WO2023183611A1 - Methods, compositions and kits for inhibiting formation of adapter dimers - Google Patents

Methods, compositions and kits for inhibiting formation of adapter dimers Download PDF

Info

Publication number
WO2023183611A1
WO2023183611A1 PCT/US2023/016295 US2023016295W WO2023183611A1 WO 2023183611 A1 WO2023183611 A1 WO 2023183611A1 US 2023016295 W US2023016295 W US 2023016295W WO 2023183611 A1 WO2023183611 A1 WO 2023183611A1
Authority
WO
WIPO (PCT)
Prior art keywords
adapter
blocker oligonucleotide
blocker
nucleotides
oligonucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2023/016295
Other languages
English (en)
French (fr)
Inventor
Kevin D. Allen
Kerry Gunning
Allyson LABAS
Eric Castro
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bioo Scientific Corp
Original Assignee
Bioo Scientific Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bioo Scientific Corp filed Critical Bioo Scientific Corp
Priority to JP2024556472A priority Critical patent/JP2025510151A/ja
Priority to EP23720194.2A priority patent/EP4499860A1/en
Priority to AU2023239149A priority patent/AU2023239149A1/en
Priority to CN202380030039.5A priority patent/CN119325511A/zh
Publication of WO2023183611A1 publication Critical patent/WO2023183611A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • C12Q1/6855Ligating adaptors
    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1093General methods of preparing gene libraries, not provided for in other subgroups
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay

Definitions

  • the present disclosure relates to methods, compositions, and kits for reducing adapterdimers in a sequencing library.
  • Genetic analysis has become increasingly common and is useful in a wide variety of molecular biology applications. For example, genetic testing of individuals is particularly useful for early detection of genetic diseases and can play a role in selection of treatments for a particular disease or condition.
  • Massively parallel nucleic acid sequencing techniques play a key role in genetic analysis of target nucleic acids but produce less than optimal results when non-target nucleic acids are sequenced along with target nucleic acids.
  • Methods of target enrichment are often used to reduce contamination of sequencing results with non-target sequences in massively parallel nucleic acid sequencing techniques.
  • One such enrichment method relies on hybridization capture of target nucleic acid sequencing library molecules.
  • sequencing libraries for massively parallel nucleic acid sequencing include adapter sequences attached to insert sequences in nucleic acid sequencing library molecules.
  • Adapters include nucleic acid sequences with various functional properties, such as extension primer binding sites, one or more index sequences for sample identification, sequencing primer binding sites, and amplification primer binding sites.
  • adapters are ligated to insert sequences of interest.
  • An undesirable by-product of adapter ligation to the insert sequences is that adapters can be ligated to each other, producing adapter-dimers. Even a small number of adapter-dimers can negatively affect sequencing quality since the adapter-dimers can be effectively amplified by amplification reactions intended to enrich for the insert sequences of interest.
  • adapter-dimers can be retained by hybridization capture during enrichment steps, thereby capturing adapter-dimers and wasting reagents and time sequencing the adapterdimers.
  • Methods of reducing adapter-dimers in a sequencing library include: combining sample nucleic acids, each having a 5’ end and a 3’ end, with 3’ adapters each having a 5’ end portion at least 8 nucleotides in length and a 5’ terminus which is an adenylated nucleotide, and a ligase, in a mixture under ligation reaction conditions, producing 1) first ligation products each including the 3’ end of a sample nucleic acid ligated to the 5’ terminus of a 3’ adapter, and 2) excess unligated, 3’ adapters in the mixture; adding blocker oligonucleotides to the mixture, the blocker oligonucleotides including: a) a first blocker oligonucleotide including: i) a first blocker oligonucleotide 5’ portion at least 8 nucleotides in length and ii) a first block
  • the first blocker oligonucleotide 3’ terminus and the second blocker oligonucleotide 3’ terminus are both capable of being ligated to the adenylated nucleotide at the 5’ terminus of the excess unligated 3’ adapters; ; and further including in a method of the present disclosure is ligating the first blocker oligonucleotide 3’ terminus of the hybridized complex to the adjacent adenylated nucleotide at the 5’ terminus of the first unligated 3’ adapter and ligating the second blocker oligonucleotide 3’ terminus of the hybridized complex to the adjacent adenylated nucleotide at the 5’ terminus of the second unligated 3’ adapter, producing ligated complex, thereby reducing excess unligated 3’ adapters in the mixture, producing a purified mixture.
  • 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the second blocker oligonucleotide 3’ portion are non-naturally occurring nucleotides.
  • the first blocker oligonucleotide 3’ portion and the second blocker oligonucleotide 3’ portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, and the first blocker oligonucleotide 3’ portion and the second blocker oligonucleotide 3’ portion each comprise a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3’ portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3’ portion.
  • the first blocker oligonucleotide and the second blocker oligonucleotide each have a length in the range of 11 to 50 nucleotides.
  • the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.
  • methods of reducing adapter-dimers in a sequencing library further include adding a 5’ adapter to the mixture, the 5’ adapter having a 3’ terminus, wherein the first ligation products each comprise the 3’ end of a sample nucleic acid ligated to the 5’ terminus of a 3’ adapter, and the 5’ end of a sample nucleic acid ligated to the 3’ terminus of a 5’ adapter, thereby producing sequencing library molecules, the sequencing library molecules including a sample nucleic acid insert disposed between, and bonded to, a 5’ adapter and a 3 ’ adapter.
  • methods of reducing adapter-dimers in a sequencing library further include adding a 5’ adapter to the purified mixture; and incubating the purified mixture under ligation reaction conditions, thereby 1) ligating the 5’ adapter to the first ligation product, producing sequencing library molecules, the sequencing library molecules including a sample nucleic acid insert disposed between, and bonded to, a 5’ adapter and a 3’ adapter.
  • methods of reducing adapter-dimers in a sequencing library wherein excess unligated 3’ adapters are reduced but not eliminated such that the ligating includes ligating the 5’ adapter to at least a portion of the excess unligated 3’ adapter, producing adapter-dimers including a 5’ adapter bonded to a 3’ adapter at a 5’ adapter-3’ adapter interface.
  • methods of reducing adapter-dimers in a sequencing library which further include inhibiting amplification of the adapter-dimers in an amplification reaction such that the sequencing library molecules are selectively enriched by the amplification reaction compared to the adapter-dimers.
  • Inhibiting amplification of the adapter-dimers may include one or more of: removing at least some of the adapter-dimers prior to amplification; specific enzymatic cleavage of the adapter-dimers; CRISPR/Cas9-based cleavage of the adapter-dimers; gel purification to remove adapter-dimers; SPRI-bead based size selection to remove adapter-dimers; and adding an adapter-dimer blocker oligonucleotide to the mixture, the adapter-dimer blocker oligonucleotide effective to inhibit amplification of the adapter-dimers.
  • methods of reducing adapter-dimers in a sequencing library include adding an adapter-dimer blocker oligonucleotide to the mixture, the adapter-dimer blocker oligonucleotide effective to inhibit amplification of the adapter-dimers, wherein the adapter-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the adapter-dimers, the one or more adjacent portions including at least one nucleotide of the 5’ adapter at the 5’ adapter-3’ adapter interface, and an adjacent portion of the 3’ adapter including an amplification primer binding site.
  • sample nucleic acids are, or include, RNA.
  • sample nucleic acids are, or include, RNA
  • methods of reducing adapter-dimers in a sequencing library include reverse transcribing the RNA, producing reverse transcribed sequencing library molecules.
  • methods of reducing adapter-dimers in a sequencing library which further include amplifying the sequencing library molecules or reverse transcribed sequencing library molecules.
  • a pair of oligonucleotides for reducing adapter-dimers in a sequencing library which includes a) a first blocker oligonucleotide including: i) a first blocker oligonucleotide 5’ portion at least 8 nucleotides in length and ii) a first blocker oligonucleotide 3’ portion at least 1 to 20 nucleotides in length and including a first oligonucleotide 3’ terminus, wherein at least 1 of the 1 to 20 nucleotides is a non- naturally occurring nucleotide; and b) a second blocker oligonucleotide including: iii) a second oligonucleotide 5’ portion at least 8 nucleotides in length and iv) a second blocker oligonucleotide 3’ portion at least 1 to 20 nucleotides in length and including a second block
  • the first blocker oligonucleotide 3’ terminus and the second blocker oligonucleotide 3’ terminus are both capable of being ligated to the adenylated nucleotide at the 5’ terminus of the excess unligated 3’ adapters.
  • the pair of blocker oligonucleotides for reducing adapter-dimers in a sequencing library is provided wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the first blocker oligonucleotide 3’ portion are non-naturally occurring nucleotides and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the second blocker oligonucleotide 3’ portion are non-naturally occurring nucleotides.
  • the pair of blocker oligonucleotides for reducing adapter-dimers in a sequencing library wherein when the first blocker oligonucleotide 3’ portion and the second blocker oligonucleotide 3’ portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, the first blocker oligonucleotide 3’ portion and the second blocker oligonucleotide 3’ portion each comprise a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3’ portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3’ portion.
  • the pair of blocker oligonucleotides for reducing adapter-dimers in a sequencing library is provided wherein the first blocker oligonucleotide and the second blocker oligonucleotide each have a length in the range of about 11 to about 50 nucleotides.
  • the pair of blocker oligonucleotides for reducing adapter-dimers in a sequencing library is provided wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.
  • Kits for reducing adapter-dimers in a sequencing library are provided according to aspects of the present disclosure which include one or more pairs of blocker oligonucleotides for reducing adapter-dimers in a sequencing library
  • kits for reducing adapter-dimers in a sequencing library further include an adapter-dimer blocker oligonucleotide effective to block amplification of adapter-dimers.
  • kits for reducing adapter-dimers in a sequencing library are provided wherein the adapter-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the adapter-dimers, the one or more adjacent portions including at least one nucleotide of the 5’ adapter at the 5’ adapter-3’ adapter interface, and an adjacent portion of the 3’ adapter including an amplification primer binding site.
  • Figure 1 is a diagrammatic illustration of a hybridized complex including blocker oligonucleotides and 3’ adapters according to aspects of the present disclosure;
  • Figure 1 includes numbering showing features of the hybridized complex including: first blocker oligonucleotide 20; 3’ terminus of the first blocker oligonucleotide 28; 5’ portion of the first blocker oligonucleotide 30; first blocker oligonucleotide 3’ portion 35; second blocker; oligonucleotide 5’ portion 55; second blocker oligonucleotide 40; 3’ terminus of the second blocker oligonucleotide 48; second blocker oligonucleotide 3’ portion 50; 3’ adapter 60; and 5’ adenylated end of the 3’ adapter 62.
  • Figure 2A is a schematic diagram showing a “single adapter system” in which the blocking oligonucleotides have the same sequence, include a blocker oligonucleotide 5’ portion (dark gray) and include a palindromic blocker oligonucleotide 3’ portion (light gray), such that the palindromic blocker oligonucleotide 3’ portions are complementary and anneal as shown;
  • a “single adapter system” is used, for example, in methods of sequencing library generation in which a single type of adapter is included.
  • Figure 2B is a schematic diagram showing a “multiple adapter system” including at least two types of blocking oligonucleotides, in which the different types of blocking oligonucleotides have different sequences, including different blocker oligonucleotide 5’ portions (dark gray, top left; and medium gray, bottom left) and include identical palindromic blocker oligonucleotide 3’ portions (light gray), such that the palindromic blocker oligonucleotide 3’ portions are complementary and anneal as shown;
  • a “multiple adapter system” is used, for example, in methods of sequencing library generation in which multiple types of adapter are included, e.g. each adapter including a different index sequence.
  • Figure 2C is a schematic diagram showing a “single adapter system” including at least two types of blocking oligonucleotides, in which the different types of blocking oligonucleotides have different sequences, including identical blocker oligonucleotide 5’ portions (dark gray) and include different non-palindromic blocker oligonucleotide 3’ portions (light gray, top; stippled gray, bottom), such that the non-palindromic blocker oligonucleotide 3’ portions are complementary and anneal as shown;
  • a “single adapter system” is used, for example, in methods of sequencing library generation in which a single type of adapter is included.
  • Figure 3 is a graph showing inhibition of adapter-dimer formation according to aspects of the present disclosure.
