treating wounds or inhibiting scar formation, comprising administering to a subject a pharmaceutical composition for treating wounds or inhibiting scar formation, comprising as an active ingredient It is there.
  • FoxN1 Formhead-box N1
  • another object of the present invention is the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; to provide a method for treating fibrosis, comprising administering to a subject a pharmaceutical composition for preventing or treating fibrosis, which contains as an active ingredient. .
  • FoxN1 Formhead-box N1
  • the present invention in the group consisting of Single Nucleotide variant (SNV), Indel (Insertion or Deletion), and Gene Copy-number variation (CNV)
  • SNV Single Nucleotide variant
  • Indel Insertion or Deletion
  • CNV Gene Copy-number variation
  • a FoxN1 protein variant encoded by a FoxN1 (Forkhead-box N1) variant gene comprising one or more selected nucleotide mutations.
  • the present invention can provide a transformed cell line in which a target cell is transformed with a FoxN1 mutant gene or a fragment thereof, and a vector containing the FoxN1 mutant gene.
  • the FoxN1 mutant gene refers to a FoxN1 gene in which a mutation has occurred.
  • the mutation may include a single nucleotide variant (SNV), insertion or deletion (Indel), and copy-number variation (CNV). ), but is not limited thereto, and refers to all genetic mutations recognized by those skilled in the art.
  • the present inventors first produced a new mutation c.55 C>A of the FoxN1 gene.
  • the FoxN1 mutant gene of the present invention has a nucleotide mutation in one or more exons selected from the group consisting of exons 1 to 3 of the wild-type FoxN1 (Forkhead-box N1) gene having the base sequence shown in SEQ ID NO: 1. It exists.
  • the nucleotide mutation is a nucleotide mutation in exon 2, which results in an amino acid change (p.L19M) in which leucine at the 19th position of the wild-type FoxN1 protein is replaced with methionine, in the base sequence of SEQ ID NO: 1. It is a mutant gene (c.55 C>A) in which cytosine (C) at position 55 is replaced with adenine (A).
  • the FoxN1 mutant protein (FoxN1 protein variant) encoded by the FoxN1 mutant gene is a mutant gene (c.57C> in which cytosine (C) at position 57 is replaced with thymine (T) in the base sequence of SEQ ID NO: 1. It is a mutant protein (Foxn1 p.L19M) encoded by T) and has the amino acid sequence shown in SEQ ID NO: 2.
  • FoxN1 gene used herein while referring to the wild type includes all homologous genes found in all animals, including humans, and the base sequence of the FoxN1 normal gene of the present invention is, for example, SEQ ID NO: 1 (MGI: 102949), but is not limited thereto.
  • Single Nucleotide Variant used in this specification is also called a single-nucleotide alteration, and refers to a mutation that shows a difference in a single base sequence among mutations in the genome. These include single nucleotide polymorphism (SNP) and point mutations. Single nucleotide polymorphism means that a specific base sequence is changed to a different base at the same location in the genome of another individual, resulting in a different trait. It is the most common form of genetic mutation in the genome. Single nucleotide polymorphisms generally occur at a frequency of more than 1% of the population, and when less than 1% occur, they are classified as mutations. A point mutation occurs when a single base sequence is substituted, inserted, or deleted and can prevent or modify the production of a specific protein.
  • SNP single nucleotide polymorphism
  • Single nucleotide mutations are classified according to their location and function in the genome. In addition, depending on the presence or absence of amino acid sequence variation, it is classified into synonymous SNV (sSNV), which does not cause amino acid sequence variation, and nonsynonymous SNV (nsSNV), which causes amino acid sequence variation.
  • SNV synonymous SNV
  • nsSNV nonsynonymous SNV
  • indels can cause more serious mutations than substitutions. In the case of indels, a frame shift in the amino acid sequence occurs, causing the amino acid translated after the SNV to change.
  • cSNVs coding SNVs
  • ncSNVs noncoding SNVs
  • SNP and “SNV” can be used interchangeably, and can be used with the same meaning, such as “SNV of the FoxN1 gene” or “SNP of the FoxN1 gene”, and can be used with the same meaning as “SNP of the FoxN1 gene”, where a single base changes in the polynucleotide sequence. (replacement), removal (deletion), or addition (insertion), SNPs can cause a change in the translation frame (inframe shift).
  • Index Insertion or Deletion
  • Indel in SNV means insertion or deletion of one nucleotide
  • insertion or deletion (Indel) can be used to include this.
  • CNV Codon-number variation
  • the FoxN1 protein variant (Foxn1 p.L19M) of the present invention affects skin cell homeostasis, converting keratinocytes or fibroblasts into preadipocytes or adipocytes. As a result, fat formation was promoted and subcutaneous fat increased.
  • transition used in the present invention may mean “Direct Reprogramming/Direct Conversion/Transdifferentiation,” which refers to mature (completely differentiated) cells with completely different cell types in higher organisms. As a process that induces liver transformation, EMT is included herein.
  • the FoxN1 protein variant (Foxn1 p.L19M) of the present invention can not only induce fat formation in a specific area, but can also induce conversion to other cells when applied to fibroblasts, which are a factor in fibrosis. It can also be applied to related diseases such as fibrosis.
  • the present invention provides an in vitro method of converting keratinocytes or fibroblasts into preadipocytes or adipocytes, including the following steps: Provides ways to drive conversions:
  • the vector can be prepared by any method known in the art, for example, homologous recombination, TALEN, ZFN, and CRISPR, as long as it can achieve the purpose of the present invention, that is, mutagenesis.
  • transfection For the introduction of vectors into the cells, transfection, electroporation, transduction, microinjection, or ballistic introduction can all be used.
  • the vector is preferably designed using CRISPR-Cas9 technology, and a vector containing the Cas9 protein is designed to recognize the PAM (protospacer adjacent motif) base sequence and cleave the target base sequence. It is desirable to do so. In addition, this causes location-specific mutations in the FoxN1 gene at the location designated by the Cas9 protein.
  • PAM protospacer adjacent motif
  • the FoxN1 gene associated with thymus development and keratinocyte differentiation is selected as a target to discover new SNPs using a CRISPR/Cas9 base editor and to confirm the function of the Foxn1 SNP variant, listed as SEQ ID NO: 1.
  • an sgRNA target was designed as a targeting vector expressing the FoxN1 mutation as shown in Figure 1a, and was targeted to keratinocytes or When fibroblasts are transformed, they are converted into preadipocytes or adipocytes and the proliferation of dermal fat (hyperplasia) can be induced by activating the adipogenic differentiation signal derived from keratinocytes. , Accelerates wound healing and skin regeneration by promoting epithelial-mesenchymal transition of keratinocytes.
  • progenitor cell is referred to as a committed stem cell, and when a cell corresponding to a descendant (X) is found to express specific differentiation, an undifferentiated parental cell that does not express differentiation traits is used as a progenitor cell of It is called.
  • preadipocyte refers to a progenitor cell that has been shown to differentiate into adipocytes.
  • the present invention provides the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; or a FoxN1 protein variant encoded by the FoxN1 mutant gene; inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes.
