WO2023173137A1 - Compositions et méthodes de modification génétique efficace et stable de cellules eucaryotes - Google Patents
Compositions et méthodes de modification génétique efficace et stable de cellules eucaryotes Download PDFInfo
- Publication number
- WO2023173137A1 WO2023173137A1 PCT/US2023/064244 US2023064244W WO2023173137A1 WO 2023173137 A1 WO2023173137 A1 WO 2023173137A1 US 2023064244 W US2023064244 W US 2023064244W WO 2023173137 A1 WO2023173137 A1 WO 2023173137A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- cells
- car
- antigen
- transposon
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/7051—T-cell receptor (TcR)-CD3 complex
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/46—Cellular immunotherapy
- A61K39/461—Cellular immunotherapy characterised by the cell type used
- A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/46—Cellular immunotherapy
- A61K39/461—Cellular immunotherapy characterised by the cell type used
- A61K39/4613—Natural-killer cells [NK or NK-T]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/46—Cellular immunotherapy
- A61K39/461—Cellular immunotherapy characterised by the cell type used
- A61K39/4614—Monocytes; Macrophages
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/46—Cellular immunotherapy
- A61K39/463—Cellular immunotherapy characterised by recombinant expression
- A61K39/4631—Chimeric Antigen Receptors [CAR]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/46—Cellular immunotherapy
- A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
- A61K39/4643—Vertebrate antigens
- A61K39/4644—Cancer antigens
- A61K39/464402—Receptors, cell surface antigens or cell surface determinants
- A61K39/464411—Immunoglobulin superfamily
- A61K39/464412—CD19 or B4
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/46—Cellular immunotherapy
- A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
- A61K39/4643—Vertebrate antigens
- A61K39/4644—Cancer antigens
- A61K39/464402—Receptors, cell surface antigens or cell surface determinants
- A61K39/464411—Immunoglobulin superfamily
- A61K39/464413—CD22, BL-CAM, siglec-2 or sialic acid binding Ig-related lectin 2
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/46—Cellular immunotherapy
- A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
- A61K39/4643—Vertebrate antigens
- A61K39/4644—Cancer antigens
- A61K39/464402—Receptors, cell surface antigens or cell surface determinants
- A61K39/464416—Receptors for cytokines
- A61K39/464417—Receptors for tumor necrosis factors [TNF], e.g. lymphotoxin receptor [LTR], CD30
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/46—Cellular immunotherapy
- A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
- A61K39/4643—Vertebrate antigens
- A61K39/4644—Cancer antigens
- A61K39/464402—Receptors, cell surface antigens or cell surface determinants
- A61K39/464424—CD20
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2878—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2887—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
- A61K2239/10—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the structure of the chimeric antigen receptor [CAR]
- A61K2239/11—Antigen recognition domain
- A61K2239/13—Antibody-based
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
- A61K2239/10—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the structure of the chimeric antigen receptor [CAR]
- A61K2239/23—On/off switch
- A61K2239/25—Suicide switch
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
- A61K2239/27—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by targeting or presenting multiple antigens
- A61K2239/29—Multispecific CARs
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/03—Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/90—Vectors containing a transposable element
Definitions
- the invention is generally related to the fields of gene editing technology and immunotherapy, and more particularly to improved methods of genetic engineering in live cells using mRNA transfection, together with transposon and AAV-mediated targeted gene editing.
- Adoptive immunotherapy in which T cells that are specific for tumor-associated antigens are expanded to generate large numbers of cells and transferred into tumor- bearing hosts, is a promising strategy to treat cancer.
- Cellular immunotherapy involves the administration of “living drugs”: genetically modified immune cells that can proliferate, adapt to their environment, engage surrounding cells, and elicit dynamic responses that directly or indirectly target tumor cells for destruction (Hayes, Cellular immunotherapies for cancer. Ir J Med Sci 190, 41-57, doi: 10.1007/s11845-020-02264-w (2021).
- Adoptive cell transfer is one type of cellular immunotherapy which involves the transfer of cells that directly target tumor cells in the patient (Laskowski & Rezvani, Adoptive cell therapy: Living drugs against cancer. J Exp Med 217, doi:10.1084/jem.20200377 (2020)).
- One notable ACT approach is chimeric antigen receptor (CAR) T cell therapy, in which T cells are engineered to express a synthetic membrane receptor specific for a tumor antigen.
