WO2019179439A1 - Animal non humain knock-out foxn1 - Google Patents

Animal non humain knock-out foxn1 Download PDF

Info

Publication number
WO2019179439A1
WO2019179439A1 PCT/CN2019/078744 CN2019078744W WO2019179439A1 WO 2019179439 A1 WO2019179439 A1 WO 2019179439A1 CN 2019078744 W CN2019078744 W CN 2019078744W WO 2019179439 A1 WO2019179439 A1 WO 2019179439A1
Authority
WO
WIPO (PCT)
Prior art keywords
animal
exon
cells
endogenous
foxn1
Prior art date
Application number
PCT/CN2019/078744
Other languages
English (en)
Inventor
Yuelei SHEN
Chaoshe GUO
Yanan GUO
yang BAI
Rui Huang
Xiaofei Zhou
Meiling Zhang
Jiawei Yao
Original Assignee
Beijing Biocytogen Co., Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Biocytogen Co., Ltd filed Critical Beijing Biocytogen Co., Ltd
Publication of WO2019179439A1 publication Critical patent/WO2019179439A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027—New breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/12—Animals modified by administration of exogenous cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/15—Humanized animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/15—Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/105—Murine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0337—Animal models for infectious diseases
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0387—Animal model for diseases of the immune system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • This disclosure relates to genetically modified animals that have a disruption at the endogenous Foxn1 gene (e.g., Foxn1 knockout) , and methods of use thereof.
  • a disruption at the endogenous Foxn1 gene e.g., Foxn1 knockout
  • Immunodeficient animals are very important for disease modeling and drug developments. In recent years, immunodeficient mice are routinely used as model organisms for research of the immune system, cell transplantation, and the mechanisms of diseases. They have also been extensively used as hosts for normal and malignant tissue transplants, and are widely used to test the safety and efficacy of therapeutic agents.
  • This disclosure is related to genetically modified animals that have a disruption at the endogenous Foxn1 gene (e.g., Foxn1 knockout) , and methods of making and use thereof.
  • a disruption at the endogenous Foxn1 gene e.g., Foxn1 knockout
  • the disclosure relates to a genetically-modified, non-human animal whose genome includes a disruption in the animal’s endogenous forkhead box N1 (Foxn1) gene.
  • the disruption of the endogenous Foxn1 gene includes deletion of one or more exons of the endogenous Foxn1 gene.
  • the disruption of the endogenous Foxn1 gene includes deletion of one or more exons selected from exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9 of the endogenous Foxn1 gene.
  • the disruption of the endogenous Foxn1 gene includes deletion of exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9 of the endogenous Foxn1 gene.
  • the disruption of the endogenous Foxn1 gene further includes deletion of one or more exons or part of exons selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9 of the endogenous Foxn1 gene.
  • the disruption of the endogenous Foxn1 gene includes deletion of one or more introns of the endogenous Foxn1 gene.
  • the disruption of the endogenous Foxn1 gene further includes deletion of one or more introns or part of introns selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, and intron 8 of the endogenous Foxn1 gene.
  • the disruption includes deletion of at least 10 nucleotides in exon 4, deletion of the entirety of intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, and intron 8; and deletion of at least 10 nucleotides in exon 9.
  • the animal is homozygous with respect to the disruption of the endogenous Foxn1 gene. In some embodiments, the animal is heterozygous with respect to the disruption of the endogenous Foxn1 gene.
  • the disruption prevents the expression of a functional Foxn1 protein.
  • the length of the remaining exon sequences at the endogenous Foxn1 gene locus is less than 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the total length of all exon sequences of the endogenous Foxn1 gene.
  • the length of the remaining sequences at that the endogenous Foxn1 gene locus is less than 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the full sequence of the endogenous Foxn1 gene.
  • the disclosure relates to a genetically-modified, non-human animal, wherein the genome of the animal does not have one or more exons of Foxn1 gene at the animal’s endogenous Foxn1 gene locus.
  • the genome of the animal does not have one or more exons or part of exons selected from the group consisting of exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9.
  • the genome of the animal does not have one or more introns or part of introns selected from the group consisting of intron 4, intron 5, intron 6, intron 7, and intron 8.
  • the disclosure relates to a Foxn1 knockout non-human animal, wherein the genome of the animal includes from 5’ to 3’ at the endogenous Foxn1 gene locus, (a) a first DNA sequence; optionally (b) a second DNA sequence; (c) a third DNA sequence.
  • the first DNA sequence, the optional second DNA sequence, and the third DNA sequence are linked.
  • the first DNA sequence includes an endogenous Foxn1 gene sequence that is located upstream of exon 4 or intron 3
  • the second DNA sequence can have a length of 0 nucleotides to 1500 nucleotides
  • the third DNA sequence includes an endogenous Foxn1 gene sequence that is located downstream of intron 8 or the last exon (e.g., exon 9) .
  • the first DNA sequence includes a sequence that has a length (5’ to 3’ ) of from 10 to 100 nucleotides.
  • the length of the sequence refers to the length from the first nucleotide in exon 4 of the Foxn1 gene to the last nucleotide of the first DNA sequence.
  • the first DNA sequence includes at least 10 nucleotides from exon 4 of the endogenous Foxn1 gene.
  • the first DNA sequence includes exon 1, intron 1, exon 2, intron 2, exon 3, and intron 3 of the endogenous Foxn1 gene.
  • the third DNA sequence includes a sequence that has a length (5’ to 3’ ) of from 10 to 1500 nucleotides.
  • the length of the sequence refers to the length from the first nucleotide in the third DNA sequence to the last nucleotide in the last exon of the endogenous Foxn1 gene.
  • the third DNA sequence includes at least 100 nucleotides from exon 9 of the endogenous Foxn1 gene.
  • the second DNA sequence includes an exogenous sequence of 1 to 50 nucleotides or an endogenous sequence of 1 to 1500 nucleotides.
  • the disclosure relates to a genetically-modified, non-human animal produced by a method comprising knocking out one or more exons of endogenous Foxn1 gene by using (1) a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in exon 4 of the endogenous Foxn1 gene, and (2) a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in exon 9 of the endogenous Foxn1 gene.
  • a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in exon 4 of the endogenous Foxn1 gene
  • sgRNA single guide RNA
  • the nuclease is CRISPR associated protein 9 (Cas9) .
  • the target sequence in exon 4 of the endogenous Foxn1 gene is set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7, and the target sequence in exon 9 of the endogenous Foxn1 gene is set forth in SEQ ID NO: 8, 9, 10, 11, 12, 13, or 14.
  • the first nuclease includes a sgRNA that targets SEQ ID NO: 1 and the second nuclease includes a sgRNA that targets SEQ ID NO: 8.
  • the animal does not express a functional Foxn1 protein.
  • the animal does not express a functional interleukin-2 receptor.
  • the animal has one or more of the following characteristics:
  • the percentage of T cells is less than 5%, 2%, 1.5%, 1%, 0.7%, or 0.5%of leukocytes in the animal;
  • the percentage of B cells is less than 1%, 0.1%or 0.05%of leukocytes in the animal;
  • the percentage of NK cells is less than 5%, 2%or 1.5%of leukocytes in the animal;
  • the percentage of CD4+ T cells is less than 1%, 0.5%, 0.3%, or 0.1%of T cells;
  • the percentage of CD8+ T cells is less than 1%, 0.5%, 0.3%, or 0.1%of T cells
  • the percentage of CD3+ CD4+ cells, CD3+ CD8+ cells, CD3-CD19+cells is less than 5%, 1%or 0.5%of leukocytes in the animal;
  • the percentage of T cells, B cells, and NK cells is less than 5%, 4%, 3%, 2%or 1%of leukocytes in the animal.
  • the animal after being engrafted with human hematopoietic stem cells to develop a human immune system has one or more of the following characteristics:
  • the percentage of human CD45+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes of the animal;
  • the percentage of human CD19+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes in the animal.
  • the animal does not have hair.
  • the animal has one or more of the following characteristics:
  • the animal has no functional T-cells and/or no functional B-cells;
  • the animal is a mammal, e.g., a monkey, a rodent, a rat, or a mouse.
  • the animal is a C57 mouse, a C57BL mouse, a BALB/c mouse, a NOD/scid mouse, or a NOD/scid nude mouse, or a NOD-Prkdc scid IL-2r ⁇ null mouse.
  • the animal further includes a sequence encoding a human or chimeric protein.
  • the human or chimeric protein is programmed cell death protein 1 (PD-1) , PD-L1, IL3, IL6, IL15, CSF1, or CSF2.
  • PD-1 programmed cell death protein 1
  • PD-L1 PD-L1
  • IL3 IL3, IL6, IL15
  • CSF1 CSF2
  • CSF2 CSF2
  • the animal further includes a disruption in the animal’s endogenous Beta-2-Microglobulin (B2M) gene.
  • B2M Beta-2-Microglobulin
  • the disclosure relates to a method of determining effectiveness of an agent or a combination of agents for the treatment of cancer.
  • the method includes the steps of engrafting tumor cells to the animal as described herein, thereby forming one or more tumors in the animal; administering the agent or the combination of agents to the animal; and determining the inhibitory effects on the tumors.
  • human peripheral blood cells hPBMC
  • human hematopoietic stem cells are injected to the animal.
  • the tumor cells are from cancer cell lines. In some embodiments, the tumor cells are from a tumor sample obtained from a human patient.
  • the inhibitory effects are determined by measuring the tumor volume in the animal.
  • the tumor cells are melanoma cells, lung cancer cells, primary lung carcinoma cells, non-small cell lung carcinoma (NSCLC) cells, small cell lung cancer (SCLC) cells, primary gastric carcinoma cells, bladder cancer cells, breast cancer cells, and/or prostate cancer cells.
  • NSCLC non-small cell lung carcinoma
  • SCLC small cell lung cancer
  • the agent is an anti-PD-1 antibody. In some embodiments, the agent is an anti-PD-L1 antibody.
  • the combination of agents includes one or more agents selected from the group consisting of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel, and capecitabine.
  • the disclosure relates to a method of producing an animal comprising a human hemato-lymphoid system.
  • the method includes the step of engrafting a population of cells comprising human hematopoietic cells or human peripheral blood cells into the animal as described herein.
  • the human hemato-lymphoid system includes human cells selected from the group consisting of hematopoietic stem cells, myeloid precursor cells, myeloid cells, dendritic cells, monocytes, granulocytes, neutrophils, mast cells, lymphocytes, and platelets.
  • the methods further include the step of irradiating the animal prior to the engrafting.
  • the disclosure relates to a method of producing a Foxn1 knockout mouse, the method comprising the steps of:
  • the disclosure relates to a method of producing a Foxn1 knockout mouse.
  • the method includes the step of
  • the gene editing system includes a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in exon 4 of the endogenous Foxn1 gene, and a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in the last exon (e.g. exon 9) or the 3’ -UTR of the endogenous Foxn1 gene.
  • sgRNA single guide RNA
  • the nuclease is CRISPR associated protein 9 (Cas9) .
  • the target sequence in exon 4 of the endogenous Foxn1 gene is set forth in SEQ ID NO: 1, 2, 3, 4, 5, 6, or 7, and the target sequence in exon 9 or the 3’ -UTR of the endogenous Foxn1 gene is set forth in SEQ ID NO: 8, 9, 10, 11, 12, 13, or 14.
  • the mouse embryonic stem cell or the fertilized egg has a C57 background, a C57BL background, a BALB/c background, a NOD/scid background, a NOD/scid nude, or a NOD-Prkdc scid IL-2r ⁇ null background.
  • the mouse embryonic stem cell or the fertilized egg includes a sequence encoding a human or chimeric protein.
  • the human or chimeric protein is PD-1 or CD137.
  • the mouse embryonic stem cell or the fertilized egg has a genome comprising a disruption in the animal’s endogenous B2M gene.
  • the disclosure relates to a non-human mammalian cell, comprising a disruption, a deletion, or a genetic modification as described herein.