  • the FoxN1 FoxN1 (Forkhead-box N1) mutant gene
  • a vector containing the FoxN1 mutant gene or a FoxN1 protein variant encoded by the FoxN1 mutant gene
  • inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes inducing in vitro conversion from keratinocytes or fibroblasts to preadipocytes or adipocytes.
  • the term “conversion to preadipocytes or adipocytes” means that keratinocytes or fibroblasts of animals, specifically mammals, are preadipocytes or fibroblasts due to FoxN1 (Forkhead-box N1) mutation. This means differentiating into fat cells.
  • the term “composition for inducing conversion” refers to a composition capable of inducing the process by which cells in the early stages acquire the characteristics of each tissue, and for the purpose of the present invention, keratinocytes or fibroblasts are converted into preadipocytes. Alternatively, it refers to a composition that can induce differentiation into adipocytes.
  • the composition for inducing conversion can induce differentiation of adipocytes by promoting the expression of the FoxN1 mutant gene or FoxN1 protein mutant.
  • the composition can promote the formation of fat cells and induce refilling of skin fat that has degenerated due to skin damage or aging.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as a cosmetic composition for fat filling or skin regeneration, comprising as an active ingredient.
  • fat filling means alleviating, improving, or filling the degree to which fat tissue in the skin has degenerated and the volume of the fat tissue has decreased. By filling with fat, dermal white skin fat-mediated skin regeneration is achieved. This means that the volume of the skin is improved.
  • the term "skin regeneration” means allowing severely damaged skin to recover its original function, and may include skin elasticity or wrinkle improvement. Although not specifically limited to this, skin regeneration relieves the degree of sagging or sagging skin, or replenishes the skin with fat to compensate for structural collapse caused by decreased skin elasticity and strength due to skin fat filling or decrease in fat tissue volume. This may include maintaining elasticity. In addition, it may include suppressing or inhibiting the formation of wrinkles on the skin or alleviating wrinkles that have already been formed.
  • Fat formation by the FoxN1 mutation of the present invention suggests that the degree of reduction in the volume of skin adipose tissue can be alleviated, improved, or filled, and thus the cosmetic composition of the present invention can be used for fat filling purposes.
  • composition of the present invention improves or improves skin elasticity and wrinkles by alleviating or improving the volume of degenerated fatty tissue, and further suggests that it can help damaged skin recover its original function. It is obvious that the cosmetic composition containing the FoxN1 mutation of the present invention can be used for skin regeneration purposes.
  • the cosmetic composition includes solution, external ointment, cream, foam, nourishing lotion, softening lotion, pack, softening water, emulsion, makeup base, essence, soap, liquid cleanser, bath agent, sunscreen cream, sun oil, suspension, emulsion, It can be prepared in a formulation selected from the group consisting of paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, patch and spray, but is not limited thereto.
  • the cosmetic composition may further include one or more cosmetically acceptable carriers that are blended with general skin cosmetics, and common ingredients include, for example, oil, water, surfactant, moisturizer, lower alcohol, thickener, Chelating agents, pigments, preservatives, fragrances, etc. may be appropriately mixed, but are not limited thereto.
  • Cosmetically acceptable carriers included in the cosmetic composition vary depending on the formulation.
  • the carrier ingredients include animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, and zinc oxide. Or a mixture thereof can be used.
  • lactose, talc, silica, aluminum hydroxide, calcium silcate, polyamide powder, or mixtures thereof may be used as carrier ingredients, and especially in the case of spray, additional May contain propellants such as chlorofluorohydrocarbons, propane/butane or dimethyl ether.
  • a solvent, solubilizing agent, or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, and propylene glycol.
  • 1,3-butyl glycol oil can be used, in particular cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic esters, polyethylene glycol or fatty acid esters of sorbitan. You can.
  • the carrier component includes water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracant may be used.
  • a liquid diluent such as ethanol or propylene glycol
  • a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester
  • Microcrystalline cellulose aluminum metahydroxide, bentonite, agar, or tracant may be used.
  • the formulation of the cosmetic composition is soap, alkali metal salts of fatty acids, hemiester salts of fatty acids, fatty acid protein hydrolysates, isethionates, lanolin derivatives, fatty alcohols, vegetable oils, glycerol, sugars, etc. are used as carrier ingredients. It can be.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a food composition for fat filling or skin regeneration.
  • the food composition may be used in the form of a health functional food, but is not limited thereto, and may include foodologically acceptable food supplements in addition to the active ingredients.
  • “food supplement” refers to a component that can be added to food as an auxiliary ingredient, and can be appropriately selected and used by a person skilled in the art as it is added to manufacture each type of health functional food.
  • food supplements include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, and protective colloidal thickeners. , pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc., but the types of food supplements of the present invention are not limited to the above examples.
  • the food composition of the present invention may include health functional foods.
  • health functional food refers to food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, and pills using raw materials or ingredients with functional properties useful to the human body.
  • functionality means controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes, such as physiological effects.
  • the health functional food can be manufactured by a method commonly used in the industry, and can be manufactured by adding raw materials and ingredients commonly added in the industry. Additionally, the formulation of the health functional food can also be manufactured without limitation as long as it is a formulation recognized as a health functional food.
  • the food composition of the present invention can be manufactured in various types of formulations, and unlike general drugs, it is made from food as a raw material and has the advantage of not having side effects that may occur when taking the drug for a long period of time, and is excellent in portability, so the present invention Health functional foods can be consumed as supplements to enhance fat replenishment and skin regeneration effects.
  • the health functional food of the present invention can take, and it can include all foods in the conventional sense, and can be used interchangeably with terms known in the art, such as functional food.
  • the health functional food of the present invention can be prepared by mixing known additives with other appropriate auxiliary ingredients that can be included in the food according to the selection of a person skilled in the art. Examples of foods that can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and There are vitamin complexes, etc., and they can be manufactured by adding the active ingredient according to the present invention to juice, tea, jelly, juice, etc. It also includes foods used as feed for animals.
  • composition containing the active ingredient of the present invention can be used as a quasi-drug composition.
  • the quasi-drug composition contains the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Alternatively, a quasi-drug composition for fat filling or skin regeneration containing a FoxN1 protein variant encoded by the FoxN1 mutant gene may be provided.
  • FoxN1 Formhead-box N1
  • a vector containing the FoxN1 mutant gene Alternatively, a quasi-drug composition for fat filling or skin regeneration containing a FoxN1 protein variant encoded by the FoxN1 mutant gene may be provided.
  • the quasi-drug composition may further include pharmaceutically acceptable carriers, excipients, or diluents as needed.
  • the pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effect of the present invention, and includes, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc. It can be included.
  • Representative examples of pharmaceutically acceptable carriers, excipients or diluents of the quasi-drug composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, gelatin, glycerin, gum acacia, alginate, calcium phosphate, Calcium carbonate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, propylene glycol, polyethylene glycol, vegetable.
  • the quasi-drug when used as a quasi-drug, it may additionally contain one or more active ingredients that exhibit the same or similar functions.