  • Figure 3 shows the proportion of a) desired RNA successfully incorporated into sequencing library molecules (dark gray); b) proportion of adapter dimers (canonical dimers) formed and incorporated into sequencing library molecules (medium gray); and c) proportion of other molecules incorporated into sequencing library molecules (light gray), in a method of reducing adapter-dimers in a sequencing library using: #1) no method for blocking formation of adapter dimers; #2) a method including use of one or more blocker oligonucleotides according to aspects of the present disclosure; 3#) a method including removing at least some adapter-dimers prior to amplification; or #4) a method including use of one or more blocker oligonucleotides according to aspects of the present disclosure and further including removing at least some adapter-dimers prior to amplification.
  • Figure 4 is a graph showing results demonstrating a significant decrease in the percent dimer sequenced, compared to a conventional method, due to a significant decrease in the percent adapter dimer incorporated into the sequencing library using a method including use of one or more blocker oligonucleotides according to aspects of the present disclosure. Further shown is an increased percent of mature miRNA sequenced, compared to a conventional method, due to a significant decrease in the percent adapter dimer incorporated into the sequencing library using a method including use of one or more blocker oligonucleotides according to aspects of the present disclosure.
  • the light gray bars, 1 represent data obtained using a method including use of one or more blocker oligonucleotides according to aspects of the present disclosure
  • the dark gray bars, 2 represent data obtained using a conventional method.
  • Figure 5 is a graph showing results obtained using a method including use of one or more blocker oligonucleotides according to aspects of the present disclosure and the dark gray bars, 2, represent data obtained using a conventional method.
  • the results show a comparison of the number of unique miRNAs represented in the sequencing data, i.e.
  • Figure 6 is a Venn diagram showing a comparison of the number of unique miRNAs found with a threshold of 5 that are the same between 3 replicates using a method including use of one or more blocker oligonucleotides according to aspects of the present disclosure (large gray circle) and 3 replicates obtained using a conventional method (medium sized medium gray circle). The smallest black circle represents the number of unique miRNAs common to both methods.
  • the term “about” and grammatical equivalents thereof, as used herein refers to a range which includes numerical values that are +/-1%, +/-2%, +/-3%, +/-4%, +/-5%, +/-6%, +/-7%, +/-8%, +/-9%, or +/-10% of the reference lower limit of the range of numerical values and numerical values that are +/-1%, +/-2%, +/-3%, +/-4%, +/-5%, +/-6%, +/-7%, +/-8%, +/-9%, or +/- 10% of the reference upper limit of the range of numerical values.
  • a listing of numerical values herein is understood to include all intermediate and fractional values of the listed numerical values, e.g. . 50%, 60%, 75%, is understood to include 55%, 64.5%, and 74%.
  • first”, “second”, etc. may be used herein in reference to elements or combinations of elements, and these terms are used to designate such elements or combinations of elements without limitation as to whether the first element and second element are identical to each other or different.
  • "at least one of: a, b, or c" is intended to cover a alone; b alone; c alone, a and b, a, b, and c, b and c, a and c, as well as any combination with multiples of the same element, such as a and a; a, a, and a; a, a, and b; a, a, and c; a, b, and b; a, c, and c; and any other combination or ordering of a, b, and c).
  • Methods of reducing adapter-dimers in a sequencing library include: hybridizing excess 3’ adapters to blocker oligonucleotides to form a hybridization complex, , such that the excess 3’ adapters are unavailable to form adapter-dimers, : wherein hybridization complex includes a first blocker oligonucleotide which has a 5’ portion complementary to and hybridized to a first unligated 3’ adapter, a second blocker oligonucleotide which has a 5’ portion complementary to and hybridized to a second unligated 3’ adapter, and wherein the first blocker oligonucleotide has a 3’ portion complementary to, and hybridized to, a 3’ portion of the second blocker oligonucleotide.
  • the 3’ adapters are covalently bonded to the blocker oligonucleotides in the hybridization complex by ligation thereby forming a ligated complex wherein a first blocker oligonucleotide 3’ terminus is ligated to an adjacent adenylated nucleotide at the 5’ terminus of a first unligated 3 ’ adapter and a second blocker oligonucleotide 3 ’ terminus is ligated to an adj acent adenylated nucleotide at the 5 ’ terminus of a second unligated 3 ’ adapter, wherein the first blocker oligonucleotide which has a 5’ portion complementary to and hybridized to a first unligated 3’ adapter, a second blocker oligonucleotide which has a 5’ portion complementary to and hybridized to a second unligated 3’ adapter, and wherein the first blocker oligonucleotide has
  • blocker oligonucleotide and “oligonucleotide blocker” as used interchangeably herein refer to a synthetic oligonucleotide which includes i) a blocker oligonucleotide 5’ portion at least 8 nucleotides in length adjacent a 5’ terminus, and ii) a blocker oligonucleotide 3’ portion at least 1 to 20 nucleotides in length, adjacent a 3’ terminus.
  • a blocker oligonucleotide has a total length in the range of about 9 nucleotides to about 50 nucleotides.
  • a blocker oligonucleotide has a total length of about 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides,
  • 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the blocker oligonucleotide 3’ portion are non-naturally occurring nucleotides.
  • 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the blocker oligonucleotide 3’ portion are Tm increasing nucleotides and/or nucleotide analogs.
  • 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the blocker oligonucleotide 3’ portion are LNAs monomers, PNA monomers, BNA monomers, other Tm increasing nucleotide analogs, or any two or more thereof.
  • 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the blocker oligonucleotide 3’ portion are LNA monomers.
  • about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the blocker oligonucleotide 5’ portion are non-naturally occurring nucleotides.
  • about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the blocker oligonucleotide 5’ portion are Tm increasing nucleotides and/or nucleotide analogs.
  • about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the blocker oligonucleotide 5’ portion are LNA monomers, PNA monomers, BNA monomers, other Tm increasing nucleotide analogs, or any two or more thereof.
  • about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the blocker oligonucleotide 5’ portion are LNA monomers.
  • the 3’ portion of a blocker oligonucleotide is or includes a palindromic nucleotide sequence.
  • Oligonucleotides according to aspects of the present disclosure are generated synthetically using chemical synthetic and/or recombinant molecular biology techniques for example as detailed in Herdewijn, P. (Ed.), Oligonucleotide Synthesis: Methods and Applications, Methods in Molecular Biology, Humana Press, 2004.
  • FIG. 1 diagrammatically illustrates a first blocker oligonucleotide 20 and a second blocker oligonucleotide 40.
  • the first blocker oligonucleotide 20 has a 5’ portion 30 and a 3’ portion 35. The 3’ terminus of the first blocker oligonucleotide is shown at 28.
  • the second blocker oligonucleotide has a 5’ portion 55 and a 5’ portion 50.
  • the second blocker oligonucleotide 3’ terminus is shown at 48. While the first and second blocker oligonucleotides are shown as equal in length to the 3’ adapters 60 and their ends 62, the first and second blocker oligonucleotides may be shorter or longer in length than the 3’ adapters 60 and their ends 62.
  • Figure 1 shows a hybridized complex in which the first blocker oligonucleotide 3’ portion 35 is hybridized with the second blocker oligonucleotide 3’ portion 50. Further shown are 3’ adapters 60 each having a 5’ adenylated end 62. The 3’ adapters 60 are shown hybridized to the 5’ portion of the first blocker oligonucleotide 30 and 5’ portion of the second blocker oligonucleotide.
  • a ligation reaction is performed such that ligation of the 5’ adenylated end 62 of the 3’ adapter and the adjacent 3’ terminus of the first blocker oligonucleotide 28 will occur in the presence of a ligase under ligation conditions; and ligation of the 5’ adenylated end 62 of the 3’ adapter and the adjacent 3’ terminus of the second blocker oligonucleotide 48 will occur in the presence of a ligase under ligation conditions, forming a ligated complex.
  • the first and second blocker oligonucleotides are identical in sequence.
  • the first and second blocker oligonucleotides are different in sequence.
  • the 5’ portion of a blocker oligonucleotide of the present disclosure is complementary to the 3’ adapter such that the 5’ portion of a blocker oligonucleotide hybridizes to the 3’ adapter under hybridization conditions.
  • the blocker oligonucleotide can be longer, shorter, or the same length as the 3’ adapter.
  • the 5’ portion of a blocker oligonucleotide can be completely complementary to the 3’ adapter, or can be 50%, 60%, 70%, 80%, 90%, or greater % complementary using hybridization conditions suitable for formation of a hybridization complex and subsequent ligation to form a ligated complex.
  • sample nucleic acids such as DNA or RNA
  • sample nucleic acids are typically present in a biological sample, which can be obtained from an individual, such as from a bodily sample, for example, blood, lymph, buccal swab, skin tissue, urine, saliva, tissue, sputum, peritoneal fluid, fecal material, gastric fluid, seminal fluid, cerebrospinal fluid, biopsy material, wound exudate, and the like, and cell lines derived therefrom.
  • Prenatal biological sample nucleic acids can be obtained from amniotic fluid, products of conception, blastocysts and blastomeres, corionic villi, fetal cells, fetal DNA, and/or fetal RNA circulating in maternal blood. Sample nucleic acids also be obtained from in vitro sources such as cell lines.
  • sample nucleic acids obtained from any of various organisms including, but not limited to, humans, non-human primates, rodents, rabbits, dogs, cats, horses, cattle, pigs, goats and sheep.
  • Non-mammalian sources of sample nucleic acids can also be used, illustratively including fish and other aquatic organisms, birds, poultry, bacteria, viruses, plants, insects, reptiles, amphibians, fungi and mycobacteria.
  • sample nucleic acids such as sample DNA or sample RNA, may be obtained from any of these sources.
  • the sample nucleic acids can be obtained from any source, including, but not limited to, a human, a non-human mammal, a vertebrate, an invertebrate, a microorganism, or a plant.
  • the sample nucleic acids, such as DNA or RNA can be obtained from one or more cells ex vivo or in vitro.
  • the sample nucleic acids, such as DNA or RNA can be obtained from cultured cells, including, but not limited to, cell lines, primary cells or laboratory manipulated cells such as recombinant cells.
  • the sample nucleic acids are “small RNA.”
  • small RNA refers to RNA which has a length in the range of about 10 nucleotides in length to about 300 nucleotides in length, such as RNA which has a length in the range of about 10 nucleotides in length to about 250 nucleotides in length, RNA which has a length in the range of about 10 nucleotides in length to about 200 nucleotides in length, RNA which has a length in the range of about 10 nucleotides in length to about 150 nucleotides in length, RNA which has a length in the range of about 10 nucleotides in length to about 100 nucleotides in length, RNA which has a length in the range of about 10 nucleotides in length to about 90 nucleotides in length, RNA which has a length in the range of about 10 nucleotides in length to about 80 nucleotides in length, such as RNA which has a length in the range of about 10
  • Small RNA may be any of: RNA fragments, rRNA, viral RNA, microRNA (miRNA), small interfering RNA (SiRNA), transfer RNA (tRNA), short hairpin RNA (shRNA), repeat-associated RNA (rasiRNA), small nucleolar RNA (snoRNA), Piwi- interacting RNA (piRNA), small cajal body RNA (scaRNA), heterochromatic siRNA (hc- siRNA), and trans-acting RNA (ta-siRNA).
  • sequencing library refers to a plurality of linear doublestranded DNA fragments which include an insert that is a sequencing target of interest derived from sample nucleic acids which may, or may not, be from the same source.