  • the cell includes Cas9 mRNA or an in vitro transcript thereof.
  • the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is a germ cell. In some embodiments, the cell is a blastocyst.
  • the disclosure relates to methods for establishing a Foxn1 knockout animal model.
  • the methods include the steps of:
  • the cell is a fertilized egg cell
  • step (d) identifying the germline transmission in the offspring of the pregnant female in step (c) .
  • the establishment of a Foxn1 knockout animal involves a gene editing technique that is based on CRISPR/Cas9.
  • the non-human mammal is a mouse. In some embodiments, the non-human mammal in step (c) is a female with false pregnancy.
  • the disclosure relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein.
  • the disclosure also relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal.
  • the disclosure further relates to the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal.
  • the disclosure relates to a tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.
  • the disclosure further relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the method as described herein in the development of a product related to an immunization processes of human cells, the manufacture of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.
  • the disclosure also relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the method as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.
  • the disclosure further relates to the use of the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal, the animal model generated through the methods as described herein, in the screening, verifying, evaluating or studying the Foxn1 gene function, and the drugs for immune-related diseases and antitumor drugs.
  • the skin of hairless animals e.g., mice
  • the present disclosure also provides an animal model for testing cosmetics, and testing therapeutic agents for treating wounds or skin injuries.
  • FIGS. 1A-1B are bar graphs showing activity testing results for sgRNA1-sgRNA14 (NC is a negative control; PC is a positive control; blank is a blank control) .
  • FIG. 2 is a schematic diagram showing pT7-sgRNA plasmid map.
  • FIG. 3 shows PCR identification results for samples collected from tails of F0 generation mice (WT is a wildtype mouse; H 2 O is a blank control; the mice were labeled with Nos. 1-44) .
  • FIG. 4 is a photo of a Foxn1 knockout mouse with NOD-Prkdc scid IL-2rg null background (B-NDG nude) .
  • FIG. 5A is a photo of Foxn1 knockout NOD-Prkdc scid IL-2rg null mouse (B-NDG-Foxn1 tm1 mouse or B-NDG nude) with human tumor cells.
  • FIG. 5B is a photo of NOD-Prkdc scid IL-2rg null mouse (B-NDG) with human tumor cells.
  • FIG. 6 is a diagram showing the mouse Foxn1 gene locus.
  • This disclosure relates to Foxn1 knockout non-human animals, and methods of use thereof.
  • Immunodeficient animals are an indispensable research tool for studying the mechanism of diseases, and methods of treating such diseases. They can easily accept exogenous cells or tissues due to their immunodeficiency, and have been widely used in the research.
  • Foxn1 knockout animal has a compromised immune system. Foxn1 knockout mouse lack T cells and suffer from a lack of cell-mediated immunity. However, Foxn1 knockout mouse still has some functional immune cells, and some immune activities.
  • the present disclosure provides Foxn1 knockout animal with a NOD-Prkdc scid IL-2r ⁇ nul background. The NOD-Prkdc scid IL-2r ⁇ nul background further increases the level of immunodeficiency of Foxn1 knockout mouse.
  • the present disclosure provides an animal model with a higher level of immunodeficiency and an animal model that is even more acceptable to exogenous cells or tissues.
  • Foxn1 knockout has a hairless phenotype.
  • some other immunodeficient animals such as, NOD-Prkdc scid IL-2r ⁇ nul mice, NOD-Rag 1 -/- -IL2rg -/- (NRG) , Rag 2 -/- -IL2rg -/- (RG) , and NOD/SCID (NOD-Prkdc scid )
  • the present disclosure provides an immunodeficient animal model (e.g., Foxn1 knockout with NOD- Prkdc scid IL-2r ⁇ nul background) with a nude phenotype, which makes the experiments and observations of these immunodeficient animals much easier.
  • Foxn1 encodes a member of the forkhead family of transcription factors, and possesses both a forkhead DNA binding domain and a negatively-charged C-terminal transactivation domain. It functions as a transcriptional activator. Loss-of-function mutations in Foxn1 cause the nude phenotype in mice, rats and humans. The human and mouse Foxn1 proteins are 85%identical. The nude mutation has pleiotropic effects, influencing the multiplication and differentiation of cutaneous and thymic epithelial cells. The lack of functional FOXN1 protein leads to the lack of a thymus and, consequently, primary T-cell immunodeficiency.
  • thymic epithelial cell lineages express the FOXN1 transcription factor, which is essential for T cell development.
  • Foxn1 is expressed in endoderm-originating thymic tissue, with coexpression of characteristic epidermal markers. Foxn1 is also expressed in the skin in the epidermis and hair follicles, and also, in the submatrix region of the nails, oral cavity, tongue, and nasal placode. In the skin, Foxn1 expression has been found in epithelial cells.
  • the visible hairless phenotype associated with the nude mutation is due, at least in part, to an impairment in follicular differentiation.
  • nude follicles appear normal during early stages of morphogenesis, the follicles frequently fail to form the hair cortex, develop defects in the inner root sheath and hair cuticle, and produce fragile hairs that rarely protrude above the interfollicular epidermis.
  • Aberrant differentiation is also observed in the interfollicular epidermis, which contains highly irregular piles of cornified debris in the stratum corneum.
  • nude mouse primary keratinocytes have a normal mitogenic response to growth factors but undergo abnormal differentiation, expressing low levels of the early differentiation marker keratin 1.
  • Foxn1 expression is associated with keratinocytes in the early stages of terminal differentiation, while in postpartum mice Foxn1 is predominantly expressed in the anagen (growing) phase of the hair cycle in post-mitotic cells.
  • Foxn1 expression is triggered when cells transit from the proliferative (basal layer) to the differentiated state (suprabasal and remaining layers of keratinocytes) . It is readily visible in murine hair follicles (HFs) as they undergo synchronized dynamic cycles of active growth (anagen) , regression (catagen) , and quiescence (telogen) .
  • HFs murine hair follicles
  • the FOXN1 level peaks during the anagen stage, while it is absent in the telogen stage.
  • Anagen is linked to the activation of multipotent SCs, which exit their niche and differentiate.
  • FOXN1-positive cells are submatrix cells that proliferate rapidly and presumably transit to differentiation.
  • the activity of FOXN1 was reported as being most prominent in the first suprabasal layer of keratinocytes, which correlates with their exit from the cell cycle and the initiation of differentiation; the vast majority of the proliferative basal cells of the IFE are FOXN1 negative.
  • Foxn1 gene In human genomes, Foxn1 gene (Gene ID: 8456) is located on chromosome 17, and has 8 exons.
  • the nucleotide sequence for human Foxn1 mRNA is NM_003593.2, and the amino acid sequence for human Foxn1 is NP_003584.2.
  • Foxn1 gene locus has 9 exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9 (FIG. 6) .
  • the nucleotide sequence for mouse Foxn1 cDNA is NM_001277290.1 (SEQ ID NO: 26)
  • the amino acid sequence for mouse Foxn1 is NP_001264219.1 (SEQ ID NO: 27) .
  • the location for each exon in the mouse Foxn1 nucleotide sequence and amino acid sequence is listed below:
  • the mouse Foxn1 gene (Gene ID: 15218) is located in Chromosome 11 of the mouse genome, which is located from 78357577 to 78387654 of NC_000077.6 (GRCm38. p4 (GCF_000001635.24) ) .
  • the 5’ -UTR is from 78,386,558 to 78,386,495 and 78,371,967 to 78,371,939
  • exon 1 is from 78,386,558 to 78,386,495
  • the first intron is from 78,386,494 to 78,371,968,
  • exon 2 is from 78,371,967 to 78,371,816,
  • the second intron is from 78,371,815 to 78,371,419
  • exon 3 is from 78,371,418 to 78,370,957
  • the third intron is from 78,370,956 to 78,368,821
  • exon 4 is from 78,368,820 to 78,368,707
  • the fifth intron is from 78,366,
  • Foxn1 genes, proteins, and locus of the other species are also known in the art.
  • the gene ID for Foxn1 in Rattus norvegicus is 287469
  • the gene ID for Foxn1 in Macaca mulatta is 708926
  • the gene ID for Foxn1 in Sus scrofa is 100625164.
  • the relevant information for these genes can be found, e.g., intron sequences, exon sequences, amino acid residues of these proteins
  • NCBI database e.g., NCBI database.
  • the present disclosure provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous Foxn1 gene, wherein the disruption of the endogenous Foxn1 gene comprises deletion of one or more exons, or part of the one or more exons, wherein the one or more exons are selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9 of the endogenous Foxn1 gene.
  • the disclosure provides a genetically-modified, non-human animal that does not have one or more exons that are selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9 of the endogenous Foxn1 gene.
  • the animals do not have exons 4-9 or exons 5-8.
  • deletion of an exon refers to the deletion the entire exon.
  • deletion of exon 5 means that all sequences in exon 5 are deleted.
  • the term “deletion of part of an exon” refers to at least one nucleotide, but not all nucleotides in the exon is deleted. In some embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, or 1500 nucleotides in the exon are deleted.
  • the disruption comprises deletion of one or more introns, or part of the one or more introns, wherein the one or more introns are selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, and intron 8 of the endogenous Foxn1 gene.
  • the disclosure provides a genetically-modified, non-human animal does not have one or more introns that are selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, and intron 8 of the endogenous Foxn1 gene.
  • the animal does not have intron 4, intron 5, intron 6, intron 7, and/or intron 8.
  • deletion of an intron refers to the deletion the entire intron.
  • deletion of intron 4 means that all sequences in intron 4 are deleted.
  • the term “deletion of part of an intron” refers to at least one nucleotide, but not all nucleotides in the intron is deleted. In some embodiment, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, or 3000 nucleotides in the intron are deleted.
  • the disruption comprises deletion of 5’ -UTR, 3’ -UTR, or part of 5’ -UTR and/or 3’ -UTR.
  • the disruption of the endogenous Foxn1 gene comprises deletion of one or more exons selected from the group consisting of exon 4, exon 5, exon 6, exon 7, exon 8, and exon 9 of the endogenous Foxn1 gene. In some embodiments, the disruption of the endogenous Foxn1 gene further comprises deletion of exon 1, exon 2, and/or exon 3 of the endogenous Foxn1 gene.
  • the entire sequence of mouse exon 5, exon 6, exon 7, and exon 8 are deleted.
  • a “region” or “portion” of mouse exons, introns, 5’ -UTR, or 3’ -UTR of Foxn1 gene are deleted.
  • the term “region” or “portion” can refer to e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, or 3000 nucleotides.
  • the “region” or “portion” can be at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, 5’ -UTR, or 3’ -UTR.
  • a region, a portion, or the entire sequence of exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9 are deleted.
  • a region, a portion, or the entire sequence of mouse intron 4, intron 5, intron 6, intron 7, and/or intron 8 are deleted.
  • the disruption comprises or consists of deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, or 1500 nucleotides in exon 4, exon 5, exon 6, exon 7, exon 8, and/or exon 9.
  • the disruption comprises or consists of deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, or 3000 nucleotides in intron 4, intron 5, intron 6, intron 7, and/or intron 8.
  • the disruption comprises or consists of deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides in exon 4; deletion of the entirety of intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7, exon 8, and intron 8; and/or deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, or 1000 nucleotides in exon 9 or 3’ -UTR.
  • the length of the remaining exon sequences at the endogenous Foxn1 gene locus is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the total length of all exon sequences of the endogenous Foxn1 gene.
  • the length of the remaining exon sequences at the endogenous Foxn1 gene locus is about or at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the total length of all exon sequences of the endogenous Foxn1