  • it may include known lipofilling, fat filling, skin regeneration, or skin moisturizing ingredients. If additional skin moisturizing ingredients are included, the fat filling or skin regeneration effect of the quasi-drug composition of the present invention can be further increased.
  • skin safety due to combined use, ease of formulation, and stability of the active ingredients can be taken into consideration.
  • the quasi-drug composition of the present invention may include, but is not limited to, disinfectant cleaner, shower foam, ointment, wet tissue, coating agent, etc., and the formulation method, dosage, usage method, and components of the quasi-drug are known in the technical field. It can be appropriately selected from conventional techniques.
  • the present invention provides an external skin preparation.
  • the present invention relates to the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Alternatively, an external skin preparation for fat filling or skin regeneration containing a FoxN1 protein variant encoded by the FoxN1 mutant gene may be provided.
  • FoxN1 FoxNhead-box N1
  • the term "external preparation” refers to preparations provided for external use, including external acid, external tablet, external solution, ointment, warning agent, suppository, etc.
  • External preparations refer to those spread on zinc starch, etc., erosions and ulcers of the skin mucous membrane
  • external tablets refer to dissolved tablets or vaginal tablets
  • external solution preparations refer to liquids containing water, ethanol, oil, etc. as solvents. It is a preparation and is used for gargling, compressing, washing, eye drops, nasal drops, etc.
  • ointments are semi-solid preparations of appropriate consistency to be applied to the skin
  • ointments are solid at room temperature and are applied to the skin that softens with body temperature
  • suppositories are preparations to be applied to the anus, vagina, and urethra.
  • the “external skin preparation” refers to a preparation that acts on the skin externally among external preparations.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene;
  • it refers to an external skin preparation containing the FoxN1 protein variant encoded by the FoxN1 mutant gene as an active ingredient.
  • external skin preparations include, but are not limited to, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment preparations, pasta preparations, or cataplasma preparations that can be manufactured and used as drugs or quasi-drugs in the form of external skin preparations. No.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a pharmaceutical composition for treating wounds or inhibiting scar formation, and a cosmetic composition for improving scars.
  • composition of the present invention induces the expression of characteristics from fibroblasts, which play an important role in wound healing, to myofibroblasts by Foxn1 p.L19M of the present invention, so the cosmetic composition containing the FoxN1 mutation of the present invention helps in wound healing and scar formation. It is clear that it can be used for suppression and scar improvement purposes.
  • the present invention provides the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; Provided is a method for treating wounds or inhibiting scar formation, comprising the step of administering to a subject a pharmaceutical composition for treating wounds or inhibiting scar formation, comprising as an active ingredient. .
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a pharmaceutical composition for preventing or treating fibrosis.
  • the fibrosis is present in the lungs, kidneys, liver, heart, brain, blood vessels, joints, intestines, skin, soft tissues, bone marrow, penis, peritoneum, lance, muscles, spine, testes, ovaries, breasts, thyroid, eardrums, pancreas, gallbladder, and bladder. and the prostate, preferably in an organ selected from the group consisting of pulmonary fibrosis, uterine fibroids, myelofibrosis, liver fibrosis, heart fibrosis, and multiple lesions.
  • cirrhosis selected from the group consisting of cirrhosis, kidney fibrosis, cystic fibrosis, neutropenia, skeletal muscle fibrosis, scleroderma, dermatomyositis, mediastinal fibrosis, and splenic fibrosis due to sickle cell anemia.
  • cirrhosis kidney fibrosis, cystic fibrosis, neutropenia, skeletal muscle fibrosis, scleroderma, dermatomyositis, mediastinal fibrosis, and splenic fibrosis due to sickle cell anemia.
  • neutropenia neutropenia
  • skeletal muscle fibrosis skeletal muscle fibrosis
  • scleroderma scleroderma
  • dermatomyositis dermatomyositis
  • mediastinal fibrosis mediastinal fibrosis
  • splenic fibrosis due to sickle cell anemia
  • the FoxN1 mutant gene of the present invention A vector containing the FoxN1 mutant gene; Or, when using a FoxN1 protein variant encoded by the FoxN1 mutant gene, fibrosis can be effectively treated or inhibited by transdifferentiating fibroblasts that cause fibrosis into other cells, such as preadipocytes or adipocytes. .
  • the present invention provides the FoxN1 (Forkhead-box N1) mutant gene; A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; It provides a method of treating fibrosis, comprising the step of administering to a subject a pharmaceutical composition for preventing or treating fibrosis, which contains as an active ingredient.
  • a pharmaceutical composition for preventing or treating fibrosis which contains as an active ingredient.
  • the term "comprising an active ingredient” refers to the FoxN1 mutant gene, which is an active ingredient of the present invention;
  • it means containing the FoxN1 protein variant encoded by the FoxN1 variant gene in an amount sufficient to achieve a predetermined efficacy or activity. They can be administered in a pharmaceutically effective amount, and the effective dose level can be determined depending on the type and age of the individual, gender, sensitivity to the drug, treatment period, drugs used simultaneously, and other medical factors.
  • composition according to one embodiment of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with existing therapeutic agents.
  • the daily dosage of the pharmaceutical composition may be 0.01 to 500 mg/kg, and may be administered once to several times a day, depending on the patient's weight, age, gender, health status, diet, administration time, administration method, Considering the excretion rate, severity of disease, etc., the amount that can achieve maximum effect without side effects can be easily determined by a person skilled in the art.
  • the pharmaceutical composition can be administered through various routes, such as orally, subcutaneously, intraperitoneally, intrapulmonary, intranasally, intramuscularly, intravenously, and arterially.
  • composition of the present invention may be formulated to include pharmaceutically acceptable carriers, excipients, and/or diluents in addition to the active ingredients.
  • the pharmaceutical preparation may be formulated in the form of oral dosage forms such as powders, granules, tablets, coated tablets, capsules, suspensions, emulsions, syrups, suppositories, aerosols, external preparations, suppositories, or injections, but is not limited thereto. .
  • the pharmaceutical preparation may be prepared by additionally mixing one or more excipients, such as starch, lactose, gelatin, sucrose, lubricant, preservative, flavoring agent, sweetener, etc.
  • excipients such as starch, lactose, gelatin, sucrose, lubricant, preservative, flavoring agent, sweetener, etc.
  • composition of the present invention may contain one or more known active ingredients that have a preventive or therapeutic effect on fibrosis, the subject of the present invention, along with the active ingredient of the present invention.
  • composition of the present invention may further include pharmaceutically acceptable additives, where the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, and lactose. , mannitol, taffy, gum arabic, pregelatinized starch, corn starch, powdered cellulose, hydroxypropyl cellulose, Opadry, sodium starch glycolate, carnauba lead, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, White sugar, etc. may be used.
  • the pharmaceutically acceptable additive according to the present invention is preferably included in an amount of 0.1 to 90 parts by weight based on the composition, but is not limited thereto.