  • the DNA fragments of a sequencing library further include functional elements flanking the insert which provide for, e.g. identification of the DNA fragments, such as barcode or index sequences, binding of an amplification primer, binding of a sequencing primer, or specific binding to a desired target, allowing for effective processing in a sequencing method, particularly massively parallel sequencing methods.
  • a sequencing library may include inserts flanked by two adapters, a 5’ adapter and a 3’ adapter, wherein the 5’ adapter is covalently bonded to the 5’ end of an insert, directly or indirectly, and a 3’ adapter is covalently bonded to the 3’ end of an insert, directly or indirectly.
  • Indirect bonding of an adapter to an insert refers to a configuration in which another DNA sequence is disposed between the insert and an adapter.
  • the term “massively parallel sequencing,” including “sequencing by synthesis,” and also referred to as “next generation sequencing” and “high throughput sequencing,” indicates a process of simultaneous or near-simultaneous sequencing of many nucleic acid sequencing library molecules, such as thousands of nucleic acid sequencing library molecules.
  • Sets of oligonucleotide blockers provided according to aspects of the present disclosure are described herein with particular reference in some cases to Illumina Nextera and/or TruSeq platforms and configurations but are not limited thereto. Rather, the compositions and methods of the present disclosure may be used in any of various sequencing protocols and with various sequencing equipment, including, but not limited to, Ion Torrent systems.
  • adapter refers to a linear, single-stranded, double-stranded, or partially double-stranded, DNA fragment which includes functional elements which provide for, e.g. identification of the DNA fragments, amplification, or specific binding to a desired target, allowing for effective processing in a sequencing method.
  • Adapters include one or more functional elements, such as a sequencing primer-binding sequence (also called a sequencing primer-binding site), an extension primer-binding sequence (also called an extension primer-binding site), and an index sequence (also called a barcode sequence or unique molecular identifier, UMI).
  • the term “5’ adapter” refers to an adapter covalently bonded to, or intended to be covalently bonded to, the 5’ end of an insert, directly or indirectly.
  • the term “3’ adapter” refers to an adapter covalently bonded to, or intended to be covalently bonded to, the 3’ end of an insert, directly or indirectly.
  • An adapter is typically about 10 to 150 nucleotides in length, such as about 10 to 25, 15 to 30, 25 to 40, 30 to 50, 45 to 75, 50 to 100, 90 to 125, or 120 to 150. It is noted that the term “adapter” is alternatively spelled “adaptor.”
  • the 3’ adapter is 5’ adenylated at the 5’ end of the 3’ adapter to facilitate ligation of the 3’ adapter to the sample nucleic acids and to the blocker oligonucleotide(s).
  • 5’ adenylated 3’ adapter included in methods, compositions, and/or kits is blocked on the 3’ end, such as by a 2’, 3’ -di deoxy nucleotide or 3’ (C3) propyl spacer.
  • end refers to the end of a linear nucleic acid molecule and is used interchangeably herein with the term “terminus” or grammatical appropriate variations such as “termini.”
  • end portion refers to a nucleic acid sequence encompassing an end of the nucleic acid molecule and an adjacent contiguous nucleic acid sequence but not the entire length of the nucleic acid sequence of the nucleic acid molecule.
  • an “end portion” of a nucleic acid molecule refers to a nucleic acid sequence encompassing an end of the nucleic acid molecule and an adjacent contiguous nucleic acid sequence which makes up about half or less of the length of the entire nucleic acid sequence of the nucleic acid molecule.
  • the term “adapter-dimer” refers to an undesirable byproduct formed when ligating a 5’ adapter and a 3’ adapter to the 5’ terminus and 3’ terminus of sample nucleic acids in a process of generating a sequencing library.
  • an adapter-dimer is a ligation product of a 5’ adenylated terminus of a 3’ adapter and a 3’ terminus of a 5’ adapter.
  • Adapter-dimers are undesirable in a process of generating a sequencing library since they may be amplified and compete with the sequencing library molecules in aspects of a process of generating a sequencing library, such as competing for binding sites in the flow cell, significantly lowering sequencing quality.
  • ligation refers to covalent bonding of two linear nucleic acid molecules to form a longer, linear nucleic acid molecule, mediated by a ligase enzyme.
  • ligase enzyme and “ligase” are used interchangeably herein to refer to an enzyme capable of covalently bonding two adjacent nucleic acids forming a linkage between the two nucleic acids, such as a phosphodiester bond, or, depending on the identity of the terminal nucleotide, modified covalent bond such as, but not limited to, a phosphorothioate bond, or phosphoamidate bond.
  • Ligase enzymes include, but are not limited to, T7 ligase, T4 ligase, E. coli ligase, and Taq ligase.
  • Ligase enzymes include ATP-dependent ligases, NAD+-dependent ligases, and include DNA ligases and RNA ligases, such as those which are members of Enzyme Class EC 6.5 defined by the International Union of Biochemistry and Molecular Biology, including, but not limited to, EC 6.5.1.1 (ATP-dependent ligases), EC 6.5.1.2 (NAD+-dependent ligases), EC 6.5.1.3 (RNA ligases), EC 6.5.1.6 DNA ligase (ATP or NAD+), EC 6.5.1.7 DNA ligase (ATP, ADP or GTP), and EC 6.5.1.8 3'-phosphate/5'-hydroxy nucleic acid ligase.
  • nucleotide refers to a molecule including a nucleobase, sugar, and phosphate. Nucleotides are the monomeric units of a nucleic acid sequence, e.g. a DNA or RNA sequence.
  • nucleotide includes ribonucleoside triphosphates, such as ATP, TTP, UTP, CTP, and GTP, and deoxyribonucleoside triphosphates, such as dATP, dCTP, dUTP, dGTP, and dTTP.
  • Nucleotides are commonly referred to as A, T, G, C, or U as an abbreviation, in reference to the nucleobase, see Table I.
  • nucleic acid refers to RNA, DNA, or RNA/DNA molecules having more than one nucleotide and/or nucleotide analog in any form including linear, single-stranded, double-stranded, oligonucleotide, or polynucleotide.
  • nucleotide analog refers to a modified or non-naturally occurring nucleotide, particularly nucleotide analogs which can be polymerized, with naturally occurring nucleotides and/or non-naturally occurring nucleotides, by template-directed nucleic acid polymerization, or non-template-directed nucleic acid polymerization, catalyzed by a nucleic acid polymerase.
  • nucleotide analog refers to a nucleotide which contains one or more modifications to the base moiety and/or the sugar moiety, and/or the phosphate moiety which modifies at least one aspect of the chemical properties of the nucleotide analog compared to a reference standard nucleotide, while retaining other properties which allow the nucleotide analog to perform its intended function.
  • Nucleotide analogs, and their incorporation into nucleic acids are well known in the art and may be synthesized according to standard procedures and/or obtained commercially.
  • nucleotide analogs are capable of Watson-Crick pairing via hydrogen bonds with a complementary nucleotide and illustratively include, but are not limited to, naturally- occurring and non-naturally-occurring nucleotides and analogs thereof including those containing an analog of a nucleotide base such as substituted purines or pyrimidines, deazapurines, methylpurines, methylpyrimidines, aminopurines, aminopyrimidines, thiopurines, thiopyrimidines, indoles, pyrroles, 7-deazaguanine, 7-deazaadenine, 7-methylguanine, hypoxanthine, pseudocytosine, pseudoisocytosine, isocytosine, isoguanine, 2-thiopyrimidines, 4- thiothymine, 6-thioguanine, nitropyrrole, nitroindole, and 4-methylindole.
  • a nucleotide base such as substituted pur
  • Nucleotide analogs include those containing an analog of a deoxyribose such as a substituted deoxyribose, a substituted or non- substituted arabinose, a substituted or non-substituted xylose, and a substituted or non-substituted pyranose.
  • Nucleotide analogs include those containing an analog of a phosphate ester such as phosphorothioates, phosphorodithioates, phosphoroamidates, phosphoroselenoates, phosophoroanilothioates, phosphoroanilidates, phosphoroamidates, boronophosphates, phosphotriesters, and alkylphosphonates such as methylphosphonates.
  • a phosphate ester such as phosphorothioates, phosphorodithioates, phosphoroamidates, phosphoroselenoates, phosophoroanilothioates, phosphoroanilidates, phosphoroamidates, boronophosphates, phosphotriesters, and alkylphosphonates such as methylphosphonates.
  • Non-naturally occurring nucleotides such as iso-dG and iso-dC, provide unique basepairing with each other and no base-pairing (or hybridization) between the non-naturally occurring nucleotide and a naturally-occurring nucleotide base, e.g. iso-dG will not pair with dC and iso-dC will not pair with dG.
  • iso-dG refers to isoguanosine. It is noted that the term “iisodG” is also used herein to refer to isoguanosine, e.g. as incorporated in a sequence.
  • iso-dC refers to isocytosine.
  • T m melting temperature
  • T m increasing nucleotide analog refers to a nucleotide analog that increases the melting temperature (T m ) of a double-stranded oligonucleotide that includes the nucleotide analog compared to the same double-stranded oligonucleotide without the nucleotide analog.
  • a T m increasing nucleotide analog may include a modified nucleobase, a modified sugar, a modified phosphate, or a combination of any two or more such modifications.
  • Tm increasing nucleotide analogs include, but are not limited to, a locked nucleic acid (LNA) monomer, a peptide nucleic acid (PNA) monomer, and a bridged nucleic acid (BNA) monomer.
  • LNA locked nucleic acid
  • PNA peptide nucleic acid
  • BNA bridged nucleic acid
  • Tmincreasing nucleotide analogs can be used including, but not limited to, an LNA monomer, PNA monomer, BNA monomer, or any two or more thereof, according to aspects of the present disclosure.
  • LNA monomer is used interchangeably herein with the terms “LNA nucleotide” and “LNA base” and refers to a nucleotide analog which includes a locked ribose due to presence of a covalent bond between the 2’ oxygen and the 4’ carbon of the ribose ring, that is, a 2’-( ,4’-C-methylene-P-D-ribofuranosyl monomer which can be incorporated into an oligonucleotide, producing a “locked nucleic acid.”
  • LNA monomers have similar, or improved, Watson-Crick base pairing selectivity compared to conventional nucleotides.
  • LNA monomers include, but are not limited to, adenine bicyclonucleoside monomers, cytosine bicyclonucleoside monomers, guanine bicyclonucleoside monomers, 5-methylcytosine bicyclonucleoside monomers, thymine bicyclonucleoside monomers, and uracil bicyclonucleoside monomers.
  • the Tm of an oligonucleotide including one or more LNA monomers is increased due to enhanced properties such as enhanced base stacking. Typically, the Tm of a is increased by two to eight °C for each LNA monomer incorporated into an LNA oligonucleotide.
  • LNA monomers may be synthesized using well-known methods or obtained commercially.
  • locked nucleic acid and LNA are used interchangeably herein to refer to an oligonucleotide which includes one or more LNA monomers.
  • Any of various Tmincreasing nucleotide analogs can be used including, but not limited to, 5 -methyl dC, 2, 6-diaminopurine, propynyl-deoxyuridine, 5-hydroxybutynl-2’-deoxyuridine, and combinations of any two or more thereof according to aspects of the present disclosure.
  • Tm increasing nucleotide analogs, and/or derivatives thereof can be included so long as the derivatives retain the function of increasing the melting temperature (Tm) of a double-stranded oligonucleotide that includes the nucleotide analog compared to the same double-stranded oligonucleotide without the nucleotide analog.
  • Tm melting temperature
  • a blocker oligonucleotide has a Tmin the range of 55 °C to 100 °C, such as 60 °C to 100 °C, such as 65 °C to 100 °C, such as 70 °C to 100 °C, such as 75 °C to 99 °C, such as 75 °C to 90 °C, such as 75 °C to 85 °C, such as 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87,88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 °C.
  • a set of blocker oligonucleotides has a Tmin the range of 55 °C to 100 °C, such as 60 °C to 100 °C, such as 65 °C to 100 °C, such as 70 °C to 100 °C, such as 75 °C to 99 °C, such as 75 °C to 90 °C, such as 75 °C to 85 °C, such as 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87,88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 °C.