  • the length of the remaining sequences at that the endogenous Foxn1 gene locus is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the full sequence of the endogenous Foxn1 gene.
  • the length of the remaining sequences at that the endogenous Foxn1 gene locus is about or at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 75%, or 80%of the full sequence of the endogenous Foxn1 gene.
  • the length of the sequence is determined by the sequence starting from the first nucleotide of exon 1. In some embodiments, the sequence ends at the last nucleotide of the last exon.
  • the present disclosure further relates to the genomic DNA sequence of a Foxn1 knockout animal (e.g., a rodent, a mouse) .
  • the genome of the animal comprises from 5’ to 3’ at the endogenous Foxn1 gene locus, (a) a first DNA sequence; optionally, (b) a second DNA sequence; (c) a third DNA sequence, wherein the first DNA sequence, the optional second DNA sequence, and the third DNA sequence are linked.
  • the second DNA sequence comprises an exogenous sequence.
  • the second DNA sequence can have a length of 0 nucleotides to 1100 nucleotides (e.g., at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, or 1050 nucleotides) .
  • 0 nucleotides to 1100 nucleotides e.g., at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 2
  • the second DNA sequence has only 0 nucleotides, which means that there is no extra sequence between the first DNA sequence and the third DNA sequence. In some embodiments, random or exogenous sequences are added. In some embodiments, the second DNA sequence has a length of 1 nucleotide to 100 nucleotides (e.g., 1 to 20 nucleotides, or 1 to 10 nucleotides) .
  • the second DNA sequence has about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, or 1200 nucleotides.
  • the second DNA sequence has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, or 1200 nucleotides.
  • the first DNA sequence comprises an endogenous Foxn1 gene sequence that is located upstream of exon 4, and can include all or just part of sequences that is located upstream of exon 4.
  • the first DNA sequence comprises a sequence that has a length (5’ to 3’ ) of from 10 to 18,000 nucleotides (e.g., from 10,000 to 18,000 nucleotides, from 17,000 to 18,000 nucleotides) starting from the first nucleotide in exon 1 of the Foxn1 gene to the last nucleotide of the first DNA sequence.
  • the first DNA sequence comprises about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, or 450 nucleotides from exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, and/or exon 4.
  • the first DNA sequence has at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 nucleotides from exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, and/or exon 4, or the combination of exon 1, intron 1, exon 2, intron 2, exon 3, intron 3, and exon 4.
  • the first DNA sequence comprises a sequence that has a length (5’ to 3’ ) of from 10 to 100 nucleotides (e.g., from 10 to 60 nucleotides, from 40 to 100 nucleotides, from 40 to 60 nucleotides, or from 50 to 60 nucleotides) starting from the first nucleotide in exon 4 of the Foxn1 gene to the last nucleotide of the first DNA sequence.
  • the first DNA sequence comprises about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides from exon 4.
  • the first DNA sequence has at most 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150 nucleotides from exon 4.
  • the third DNA sequence comprises an endogenous Foxn1 gene sequence that is located downstream of intron 8, and can include all or just part of sequences that is located downstream of intron 8.
  • the third DNA sequence comprises a sequence that has a length (5’ to 3’ ) of from 1 to 1300 nucleotides (e.g., from 1 to 1000 nucleotides, or from 500 to 1300 nucleotides) starting from the first nucleotide in the third DNA sequence to the last nucleotide in the last exon (e.g., exon 9 in mouse) of the endogenous Foxn1 gene.
  • the third DNA sequence comprises about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, or 1300 nucleotides from exon 9 or 3’ -UTR.
  • the third DNA sequence has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, or 1350 nucleotides from exon 9 or 3’ -UTR.
  • the Foxn1 gene sequence at the endogens Foxn1 locus is set forth in SEQ ID NO: 28.
  • a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical or 100%identical to SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, or SEQ ID NO: 34 is deleted.
  • the genetic modified non-human animal comprises a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical or 100%identical to SEQ ID NO: 30, SEQ ID NO: 32, or SEQ ID NO: 35.
  • the sequence is located at the endogenous Foxn1 locus.
  • the disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical to any nucleotide sequence as described herein (e.g., exon sequences, intron sequences, the remaining exon sequences, the deleted sequences, the 5’ -UTR, the 3’ -UTR) , and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%
  • the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein.
  • the nucleic acid sequence is less than 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or 11000 nucleotides.
  • the amino acid sequence is less than , 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400 or 1500 amino acid residues.
  • the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.
  • the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) .
  • the length of a reference sequence aligned for comparison purposes is at least 80%of the length of the reference sequence, and in some embodiments is at least 90%, 95%, or 100%.
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
  • Cells, tissues, and animals are also provided that comprise a disruption of the endogenous Foxn1 gene as described herein, as well as cells, tissues, and animals (e.g., mouse) that have any nucleic acid sequence as described herein.
  • the term “genetically-modified non-human animal” refers to a non-human animal having a modified sequence (e.g., deletion of endogenous sequence or insertion of exogenous sequence) in at least one chromosome of the animal’s genome.
  • at least one or more cells e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%of cells of the genetically-modified non-human animal have the modified sequence in its genome.
  • the cell having the modified sequence can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, a germ cell, a blastocyst, an epithelia cell, or an endogenous tumor cell.
  • genetically-modified non-human animals are provided that comprise a disruption or a deletion at the endogenous Foxn1 locus. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.
  • the genetically-modified non-human animal does not express Foxn1 (e.g., intact or functional Foxn1 protein) . Because Foxn1 is involved in follicular differentiation, the genetically-modified non-human animal does not have hair. In some embodiments, the hair coverage of the genetically-modified non-human animal is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%.
  • Foxn1 e.g., intact or functional Foxn1 protein
  • the genetically-modified non-human animal is an immunodeficient animal.
  • the animal is a NOD-Prkdc scid IL-2r ⁇ nul , NOD-Rag 1 -/- -IL2rg -/- (NRG) , Rag 2 -/- -IL2rg -/- (RG) , NOD/SCID (NOD-Prkdc scid ) , NOD/SCID nude, or NOD-Prkdc scid IL-2rg null animal (e.g., a rodent, a rat, or a mouse) .
  • NOD-Prkdc scid IL-2rg null animal e.g., a rodent, a rat, or a mouse
  • mice Some of these immunodeficient mice are described in detail e.g., in Ito et al. "Current advances in humanized mouse models. " Cellular &molecular immunology 9.3 (2012) : 208, and WO/2018/166534; each of which is incorporated herein by reference in its entirety.
  • the genetically-modified non-human animal is not an immunodeficient animal.
  • the genetically-modified non-human animal lack functional T cells, B cells, and/or NK cells.
  • the animal can have one or more of the following characteristics:
  • the percentage of T cells is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%or 0.1%of leukocytes in the animal;
  • the percentage of B cells is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%or 0.01%of leukocytes in the animal;
  • the percentage of NK cells is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, or 0.5%of leukocytes in the animal;
  • CD4+ T cells CD3+ CD4+ cells
  • percentage of CD4+ T cells is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%of T cells;
  • the percentage of CD8+ T cells is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%of T cells;
  • the percentage of CD3+ CD4+ cells, CD3+ CD8+ cells, CD3-CD19+cells is less than 5%, 4%, 3%, 2%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%of leukocytes in the animal;
  • the percentage of T cells (CD3+ cells) and NK cells (CD3-CD49b+ cells) is less than 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, or 0.1%of leukocytes in the animal.
  • leukocytes or “white blood cells” include neutrophils, eosinophils (acidophilus) , basophils, lymphocytes, and monocytes. All leukocytes have nuclei, which distinguishes them from the anucleated red blood cells (RBCs) and platelets.
  • CD45 also known as leukocyte common antigen (LCA) , is a cell surface marker for leukocytes. Among leukocytes, monocytes and neutrophils are phagocytic.
  • Lymphocytes is a subtype of leukocytes. Lymphocytes include natural killer (NK) cells (which function in cell-mediated, cytotoxic innate immunity) , T cells, and B cells.
  • NK natural killer
  • the variations among individual mice are very small.
  • the standard deviations of the percentages are less than 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%or 0.01%.
  • the genetically-modified non-human animal has a NOD-Prkdc scid IL-2rg null background.
  • the genetically-modified animal can also have one or more of the following characteristics:
  • the genetically-modified mouse has no functional T-cells and/or no functional B-cells;
  • the genetically-modified mouse exhibits reduced macrophage function relative to a NOD/scid mouse, or a NOD/scid nude mouse;
  • the genetically-modified mouse exhibits reduced dendritic function relative to a NOD/scid mouse, or a NOD/scid nude mouse;
  • the genetically-modified mouse has an enhanced engraftment capacity of exogenous cells relative to a NOD/scid mouse, or a NOD/scid nude mouse;
  • the genetically-modified mouse has a higher level of immunodeficiency as compared to Foxn1 knockout mice.
  • the genetically modified non-human animal can also be various other animals, e.g., a rat, rabbit, pig, bovine (e.g., cow, bull, buffalo) , deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey) .
  • a rat, rabbit, pig, bovine e.g., cow, bull, buffalo
  • deer sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey)
  • a non-human animals where suitable genetically modifiable ES cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification.
  • Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo.
  • a suitable cell e.g., an oocyte
  • gestating the modified cell e.g., the modified oocyte
  • the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea.
  • the genetically modified animal is a rodent.
  • the rodent can be selected from a mouse, a rat, and a hamster.
  • the rodent is selected from the superfamily Muroidea.
  • the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters) , Cricetidae (e.g., hamster, New World rats and mice, voles) , Muridae (true mice and rats, gerbils, spiny mice, crested rats) , Nesomyidae (climbing mice, rock mice, with-tailed rats, Malagasy rats and mice) , Platacanthomyidae (e.g., spiny dormice) , and Spalacidae (e.g., mole rates, bamboo rats, and zokors) .
  • Calomyscidae e.g., mouse-like hamsters
  • Cricetidae e.g., hamster, New World rats and mice, voles
  • Muridae true mice and rats, gerbils, spiny mice, crested rats
  • the genetically modified rodent is selected from a true mouse or rat (family Muridae) , a gerbil, a spiny mouse, and a crested rat.
  • the non-human animal is a mouse.
  • the animal is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola.
  • a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/Ola.
  • the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm) , 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac) , 129S7, 129S8, 129T1, 129T2.
  • a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm) , 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac) , 129S7, 129S8, 129T1, 129T2.
  • the genetically modified mouse is a mix of the 129 strain and the C57BL/6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains.
  • the mouse is a BALB strain, e.g., BALB/c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50%BALB/c-50%12954/Sv; or 50%C57BL/6-50%129) .
  • a hybrid line e.g., 50%BALB/c-50%12954/Sv; or 50%C57BL/6-50%129
  • the animal is a rat.
  • the rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti.
  • the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.
  • the animal can have one or more other genetic modifications, and/or other modifications, that are suitable for the particular purpose for which the Foxn1 knockout animal is made.