  • composition of the present invention can be administered in various oral or parenteral formulations during actual clinical administration.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants are used. It can be prepared, and it is preferable to use suitable preparations known in the art that are disclosed in the literature (Remington's Pharmaceutical Science, recently published by Mack Publishing Company, Easton PA).
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, such as starch, calcium carbonate, sucrose, or It is prepared by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium styrate talc are also used.
  • the liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and in addition to the commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, preservatives, etc. This may be included.
  • Preparations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate.
  • injectable ester such as ethyl oleate.
  • As a base for suppositories witepsol, macrogol, tween 61, cacao, laurin, glycerogeratin, etc. can be used.
  • the dosage of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time, and/or administration route of the pharmaceutical composition, and the type and degree of response to be achieved by administration of the pharmaceutical composition. , various factors including the type, age, weight, general health condition, symptoms or degree of disease, gender, diet, excretion, drugs used simultaneously or simultaneously with the subject, other components of the composition, etc. of the subject to be administered, and It may vary depending on similar factors well known in the pharmaceutical field, and a person skilled in the art can easily determine and prescribe an effective dosage for the desired treatment.
  • the pharmaceutical composition of the present invention is preferably administered at a concentration of, for example, 0.01 to 500 mg/kg, but this dosage does not limit the scope of the present invention in any way.
  • the administration route and administration method of the pharmaceutical composition of the present invention may be independent, and are not particularly limited, and any administration route and administration method may be used as long as the pharmaceutical composition can reach the desired area. can be followed.
  • the pharmaceutical composition can be administered orally or parenterally.
  • the parenteral administration method includes, for example, intravenous administration, intraperitoneal administration, intramuscular administration, transdermal administration, or subcutaneous administration.
  • the pharmaceutical composition of the present invention can be used alone or in combination with surgery, radiation therapy, hormone therapy, chemotherapy, and methods using biological response regulators for the prevention or treatment of target indications.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as an active ingredient, a food composition for preventing or improving fibrosis, or a health functional food containing the same.
  • health functional food used in this specification refers to food manufactured and processed using raw materials or ingredients with functional properties useful to the human body.
  • 'functionality' means ingestion for the purpose of controlling nutrients for the structure and function of the human body or obtaining useful effects for health purposes such as physiological effects.
  • the food composition includes all types of functional foods, nutritional supplements, health foods, and food additives.
  • the above types can be manufactured in various forms according to conventional methods known in the art.
  • the food composition can be formulated in the same way as the pharmaceutical composition and used as a health functional food, and can be added to various foods.
  • the composition of the present invention when producing a food or beverage, is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the raw materials. However, when consumed for a long period of time for health and hygiene purposes or health control, it can be added in an amount below the above range. Since there is no problem in terms of safety, the active ingredient can be used in an amount above the above range. there is.
  • the type of food but examples of food to which the ingredients of the present invention can be added include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, and ice cream. It includes dairy products, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, etc., and includes all health foods in the conventional sense.
  • the food composition of the present invention When the food composition of the present invention is manufactured into a beverage, it may contain additional ingredients such as various flavoring agents or natural carbohydrates, like conventional beverages.
  • the natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame.
  • the natural carbohydrate is included in an amount of 0.01 to 10% by weight, preferably 0.01 to 0.1% by weight, based on the total weight of the food composition of the present invention.
  • the food composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonic acid. It may include carbonating agents used in beverages, and may include pulp for the production of natural fruit juice, fruit juice beverages, and vegetable beverages, but is not limited thereto. These ingredients can be used independently or in combination.
  • the ratio of the above additives is not greatly limited, but is preferably contained within the range of 0.01 to 0.1% by weight based on the total weight of the food composition of the present invention.
  • the FoxN1 (Forkhead-box N1) mutant gene A vector containing the FoxN1 mutant gene; Or a FoxN1 protein variant encoded by the FoxN1 mutant gene; provided as a cosmetic composition for preventing or improving fibrosis, comprising as an active ingredient.
  • the FoxN1 mutant gene of the present invention A vector containing the FoxN1 mutant gene;
  • fibrosis-inducing fibroblasts are transdifferentiated into other cells, such as preadipocytes or adipocytes, and thus fibrosis can be effectively suppressed.
  • composition of the present invention uses expression of the above-described FoxN1 mutant gene or FoxN1 mutant protein, duplicate content is omitted to avoid excessive complexity of the present specification.
  • the random missense mutant (Foxn1 c.55 C>A(p.L19M)) produced through the CRISPR/Cas9 editing system according to the present invention can be used to transform keratinocytes or fibroblasts into adipocytes or preadipocytes. ) and activating keratinocyte-derived fat differentiation signals to promote fat formation to increase subcutaneous fat, and to induce the expression of fibroblasts, which play an important role in wound healing and hair follicle formation, into myofibroblasts, thereby forming fibrotic cells. Not only can it be applied to disease treatment and skin wound improvement treatment, but it can also improve the aesthetic problems of modern people caused by volume loss and functional decline due to adipose tissue involution by inducing subcutaneous fat in specific areas of the skin.
  • Figure 1 shows B6. It shows obesity accompanied by proliferation of dermal white adipose tissue (dWAT) induced by Foxn1 p.L19M.
  • Figure 1A shows a simplified image of the generation of mice with Forkhead protein N1 (Foxn1) missense mutations.
  • a single guide RNA (sgRNA) binding sequence was selected from the first coding exon of Foxn1.
  • sgRNA single guide RNA
  • nCas9-BE linked to sgRNA and nickase Streptococcus pyogens Cas9 was applied to mouse embryos, and the genotype of the resulting offspring was confirmed by Sanger sequencing.
  • Red alphabet nucleotide substitutions
  • blue alphabet protospacer adjacent motif (PAM) sequence.
  • Figure 1B is B6.
  • Figure 1d shows the results of hematoxylin and eosin staining on skin. After 16 weeks of NC and HFD feeding, dorsal skin was fixed in formalin and stained. Black scale bar: 500 ⁇ m.
  • Figure 1E shows a simplified image for calculating the thickness of the dermal white adipocyte (dWAT) layer and the number of adipocytes.
  • Red square thickness x 500 ⁇ m width
  • Foxn1 L19M/L19M a larger number of adipocytes are observed in the dermal white fat layer than in WT, which means that the Foxn1 p.L19M mutant causes hyperplasia rather than adipocyte enlargement (hypertrophy).
  • Figure 2 shows that Foxn1 p.L19M promotes epithelial-mesenchymal transition (EMT) of keratinocytes.
  • Figure 2a shows the results of Sashimi plot analysis for the Foxn1 gene using RNA sequencing data from newborn epidermal tissues of WT and Foxn1 L19M/L19M , suggesting that alternative splicing of messenger RNA (mRNA) does not occur.
  • Figure 2b shows the results of Foxn1 detection by Western blot using epidermal and dermal tissue proteins, indicating that there is no difference in FOXN1 protein expression in keratinocytes between WT and Foxn1 L19M/L19M .