  • the 3 ’ end of one or more of the blocker oligonucleotides is optionally modified to prevent polymerase extension from the 3’ end, for example, in a post-hybridization capture PCR step.
  • Any of various techniques for modifying the 3’ end of one or more blocker oligonucleotides is modified to prevent polymerase extension from the 3 ’ end can be used, including but not limited to, removal or modification of the hydroxyl group at the 3’ end of an oligonucleotide, such as to include a 3’ dideoxy-C (ddC), a phosphate group, or a 3’ spacer.
  • a spacer is present at the 3’ terminus of a blocker oligonucleotide.
  • a nonlimiting example is a 3’ Spacer C3 (abbreviated 3SpC3), a 3 carbon chain (C3) which is attached to the terminal 3’ hydroxyl group of the oligonucleotide blocker.
  • 3SpC3 3’ Spacer C3
  • C3 3 carbon chain
  • the 3’ end of the blocker oligonucleotides are not modified to prevent polymerase extension from the 3’ end, for example if no post-hybridization capture PCR step, or other polymerase-mediated extension step post-hybridization capture, is to be used.
  • hybridization and “hybridized” refer to pairing and binding of complementary nucleic acids. Hybridization occurs to varying extents between two nucleic acids depending on factors such as the degree of complementarity of the nucleic acids, the melting temperature, Tm, of the nucleic acids and the stringency of hybridization conditions, and post- hybridization wash conditions, as is well known in the art.
  • stringency of hybridization conditions refers to conditions of temperature, ionic strength, and composition of a hybridization medium with respect to particular common additives such as formamide, betaine, and polyethylene glycol.
  • stringency of post-hybridization wash conditions refers to conditions of temperature, ionic strength, and composition of a hybridization medium, although additives such as surfactants, formamide, betaine, and polyethylene glycol are not commonly used in wash conditions.
  • Particular surfactants that can be used include, for example, SDS (sodium dodecyl sulfate), sodium lauroyl sarcosinate (Sarkosyl), and CT AB (cetyltrimethylammonium bromide). Determination of particular hybridization conditions, and post-hybridization wash conditions, relating to a specified nucleic acid is routine and is well known in the art, for instance, as described in J. Sambrook and D.W.
  • High stringency hybridization conditions are those which only allow hybridization of substantially complementary nucleic acids.
  • High stringency post-hybridization wash conditions are those which only maintain hybridization of substantially complementary nucleic acids.
  • annealing refers to the pairing and binding of an oligonucleotide to a target nucleic acid. There is no intended distinction between the terms “annealing” and “hybridizing.”
  • nucleic acid includes a nucleotide sequence described as having a "percent complementarity" to a specified second nucleotide sequence.
  • a nucleotide sequence may have 80%, 90%, or 100% complementarity to a specified second nucleotide sequence, indicating that 8 of 10, 9 of 10 or 10 of 10 nucleotides of a sequence are complementary to the specified second nucleotide sequence.
  • the nucleotide sequence 3'-TCGA-5' is 100% complementary to the nucleotide sequence 5'-AGCT-3'.
  • the nucleotide sequence 3'-TCGA-5’ is 100%, or completely, complementary to a region of the nucleotide sequence 5'-TTAGCTGG-3'.
  • the term “complement” as used herein refers to a nucleotide sequence that is complementary to a given nucleotide sequence.
  • nucleic acids having about 85-100% complementarity are considered highly complementary and hybridize under high stringency conditions.
  • Intermediate stringency conditions are exemplified by conditions under which nucleic acids having intermediate complementarity, about 50-84% complementarity, as well as those having a high degree of complementarity, hybridize.
  • low stringency hybridization conditions are those in which nucleic acids having a low degree of complementarity hybridize.
  • specific hybridization and “specifically hybridizes” refer to hybridization of a particular nucleic acid to a target nucleic acid without substantial hybridization to nucleic acids other than the target nucleic acid in a sample.
  • palindromic nucleotide sequence refers to a nucleotide sequence that is an inverted repeat such that the nucleotide sequence is the same whether read in the 5’ to 3’ direction or when read from 5’ to 3’ on the complementary strand.
  • a palindromic nucleotide sequence read from 5’ to 3’ is 5'-GGATCC-3' which is the same when read from 5’ to 3’ on the complementary strand, i.e. 3'-CCTAGG-5'.
  • Annealing of blocker oligonucleotides to excess adapters is performed at an annealing temperature.
  • the annealing temperature depends on factors, including the nucleic acid sequence of the blocker oligonucleotides, and the target nucleic acid, and the composition of the reaction medium, including factors such as salt concentration, and concentration of additives, such as but not limited to, formamide, betaine, polyethylene glycol, a surfactant, such as SDS, and DMSO.
  • the annealing temperature is in the range of 30°C to 65°C, but can be higher or lower.
  • the annealing temperature may be higher or lower than the blocker oligonucleotide melting temperature (Tm), however, typically blocker oligonucleotides according to aspects of the present disclosure have a higher Tm than the annealing temperature to ensure that the blocker oligonucleotides are bound, i.e. hybridized, to their targets during annealing. Similarly, one or more post-hybridization washes may be performed at a temperature which is lower than the Tm of the blocker oligonucleotide(s).
  • Tm blocker oligonucleotide melting temperature
  • a hybridized complex is produced wherein the first blocker oligonucleotide 3’ terminus is adjacent to an adenylated 5’ end nucleotide of a first unligated 3’ adapter and the second blocker oligonucleotide 3’ terminus is adjacent to an adenylated 5’ end nucleotide of a second unligated 3’ adapter, thereby reducing excess unligated 3’ adapters.
  • the first blocker oligonucleotide 3’ terminus of the hybridized complex is ligated to the adjacent adenylated nucleotide at the 5’ terminus of the first unligated 3’ adapter and the second blocker oligonucleotide 3’ terminus of the hybridized complex is ligated to the adjacent adenylated nucleotide at the 5’ terminus of the second unligated 3’ adapter, producing ligated complex, thereby reducing excess unligated 3’ adapters.
  • the hybridized complex or the ligated complex can be separated from the desired sequencing library molecules. Separation of the hybridized complex or the ligated complex from the desired sequencing library molecules may be a size-based separation, such as by column-based separation, filter-based separation, gel-based, separation, binding of either the ligated complex or the desired sequencing library molecules to a solid or semi-solid support, followed by separation of the unbound material from the bound material.
  • the solid support includes magnetic beads.
  • Amplification of template DNA is achieved using an in vitro amplification method.
  • the terms “amplify, “amplification,” and “amplifying” are used to refer generally to a method or technique for copying a template nucleic acid, thereby producing nucleic acids including copies of all or a portion of the template nucleic acid, the produced nucleic acids also termed amplicons.
  • Amplification methods included in embodiments of the present invention are those which include template directed primer extension catalyzed by a nucleic acid polymerase using a pair of primers which flank the target nucleic acid, illustratively including, but not limited to, Polymerase Chain Reaction (PCR), reverse-transcription PCR (RT-PCR).
  • PCR Polymerase Chain Reaction
  • RT-PCR reverse-transcription PCR
  • LM-PCR ligation-mediated PCR
  • qPCR real-time quantitative PCR
  • whole genome amplification and other nucleic acid amplification methods, for instance, as described in C.W. Dieffenbach et al., PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2003; V. Demidov et al., DNA Amplification: Current Technologies and Applications, Taylor & Francis, 2004; and Kroneis, T. (Ed.), Whole Genome Amplification: Methods and Protocols (Methods in Molecular Biology), 2015, Humana Press ISBN-10: 1493929895.
  • isothermal amplification refers to nucleic acid amplification that includes single temperature amplification and therefore avoids the need for thermal cycling (as in PCR).
  • examples of isothermal amplification include, but are not limited to, circular helicase-dependent amplification (cHDA), genome exponential amplification reaction (GEAR), helicase-dependent amplification (HDA), isothermal multiple displacement amplification (IMDA), loop-mediated isothermal amplification (LAMP), multiple displacement amplification (MDA), nicking enzyme amplification reaction (NEAR), nucleic acid sequence-based amplification (NASBA), ramification amplification (RAM), recombinase polymerase amplification (RPA), rolling circle amplification (RCA), self-sustained sequence replication (3 SR), signal mediated amplification of RNA technology (SMART), strand-displacement amplification (SDA), single primer isothermal amplification (SPIA), and transcription mediated amplification (TMA).
  • amplified nucleic acid refers to the product of a process of copying a target nucleic acid template.
  • Amplified nucleic acids optionally contain additional materials such as, but not limited to, nucleic acid sequences, functional groups for chemical reaction and detectable labels, present in the primers and not present in the original nucleic acid template.
  • additional materials such as, but not limited to, nucleic acid sequences, functional groups for chemical reaction and detectable labels, present in the primers and not present in the original nucleic acid template.
  • primer-derived nucleic acid sequences that can be incorporated into amplicons, and thereby incorporated into the library produced, include, universal sequences, adapters, index sequences, identification sequences, detection sequences, sorting sequences, captures sequences, restriction enzyme cleavage sites, sequencing primer binding site sequences, and amplification primer binding site sequences.
  • universal sequence refers to a nucleic acid sequence that is present in a plurality of nucleic acid molecules that also contain nucleic acid sequences which are not common to the plurality of nucleic acid molecules.
  • a universal sequence allows the plurality of nucleic acid molecules to share a common functional aspect, such as binding to a particular primer or capture moiety.
  • Non-limiting examples of universal extension primer binding sites include sequences that are identical to or complementary to P5 and P7 primers. P5 and P7 primers, their complements, and uses, such as in flow cells for capture on a flow cells substrate for next generation sequencing (NGS), are known in the art, for example as detailed in WO2015106941.
  • An index sequence is incorporated into amplicons during library preparation according to aspects of the present disclosure.
  • An index sequence is a unique nucleic acid sequence common to a set of amplicons, e.g. to identify the set of amplicons as originating from a particular source. Index sequences allow for multiplexing since multiple nucleic acids from different sources can be pooled for sequencing and later can be “demultiplexed” for data analysis if desired.
  • primer refers to an oligonucleotide that is capable of acting as a site of initiation of synthesis of a template directed primer extension product under conditions in which synthesis of an oligonucleotide primer extension product which is complementary to a template nucleic acid is induced.
  • Such conditions include the presence of nucleotides and/or nucleotide analogs, and a suitable polymerase, at a suitable temperature and pH.
  • a primer is typically about 10 - 30 contiguous nucleotides in length and may be longer or shorter.
  • An oligonucleotide primer is completely or substantially complementary to a region of a template nucleic acid such that, under hybridization conditions, the oligonucleotide primer anneals to the complementary region of the template nucleic acid.
  • Appropriate reactions conditions for synthesis of a primer extension product according to aspects of the present disclosure include presence of suitable reaction components including, but not limited to, a polymerase; and nucleotides and/or nucleotide analogs.
  • Various primers may be used in methods according to aspects of the present disclosure, such as amplification primers, sequencing primers, and primers for reverse transcription.