  • suitable mice for maintaining a xenograft e.g., a human cancer or tumor
  • mice for maintaining a xenograft can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part.
  • Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and/or immune cells by chemical means (e.g., administering a toxin) , physical means (e.g., irradiating the animal) , and/or genetic modification (e.g., knocking out one or more genes) .
  • chemical means e.g., administering a toxin
  • physical means e.g., irradiating the animal
  • genetic modification e.g., knocking out one or more genes
  • mice include, e.g., NOD mice, SCID mice, NOD/SCID mice, nude mice, NOD/SCID nude mice, NOD-Prkdc scid IL-2r ⁇ null , and Rag1 and/or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type.
  • a genetically modified mouse is provided that can include a disruption of the endogenous non-human Foxn1 locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part.
  • modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD/SCID mice, nude mice, NOD-Prkdc scid IL-2r ⁇ null mice, Rag1 and/or Rag2 knockout mice, and a combination thereof.
  • genetically modified cells are also provided that can comprise the modifications (e.g., disruption) described herein (e.g., ES cells, somatic cells)
  • the genetically modified non-human animals comprise the modification of the endogenous Foxn1 locus in the germline of the animal.
  • the genetically modified animal can be homozygous with respect to the disruption of the endogenous Foxn1 gene. In some embodiments, the animal can be heterozygous with respect to the disruption of the endogenous Foxn1 gene.
  • the present disclosure further relates to a non-human mammal generated through the methods as described herein.
  • the genome thereof contains human gene (s) .
  • the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein.
  • the non-human mammal is a rodent (e.g., a mouse) .
  • the present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.
  • the present disclosure also provides non-human mammals produced by any of the methods described herein.
  • a non-human mammal is provided; and the genetically modified animal contains a disruption of the Foxn1 gene in the genome of the animal.
  • the present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.
  • the present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof.
  • a model based on cell culture can be prepared, for example, by the following methods.
  • Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cell can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques.
  • the disruption of Foxn1 gene can be detected by a variety of methods.
  • RNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies) .
  • RT-PCR reverse transcriptase polymerase chain reaction
  • protein level including histochemistry, immunoblot analysis and in vitro binding studies.
  • Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels of wildtype Foxn1 can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human proteins.
  • the disclosure also provides vectors for constructing a Foxn1 animal model.
  • the vectors comprise sgRNA sequence, wherein the sgRNA sequence target Foxn1 gene, and the sgRNA is unique on the target sequence of the Foxn1 gene to be altered.
  • the sequence meets the sequence arrangement rule of 5’ -NNN (20) -NGG3’ or 5’ -CCN-N (20) -3’ ; and in some embodiments, the targeting site of the sgRNA in the mouse Foxn1 gene is located on the exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, upstream of exon 1, or downstream of exon 9 of the mouse Foxn1 gene.
  • the 5’ targeting sequence for the knockout sequence is shown as SEQ ID NOs: 1-7, and the sgRNA sequence recognizes the 5’ targeting site.
  • the 3’ targeting sequence for the knockout sequence is shown as SEQ ID NOs: 8-14 and the sgRNA sequence recognizes the 3’ targeting site.
  • the disclosure provides sgRNA sequences for constructing a Foxn1 knockout animal model.
  • the oligonucleotide sgRNA sequences are set forth in SEQ ID NOs: 15-18 and 22-25.
  • the disclosure relates to a plasmid construct (e.g., pT7-sgRNA) including the sgRNA sequence, and/or a cell including the construct.
  • a plasmid construct e.g., pT7-sgRNA
  • the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the sgRNA construct as described herein.
  • the cell includes Cas9 mRNA or an in vitro transcript thereof.
  • the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.
  • the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell.
  • Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ) , homologous recombination (HR) , zinc finger nucleases (ZFNs) , transcription activator-like effector-based nucleases (TALEN) , and the clustered regularly interspaced short palindromic repeats (CRISPR) -Cas system.
  • NHEJ nonhomologous end-joining
  • HR homologous recombination
  • ZFNs zinc finger nucleases
  • TALEN transcription activator-like effector-based nucleases
  • CRISPR clustered regularly interspaced short palindromic repeats
  • homologous recombination is used.
  • CRISPR-Cas9 genome editing is used to generate genetically modified animals.
  • genome editing techniques are known in the art, and is described, e.g., in Yin et al., "Delivery technologies for genome editing, " Nature Reviews Drug Discovery 16.6 (2017) : 387-399, which is incorporated by reference in its entirety.
  • Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.
  • the disclosure provides knocking out in at least one cell of the animal, at an endogenous Foxn1 gene locus, one or more exons (e.g., about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9 exons) and/or one or more introns (e.g., about or at least 1, 2, 3, 4, 5, 6, 7, 8 introns) of the endogenous Foxn1 gene.
  • the modification occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc.
  • the nucleus of a somatic cell or the fibroblast can also be inserted into an enucleated oocyte.
  • cleavages at the upstream and the downstream of the knockout sequence by a nuclease can result in DNA double strands break, and non-homologous end joining (NHEJ) occurs and ligates the break ends, thereby knocking out the sequence of interest.
  • NHEJ typically utilizes short homologous DNA sequences called microhomologies to guide repair. These microhomologies are often present in single-stranded overhangs on the ends of double-strand breaks. When the overhangs are perfectly compatible, NHEJ usually repairs the break accurately.
  • imprecise repair occurs, and in some cases, leading to loss of nucleotides or insertion of random nucleotides.
  • Zinc finger proteins, TAL-effector domains, or single guide RNA (sgRNA) DNA-binding domains can be designed to target the upstream and the downstream of the knockout sequence.
  • SEQ ID NOs: 1-14 are exemplary target sequences for the modification. Among them, SEQ ID NOs: 1-7 are located within exon 4 of mouse endogenous Foxn1 gene. SEQ ID NOs: 8-14 are located within 3’ -UTR or exon 9 of mouse endogenous Foxn1 gene.
  • the nuclease cleaves the genomic DNA, and triggers NHEJ.
  • the nuclease is CRISPR associated protein 9 (Cas9) .
  • the methods of producing a Foxn1 knockout mouse can involve one or more of the following steps: transforming a mouse embryonic stem cell with a gene editing system that targets endogenous Foxn1 gene, thereby producing a transformed embryonic stem cell; introducing the transformed embryonic stem cell into a mouse blastocyst; implanting the mouse blastocyst into a pseudopregnant female mouse; and allowing the blastocyst to undergo fetal development to term.
  • the transformed embryonic cell is directly implanted into a pseudopregnant female mouse instead, and the embryonic cell undergoes fetal development.
  • the gene editing system can involve zinc finger proteins, TAL-effector domains, or single guide RNA (sgRNA) DNA-binding domains.
  • sgRNA single guide RNA
  • the present disclosure further provides a method for establishing a Foxn1 gene knockout animal model, involving the following steps:
  • step (d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c) .
  • the non-human mammal in the foregoing method is a mouse (e.g., a C57BL/6 mouse, a NOD/scid mouse, a NOD/scid nude mouse, or a NOD-Prkdc scid IL-2r ⁇ null mouse) .
  • the non-human mammal is a NOD/scid mouse.
  • the SCID mutation has been transferred onto a non-obese diabetic (NOD) background. Animals homozygous for the SCID mutation have impaired T and B cell lymphocyte development. The NOD background additionally results in deficient natural killer (NK) cell function.
  • NOD non-obese diabetic
  • the non-human mammal is a NOD/scid additionally has a disruption of HR gene.
  • the animal can comprise an additional disruption in the animal’s endogenous Beta-2-Microglobulin (B2M) gene.
  • the fertilized eggs for the methods described above are NOD/scid fertilized eggs, NOD/scid nude fertilized eggs, or NOD-Prkdc scid IL-2r ⁇ null fertilized eggs.
  • Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, C57BL/6 fertilized eggs, FVB/N fertilized eggs, BALB/c fertilized eggs, DBA/1 fertilized eggs and DBA/2 fertilized eggs.
  • Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein.
  • the fertilized egg cells are derived from rodents.
  • the genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the method described above.
  • the genetically modified animals e.g., mice
  • the genetically modified mice do not require backcrossing, and thus have a more defined background (e.g., less genetic variations among individual subjects) as compared to some other Foxn1 knockout or immunodeficient mice.
  • a defined background or a pure background is beneficial to obtain consistent experiment results.
  • the genetic variation among the mice across the entire genome (e.g., autosomes) among different individuals is less than 3%, 2%, 1%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%or 0.01%.
  • the methods to determine the genetic variations are known in the art.
  • the genetic variations can be measured or determined by sequencing, whole genome sequencing, exome sequencing, detecting variations at some selected sites (e.g., by using SNP microarrays, by detecting copy number variations) etc.
  • the mice have a genome (e.g., autosomes) that is about or at least 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99%identical to NOD-Prkdc scid IL-2r ⁇ null mice (e.g., B-NDG mice) except for certain mutations (e.g., the Foxn1 knockout mutation) .
  • the mice have a genome (e.g., autosomes) that is about or at least 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99%identical to NOD/SCID mice (or NOD-Prkdc scid mice) except for certain mutations (e.g., the Foxn1 knockout mutation and/or IL-2r ⁇ mutation) .
  • a genome e.g., autosomes
  • the mice have a genome (e.g., autosomes) that is about or at least 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.91%, 99.92%, 99.93%, 99.94%, 99.95%, 99.96%, 99.97%, 99.98%, 99.99%identical to NOD mice except for certain mutations (e.g., the Foxn1 knockout mutation, the SCID mutation, and/or IL-2r ⁇ mutation) .
  • a genome e.g., autosomes
  • mice are also relatively healthy, and in some cases, they have a relatively long life span (e.g., about or at least 1 year, 1.5 years, 2 years, 2.5 years, or 3 years) .
  • Genetically modified animals with a disruption at endogenous Foxn1 gene can provide a variety of uses that include, but are not limited to, observing tumor growth, testing various therapeutic agents (e.g., to treat tumors, wounds, and various skin diseases) , and testing cosmetics.
  • the animal is an immunodeficient animal, e.g., a NOD-Prkdc scid IL-2r ⁇ nul , NOD-Rag 1 -/- -IL2rg -/- (NRG) , Rag 2 -/- -IL2rg -/- (RG) , NOD/SCID (NOD-Prkdc scid ) , NOD/SCID nude, or NOD-Prkdc scid IL-2rg null animal (e.g., a rodent, a rat, or a mouse) .
  • the animal further comprises an additional disruption in the animal’s endogenous Beta-2-Microglobulin (B2M) gene.
  • B2M Beta-2-Microglobulin
  • the hairless immunodeficient animal can be used to establish a human hemato-lymphoid animal model, develop therapeutics for human diseases and disorders, and assess the efficacy of these therapeutic agents in the animal models.
  • the genetically modified animals can be used for establishing a human hemato-lymphoid system.
  • the methods involve engrafting a population of cells comprising human hematopoietic cells (CD34+ cells) or human peripheral blood cells into the genetically modified animal described herein.
  • the methods further include the step of irradiating the animal prior to the engrafting.
  • the human hemato-lymphoid system in the genetically modified animals can include various human cells, e.g., hematopoietic stem cells, myeloid precursor cells, myeloid cells, dendritic cells, monocytes, granulocytes, neutrophils, mast cells, lymphocytes, and platelets.
  • the genetically modified animals described herein are also an excellent animal model for establishing the human hemato-lymphoid system.