- CAR-T therapy has had a remarkable effect in patients with certain hematological malignancies (June, et al. CAR T cell immunotherapy for human cancer. Science 359, 1361-1365, doi:10.1126/science. aar6711 (2016); Majzner, et al.
- the T cells used for adoptive immunotherapy can be generated either by expansion of antigen- specific T cells or redirection of T cells through genetic engineering.
- One approach to genetically engineering T cells is to modify the cells to target antigens expressed on tumor cells through the expression of chimeric antigen receptors (CARs).
- CARs are antigen receptors that are designed to recognize cell surface antigens in a human leukocyte antigen-independent manner. Upon recognition and binding of the antigen, the CAR T cell activates an immune response against the antigen bearing cells.
- Engineered CAR T cell treatments of patients with cancer have shown promising clinical results.
- genetically modified T cells expressing anti-CD19 CARs have recently been approved by the FDA for the treatment of patients with relapsed or refractory diffuse large B-cell lymphoma and B-cell acute lymphoblastic leukemia.
- TILs tumor infiltrating lymphocytes
- TCR-T T cell receptor T
- CAR-NK cells Cho, et al. CSl-specific chimeric antigen receptor (CAR)-engineered natural killer cells enhance in vitro and in vivo antitumor activity against human multiple myeloma. Leukemia 28, 917-927, doi:10.1038/leu.2013.279 (2014); Genssler, et al. Dual targeting of glioblastoma with chimeric antigen receptor-engineered natural killer cells overcomes heterogeneity of target antigen expression and enhances antitumor activity and survival. Oncoimmunology 5, el 119354,(2016); Zhang, et al.
- CAR-Ms CAR macrophages
- iPSC human induced pluripotent stem cell
- CAR constructs to enhance therapeutic efficacy or safety, e.g., kill switch-CARs that can be depleted upon administration of a drug in the case of deleterious CAR toxicity (Di Stasi, et al. Inducible apoptosis as a safety switch for adoptive cell therapy. N Engl J Med 365, 1673-1683, doi: 10.1056/NEJMoal 106152 (2011)), or tandem CARs that can target two different antigens (Shah, et al., Bispecific anti-CD20, anti-CD19 CAR T cells for relapsed B cell malignancies: a phase 1 dose escalation and expansion trial.
- CAR-Ts used in clinical trials were generated using y-retrovirus or lentivirus for gene transfer.
- these limitations of this family of viral vectors exist. For example, they can be challenging to produce in ultra-high titer (e.g., 1x10 10 ⁇ g/mL or higher); their transduction efficiency vary significantly between donors; and their transgene expression may get silenced or dampened (Ellis, Silencing and variegation of gammaretrovirus and lentivirus vectors. Hum Gene Ther 16, 1241-1246, doi: 10.1089/hum.2005.16.1241 (2005)).
- a key limitation of y-retroviruses specifically is their preference of integration into promoters of active genes (Lukjanov, et al.
- Adeno-associated virus is commonly used in gene therapy and is considered a safer vector (Naso, et al., Adeno-Associated Virus (AAV) as a Vector for Gene Therapy. BioDrugs 31, 317-334, doi: 10.1007/s40259-017-0234-5 (2017)) (consistent with its BSL1 classification).
- AAV was explored as a candidate for cell therapy vehicle (Bulcha, et al., G. Viral vector platforms within the gene therapy landscape.
- Non- viral systems have been proposed to eliminate the need for viral vectors.
- all current non-viral cell therapy approaches also have their limitations.
- mRNA electroporation is another CAR-generation strategy, but the duration of CAR expression is extremely short — even for state-of-the-art mRNA technology — due to the instability of mRNA (Morgan, et al., Genetic Modification of T Cells. Biomedicines 4, doi:10.3390/biomedicines4020009 (2016)).
- Transposon systems such as PiggyBac (Wilson, et al., Jr. PiggyBac transposon-mediated gene transfer in human cells.
- Non-viral genome editing e.g., CRISPR
- CRISPR CRISPR
- T cell natural killer
- NK natural killer
- compositions and methods for highly efficient cellular genomic engineering that can transduce diverse cell types with minimal cellular toxicity, leading to highly efficient and stable genomic modifications are provided.
- the disclosed compositions and methods are especially applicable to development of enhanced chimeric antigen receptor engineered T cell therapy (CAR-T).
- CAR-T enhanced chimeric antigen receptor engineered T cell therapy
- An exemplary method for introducing a gene of interest into a cell includes introducing to the cell a viral vector including a transposon encoding the gene of interest and mRNA including a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome, whereby the mRNA is introduced to the cell via electroporation.