  • Primer design is well-known to those of skill in the art and are designed according to well-known methods and criteria. For instance, when using a pair of primers, such as in an amplification reaction, the annealing temperature of the primers should be about the same, within a few degrees. In general, the primers should not form dimers with each other and the primers should not form secondary structures, such as hairpins. Methods and considerations for primer design and amplification procedures are described in detail in Yuryev, A., PCR Primer Design, Methods in Molecular Biology, vol. 42, Human Press, 2007; C.W. Dieffenbach et al., PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2003; and V. Demidov et al., DNA Amplification: Current Technologies and Applications, Taylor & Francis, 2004.
  • Primer extension producing a first strand complementary DNA, is accomplished using a polymerase enzyme under extension reaction conditions compatible with the polymerase activity to produce a complementary strand.
  • Particular conditions and protocols for primer extension are detailed in J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; and F.M. Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002.
  • the sample nucleic acids are RNA, i.e. sample RNA, and the sample RNA is reverse transcribed, producing cDNA.
  • the sample RNA may be reverse transcribed before or after addition of the adapters.
  • the method includes annealing a reverse transcription primer to target nucleic acids including RNA; and reverse transcribing the RNA, producing a first strand complementary DNA (cDNA) which is complementary to the RNA.
  • a reverse transcription primer to target nucleic acids including RNA
  • cDNA first strand complementary DNA
  • Annealing the reverse transcription primer, or reverse transcription primer set, to target nucleic acids is performed at an annealing temperature.
  • the annealing temperature depends on factors, including the nucleic acid sequence of the reverse transcription primer, or primers, and the target nucleic acids, and the composition of the reaction medium, including factors such as salt concentration, and concentration of additives, such as but not limited to, formamide, betaine, polyethylene glycol, SDS, and DMSO.
  • the annealing temperature is in the range of 30°C to 65°C, but can be higher or lower.
  • the annealing temperature may be higher or lower than the reverse transcription primer melting temperature (Tm). Often annealing temperatures are higher than the Tm of the reverse transcription primer to improve the stringency of the reaction.
  • Methods of generating a sequencing library are provided according to the present disclosure which include reverse transcribing target RNA, producing first strand complementary DNA (cDNA), is accomplished using a reverse transcriptase enzyme under reaction conditions compatible with reverse transcriptase enzyme activity to transcribe the target RNA.
  • a reverse transcriptase enzyme under reaction conditions compatible with reverse transcriptase enzyme activity to transcribe the target RNA.
  • Particular conditions and protocols for reverse transcription are detailed in J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor 20 Laboratory Press; 3rd Ed., 2001; and F.M. Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002.
  • Methods of generating a sequencing library are provided according to the present disclosure which further include polymerizing a second strand of DNA complementary to the first strand cDNA, producing double-stranded cDNA.
  • Polymerizing a second strand of DNA complementary to the first strand cDNA may include providing an appropriate DNA polymerase and polymerizing to produce double-stranded cDNA under reaction conditions compatible with DNA polymerase activity to produce double-stranded cDNA.
  • Suitable polymerases may include bacterial DNA polymerases, eukaryotic 30 DNA polymerases, archaeal DNA polymerases, viral DNA polymerases, Taq polymerase, DNA polymerase I, T4 DNA polymerase, Pfu polymerase, and phage DNA polymerases, including the Klenow fragment of DNA polymerase I, SEQUENASE 1.0 and SEQUENASE 2.0 (U.S. Biochemical), T5 DNA polymerase, and Phi29 DNA polymerase, among others.
  • Sequencing of amplicons is accomplished using any of various sequencing methodologies, including, traditional Sanger sequencing and massively parallel sequencing methodologies (“next generation sequencing”).
  • paired end reads are performed.
  • the term “paired end reads” refers to a sequencing technique including one sequencing “read” from each end of an amplicon to be sequenced. This allows for a greater yield of sequencing data and increased confidence in the sequencing results.
  • excess unligated 3’ adapters are reduced but not eliminated by formation of hybridized complexes or ligation complexes, such that a step of ligating the 5’ adapter to a library insert, also includes ligating the 5’ adapter to some of the excess unligated 3’ adapter, producing adapter-dimers wherein a 5’ adapter is covalently bonded by ligation to a 3’ adapter at a 5’ adapter-3’ adapter interface.
  • methods of reducing adapter-dimers in a sequencing library further include inhibiting amplification of the adapter-dimers in an amplification reaction such that the sequencing library molecules are selectively enriched by the amplification reaction compared to the adapter-dimers.
  • inhibiting amplification of the adapterdimers includes removing at least some of the adapter-dimers prior to amplification.
  • removing at least some of the adapterdimers prior to amplification includes one or more of: 1) specific enzymatic cleavage of the adapter-dimers; 2) CRISPR/Cas9-based cleavage of the adapter-dimers; 3) gel purification; 4) SPRI-bead based size selection; and 5) adding an adapter-dimer blocker oligonucleotide to the mixture, the adapter-dimer blocker oligonucleotide effective to inhibit amplification of the adapter-dimers.
  • Specific enzymatic cleavage of the adapter-dimers refers to use of a restriction endonuclease to cleave the adapter-dimers into two or more fragments, thereby reducing the number of adapter-dimers.
  • the nucleotide sequence of the adapter-dimers can be analyzed to determine which restriction endonuclease(s) will cleave the adapter-dimers or various restriction endonucleases can be assayed to determine which are effective to cleave the adapter-dimers, preventing amplification of the adapter-dimers.
  • CRISPR/Cas-based cleavage refers to use of a CRISPR/Cas system to cleave the adapter-dimers into two or more fragments, thereby reducing the number of adapter-dimers.
  • the adapter-dimers contain a CRISPR stem loop and the Cas protein recognizes the stem loop, cleaving the adapter-dimers, or binding with high affinity to the stem loop without cleaving the adapter-dimers, thereby preventing amplification of the adapter-dimers.
  • Solid Phase Reversible Immobilization (SPRI)-bead based size selection can be used to separate adapter-dimers from sequencing library molecules in a mixture, either by immobilizing the adapter-dimers on a solid support and removing the solid support with the immobilized adapter-dimers from the mixture or by immobilizing the sequencing library molecules on a solid support and removing the solid support with the immobilized sequencing library molecules from the mixture, followed by elution of the sequencing library molecules from the solid support.
  • SPRI Solid Phase Reversible Immobilization
  • adapter-dimer blocker oligonucleotide refers to an oligonucleotide which specifically hybridizes to at least a portion of an adapter-dimer containing an amplification primer binding site, thereby preventing amplification of the adapter-dimer.
  • An adapter-dimer blocker oligonucleotide has a length in the range of about 10 to about 300 nucleotides in length, depending on factors such as the size of the adapter-dimer, and hybridization conditions to be used.
  • an adapter-dimer blocker oligonucleotide has a length in the range of about 10 to about 300 nucleotides in length, about 10 to about 200 nucleotides in length, about 10 to about 100 nucleotides in length, about 10 to about 75 nucleotides in length, about 10 to about 50 nucleotides in length, about 10 to about 40 nucleotides in length, about 10 to about 30 nucleotides in length, or about 10 to about 20 nucleotides in length.
  • about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the adapter-dimer blocker oligonucleotide are non- naturally occurring nucleotides. According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the adapter-dimer blocker oligonucleotide are Tm increasing nucleotides and/or nucleotide analogs.
  • about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the adapter-dimer blocker oligonucleotide are LNA monomers, PNA monomers, BNA monomers, other Tm increasing nucleotide analogs, or any two or more thereof.
  • about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the adapter-dimer blocker oligonucleotide are LNA monomers.
  • An example adapter-dimer blocker oligonucleotide is 5’- C+G+AG+AA+T+T+CC+A+GA+T+CG+T+C+G+GA+C+T+G-3’ (SEQ ID NO:2), where +’s indicate LNA bases (i.e. incorporated LNA monomers).
  • a 3SpC3 (3 ’(C3) propyl spacer) is present on the 3’ end in a preferred example.
  • Kits for reducing adapter-dimers in a sequencing library are provided according to aspects of the present disclosure which include one or more blocker oligonucleotides and/or pairs of blocker oligonucleotides for reducing adapter-dimers in a sequencing library
  • kits for reducing adapter-dimers in a sequencing library further include one or more adapter-dimer blocker oligonucleotides effective to block amplification of adapter-dimers.
  • kits for reducing adapter-dimers in a sequencing library which include an adapter-dimer blocker oligonucleotide complementary to one or more adjacent portions of the adapter-dimers, the one or more adjacent portions including at least one nucleotide of the 5’ adapter at the 5’ adapter-3’ adapter interface, and an adjacent portion of the 3’ adapter including an amplification primer binding site.
  • a kit includes one or more blocker oligonucleotides and/or one or more adapter-dimer blocker oligonucleotides in aqueous, buffered, or lyophilized form.
  • the one or more blocker oligonucleotides and/or one or more adapter-dimer blocker oligonucleotides may be packaged together or separately.
  • the one or more blocker oligonucleotides and/or one or more adapter-dimer blocker oligonucleotides may be aliquoted into suitable amounts for use in sequencing library preparation, or may be packaged in bulk for aliquoting by a user.
  • kit components may include, but are not limited to, buffers, diluents, stabilizers, preservatives, reagents such as nucleotides, nucleotide analogs, and enzymes.
  • Compositions and methods according to aspects of the present disclosure have utility in numerous applications, including, but not limited to, reducing adapter-dimers sequenced in sequencing protocols, particularly in sequencing libraries including small inserts.
  • compositions and methods according to aspects of the present disclosure provide high sensitivity such that rare nucleic acids present in a sample can be detected more often. Reliable detection of rare nucleic acids allows for diagnostic and therapeutic methods of analyzing nucleic acids in a patient sample.
  • inventive compositions and methods are illustrated in the following examples. These examples are provided for illustrative purposes and are not considered limitations on the scope of inventive compositions and methods.
  • 3’ adapter ligation a Combine the following components on ice: i. 1 pL input RNA (Ing/pL) ii. 9.5 pL Nuclease-free water iii. 1 pL 5 uM 3’ adapter C3 /5rApp/TGGAATTCTCGGGTGCCAAGG/3SpC3/ (SEQ ID NO:3) iv. 7 pL 3’ ligation buffer v. 1.5 pL 3’ ligation enzyme mix vi. 20 pL total reaction volume b. Incubate as follows: i. 1 hr at 25°C ii. Hold at 4°C
  • the palindromic 3’ end of the oligonucleotide blocker allows the 3’ portions of two oligonucleotide blocker molecules to hybridize with each other, and the 5’ portion of the blocker oligonucleotides hybridize with the excess 3’ adapter, under hybridization conditions, forming a hybridization complex.
  • b. Incubate as follows: i. 10 min at 70°C ii. Hold at 4°C
  • Reverse transcription a. Start with the 26 pL 5’ ligation reaction from the previous step on the thermal cycler. b. Program a thermal cycler as follows: i. 2 min at 70°C ii. 30 min at 50°C iii. 5 min at 90°C iv. Hold at 4°C c. Prepare the RT master mix as follows: i. 13 pL RT Buffer ii. 1 pL 25 uM RT primer 5’-CCTTGGCACCCGAGAATTCCA-3’ (SEQ ID N0:5) iii. 2 pL EnzScript Reverse Transcriptase (Enzymatics) iv. 16 pL total vol. d.