  • the animal after being engrafted with human hematopoietic stem cells or human peripheral blood cells to develop a human immune system has one or more of the following characteristics:
  • the percentage of human CD45+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes or CD45+ cells of the animal;
  • the percentage of human CD3+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes or CD45+ cells in the animal;
  • the percentage of human CD19+ cells is about or at least 10%, 20%, 30%, 40%, or 50%of leukocytes or CD45+ cells in the animal.
  • the genetically modified animals described herein are less likely to develop graft-versus-host disease (GVHD) or xenogeneic graft-versus-host disease (X-GVHD) .
  • GVHD graft-versus-host disease
  • X-GVHD xenogeneic graft-versus-host disease
  • the genetically modified animals described herein can live for about or at least 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, or 180 days.
  • the genetically modified animals described herein do not have a NSG or NOG background. In some embodiments, the genetically modified animals described herein are better animal models for establishing the human hemato-lymphoid system (e.g., having a higher percentage of human leukocytes, human T cells, human B cells, or human NK cells) .
  • Both NSG and NOG mice are commercially available.
  • the NSG mouse can be obtained from the Jackson Laboratory (Catalog number: 005557) .
  • the NOG mouse can be obtained from Taconic (Model number: NOG-F or NOG-M) . A detailed description of the NSG mice and NOD mice can be found, e.g., in Ishikawa et al.
  • the genetically modified animals can be used to determine the effectiveness of an agent or a combination of agents for the treatment of cancer.
  • the methods involve engrafting tumor cells to the animal as described herein, administering the agent or the combination of agents to the animal; and determining the inhibitory effects on the tumors.
  • the tumor cells are from a tumor sample obtained from a human patient.
  • These animal models are also known as patient derived xenografts (PDX) models.
  • PDX models are often used to create an environment that resembles the natural growth of cancer, for the study of cancer progression and treatment.
  • patient tumor samples grow in physiologically-relevant tumor microenvironments that mimic the oxygen, nutrient, and hormone levels that are found in the patient’s primary tumor site.
  • implanted tumor tissue maintains the genetic and epigenetic abnormalities found in the patient and the xenograft tissue can be excised from the patient to include the surrounding human stroma.
  • PDX models can often exhibit similar responses to anti-cancer agents as seen in the actual patient who provide the tumor sample.
  • the genetically modified animals do not have functional T cells or B cells, the genetically modified animals still have functional phagocytic cells, e.g., neutrophils, eosinophils (acidophilus) , basophils, or monocytes. Macrophages can be derived from monocytes, and can engulf and digest cellular debris, foreign substances, microbes, cancer cells.
  • an agent e.g., anti-CD47 antibodies or anti-SIRPa antibodies
  • human peripheral blood cells hPBMC
  • human hematopoietic stem cells are injected to the animal to develop human hematopoietic system.
  • the genetically modified animals described herein can be used to determine the effect of an agent in human hematopoietic system, and the effects of the agent to inhibit tumor cell growth or tumor growth.
  • the methods as described herein are also designed to determine the effects of the agent on human immune cells (e.g., human T cells, B cells, or NK cells) , e.g., whether the agent can stimulate T cells or inhibit T cells, whether the agent can upregulate the immune response or downregulate immune response.
  • the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., cancer, or autoimmune diseases.
  • the tested agent or the combination of tested agents is designed for treating various cancers.
  • cancer refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness.
  • tumor refers to cancerous cells, e.g., a mass of cancerous cells.
  • Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus.
  • the agents described herein are designed for treating or diagnosing a carcinoma in a subject.
  • carcinoma is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas.
  • the cancer is renal carcinoma or melanoma.
  • Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary.
  • carcinosarcomas e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues.
  • an “adenocarcinoma” refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.
  • the term “sarcoma” is art recognized and refers to malignant tumors of mesenchymal derivation.
  • the tested agent is designed for the treating melanoma, primary lung carcinoma, non-small cell lung carcinoma (NSCLC) , small cell lung cancer (SCLC) , primary gastric carcinoma, bladder cancer, breast cancer, and/or prostate cancer.
  • NSCLC non-small cell lung carcinoma
  • SCLC small cell lung cancer
  • the injected tumor cells are human tumor cells.
  • the injected tumor cells are melanoma cells, primary lung carcinoma cells, non-small cell lung carcinoma (NSCLC) cells, small cell lung cancer (SCLC) cells, primary gastric carcinoma cells, bladder cancer cells, breast cancer cells, and/or prostate cancer cells.
  • NSCLC non-small cell lung carcinoma
  • SCLC small cell lung cancer
  • the inhibitory effects on tumors can also be determined by any methods known in the art.
  • the tumor cells can be labeled by a luciferase gene.
  • the number of the tumor cells or the size of the tumor in the animal can be determined by an in vivo imaging system (e.g., the intensity of fluorescence) .
  • the inhibitory effects on tumors can also be determined by measuring the tumor volume in the animal, and/or determining tumor (volume) inhibition rate (TGI TV ) .
  • the tested agent can be one or more agents selected from the group consisting of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel, and capecitabine.
  • the tested agent can be an antibody, for example, an antibody that binds to CD47, PD-1, CTLA-4, LAG-3, TIM-3, BTLA, PD-L1, 4-1BB, CD27, CD28, CD47, TIGIT, CD27, GITR, or OX40.
  • the antibody is a human antibody.
  • the present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization process of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.
  • the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.
  • the present disclosure further relates to methods for generating genetically modified animal models described herein with some additional modifications (e.g., human or chimeric genes or additional gene knockout) .
  • the animal can comprise a disruption at the endogenous Foxn1 gene and a sequence encoding a human or chimeric protein.
  • the human or chimeric protein can be programmed cell death protein 1 (PD-1) , TNF Receptor Superfamily Member 9 (4-1BB or CD137) , cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) , LAG-3, T-cell immunoglobulin and mucin-domain containing-3 (TIM-3) , B And T Lymphocyte Associated (BTLA) , Programmed Cell Death 1 Ligand 1 (PD-L1) , CD27, CD28, CD47, T-Cell Immunoreceptor With Ig And ITIM Domains (TIGIT) , Glucocorticoid-Induced TNFR-Related Protein (GITR) , or TNF Receptor Superfamily Member 4 (TNFRSF4; or OX40) .
  • PD-1BB TNF Receptor Superfamily Member 9
  • CTLA-4 cytotoxic T
  • the animal can further comprise a disruption (e.g., knockout) at one or more of the following endogenous genes, e.g., IL6, IL15, colony stimulating factor (CSF) , colony stimulating factor 1 (CSF1) , colony stimulating factor 2 (CSF2 or GM-CSF) , colony stimulating factor 3 (CSF3) , signal regulatory protein alpha (SIRPA) , B2M, and KIT proto-oncogene receptor tyrosine kinase (C-KIT) genes.
  • the animal can comprise a disruption at the endogenous CD132 gene (interleukin-2 receptor subunit gamma) .
  • the animal can comprise a disruption at some other endogenous genes (e.g., Lysine-specific demethylase hairless (HR) ) .
  • the animal can comprise a disruption at the endogenous B2M gene.
  • the methods of Foxn1 knockout animal model with additional genetic modifications can include the following steps:
  • the genetically modified animal in step (b) of the method, can be mated with a genetically modified non-human animal with human or chimeric PD-1, CTLA-4, LAG-3, TIM-3, BTLA, PD-L1, 4-1BB, CD27, CD28, CD47, TIGIT, GITR, or OX40, or an animal with NOD-Prkdc scid IL-2r ⁇ null mutation and/or B2M mutation.
  • the Foxn1 knockout can be directly performed on a genetically modified animal having a human or chimeric PD-1, CTLA-4, LAG-3, BTLA, TIM-3, PD-L1, 4-1BB, CD27, CD28, CD47, TIGIT, GITR, or OX40 gene, or an animal with NOD-Prkdc scid IL-2r ⁇ null mutation and/or B2M mutation.
  • the mouse further has a disruption of B2M gene (e.g., deletion of one or more exons or part of exons selected from the group consisting of exon 1, exon 2, exon 3, or exon 4 of the endogenous B2M gene) .
  • the Foxn1 knockout can be directly performed on a CD132 knockout mouse or a HR knockout mouse. In some embodiments, the Foxn1 knockout can be directly performed on NOD/SCID mice.
  • a combination therapy that targets two or more of these proteins thereof may be a more effective treatment.
  • many related clinical trials are in progress and have shown a good effect.
  • the Foxn1 knockout animal model, and/or the Foxn1 knockout animal model with additional genetic modifications can be used for determining effectiveness of a combination therapy.
  • the combination of agents can include one or more agents selected from the group consisting of paclitaxel, cisplatin, carboplatin, pemetrexed, 5-FU, gemcitabine, oxaliplatin, docetaxel, and capecitabine.
  • the combination of agents can include one or more agents selected from the group consisting of campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and methotrexate.
  • campothecin campothecin
  • doxorubicin doxorubicin
  • cisplatin carboplatin
  • procarbazine mechlorethamine
  • cyclophosphamide adriamycin
  • the combination of agents can include one or more antibodies that bind to CD47, PD-1, CTLA-4, LAG-3, BTLA, TIM-3, PD-L1, 4-1BB, CD27, CD28, CD47, TIGIT, GITR, and/or OX40.
  • the methods can also include performing surgery on the subject to remove at least a portion of the cancer, e.g., to remove a portion of or all of a tumor (s) , from the subject.
  • Interleukin-2 is a 15.5 kDa type 1 four ⁇ -helical bundle cytokine produced primarily by CD4+ T cells following their activation by antigen.
  • IL-2 was the first type 1 cytokine cloned and the first cytokine for which a receptor component was cloned.
  • the ligand-specific IL-2 receptor ⁇ chain (IL-2R ⁇ , CD25, Tac antigen) , which is expressed on activated but not non-activated lymphocytes, binds IL-2 with low affinity (Kd ⁇ 10 -8 M) ; the combination of IL-2R ⁇ (CD122) and IL-2R ⁇ (CD132) together form an IL-2R ⁇ / ⁇ c complex mainly on memory T cells and NK cells that binds IL-2 with intermediate affinity (Kd ⁇ 10 -9 M) ; and when all three receptor chains are co-expressed on activated T cells and Treg cells, IL-2 is bound with high affinity (Kd ⁇ 10 -11 M) .
  • the three dimensional structure of the quaternary complex supports a model wherein IL-2 initially bind IL-2R ⁇ , then IL-2R ⁇ is recruited, and finally IL-2R ⁇ .
  • the intermediate and high affinity receptor forms are functional, transducing IL-2 signals.
  • CD132 is also an essential component shared by the receptors for IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21.
  • IL-2R ⁇ is encoded by the gene, IL2RG (CD132) , that is mutated in humans with X-linked severe combined immunodeficiency (XSCID) and physically recruits JAK3, which when mutated also causes an XSCID-like T-B+NK-form of SCID.
  • XSCID and JAK3-deficient SCID the lack of signaling by IL-7 and IL-15, respectively, explains the lack of T and NK cell development, whereas defective signaling by IL-4 and IL-21 together explain the non-functional B cells and hypogammaglobulinemia.
  • CD132 A detailed description of CD132 and its function can be found, e.g., in Liao et al. "IL-2 family cytokines: new insights into the complex roles of IL-2 as a broad regulator of T helper cell differentiation, " Current opinion in immunology 23.5 (2011) : 598-604; Noguchi et al. "Interleukin-2 receptor gamma chain: a functional component of the interleukin-7 receptor, " Science 262.5141 (1993) : 1877-1880; Henthorn et al. "IL-2R ⁇ gene microdeletion demonstrates that canine X-linked severe combined immunodeficiency is a homologue of the human disease, " Genomics 23.1 (1994) : 69-74; and US Patent No. 7145055; each of which is incorporated herein by reference in its entirety.
  • CD132 gene In human genomes, CD132 gene (Gene ID: 3561) is located on X chromosome, and has eight exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8.
  • the CD132 protein also has an extracellular region, a transmembrane region, and a cytoplasmic region.