  • Figure 2c shows the results of detection of Foxn1-positive cells in the skin using immunohistochemistry, showing that Foxn1-positive cells are located at the boundary between the dermis and the fat layer, suggesting the possibility that Foxn1 L19M/L19M keratinocytes have migrated (black) Scale bar: 50 ⁇ m).
  • Figure 2g shows epithelial-mesenchymal-transition (EMT) in epidermal (Epi-; epidermal) tissue, dermal (Der-; dermal) tissue, primary keratinocyte (Kera-; keratinocyte), and dermal fibroblast (DF). Shows the Western blot results confirming the protein level of the intermediate gene.
  • Figure 2h shows the results of immunofluorescence staining of E-cadherin, N-cadherin, and Foxn1 using skin tissue. Green or yellow alphabets indicate the target gene name and detected fluorescence signal color (blue; DAPI. White scale bar: 50 ⁇ m).
  • Figure 2I shows EMT-related gene expression levels in the skin of Foxn1 L19M/L19M .
  • Figure 3 shows the results of Foxn1 p.L19M in keratinocytes activating adipogenic signals in mouse embryonic fibroblast (MEF) cells.
  • Figure 3a shows the results of immunofluorescence staining to detect Foxn1, CD34, or ⁇ SMA (Alpha Smooth Muscle Actin) positive cells in skin tissue. Green or red alphabets indicate the target gene name and detected signal color. blue; DAPI. Black and white scale bar: 50 ⁇ m.
  • Figure 3b shows the results of Western blot analysis to detect CD24, CD34, Sca-1, and ⁇ SMA using proteins from epidermal and dermal tissues, primary keratinocytes, and dermal fibroblasts.
  • Figure 3c shows that Foxn1 p.L19M was expressed in a keratinocyte cell line (Kera-308) and cultured in adipogenic medium, showing that keratinocytes can be differentiated into preadipocytes and adipocytes by transduction of Foxn1 p.L19M.
  • Figure 3d shows the results of analyzing whether Foxn1 p.L19M induces adipogenesis in mouse embryonic fibroblasts (MEF) through signal transduction.
  • MEF mouse embryonic fibroblasts
  • Figure 3f shows that Western blot analysis to compare the expression of Foxn1, ⁇ -catenin, PPAR ⁇ (Peroxisome proliferator-activated receptor gamma), and ⁇ SMA was performed using proteins from MEF cells in the lower well.
  • Figure 3g shows the results of analyzing the effect of Foxn1 p.L19M on adipogenesis in dermal fibroblasts. WT and Foxn1 L19M/L19M skin fibroblasts were seeded and cultured with adipogenic medium for 10 days.
  • Figure 4 shows that the Foxn1 p.L19M trait promotes proliferation of keratinocytes and activates various adipogenic differentiation signals.
  • the coding genes for Foxn1 and Foxn1 p.L19M were overexpressed in a mouse keratinocyte cell line (Kera-308), and then gene expression was changed to Foxn1 L19M/ The expression pattern was compared with that of L19M mice. (Red color: increased relative gene expression, Bule color: decreased relative gene expression)
  • Figure 5 shows that Wnt signaling is involved in Foxn1 p.L19M-mediated EMT and adipogenesis.
  • Figures 5b and 5c show the results of immunohistochemistry and immunofluorescence staining to detect Wnt (Wingless-related integration site)5 ⁇ or Wnt10 ⁇ positive cells in skin tissue. blue; DAPI. Black or white scale bar: 50 ⁇ m.
  • Figures 5d and 5e show Wnt/ ⁇ -catenin signal, Methyl Ethyl Ketone (MEK), extracellular-signal-regulated kinase (ERK), and Signal transducer and activator of transcript 3 (STAT3) using proteins extracted from epidermal and dermal tissues. Shows the results of Western blot analysis for detection.
  • Figure 5h shows the results of Western blot analysis of ⁇ -catenin and E-cadherin to evaluate the induction of adipogenic differentiation and activation of epithelial-mesenchymal transition by Wnt5 ⁇ silencing.
  • Figure 6 shows that Foxn1 p.L19M gain-of-function stimulates migration and adipogenic signaling of keratinocytes and ⁇ SMA expression of fibroblasts.
  • Figure 6a shows the results of evaluating the adipogenic signal of Foxn1 p.L19M using the transwell system. Skin keratin cell line (Kera-308) was seeded in the upper well and MEFs were seeded in the lower well, and then transformed with each plasmid (CAG- Foxn1 -polyA [p Foxn1 ] or CAG- Foxn1 p.L19M-pA [p Foxn1 L19M]). converted.
  • Figure 6c shows the results of cellular wound healing assay after transient Foxn1 p.L19M expression. After culturing Kera-308 as a monolayer, each plasmid was transfected. Twenty-four hours after transfection, crevices were created by scraping, and wound healing density was calculated. Yellow line: initial edge of the gap and black line: edge observed after wound healing.
  • Figures 6e and 6f show the results of Western blot analysis to detect Foxn1, Wnt5 ⁇ , Wnt10 ⁇ , ⁇ -Catenin, E-cadherin, N-cadherin, CD34, and ⁇ SMA in Kera-308 or NIH3T3 cells after transfection with pFoxn1 or pFoxn1 p.L19M. shows. Each point represents the individual value of each culture. Data were expressed as mean ⁇ SEM. Statistical analysis was performed using unpaired Student's t-test (ns: not significant, *: p ⁇ 0.05, **: p ⁇ 0.01, ***: p ⁇ 0.001).
  • Figure 7 shows dWAT adipogenesis and activation of wound healing by Foxn1 p.L19M.
  • Figure 7a is a schematic diagram of an experiment performing in vivo transfection using lipofectamine. Each plasmid mixture was injected into the ear by intradermal injection. Injections were performed twice at two-week intervals.
  • Figure 7b shows H&E results of the ear 4 weeks after in vivo transfection. The thickness of the fat cell layer was measured at 5 locations per mouse, and the average value was used for analysis. Each dot represents data from an individual mouse. Data were expressed as mean ⁇ SEM. Statistical analysis was performed using unpaired Student's t-test. AC: ear cartilage. Scale bar: 50 ⁇ m.
  • Figure 7d shows the mechanism for dWAT adipogenesis in Foxn1 L19M/L19M .
  • the pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA (nSpCas9-BE, addgene ID: 79620) plasmid was obtained from addgene. After linearization by enzymatic digestion with Xba1, mRNA was synthesized using the mMESSAGE mMACHINE T7 Ultra transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). The sgRNA binding site is the third exon of the mouse Foxn1 gene (the first coding exon, House mouse Foxn1 has various alternative splicing mRNAs depending on the promoter signal, and includes the second exon, start codon, based on forkhead box N1 and transcript variant 1. Exon) was selected from sequences having 5'-NGG-3'. sgRNA was synthesized using the Megashortscript T7 Kit (Thermo Fisher Scientific).