  • Bead cleanup a. Add and mix 40 pL Adapter Depletion Solution b. Add and mix 40 pL NEXTFLEX Cleanup Beads c. Add and mix 90 pL isopropanol d. Incubate 5 min at room temperature e. Place on magnetic stand for 5 minutes or until solution is clear f. Aspirate to remove the supernatant g. Wash by adding 200 pL 80% ethanol, incubating 30 sec, and aspirating to remove supernatant h. Repeat above step for a total of 2 washes i. Let dry on magnetic stand for a total of 3 minutes. After 1 min, aspirate and remove any liquid that has collected at the bottom of the well j.
  • PCR a Combine the following components on ice: i. 18 pL cDNA from previous step 5n ii. 2 pL NEXTFLEX UDI Barcoded Primer Mix iii . 5 pL NEXTFLEX PCR Master Mix iv. 1 pL 10 pM long dblock02C3 (or water)
  • Bead cleanup a Take 25 pL of the PCR reaction from the previous step b. Add and mix 48.6 pL NEXTFLEX Cleanup Beads c. Incubate 5 min at room temperature d. Place on magnetic stand for 5 minutes or until solution is clear e. Aspirate to remove the supernatant f. Wash by adding 200 pL 80% ethanol, incubating 30 sec, and aspirating to remove supernatant g. Repeat above step for a total of 2 washes h. Let dry on magnetic stand for a total of 3 minutes. After 1 min, aspirate and remove any liquid that has collected at the bottom of the well i.
  • Adapter Ligation a. Combine the following components on ice: i. “X” pL input RNA (1 ng Total RNA) ii. 1 pL tRNA/YRNA Blockers ii. “Y” pL Nuclease-free water iv. 1 pL 3' Adenylated Adapter 5’-rApp /TGGAATTCTCGGGTGCCAAGG/ 3SpC3/-3’ (SEQ ID NO:3) v. 12.5 pL 3’ Ligation Buffer vi. 1.5 pL 3’ Ligation Enzyme Mix vii. 20 pL total reaction volume (Water and RNA should equal 4pL total volume) viii. Mix viscous reaction by vortexing for at least 3 seconds until homogenized. c. Incubate as follows: i. 1 hr at 25°C ii. Hold at 4°C
  • Adapter Ligation a. Combine the following components on ice: i. 24 pL reaction from previous step ii. 1 pL 5’ Adapter 5’ -UCUUUCCCUACACGACGCUCUUCCGAUCU-3’ (SEQ ID NO: 6) iii. 3 pL 5’ Ligation Buffer iv. 2 pL 5’ Ligation Enzyme Mix v. 30 pL TOTAL reaction volume b. Incubate as follows: i. 1 hr at 20°C ii. Hold at 4°C
  • reaction should turn orange rse Transcription a. Combine the following components on ice: i. 7 pL RT Buffer iii. 2 pL RT Enzyme Mix iv. 1 pL 25 uM RT primer 5’-CCTTGGCACCCGAGAATTCCA-3’ (SEQ ID NO: 5) v. 40 pL total reaction volume b. Incubate as follows: ii. 60 min at 50°C iii. 5 min at 90°C iv. Hold at 4°C c. Allow incubation to complete and ramp down to 4°C. cleanup a. Add and mix 40 pL Adapter Depletion Solution b.
  • Dual-sided Bead cleanup a. Take 26 pL of the PCR reaction from the previous step b. Add and mix 34 pL NEXTFLEX Cleanup Beads c. Incubate 5 min at room temperature d. Transfer 56 uL of supernatant to a new well e. Add and mix 13 pL NEXTFLEX Cleanup Beads d. Place on magnetic stand for 5 minutes or until solution is clear e. Aspirate to remove the supernatant f. Wash by adding 200 pL 80% ethanol, incubating 30 sec, and aspirating to remove supernatant g. Repeat above step for a total of 2 washes h. Let dry on magnetic stand for a total of 3 minutes.
  • Item 1 A method of reducing adapter-dimers in a sequencing library, comprising: combining sample nucleic acids, each having a 5’ end and a 3’ end, with 3’ adapters each having a 5’ end portion at least 8 nucleotides in length and a 5’ terminus which is an adenylated nucleotide, and a ligase, in a mixture under ligation reaction conditions, producing 1) first ligation products each comprising the 3’ end of a sample nucleic acid ligated to the 5’ terminus of a 3’ adapter, and 2) excess unligated, 3’ adapters in the mixture; adding blocker oligonucleotides to the mixture, the blocker oligonucleotides comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5’ portion at least 8 nucleotides in length and ii) a first blocker oligonu
  • Item 2 The method of item 1, wherein the first blocker oligonucleotide 3’ terminus and the second blocker oligonucleotide 3’ terminus are both capable of being ligated to the adenylated nucleotide at the 5’ terminus of the excess unligated 3’ adapters; and further comprising ligating the first blocker oligonucleotide 3’ terminus of the hybridized complex to the adjacent adenylated nucleotide at the 5’ terminus of the first unligated 3’ adapter and ligating the second blocker oligonucleotide 3’ terminus of the hybridized complex to the adjacent adenylated nucleotide at the 5’ terminus of the second unligated 3’ adapter, producing ligated complex, thereby reducing excess unligated 3’ adapters in the mixture, producing a purified mixture.
  • Item 3 The method of item 1 or 2, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the first blocker oligonucleotide 3 ’ portion are non-naturally occurring nucleotide analogs and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the second blocker oligonucleotide 3’ portion are non-naturally occurring nucleotide analogs.
  • Item 4 The method of any one of item 1, 2, or 3, wherein when the first blocker oligonucleotide 3’ portion and the second blocker oligonucleotide 3’ portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, the first blocker oligonucleotide 3’ portion and the second blocker oligonucleotide 3’ portion each comprise a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3’ portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3’ portion.
  • Item 5 The method of any one of items 1 to 4, further comprising: adding 5’ adapter to the mixture, the 5’ adapter having a 3’ terminus, wherein the first ligation products each comprise the 3’ end of a sample nucleic acid ligated to the 5’ terminus of a 3’ adapter, and the 5’ end of a sample nucleic acid ligated to the 3’ terminus of a 5’ adapter, thereby producing sequencing library molecules, the sequencing library molecules comprising a sample nucleic acid insert disposed between, and bonded to, a 5’ adapter and a 3’ adapter.
  • Item 6 The method of any one of items 1 to 5, further comprising: adding 5’ adapter to the purified mixture; and incubating the purified mixture under ligation reaction conditions, thereby 1) ligating the 5’ adapter to the first ligation product, producing sequencing library molecules, the sequencing library molecules comprising a sample nucleic acid insert disposed between, and bonded to, a 5’ adapter and a 3’ adapter.
  • Item 7 The method of any one of items 1 to 6, wherein excess unligated 3’ adapters are reduced but not eliminated such that the ligating includes ligating the 5’ adapter to at least some of the excess unligated 3’ adapter, producing adapter-dimers comprising a 5’ adapter bonded to a 3’ adapter at a 5’ adapter-3’ adapter interface; and further comprising inhibiting amplification of the adapter-dimers in an amplification reaction such that the sequencing library molecules are selectively enriched by the amplification reaction compared to the adapter-dimers.
  • Item 8 The method of any one of items 1 to 7, wherein inhibiting amplification of the adapter-dimers comprises removing at least some of the adapter-dimers prior to amplification.
  • Item 9 The method of item 7 or item 8, wherein inhibiting amplification of the adapter-dimers comprises one or more of: specific enzymatic cleavage of the adapter-dimers; CRISPR/Cas9-based cleavage of the adapter-dimers; gel purification; SPRI-bead based size selection; and adding an adapter-dimer blocker oligonucleotide to the mixture, the adapter-dimer blocker oligonucleotide effective to inhibit amplification of the adapter-dimers.
  • Item 10 The method of item 9, wherein the adapter-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the adapter-dimers, the one or more adjacent portions comprising at least one nucleotide of the 5’ adapter at the 5’ adapter-3’ adapter interface, and an adjacent portion of the 3’ adapter comprising an amplification primer binding site.
  • Item 11 The method of any one of items 1 to 10, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.
  • Item 12 The method of item 1, wherein the sample nucleic acids are, or include, RNA, and further comprising reverse transcribing the RNA, producing reverse transcribed sequencing library molecules.
  • Item 13 The method of item 1 , wherein the sample nucleic acids are, or include, DNA.
  • Item 14 The method of item 12 or 13, further comprising amplifying the sequencing library molecules.
  • a pair of oligonucleotides for reducing adapter-dimers in a sequencing library comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5’ portion at least 8 nucleotides in length and ii) a first blocker oligonucleotide 3’ portion at least 1 to 20 nucleotides in length and comprising a first oligonucleotide 3’ terminus, wherein at least 1 of the 1 to 20 nucleotides is a non-naturally occurring nucleotide analog; and b) a second blocker oligonucleotide comprising: iii) a second oligonucleotide 5’ portion at least 8 nucleotides in length and iv) a second blocker oligonucleotide 3’ portion at least 1 to 20 nucleotides in length and comprising a second block
  • Item 16 The pair of oligonucleotides for reducing adapter-dimers in a sequencing library of item 15, wherein the first blocker oligonucleotide 3’ terminus and the second blocker oligonucleotide 3’ terminus are both capable of being ligated to the adenylated nucleotide at the 5’ terminus of the excess unligated 3’ adapters.
  • Item 17 The pair of oligonucleotides for reducing adapter-dimers in a sequencing library of item 15 or 16, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the first blocker oligonucleotide 3’ portion are non-naturally occurring nucleotide analogs and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the at least 1 to 20 nucleotides of the second blocker oligonucleotide 3’ portion are non- naturally occurring nucleotide analogs.
  • Item 18 The pair of oligonucleotides for reducing adapter-dimers in a sequencing library of any one of items 15, 16, or 17, wherein when the first blocker oligonucleotide 3’ portion and the second blocker oligonucleotide 3’ portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, the first blocker oligonucleotide 3’ portion and the second blocker oligonucleotide 3’ portion each comprise a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3’ portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3’ portion.
  • Item 19 The pair of oligonucleotides for reducing adapter-dimers in a sequencing library of any one of items 15 to 18, wherein the first blocker oligonucleotide and the second blocker oligonucleotide each have a length in the range of about 11 to about 50 nucleotides.
  • Item 20 The pair of oligonucleotides for reducing adapter-dimers in a sequencing library of any one of items 15 to 19, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.
  • Item 21 A kit for reducing adapter-dimers in a sequencing library, comprising the pair of oligonucleotides of any one of items 15 to 20.
  • Item 22 The kit of item 21, further comprising an adapter-dimer blocker oligonucleotide effective to block amplification of adapter-dimers.
  • Item 23 The kit of item 22, wherein the adapter-dimer blocker oligonucleotide is complementary to one or more adjacent portions of the adapter-dimers, the one or more adjacent portions comprising at least one nucleotide of the 5’ adapter at the 5’ adapter-3’ adapter interface, and an adjacent portion of the 3’ adapter comprising an amplification primer binding site.
  • Item 24 The method of any one of items 1 to 14 or the kit of any one of items 21 to
  • first blocker and the second blocker have identical nucleic acid sequences.
  • Item 25 The method of any one of items 1 to 14 or the kit of any one of items 21 to
  • first blocker and the second blocker have different nucleic acid sequences.
  • Item 26 A method, kit, or pair of oligonucleotides substantially as shown or described herein.
  • Item 27 The method of any one of items 1 to 14, wherein the first blocker oligonucleotide and the second blocker oligonucleotide each have a length in the range of about 11 to about 50 nucleotides.
  • compositions and methods described herein are presently representative of preferred embodiments, exemplary, and not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art. Such changes and other uses can be made without departing from the scope of the invention as set forth in the claims.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2023/016295 2022-03-25 2023-03-24 Methods, compositions and kits for inhibiting formation of adapter dimers Ceased WO2023183611A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2024556472A JP2025510151A (ja) 2022-03-25 2023-03-24 アダプターダイマーの形成を阻害するための方法、組成物、及びキット
EP23720194.2A EP4499860A1 (en) 2022-03-25 2023-03-24 Methods, compositions and kits for inhibiting formation of adapter dimers
AU2023239149A AU2023239149A1 (en) 2022-03-25 2023-03-24 Methods, compositions and kits for inhibiting formation of adapter dimers
CN202380030039.5A CN119325511A (zh) 2022-03-25 2023-03-24 用于抑制接头二聚体形成的方法、组合物和试剂盒