  • the nucleotide sequence for human CD132 mRNA is NM_000206.2
  • amino acid sequence for human CD132 is NP_000197.1.
  • CD132 gene locus has eight exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8.
  • the CD132 protein also has an extracellular region, a transmembrane region, and a cytoplasmic region, and the signal peptide is located at the extracellular region of CD132.
  • the nucleotide sequence for mouse CD132 cDNA is NM_013563.4 (SEQ ID NO: 36)
  • amino acid sequence for mouse CD132 is NP_038591.1 (SEQ ID NO: 37) .
  • the location for each exon and each region in the mouse CD132 nucleotide sequence and amino acid sequence is listed below:
  • the mouse CD132 gene (Gene ID: 16186) is located in Chromosome X of the mouse genome, which is located from 101, 268, 255 to 101, 264, 385 of NC_000086.7 (GRCm38. p4 (GCF_000001635.24) ) .
  • the 5’ -UTR is from 101,268,255 to 101,268,170
  • exon 1 is from 101,268,255 to 101,268,055
  • the first intron (intron 1) is from 101,268,054 to 101,267,865
  • exon 2 is from 101,267,864 to 101,267,711
  • the second intron (intron 2) is from 101,267,710 to 101,267,496,
  • exon 3 is from 101,267,495 to 101,267,311
  • the third intron (intron 3) is from 101,267,310 to 101,267,121
  • exon 4 is from 101,267,120 to 101,266,978
  • the fourth intron (intron 4) is from 101,266,977 to 101,266,344, exon 5 is from 101,266,343 to 101,266,181,
  • the fifth intron (intron 5) is from 101,266,180 to 101,265,727
  • CD132 genes, proteins, and locus of the other species are also known in the art.
  • the gene ID for CD132 in Rattus norvegicus is 140924
  • the gene ID for CD132 in Macaca mulatta (Rhesus monkey) is 641338,
  • the gene ID for CD132 in Sus scrofa (pig) is 397156.
  • the relevant information for these genes can be found, e.g., intron sequences, exon sequences, amino acid residues of these proteins
  • NCBI database e.g., NCBI database.
  • the present disclosure provides a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous CD132 gene, wherein the disruption of the endogenous CD132 gene comprises deletion of one or more exons, or part of the one or more exons, wherein the one or more exons are selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 of the endogenous CD132 gene.
  • the disclosure provides a genetically-modified, non-human animal that does not have one or more exons that are selected from the group consisting of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 of the endogenous CD132 gene.
  • At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides in the exon of CD132 are deleted.
  • the disruption comprises deletion of one or more introns, or part of the one or more introns, wherein the one or more introns are selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7 of the endogenous CD132 gene.
  • the disclosure provides a genetically-modified, non-human animal does not have one or more introns that are selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7 of the endogenous CD132 gene.
  • the disruption of the endogenous CD132 gene comprises deletion of exon 2 of the endogenous CD132 gene. In some embodiments, the disruption of the endogenous CD132 gene further comprises deletion of exon 1, or part of exon 1 of the endogenous CD132 gene.
  • the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 are deleted.
  • the signal peptide region, extracellular region, transmembrane region, and/or cytoplasmic region of CD132 are deleted.
  • a “region” or “portion” of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7, signal peptide region, extracellular region, transmembrane region, and/or cytoplasmic region are deleted.
  • the “region” or “portion” can be at least 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7, signal peptide region, extracellular region, transmembrane region, or cytoplasmic region of CD132.
  • a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or exon 8 of CD132 are deleted.
  • a region, a portion, or the entire sequence of mouse intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and/or intron 7 are deleted.
  • the disruption comprises or consists of deletion of more than 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, or 650 nucleotides in exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and/or exon 8.
  • the disruption comprises or consists of deletion of more than 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, or 1000 nucleotides in intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and/or intron 7.
  • the disruption comprises or consists of deletion of more than 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (e.g., about 150 or 160 nucleotides) in exon 1; deletion of the entirety of intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7; and/or deletion of more than 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 350, 400, 450, 500, 550, 600, or 650 nucleotides (e.g., about 200, 250 or 270 nucleotides) in exon 8.
  • nucleotides e.g., about 150 or 160 nucleotides in exon 8.
  • the length of the remaining exon sequences at the endogenous CD132 gene locus is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, or 50%of the total length of all exon sequences of the endogenous CD132 gene.
  • the length of the remaining exon sequences at the endogenous CD132 gene locus is more than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, or 50%of the total length of all exon sequences of the endogenous CD132 gene.
  • the length of the remaining sequences at that the endogenous CD132 gene locus is less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, or 50%of the full sequence of the endogenous CD132 gene.
  • the length of the remaining sequences at that the endogenous CD132 gene locus is more than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 35%, 40%, 45%, or 50%of the full sequence of the endogenous CD132 gene.
  • the present disclosure further relates to the genomic DNA sequence of a CD132 knockout mouse.
  • the genome of the animal comprises from 5’ to 3’at the endogenous CD132 gene locus, (a) a first DNA sequence; optionally (b) a second DNA sequence comprising an exogenous sequence; (c) a third DNA sequence, wherein the first DNA sequence, the optional second DNA sequence, and the third DNA sequence are linked.
  • the second DNA sequence can have a length of 0 nucleotides to 300 nucleotides (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 nucleotides) .
  • the second DNA sequence has only 0 nucleotides, which means that there is no extra sequence between the first DNA sequence and the third DNA sequence.
  • the second DNA sequence has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 nucleotides.
  • the second DNA sequence has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 nucleotides.
  • the first DNA sequence comprises an endogenous CD132 gene sequence that is located upstream of intron 1, and can include all or just part of sequences that is located upstream of intron 1. In some embodiments, the first DNA sequence comprises an endogenous CD132 gene sequence that is located upstream of exon 1. In some embodiments, the first DNA sequence comprises a sequence that has a length (5’ to 3’ ) of from 10 to 200 nucleotides (e.g., from 10 to 100 nucleotides, or from 10 to 20 nucleotides) starting from the first nucleotide in exon 1 of the CD132 gene to the last nucleotide of the first DNA sequence.
  • the first DNA sequence comprises at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, or 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides from exon 1. In some embodiments, the first DNA sequence has at most 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, or 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides from exon 1.
  • the third DNA sequence comprises an endogenous CD132 gene sequence that is located downstream of the last intron (e.g., intron 7 in mouse) , and can include all or just part of sequences that is located downstream of intron 7.
  • the third DNA sequence comprises a sequence that has a length (5’ to 3’ ) of from 200 to 600 nucleotides (e.g., from 300 to 400 nucleotides, or from 350 to 400 nucleotides) starting from the first nucleotide in the third DNA sequence to the last nucleotide in the last exon (e.g., exon 8 in mouse) of the endogenous CD132 gene.
  • the third DNA sequence comprises at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, or 650 nucleotides from the last exon (e.g., exon 8 in mouse) . In some embodiments, the third DNA sequence has at most 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, or 650 nucleotides from the last exon (e.g., exon 8 in mouse) .
  • the disclosure relates to a genetically-modified, non-human animal whose genome comprise a disruption in the animal’s endogenous CD132 gene, wherein the disruption of the endogenous CD132 gene comprises deletion of exon 2 of the endogenous CD132 gene.
  • the disruption of the endogenous CD132 gene further comprises deletion of exon 1 of the endogenous CD132 gene. In some embodiments, the disruption of the endogenous CD132 gene comprises deletion of part of exon 1 of the endogenous CD132 gene.
  • the disruption of the endogenous CD132 gene further comprises deletion of one or more exons or part of exons selected from the group consisting of exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 of the endogenous CD132 gene. In some embodiments, the disruption of the endogenous CD132 gene comprises deletion of exons 1-8 of the endogenous CD132 gene.
  • the disruption of the endogenous CD132 gene further comprises deletion of one or more introns or part of introns selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7 of the endogenous CD132 gene.
  • the disruption consists of deletion of more than 150 nucleotides in exon 1; deletion of the entirety of intron 1, exon 2, intron 2, exon 3, intron 3, exon 4, intron 4, exon 5, intron 5, exon 6, intron 6, exon 7, intron 7; and deletion of more than 250 nucleotides in exon 8.
  • the animal is homozygous with respect to the disruption of the endogenous CD132 gene. In some embodiments, the animal is heterozygous with respect to the disruption of the endogenous CD132 gene.
  • the disruption prevents the expression of functional CD132 protein.
  • the length of the remaining exon sequences at the endogenous CD132 gene locus is less than 30%of the total length of all exon sequences of the endogenous CD132 gene. In some embodiments, the length of the remaining sequences at that the endogenous CD132 gene locus is less than 15%of the full sequence of the endogenous CD132 gene.
  • the disclosure relates to a genetically-modified, non-human animal, wherein the genome of the animal does not have exon 2 of CD132 gene at the animal’s endogenous CD132 gene locus.
  • the genome of the animal does not have one or more exons or part of exons selected from the group consisting of exon 1, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8. In some embodiments, the genome of the animal does not have one or more introns or part of introns selected from the group consisting of intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, and intron 7.
  • the disclosure also provides a CD132 knockout non-human animal, wherein the genome of the animal comprises from 5’ to 3’ at the endogenous CD132 gene locus, (a) a first DNA sequence; optionally (b) a second DNA sequence comprising an exogenous sequence; (c) a third DNA sequence, wherein the first DNA sequence, the optional second DNA sequence, and the third DNA sequence are linked, wherein the first DNA sequence comprises an endogenous CD132 gene sequence that is located upstream of intron 1, the second DNA sequence can have a length of 0 nucleotides to 300 nucleotides, and the third DNA sequence comprises an endogenous CD132 gene sequence that is located downstream of intron 7.
  • the first DNA sequence comprises a sequence that has a length (5’ to 3’ ) of from 10 to 100 nucleotides (e.g., approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 nucleotides) , wherein the length of the sequence refers to the length from the first nucleotide in exon 1 of the CD132 gene to the last nucleotide of the first DNA sequence.
  • the first DNA sequence comprises at least 10 nucleotides from exon 1 of the endogenous CD132 gene. In some embodiments, the first DNA sequence has at most 100 nucleotides from exon 1 of the endogenous CD132 gene.
  • the third DNA sequence comprises a sequence that has a length (5’ to 3’ ) of from 200 to 600 nucleotides (e.g., approximately 200, 250, 300, 350, 400, 450, 500, 550, 600 nucleotides) , wherein the length of the sequence refers to the length from the first nucleotide in the third DNA sequence to the last nucleotide in exon 8 of the endogenous CD132 gene.
  • the third DNA sequence comprises at least 300 nucleotides from exon 8 of the endogenous CD132 gene. In some embodiments, the third DNA sequence has at most 400 nucleotides from exon 8 of the endogenous CD132 gene.