  • C57BL/6 (B6) was purchased from Coretech (Pyeongtaek, Korea). After superovulation, B6 female mice were mated with a sperm donor, and embryos were collected the next day. Afterwards, 50ng/ ⁇ l of nSpCas9-BE mRNA and 10ng/ ⁇ l of sgRNA were pronuclear microinjected into the embryo. The manipulated embryos were transferred into the oviduct of mice, and the genotypes of the resulting offspring were analyzed by Sanger sequencing. Sequence information for sgRNA, primers, and shRNA is aligned in Table 1 below. This study was approved by the Animal Care Committee of Seoul National University Animal Hospital (SNU-161031-2 and 200221-1) and was conducted in accordance with the guidelines.
  • mice Four-week-old B6 and Foxn1 L19M/L19M male mice were randomly divided and fed regular chow (Purina Korea, Seongnam, Korea) and 45% HFD (Research Diet Inc., New Brunswick, NJ, USA) for 15 weeks. The body weight of each mouse was measured weekly.
  • mice were anesthetized using 2.5% Avertin and perfused through the heart with phosphate-buffered saline and 4% paraformaldehyde. Skin tissue fixed in formalin was embedded in paraffin and stained. In H&E staining, deparaffinized tissue was stained with 0.1% Mayer's H&E solution. For immunofluorescence and immunohistochemical staining, tissues were blocked with control serum and then incubated with primary and secondary antibodies. Antibody-reactive cells were detected with Cytation 5 (BioTek, Winooski, VT, USA), and the list of antibodies used is listed in Table 2 below. Masson trichrome staining was performed using a Masson trichrome staining kit (Polysciences, Warrington, PA, USA).
  • RNA sequencing and analysis (Sashimi plots, heatmaps, and gene network analysis)
  • HTS High-throughput sequencing
  • qRT-PCR was performed with PowerUp SYBR Green Master Mix and StepOne Plus Real-Time PCR system. All reactions were performed in triplicate and the average value of each sample was used for further analysis. Expression of target genes was normalized to the expression of actin. All reagents and instruments used for qPCR analysis were purchased from Thermo Fisher Scientific. Primer sequences used in this example were aligned in Table 1 above.
  • Immunoreactive proteins were detected using an ECL kit (Abclon, Seoul, Korea) after incubation with horseradish peroxidase-conjugated secondary antibody for 1 hour at room temperature. Information on the antibodies used in this example is arranged in Table 2 above.
  • dermal fibroblast culture dermal tissue was isolated with 200 IU/mg collagenase I (Thermo Fisher Scientific) for 30 minutes at 37°C. After filtration using a strainer with 70 ⁇ m pores, the cells were cultured in DMEM (Dulbecco Modified Eagle Medium) with 15% fetal bovine serum (FBS; Thermo Fisher Scientific).
  • DMEM Dynamic Eagle Medium
  • FBS fetal bovine serum
  • MEF mouse embryonic fibroblast
  • fetal tissues were obtained from female B6 mice at 13.5 days of gestation, and the tissues were dissociated by mincing with 250 IU/mg collagenase IV (Thermo Fisher Scientific) for 30 minutes at 37°C. . After stopping the enzyme reaction using FBS, the cells were cultured using DMEM containing 10% FBS.
  • shRNA plasmids for Foxn1, Wnt5 ⁇ , Wnt5 ⁇ and Wnt10 ⁇ were designed with ITR-U6-shRNA sequence-human PGK promoter-eGFP/Puro-pA-ITR to utilize the PiggyBac system. Additionally, gene expression vectors for Foxn1 and Foxn1 p.L19M were designed with CAG promoter- Foxn or Foxn1 p.L19M coding sequence-pA. Plasmids were constructed by DNA synthesis (VectorBuilder, Chicago, IL, USA).
  • shRNA and PiggyBac transposase plasmid were co-transfected into Kera-308, and a stable cell line was established after antibiotic screening.
  • a single plasmid was transfected into Kera-308. Transfection was performed for 48 hours using Lipofectamine 3000 (Invitrogen, Waltham, MA, USA) according to the manufacturer's manual. Sequence information of shRNA was arranged in Table 1 above.
  • the present inventors sought to develop a novel variant that can be useful for cosmetic purposes and to overcome related skin diseases by inducing EMT (epithelial-mesenchymal transition) and dWAT (dermal white adipose tissue) fat production regardless of whether the skin is damaged or not.
  • EMT epi-mesenchymal transition
  • dWAT skin white adipose tissue
  • cgactggagggcgaacccca agg
  • Exon 2 containing the start codon of Foxn1 was selected as the target site for SNP formation.
  • sgRNA single guide RNA
  • nSpCas9-BE nickase Streptococcus pyogens Cas9 fused base editor
  • the homozygote p.L19M (B6. Foxn1 p.L19M, Foxn1 L19M/L19M ) mouse was found to have an obese phenotype with normal hair growth.
  • Example 1 In order to investigate the cause of obesity of p.L19M (B6. Foxn1 p.L19M, Foxn1 L19M/L19M ) identified in Example 1, the present inventors randomly divided mice and fed them with normal feed (NC) and 45% solid food. A solid diet (HFD) was fed for 15 weeks.
  • NC normal feed
  • HFD solid diet
  • TEC thymic epithelial cells
  • keratinocytes skin changes were analyzed histologically.
  • HFD feeding increased dWAT thickness approximately two-fold compared to the regular feed treatment group in both WT and Foxn1 L19M/L19M, with no difference depending on genotype. Additionally, as shown in Figures 1E, 1F and 1G, HFD feeding did not increase the number of dermal adipocytes in WT and Foxn1 L19M/L19M .
  • the present inventors analyzed the Foxn1 gene expression pattern in the epidermis of Foxn1 L19M/L19M . As a result, as shown in Figure 2A, Foxn1 p.L19M did not induce alternative exon splicing in mice.
  • EMT epidermal-mesenchymal-transition
  • E-cadherin expression of Foxn1 p.L19M was decreased compared to WT in epidermal tissue and primary keratinocytes, and an increase in N-cadherin was observed only in dermal tissue and in primary dermal fibroblasts. It didn't work. This indicates that the EMT of Foxn1 L19M/L19M was limited to epidermal keratinocytes and not dermal fibroblasts.
  • EMT-related genes such as Matrix metalloproteinase-2 and 9, Vimentin, and Fibronectin showed relatively significantly increased expression in the skin of Foxn1 L19M/L19M .
  • the present inventors confirmed the expression locations of CD34 and ⁇ SMA, known as markers of adipocyte precursor cells, through immunofluorescence analysis.
  • CD34-positive cells are known as adipocyte precursor cells that can differentiate into mature adipocytes, and ⁇ SMA-positive myofibroblasts are known to be able to differentiate into adipocytes during wound healing.
  • CD34-positive and ⁇ SMA-positive cells co-expressed Foxn1 and were observed in the dermis-dWAT border area. This indicates that Foxn1 positive cells located in the dermis-dWAT border area can be differentiated into adipocytes.
  • preadipocyte markers CD24, CD34, Sca-1, and ⁇ SMA protein were confirmed through Western blotting.
  • adipocytes such as CD34 and Sca-1 increased in Foxn1 L19M/L19M epidermal tissue.
  • CD24, CD34, Sca-1, and ⁇ SMA increased in dermal tissue.