- kits for introducing a gene of interest into a cell where the kit includes a viral vector including a transposon encoding the gene of interest and mRNA including a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome.
- the transposon is the Sleeping Beauty transposon, and/or the transposase enzyme is the SB100x hyperactive transposase, and/or the viral vector is an Adeno-associated virus (AAV) vector.
- the transposon is the Sleeping Beauty transposon, the transposase enzyme is the SB 100x hyperactive transposase, and the viral vector is an Adeno-associated virus (AAV) vector.
- the transposon includes a gene of interest including a reporter gene, a chimeric antigen receptor (CAR), or combinations thereof.
- the transposon further includes a promoter and/or polyadenylation signal operationally linked to the reporter gene and/or the CAR.
- An exemplary CAR is specific for an antigen selected from a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- an antigen selected from a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- Exemplary CARs target one or more antigens selected from AFP, AKAP-4, ALK, Androgen receptor, B7H3, BCMA, Bcr-Abl, BORIS, Carbonic, CD123, CD138, CD174, CD19, CD20, CD22, CD30, CD33, CD38, CD80, CD86, CEA, CEACAM5, CEACAM6, Cyclin, CYP1B1, EBV, EGFR, EGFR806, EGFRvIII, EpCAM, EphA2, ERG, ETV6-AML, FAP, Fos-related antigenl, Fucosyl, fusion, GD2, GD3, GloboH, GM3, gplOO, GPC3, HER-2/neu, HER2, HMWMAA, HPV E6/E7, hTERT, Idiotype, IL12, IL13RA2, IM19, IX, LCK, Legumain, IgK, LMP2, MAD-CT-1, MAD-CT-2,
- An exemplary cancer antigen that is recognized by a CAR includes 4-1BB, 5T4, adenocarcinoma antigen, alpha-fetoprotein, BAFF, B-lymphoma cell, C242 antigen, CA-125, carbonic anhydrase 9 (CA- IX), C-MET, CCR4, CD 152, CD 19, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD28, CD30 (TNFRSF8), CD33, CD4, CD40, CD44 v6, CD51, CD52, CD56, CD74, CD80, CEA, CNT0888, CTLA-4, DR5, EGFR, EpCAM, CD3, FAP, fibronectin extra domain-B, folate receptor 1, GD2, GD3 ganglioside, glycoprotein 75, GPNMB, HER2/neu, HGF, human scatter factor receptor kinase, IGF-1 receptor, IGF-I, IgGl, Ll-CAM, IL-13, IL-6,
- the CAR is bispecific or multivalent.
- the CAR is an anti-CD19 CAR, or an anti-CD22, or an anti-CD19 and anti-CD22 CAR.
- the CAR is CD19BBz or CD22BBz.
- the mRNA encoding the transposase includes one or more of N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine ( ⁇ ), N1 -methylpseudouridine (me1 ⁇ ), 5-methoxyuridine (5moU), a 5’ cap, a poly(A) tail, one or more nuclear localization signals.
- the mRNA, or the transposon, or both are codon optimized for expression in a eukaryotic cell.
- the mRNA encoding transposase and the viral vector is introduced to the cell at the same or different times.
- the mRNA is introduced to the cell by electroporation at a time point between 10 hours before, and 10 hours after the viral vector including a transposon encoding the gene of interest is introduced to the cell.
- the mRNA is introduced to the cell by electroporation at a time point between one and four hours before the viral vector including a transposon encoding the gene of interest is introduced to the cell.
- the AAV vectors is AAV6 or AAV9.
- the introduction of mRNA encoding transposase and the viral vector including the transposon is performed ex vivo.
- the cell is a T cell, hematopoietic stem cell (HSC), macrophage, natural killer cell (NK), or dendritic cell (DC).
- the T cell is a CD8+ T cell selected from the group including effector T cells, memory T cells, central memory T cells, and effector memory T cells.
- the T cell is a CD4+ T cell selected from the group including Thl cells, Th2 cells, Thl7 cells, and Treg cells.
- Isolated cells modified according to a method for introducing a gene of interest into a cell including introducing to the cell a viral vector including a transposon encoding the gene of interest and mRNA including a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome, whereby the mRNA is introduced to the cell via electroporation are also provided.
- the cell includes a gene of interest that is a CAR.
- the CAR is bispecific or multi- specific.