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263323778P 2022-03-25 2022-03-25
US63/323,778 2022-03-25

Publications (1)

Publication Number Publication Date
WO2023183611A1 true WO2023183611A1 (en) 2023-09-28

Family

ID=86271326

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/016295 Ceased WO2023183611A1 (en) 2022-03-25 2023-03-24 Methods, compositions and kits for inhibiting formation of adapter dimers

Country Status (6)

Country Link
US (1) US20230323341A1 (https=)
EP (1) EP4499860A1 (https=)
JP (1) JP2025510151A (https=)
CN (1) CN119325511A (https=)
AU (1) AU2023239149A1 (https=)
WO (1) WO2023183611A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025079565A1 (ja) * 2023-10-13 2025-04-17 アークレイ株式会社 ライゲーション方法、アダプターダイマー形成の抑制方法、ngsライブラリの調製方法、ngsライブラリ調製キット、及び3'アダプター

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012033687A1 (en) * 2010-09-10 2012-03-15 New England Biolabs, Inc. Method for reducing adapter-dimer formation
WO2015106941A1 (en) 2014-01-16 2015-07-23 Illumina Cambridge Limited Polynucleotide modification on solid support
WO2016164866A1 (en) * 2015-04-10 2016-10-13 Hudsonalpha Institute For Biotechnology METHOD FOR BLOCKING miRNA
WO2020247950A1 (en) * 2019-06-07 2020-12-10 Bio-Rad Laboratories, Inc. Multiple beads per droplet resolution
WO2021232023A2 (en) * 2020-05-15 2021-11-18 Swift Biosciences, Inc. Methods for ligation-coupled-pcr
WO2022046797A1 (en) * 2020-08-25 2022-03-03 Twist Bioscience Corporation Compositions and methods for library sequencing

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012033687A1 (en) * 2010-09-10 2012-03-15 New England Biolabs, Inc. Method for reducing adapter-dimer formation
WO2015106941A1 (en) 2014-01-16 2015-07-23 Illumina Cambridge Limited Polynucleotide modification on solid support
WO2016164866A1 (en) * 2015-04-10 2016-10-13 Hudsonalpha Institute For Biotechnology METHOD FOR BLOCKING miRNA
WO2020247950A1 (en) * 2019-06-07 2020-12-10 Bio-Rad Laboratories, Inc. Multiple beads per droplet resolution
WO2021232023A2 (en) * 2020-05-15 2021-11-18 Swift Biosciences, Inc. Methods for ligation-coupled-pcr
WO2022046797A1 (en) * 2020-08-25 2022-03-03 Twist Bioscience Corporation Compositions and methods for library sequencing

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
"Methods in Molecular Biology", 2015, HUMANA PRESS, article "Whole Genome Amplification: Methods and Protocols"
"Remington: The Science and Practice of Pharmacy", 2005, LIPPINCOTT WILLIAMS & WILKINS
B. ALBERTS ET AL.: "Short Protocols in Molecular Biology, Current Protocols", 2002, GARLAND
C.W. DIEFFENBACH ET AL.: "PCR Primer: A Laboratory Manual", 2003, COLD SPRING HARBOR LABORATORY PRESS
J. SAMBROOKD.W. RUSSELL: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS
L. BRUNTON ET AL.: "Goodman & Gilman's The Pharmacological Basis of Therapeutics", 2011, MCGRAW-HILL PROFESSIONAL
L.V. ALLEN, JR. ET AL.: "Oligonucleotide Synthesis: Methods and Applications, Methods in Molecular Biology", 2004, LIPPINCOTT, WILLIAMS & WILKINS
MITSUOKI KAWANO ET AL: "Reduction of non-insert sequence reads by dimer eliminator LNA oligonucleotide for small RNA deep sequencing", BIOTECHNIQUES, INFORMA HEALTHCARE, UNITED STATES, vol. 49, no. 4, 1 October 2010 (2010-10-01), pages 751 - 755, XP002667963, ISSN: 1940-9818, DOI: 10.2144/000113516 *
YURYEV, A.: "PCR Primer Design, Methods in Molecular Biology", vol. 42, 2007, HUMAN PRESS

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025079565A1 (ja) * 2023-10-13 2025-04-17 アークレイ株式会社 ライゲーション方法、アダプターダイマー形成の抑制方法、ngsライブラリの調製方法、ngsライブラリ調製キット、及び3'アダプター

Also Published As

Publication number Publication date
CN119325511A (zh) 2025-01-17
EP4499860A1 (en) 2025-02-05
AU2023239149A1 (en) 2024-09-19
US20230323341A1 (en) 2023-10-12
JP2025510151A (ja) 2025-04-14

Similar Documents

Publication Publication Date Title
US11964997B2 (en) Methods of library construction for polynucleotide sequencing
US8034568B2 (en) Isothermal nucleic acid amplification methods and compositions
CN110191961B (zh) 制备经不对称标签化的测序文库的方法
US9518292B2 (en) Methods for suppression PCR
CA2948951C (en) Synthesis of double-stranded nucleic acids
US20070269825A1 (en) Method and kit for nucleic acid sequence detection
WO2009102896A2 (en) Isothermal nucleic acid amplification methods and compositions
CN109511265A (zh) 通过链鉴定改进测序的方法
WO2016181128A1 (en) Methods, compositions, and kits for preparing sequencing library
WO2016161237A1 (en) Nucleic acid retro-activated primers
CA3122844A1 (en) A method for suppressing non-specific amplification products in nucleic acid amplification technologies
US20230323341A1 (en) Methods, compositions, and kits for inhibiting formation of adapter dimers
EP2964777B1 (en) Synthesis of pools of probes by primer extension
US20220282398A1 (en) Universal blocking oligonucleotides for reduced off-target hybridization in hybridization capture methods
CN119095979A (zh) 目标富集
US12247200B2 (en) Compositions and methods for generating massively parallel nucleic acid sequencing libraries
EP4421187A2 (en) Methods and compositions for preparing nucleic acid libraries
EP3638786B1 (en) Duplex sequencing using direct repeat molecules
WO2018009677A1 (en) Fast target enrichment by multiplexed relay pcr with modified bubble primers
HK40109510A (en) Methods and compositions for preparing nucleic acid libraries
HK40087449A (en) Methods and compositions for preparing nucleic acid libraries
HK40087449B (en) Methods and compositions for preparing nucleic acid libraries

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23720194

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2023239149

Country of ref document: AU

Date of ref document: 20230324

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2024556472

Country of ref document: JP

Ref document number: 202380030039.5

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2023720194

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023720194

Country of ref document: EP

Effective date: 20241025

WWP Wipo information: published in national office

Ref document number: 202380030039.5

Country of ref document: CN