  • CD34 was highly expressed in Foxn1 L19M/L19M dermal tissue compared to WT, while there was no difference in expression level compared to WT in primary dermal fibroblasts.
  • This increased CD34 expression was derived from epidermal keratinocytes, and as shown in Figure 3c, when Foxn1 p.L19M is overexpressed in keratinocytes, conversion to adipocytes is observed. This means that keratinocytes can differentiate into preadipocytes.
  • the generation and supply of adipocytes is a major mechanism responsible for the induction of dWAT hyperplasia in Foxn1 L19M/L19M .
  • Example 5 Foxn1 Adipogenesis through conversion of dermal fibroblasts to preadipocytes or adipocytes via keratinocyte-derived signaling, induced by p.L19M
  • Foxn1 L19M/L19M is a systemic mutant animal, and dermal fibroblasts have a high level of ⁇ SMA expression (Figure 3b). Accordingly, Foxn1 L19M/L19M and WT dermal fibroblasts were cultured using adipogenic medium ( Figure 3g). Dermal fibroblasts showed adipogenic potential, and there was no difference in the amount of adipogenesis between Foxn1 +/+ and Foxn1 L19M/L19M ( Figure 3h).
  • Foxn1 p.L19M activates the conversion of fibroblasts into preadipocytes or adipocytes that can produce fat.
  • Foxn1 p.L19M To determine whether the increase in adipogenesis and EMT caused by Foxn1 p.L19M was caused by overexpression of Foxn1, the present inventors compared and analyzed the gene expression of epidermal tissue and Foxn1 and keratinocyte lines overexpressed by Foxn1 p.L19M. As shown in Figure 4, Foxn1 p.L19M characteristically increased the expression of cell structure-related genes and proliferation-related genes, which was different from overexpression of the Foxn1 gene. Additionally, genes related to signal transduction related to adipogenic differentiation were also more activated in epidermal tissues of Foxn1 p.L19M overexpression and Foxn1 L19M/L19M .
  • the present inventors analyzed genes related to cell migration and cell differentiation through RNA sequencing data to investigate the mechanism of increased EMT of Foxn1 p.L19M.
  • Wnt5 ⁇ and Wnt10 ⁇ signaling were correlated with Foxn1 in the gene network analysis.
  • Figures 5b and 5c as a result of expression location analysis, Wnt5 ⁇ and Foxn1 were co-located in the border area between the dermis and dWAT in Foxn1 L19M/L19M .
  • Wnt10 ⁇ was mainly expressed in the epidermis of WT, and its expression was reduced in Foxn1 L19M/L19M ( Figure 5b).
  • Wnt5ß increased and Wnt10 ⁇ and ⁇ -catenin decreased in the dermis of Foxn1 L19M/L19M
  • Wnt/ ⁇ -catenin signaling is related to adipogenesis.
  • the Wnt5-Fizzled2 pathway promotes EMT through STAT3 phosphorylation, and increased phosphorylation of MEK and STAT3 in the epidermis was also observed in Foxn1 L19M/L19M .
  • the Wnt5-Fizzled pathway seemed to be involved in the EMT of Foxn1 L19M/L19M .
  • the present inventors sought to confirm the correlation between Wnt5 ⁇ signaling and adipogenesis or EMT through gene silencing experiments.
  • Wnt5 ⁇ inhibition reduced adipogenesis and cell migration to dermal fibroblasts in the lower wells.
  • Wnt5 ⁇ inhibition led to a decrease in ⁇ -catenin and an increase in E-cadherin, identical to that seen in Foxn1L19M/L19M mice.
  • the present inventors analyzed the coding sequences of WT Foxn1 (pCAG- Foxn1 -pA, p Foxn1 ) and Foxn1 p.L19M (pCAG- Foxn1 p.L19M-pA, p Foxn1 p.L19M) in a mouse wild type keratinocyte cell line (Kera-308). After transfection, adipogenesis and cell migration activities were analyzed.
  • the present inventors confirmed WNT ligand activation in keratinocytes and ⁇ SMA expression in fibroblasts.
  • Wnt5 ⁇ was expressed relatively highly in Kera-308 after pFoxn1 or pFoxn1 p.L19M transfection.
  • the expression pattern of Wnt5 ⁇ was similar between Foxn1 L19M/L19M and transfected Kera-308, whereas Wnt10 ⁇ showed an opposite pattern between mice and cells ( Figures 5D and 6E).
  • Wnt5 ⁇ is the main linker for EMT and adipogenesis of Foxn1 p.L19M.
  • Foxn1 p.L19M may increase ⁇ SMA expression in fibroblasts of the lower wells, leading to their differentiation into adipocytes, resulting in higher ⁇ SMA in the dermis of Foxn1 L19M/L19M. Focusing on expression, pFoxn1 and pFoxn1 p.L19M were transfected into a mouse fibroblast cell line (NIH3T3).
  • transient expression of pFoxn1 p.L19M induced increased ⁇ SMA expression in the NIH3T3 cell line, but not pFoxn1 .
  • the present inventors focused on the fact that, as confirmed in Example 8 above, transient pFoxn1 p.L19M expression in Kera-308 can promote cell migration and adipogenesis (FIGS. 6A and 6B), To rule out possible changes in dWAT adipogenesis, the ear was selected as the target organ for in vivo experiments to confirm its in vivo applicability. peGFP, p Foxn1 , and p Foxn1 p.L19M were transfected twice at 2-week intervals, and the thickness of the dermal white fat layer was compared after 4 weeks ( Figure 7a).
  • the healing ability was compared in a wound-induced model to utilize the characteristics of epithelial-mesenchymal transition induced by Foxn1 p.L19M, and Foxn1 L19M/L19M mice showed significantly faster healing than wild type mice. Wound healing ability was induced.
  • EMT epithelial-mesenchymal transition
  • dWAT dermal white adipose tissue
  • Foxn1 p.L19M of the present invention affects skin cell homeostasis, causing keratinocytes to transition into preadipocytes, and induces a fat differentiation signal in keratinocytes to transform subcutaneous preadipocytes into adipocytes. It promoted fat formation and increased subcutaneous fat. On the other hand, wild-type Foxn1 did not promote the formation of subcutaneous fat. In addition, it was confirmed that when introducing Foxn1 p.L19M into normal animals, not only can adipogenesis be induced only in specific areas, but also healthy fat can be obtained by increasing the number of adipocytes. Additionally, Foxn1 p.L19M can be used to obtain healthy fat. It was confirmed that when applied to fibroblasts, it can induce the expression of characteristics into myofibroblasts, which play an important role in wounds and fibrosis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Dermatology (AREA)
  • Epidemiology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Birds (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Polymers & Plastics (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Rheumatology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Le mutant aléatoire faux-sens (Foxn1 c.55 C > A(p.L19M)) construit par le système d'édition CRISPR/Cas9 selon la présente invention favorise la lipogenèse pour augmenter la graisse sous-cutanée par conversion des kératinocytes ou des fibroblastes en adipocytes ou en préadipocytes et induit l'expression caractéristique des fibroblastes, qui jouent un rôle crucial dans la cicatrisation et la fibrose des plaies, dans les myofibroblastes. Ainsi, le mutant peut être utilisé non seulement dans le traitement de maladies fibrotiques et l'atténuation des plaies cutanées, mais également dans le soulagement de problèmes esthétiques et de santé provoqués par une réduction de volume et une déficience fonctionnelle due à une atrophie tissulaire grasse chez des individus contemporains, grâce à l'induction de graisse sous-cutanée dans des zones spécifiques de la peau.