  • the genetic modified non-human animal comprises a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%identical or 100%identical to the following sequence: aggaaatgtatggtggggagggcttgtgggagagctaagtttcgatttcctgtcccatgtaactgcttttctgttccatatgccctacttgagagtgtcccttgcctttgcctcttccctgcacaagccctcccatgcccagcctaacacctttccactttcttttgaagagagtcttaccctgtagcccagggtggctgggagctcactatgtaggccaggttggcctccaactcacaggct
  • the disclosure also relates to a genetically-modified, non-human animal produced by a method comprising knocking out one or more exons of endogenous CD132 gene by using (1) a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in exon 1 of the endogenous CD132 gene or upstream of exon 1 of the endogenous CD132 gene, and (2) a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in exon 8 of the endogenous CD132 gene.
  • a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in exon 1 of the endogenous CD132 gene or
  • the nuclease is CRISPR associated protein 9 (Cas9) .
  • the target sequence is in exon 1 of the endogenous CD132 gene or upstream of exon 1 of the endogenous CD132 gene. In some embodiments, the target sequence is in exon 8 of the endogenous CD132 gene.
  • the animal does not express a functional CD132 protein. In some embodiments, the animal does not express a functional interleukin-2 receptor.
  • the animal further comprises a disruption in the animal’s endogenous Beta-2-Microglobulin (B2m) gene and/or a disruption in the animal’s endogenous lysine-specific demethylase hairless (HR) gene.
  • B2m Beta-2-Microglobulin
  • HR lysine-specific demethylase hairless
  • the disclosure is also related to methods of producing a CD132 knockout mouse.
  • the methods involve
  • the disclosure also provides methods of producing a CD132 knockout mouse.
  • the methods include the steps of
  • the gene editing system comprises a first nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a target sequence in exon 1 of the endogenous CD132 gene or upstream of exon 1 of the endogenous CD132 gene, and a second nuclease comprising a zinc finger protein, a TAL-effector domain, or a single guide RNA (sgRNA) DNA-binding domain that binds to a sequence in exon 8 of the endogenous CD132 gene.
  • sgRNA single guide RNA
  • the mouse embryonic stem cell has a Nod/scid background, or a NOD/scid nude background.
  • the mouse embryonic stem cell has a genome comprising a disruption in the animal’s endogenous Beta-2-Microglobulin (B2m) gene and/or a disruption in the animal’s endogenous lysine-specific demethylase hairless (HR) gene.
  • B2m Beta-2-Microglobulin
  • HR lysine-specific demethylase hairless
  • the disclosure relates to a non-human mammalian cell, comprising a disruption, a deletion, or a genetic modification as described herein.
  • the cell includes Cas9 mRNA or an in vitro transcript thereof.
  • the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is a germ cell. In some embodiments, the cell is a blastocyst.
  • the disclosure relates to methods for establishing a CD132 knockout animal model.
  • the methods include the steps of:
  • step (d) identifying the germline transmission in the offspring of the pregnant female in step (c) .
  • the establishment of a CD132 knockout animal involves a gene editing technique that is based on CRISPR/Cas9.
  • the non-human mammal is mouse. In some embodiments, the non-human mammal in step (c) is a female with false pregnancy.
  • NOD/scid mice were purchased from Beijing HFK Bioscience Co., Ltd.
  • NOD-Prkdc scid IL-2rg null (B-NDG) mice were obtained from Beijing Biocytogen Co., Ltd (Catalog number: B-CM-001 or B-CM-002) .
  • UCA kit was obtained from Beijing Biocytogen Co., Ltd. The catalog number is BCG-DX-001.
  • EcoRI, BamHI, and BbsI were purchased from NEB. The catalog numbers are R3101M, R3136M, and R0539L.
  • Ambion TM in vitro transcription kit was purchased from Ambion, Inc. The catalog number is AM1354.
  • Cas9 mRNA was obtained from SIGMA.
  • the catalog number is CAS9MRNA-1EA.
  • E. coli TOP10 competent cells were purchased from the Tiangen Biotech (Beijing) Co. The catalog number is CB104-02.
  • Kanamycin was purchased from Amresco. The catalog number is 0408.
  • mice were then mated with immunodeficient NOD-Prkdc scid IL-2rg null (B-NDG) mice to obtain NOD-Prkdc scid IL-2rg null nude mice.
  • sgRNA1, sgRNA2, sgRNA3, sgRNA4, sgRNA5, sgRNA6, and sgRNA7 target the 5’ -end target site and sgRNA8, sgRNA9, sgRNA10, sgRNA11, sgRNA12, sgRNA13, and sgRNA14 target the 3’ -end target site.
  • the target sites for sgRNA1, sgRNA2, sgRNA3, sgRNA4, sgRNA5, sgRNA6, and sgRNA7 are located within exon 4 of the mouse endogenous Foxn1 gene (Gene ID: 15218) .
  • the target sites for sgRNA8, sgRNA9, sgRNA10, sgRNA11, sgRNA12, sgRNA13, and sgRNA14 are located within the 3’ -UTR (3’ -untranslated region) of the endogenous Foxn1 gene.
  • the target sequences for these sgRNAs are shown below:
  • sgRNA-1 target sequence (SEQ ID NO: 1) :
  • sgRNA-2 target sequence (SEQ ID NO: 2) :
  • sgRNA-3 target sequence (SEQ ID NO: 3) :
  • sgRNA-4 target sequence (SEQ ID NO: 4) :
  • sgRNA-5 target sequence (SEQ ID NO: 5) :
  • sgRNA-6 target sequence (SEQ ID NO: 6) :
  • sgRNA-7 target sequence (SEQ ID NO: 7) :
  • sgRNA-8 target sequence (SEQ ID NO: 8) :
  • sgRNA-9 target sequence (SEQ ID NO: 9) :
  • sgRNA-10 target sequence (SEQ ID NO: 10) :
  • sgRNA-11 target sequence SEQ ID NO: 11:
  • sgRNA-12 target sequence (SEQ ID NO: 12) :
  • sgRNA-13 target sequence (SEQ ID NO: 13) :
  • sgRNA-14 target sequence (SEQ ID NO: 14) :
  • the UCA kit was used to detect the activities of sgRNAs (FIGS. 1A-1B and Table 3) .
  • the results show that the sgRNAs had different activities. Among them, sgRNA-4, sgRNA-9, sgRNA-10 and sgRNA-11 had relatively low activities. sgRNA-1 and sgRNA-8 had relatively high activities. Two of them (sgRNA1 and sgRNA8) were selected for further experiments.
  • Single strand oligonucleotides were synthesized for sgRNA1 and sgRNA8.
  • TAGG was first added to the 5’ end of the upstream sequence of sgRNA1 and sgRNA8 target sequences to obtain a forward oligonucleotide sequence
  • AAAC was added to the 5’ end of the complementary strand to obtain a reverse oligonucleotide sequence.
  • the product was ligated into the pT7-sgRNA plasmid (the plasmid was first treated by BbsI restriction enzyme) to obtain pT7-sgRNA1 and pT7-sgRNA8 vectors.
  • the ligation reaction was carried out at room temperature for 10 to 30 minutes.
  • the ligation product was then transferred to 30 ⁇ L of TOP10 competent cells.
  • the cells were then plated on a petri dish with Kanamycin, and then cultured at 37 °C for at least 12 hours and then two clones were selected and added to LB medium with Kanamycin (5 ml) , and then cultured at 37 °C at 250 rpm for at least 12 hours.
  • pT7-sgRNA vector map is shown in FIG. 2 (Takara, Catalog No. : 3299) .
  • the DNA fragment containing T7 promoter and sgRNA scaffold was synthesized, and linked to the backbone vector by restriction enzyme digestion (EcoRI and BamHI) and ligation.
  • the plasmid sequences were confirmed by sequencing.
  • the DNA fragment containing the T7 promoter and sgRNA scaffold (SEQ ID NO: 19) is shown below:
  • the pre-mixed Cas9 mRNA, in vitro transcription products of pT7-sgRNA1 and pT7-sgRNA8 plasmids were injected into the cytoplasm or nucleus of NOD/scid mouse fertilized eggs with a microinjection instrument (using Ambion in vitro transcription kit to carry out the transcription according to the method provided in the product instruction) .
  • the embryo microinjection was carried out according to the method described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003.
  • the injected fertilized eggs were then transferred to a culture medium to culture for a short time and then was transplanted into the oviduct of the recipient mouse to produce the genetically modified mice (F0 generation) .
  • the mouse population was further expanded by cross-mating and self-mating to establish stable mouse lines.
  • genomic DNA was extracted from the tail of the F0 generation mice. PCR was performed with the primer PCR-1 (SEQ ID NO: 20) and PCR-2 (SEQ ID NO: 21) . PCR-1 is located on the left of the 5’ end target site. PCR-2 is located on the right of the 3’ end target site. The sequence for the primers are shown below:
  • Upstream primer PCR-1 (SEQ ID NO: 20) :
  • PCR-2 (SEQ ID NO: 21) :
  • the length of the PCR amplification products should be around 776 bp.
  • the wildtype (WT) mice should not have PCR amplification products.
  • the PCR reaction conditions are shown in the tables below.
  • mice The results for 44 F0 generation mice are shown in FIG. 3. Among them, the mice labeled with Nos. 2, 16, and 17 were positive for Foxn1 knockout. These mice were then selected for further sequencing.
  • the mouse labeled with No. 2 had a deletion of 10182 base pairs (SEQ ID NO: 31) at the Foxn1 gene locus.
  • the remaining gene had 19896 base pair at the locus.
  • the sequence is set forth in SEQ ID NO: 32.
  • the mouse labeled with No. 37 had a deletion of 10192 nucleotides, but had an insertion of a short sequence of 7 random nucleotides.
  • the deleted sequence is shown in SEQ ID NO: 29.
  • the inserted sequence is AGTGCAT.
  • the sequence at the Foxn1 gene locus is shown in SEQ ID NO: 30.
  • the mouse labeled with No. 16 had deletions at two sites.
  • the first site had a deletion of 9095 base pairs (SEQ ID NO: 33) .
  • the second site had a deletion of 31 base pairs (SEQ ID NO: 34) .
  • the mouse had a deletion of 9126 base pairs in total.
  • the remaining sequence at the Foxn1 gene locus is shown in SEQ ID NO: 35.
  • F0 generation mice that were positive for Foxn1 knockout was mated with NOD/scid mice to obtain F1 generation mice.
  • F1 generation heterozygous mice were mated with each other to obtain F2 generation homozygous mice.
  • These F2 generation homozygous mice had the "nude" phenotype (hairless phenotype) .
  • mice F2 generation homozygous mice were then crossed with NOD-Prkdc scid IL-2rg null (B-NDG) mice to obtain heterozygous mice. These mice were then mated with each other to obtain NOD-Prkdc scid IL-2rg null mice with the nude phenotype. These mice are shown in FIG. 4.
  • the pre-mixed Cas9 mRNA, in vitro transcription products of pT7-sgRNA1 and pT7-sgRNA8 plasmids are injected into the cytoplasm or nucleus of NOD-Prkdc scid IL-2rg null mouse fertilized eggs with a microinjection instrument (using Ambion in vitro transcription kit to carry out the transcription according to the method provided in the product instruction) .
  • the embryo microinjection is carried out according to the method described, e.g., in A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition) , ” Cold Spring Harbor Laboratory Press, 2003.
  • the injected fertilized eggs are then transferred to a culture medium to culture for a short time and then is transplanted into the oviduct of the recipient mouse to produce the genetically modified mice (F0 generation) .
  • the mouse population can be further expanded by cross-mating and self-mating to obtain NOD-Prkdc scid IL-2rg null Foxn1 null (B-NDG nude) mice.
  • mice Five C57BL/6 mice, five B-NDG mice, five NOD/scid mice and four B-NDG nude mice were selected for experiments.
  • Whole blood was collected from these mice and treated with ethylenediaminetetraacetic acid (EDTA) to prevent blood from clotting.
  • EDTA ethylenediaminetetraacetic acid
  • flow cytometry was performed to detect the expression level of mCD3, mCD19 and NKp46 among leukocytes.
  • the results showed there were a significant number of T cells, B cells and NK cells in whole blood leukocytes collected from C57BL/6 and NOD/scid mice, while no T cells, B cells and NK cells were detected in B-NDG nude and B-NDG mice.
  • the results indicate that B-NDG mice and B-NDG nude mice were highly immunodeficient.
  • FIGS. 5A-5B Human breast cancer MDA-mB-231 cells (1 ⁇ 10 7 ) were injected to the breast of several B-NDG nude mice and B-NDG mice. The tumor growth were recorded. The tumor volume reached 400-600 mm 3 about 40 days after the injection. The photos of these tumors are shown in FIGS. 5A-5B. As shown in the figures, it was much easier to observe and measure the tumor size in B-NDG nude mice (FIG. 5A) as compared to the B-NDG mice (FIG. 5B) .
  • mice obtained by the methods as described herein a human immune system was constructed by engraftment with human peripheral blood cells (hPBMC) .
  • hPBMC human peripheral blood cells
  • mice Five immunodeficient NOD-Prkdc scid IL-2rg null Foxn1 null mice were selected and 1 x 10 7 human peripheral blood cells (hPBMCs) were injected into the tail vein of each mouse. After two weeks, blood was collected from these mice for flow cytometry analysis. The flow cytometry results showed that cells expressing human leukocyte surface molecular markers (human CD45) were detected in all these mice. The results show that human peripheral blood cells engraftment on these mice can create a humanized mouse model with the human immune system. Further analysis showed that the leukocytes were primarily T cells.

Abstract

L'invention concerne un animal non humain génétiquement modifié qui a une interruption au niveau du gène Foxn1 endogène, et des procédés d'utilisation de ceux-ci.
PCT/CN2019/078744 2018-03-19 2019-03-19 Animal non humain knock-out foxn1 WO2019179439A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN201810226321.1 2018-03-19
CN201810226321 2018-03-19

Publications (1)

Publication Number Publication Date
WO2019179439A1 true WO2019179439A1 (fr) 2019-09-26

Family

ID=67988218

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2019/078744 WO2019179439A1 (fr) 2018-03-19 2019-03-19 Animal non humain knock-out foxn1

Country Status (2)

Country Link
CN (1) CN110283850A (fr)
WO (1) WO2019179439A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113930446A (zh) * 2020-07-13 2022-01-14 黄菁 对非人动物基因改造的方法及构建的免疫缺陷动物模型
WO2023195749A1 (fr) * 2022-04-06 2023-10-12 서울대학교 산학협력단 Nouveau mutant de foxn1 et son utilisation

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112522202B (zh) * 2020-09-23 2022-04-05 南京启真基因工程有限公司 制备addi四个基因联合敲除的重症免疫缺陷猪源重组细胞的方法及其专用试剂盒
CN113106101B (zh) * 2021-05-11 2023-04-07 广州欣意生物技术有限公司 一种nod遗传背景双基因缺陷小鼠模型的制备方法及应用

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017143894A1 (fr) * 2016-02-25 2017-08-31 深圳市体内生物医药科技有限公司 Souris immunodéficiente, procédé de préparation correspondant et application correspondante

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011149102A1 (fr) * 2010-05-24 2011-12-01 国立大学法人熊本大学 Souris hautement immunodéprimée optimisée pour l'imagerie biologique

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017143894A1 (fr) * 2016-02-25 2017-08-31 深圳市体内生物医药科技有限公司 Souris immunodéficiente, procédé de préparation correspondant et application correspondante

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JAE HOON YEO ET AL.: "Transgenic Efficiency of FoxN1-targeted Pig Parthenogenetic Embryos", JOURNAL OF EMBRYO TRANSFER, vol. 29, no. 4, 4 September 2014 (2014-09-04), pages 339 - 344, XP055638703, ISSN: 1225-4991 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113930446A (zh) * 2020-07-13 2022-01-14 黄菁 对非人动物基因改造的方法及构建的免疫缺陷动物模型
WO2022012544A1 (fr) * 2020-07-13 2022-01-20 黄菁 Procédé de réalisation d'une modification génétique sur un animal non humain et procédé de construction d'un modèle animal immunodéficient
WO2023195749A1 (fr) * 2022-04-06 2023-10-12 서울대학교 산학협력단 Nouveau mutant de foxn1 et son utilisation

Also Published As

Publication number Publication date
CN110283850A (zh) 2019-09-27

Similar Documents

Publication Publication Date Title
US11723348B2 (en) Genetically modified mice expressing humanized CD47
US11317611B2 (en) Genetically modified non-human animal with human or chimeric PD-L1
US10945418B2 (en) Genetically modified non-human animal with human or chimeric PD-L1
US11505806B2 (en) Genetically modified non-human animal with human or chimeric OX40
US11071290B2 (en) Genetically modified non-human animal with human or chimeric CTLA-4
US11234421B2 (en) Genetically modified non-human animal with human or chimeric IL15
WO2018041121A1 (fr) Animal non humain génétiquement modifié avec un ctla-4 humain ou chimérique
US20190352666A1 (en) Genetically Modified Non-Human Animal With Human Or Chimeric OX40
WO2018041120A1 (fr) Animal non humain génétiquement modifié avec un tigit humain ou chimérique
US10820580B2 (en) Immunodeficient non-human animal
WO2019179439A1 (fr) Animal non humain knock-out foxn1
WO2018086594A1 (fr) Animal non humain génétiquement modifié avec une tim-3 humaine ou chimérique
WO2020125639A1 (fr) Animal non humain génétiquement modifié comportant des gènes humains ou chimériques
US11464876B2 (en) Genetically modified mouse comprising a chimeric TIGIT
WO2019141251A1 (fr) Animal non humain immunodéficient
US11350614B2 (en) Genetically modified non-human animal with human or chimeric CD28
US20230227531A1 (en) Genetically modified non-human animal expressing a b2m/fcrn fusion protein
WO2021083366A1 (fr) Animaux non humains génétiquement modifiés avec de la thpo humaine ou chimérique
WO2021136537A1 (fr) ANIMAL NON HUMAIN IMMUNODÉFICIENT GÉNÉTIQUEMENT MODIFIÉ À SIRPα/CD47 HUMAIN OU CHIMÉRIQUE
WO2021139799A1 (fr) Animal non humain génétiquement modifié avec le complexe protéine-cmh humain ou chimérique
EP3311660A1 (fr) Procédé de production d'un animal chimère de sang
WO2019161805A1 (fr) Animal non humain hr inactivé
WO2021043289A1 (fr) Animaux non humains génétiquement modifiés par des mutations de kit
WO2018233608A1 (fr) Animal non humain génétiquement modifié à cd28 humaine ou chimérique

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 19770382

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 19770382

Country of ref document: EP

Kind code of ref document: A1