PCT/KR2023/004541 2022-04-06 2023-04-04 Nouveau mutant de foxn1 et son utilisation WO2023195749A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2022-0043046 2022-04-06
KR1020220043046A KR20230144171A (ko) 2022-04-06 2022-04-06 신규한 Foxn1 변이체 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2023195749A1 true WO2023195749A1 (fr) 2023-10-12

Family

ID=88243175

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/004541 WO2023195749A1 (fr) 2022-04-06 2023-04-04 Nouveau mutant de foxn1 et son utilisation

Country Status (2)

Country Link
KR (1) KR20230144171A (fr)
WO (1) WO2023195749A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019179439A1 (fr) * 2018-03-19 2019-09-26 Beijing Biocytogen Co., Ltd Animal non humain knock-out foxn1

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019179439A1 (fr) * 2018-03-19 2019-09-26 Beijing Biocytogen Co., Ltd Animal non humain knock-out foxn1

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
"Master Thesis", 1 January 2019, DEPARTMENT OF INTERNATIONAL AGRICULTURAL TECHNOLOGY, GRADUATE SCHOOL OF INTERNATIONAL AGRICULTURAL TECHNOLOGY SEOUL NATIONAL UNIVERSITY, Korea, article BAE, JI HYUN: "A Study for Phenotype Analysis with the CRISPR Mediated Mice Model on the Skin Associated Immunity and Metabolism", pages: 1 - 76, XP009550177 *
DATABASE PROTEIN ANONYMOUS : "forkhead box protein N1 isoform X1 [Mus musculus]", XP093097146, retrieved from NCBI *
GAWRONSKA-KOZAK BARBARA, GRABOWSKA ANNA, KUR-PIOTROWSKA ANNA, KOPCEWICZ MARTA: "Foxn1 Transcription Factor Regulates Wound Healing of Skin through Promoting Epithelial-Mesenchymal Transition", PLOS ONE, vol. 11, no. 3, pages e0150635, XP093097148, DOI: 10.1371/journal.pone.0150635 *
WALENDZIK KATARZYNA, KOPCEWICZ MARTA, BUKOWSKA JOANNA, PANASIEWICZ GRZEGORZ, SZAFRANSKA BOZENA, GAWRONSKA-KOZAK BARBARA: "The Transcription Factor FOXN1 Regulates Skin Adipogenesis and Affects Susceptibility to Diet-Induced Obesity", JOURNAL OF INVESTIGATIVE DERMATOLOGY, ELSEVIER, NL, vol. 140, no. 6, 1 June 2020 (2020-06-01), NL , pages 1166 - 1175.e9, XP093097147, ISSN: 0022-202X, DOI: 10.1016/j.jid.2019.11.010 *

Also Published As

Publication number Publication date
KR20230144171A (ko) 2023-10-16

Similar Documents

Publication Publication Date Title
WO2019045259A2 (fr) Composition cosmétique comprenant un extrait de fleur de dendrobium candidum wallich ex lindley
WO2017171491A1 (fr) Composition pharmaceutique comprenant un extrait de cellules souches pour la prévention ou le traitement d'une maladie inflammatoire
WO2017222345A1 (fr) Nouveau composé induisant l'activation de l'autophagie permettant d'atténuer l'inflammation ou le vieillissement de la peau
WO2016159567A2 (fr) Composition pour favoriser la croissance capillaire ou la régénération capillaire, et à effet anti-inflammatoire
WO2019103300A1 (fr) Composition contenant des miarn pour le traitement de plaies et l'amélioration de la peau
WO2016080796A2 (fr) Composition pharmaceutique contenant un composé sesquiterpénique et utilisable en vue de la prévention ou du traitement de maladies à médiation par stat3, et son utilisation
WO2015111832A1 (fr) Composition de prévention ou de traitement de maladies liées à la prostate, contenant un extrait de poncirus trifoliata
WO2023195749A1 (fr) Nouveau mutant de foxn1 et son utilisation
WO2012134172A2 (fr) Composition contenant, comme ingrédient actif, une fraction d'acétate d'éthyle de schisandra chinensis baill, ou wuweizisu c séparée de la fraction, pour prévenir ou traiter l'obésité
WO2019022482A2 (fr) Composition pour prévenir ou traiter les maladies fibrotiques comprenant un extrait de dendropanax morbifera à titre de principe actif
WO2013054998A1 (fr) Nouveau dérivé de chalcone et composition anticancéreuse comprenant celui-ci comme principe actif
WO2018128479A1 (fr) Composition pour la prévention ou le traitement de maladies musculaires, comprenant comme principe actif de l'acide subérique ou un sel pharmaceutiquement acceptable de celui-ci
WO2021033833A1 (fr) Peptide ayant une activité de blanchiment de la peau et son utilisation
WO2017146332A1 (fr) Nouvelle utilisation d'un dérivé de chromone en tant que composition pharmaceutique pour prévenir et traiter une fibrose au moyen d'une activité inhibitrice de transition épithélio-mésenchymateuse de celui-ci
WO2016093515A1 (fr) Composition pour activer un gène de longévité
WO2019124803A1 (fr) Composition comprenant un extrait de selaginella rossii warb. ou des fractions de celui-ci pour la prévention ou le traitement de syndromes métaboliques
WO2021107381A1 (fr) Composition comprenant de l'acide férulique et des analogues de celui-ci pour prévenir et traiter des maladies cutanées causées par une mutation génétique
WO2019103572A1 (fr) Composition comprenant un miarn pour la prévention de chute des cheveux ou la stimulation de repousse des cheveux
WO2022139524A1 (fr) Nouveau dérivé de fk506 et composition le comportant pour favoriser la pousse des cheveux
WO2021251790A1 (fr) Conjugué acide désoxycholique-peptide à activité anti-obésité et son utilisation
WO2021002664A1 (fr) Composition pour la prévention, le soulagement ou le traitement d'un cancer
WO2015190808A2 (fr) Capacité de blanchiment de petites cellules souches et leur utilisation
WO2023146274A1 (fr) Composition permettant de prévenir, de soulager ou de traiter l'alopécie ou la poliose par la régulation de l'aldéhyde déshydrogénase 2
WO2021025529A1 (fr) Composition de blanchiment de la peau contenant un dérivé de dihydro-5-méthylfuran-2 (3h)-one
WO2021182896A1 (fr) Composition de différenciation de graisse brune induite comprenant un dérivé d'isoliquiritigénine

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23784973

Country of ref document: EP

Kind code of ref document: A1