- a population of cells derived by expanding cells modified according to a method for introducing a gene of interest into a cell including introducing to the cell a viral vector including a transposon encoding the gene of interest and mRNA including a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome, whereby the mRNA is introduced to the cell via electroporation are also provided.
- Pharmaceutical compositions including the population of cells, together with a pharmaceutically acceptable buffer, carrier, diluent, or excipient are also described.
- Methods of treating a subject having a disease, disorder, or condition include administering to the subject an effective amount of the pharmaceutical composition including cells modified according to a method for introducing a gene of interest into a cell including introducing to the cell a viral vector including a transposon encoding the gene of interest and mRNA including a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome, whereby the mRNA is introduced to the cell via electroporation are also provided.
- the methods treat a subject having a disease, disorder, or condition associated with an elevated expression or specific expression of an antigen, whereby the cell includes a CAR that targets the antigen.
- Methods of treating a subject having a disease, disorder, or condition include administering to the subject an effective amount of a pharmaceutical composition including a genetically modified cell, where the cell is genetically modified by a method including introducing to the cell (i) a viral vector including a transposon encoding the gene of interest; and (ii) mRNA including a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome, whereby the mRNA is introduced to the cell via electroporation.
- the transposon is the Sleeping Beauty transposon, and/or the transposase enzyme is the SB100x hyperactive transposase, and/or the viral vector is an Adeno-associated virus (AAV) vector.
- the transposon is the Sleeping Beauty transposon, the transposase enzyme is the SB100x hyperactive transposase, and the viral vector is an Adeno-associated virus (AAV) vector.
- the transposon encodes one or more gene of interest including a reporter gene, a chimeric antigen receptor (CAR), or combinations thereof.
- the transposon includes a promoter and/or polyadenylation signal operationally linked to the reporter gene and/or the CAR.
- the CAR is specific for an antigen selected from a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- the CAR targets one or more antigens selected from AFP, AKAP-4, ALK, Androgen receptor, B7H3, BCMA, Bcr-Abl, BORIS, Carbonic, CD123, CD138, CD174, CD19, CD20, CD22, CD30, CD33, CD38, CD80, CD86, CEA, CEACAM5, CEACAM6, Cyclin, CYP1B1, EBV, EGFR, EGFR806, EGFRvIII, EpCAM, EphA2, ERG, ETV6-AML, FAP, Fos-related antigenl, Fucosyl, fusion, GD2, GD3, GloboH, GM3, gplOO, GPC3, HER-2/neu, HER2, HMWMAA, HPV E6/E7, hTERT, Idiotype, IL12, IL13RA2, IM19, IX, LCK, Legumain, IgK, LMP2, MAD-CT-1, MAD-
- Exemplary cancer antigens are selected from 4- IBB, 5T4, adenocarcinoma antigen, alpha- fetoprotein, BAFF, B-lymphoma cell, C242 antigen, CA-125, carbonic anhydrase 9 (CA-IX), C-MET, CCR4, CD 152, CD 19, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD28, CD30 (TNFRSF8), CD33, CD4, CD40, CD44 v6, CD51, CD52, CD56, CD74, CD80, CEA, CNT0888, CTLA-4, DR5, EGFR, EpCAM, CD3, FAP, fibronectin extra domain-B, folate receptor 1, GD2, GD3 ganglioside, glycoprotein 75, GPNMB, HER2/neu, HGF, human scatter factor receptor kinase, IGF-1 receptor, IGF-I, IgGl, Ll-CAM, IL-13, IL-6, insulin-like growth factor
- the CAR is bispecific or multivalent. In preferred forms, the CAR is anti-CD19 or anti-CD22, or both. In some forms, the CAR is CD19BBz or CD22BBz. In some forms, the AAV vector is AAV6 or AAV9.
- the genetically modified cell is a T cell, hematopoietic stem cell (HSC), macrophage, natural killer cell (NK), or dendritic cell (DC).
- the T cell is a CD8+ T cell selected from the group including effector T cells, memory T cells, central memory T cells, and effector memory T cells.
- the T cell is a CD4+ T cell selected from Thl cells, Th2 cells, Thl7 cells, and Treg cells.
- the introduction to the cell is performed ex vivo.
- the cell was isolated from the subject having the disease, disorder, or condition prior to the introduction to the cell.
- the cell was isolated from a healthy donor prior to the introduction to the cell.
- the pharmaceutical composition includes a population of cells derived by expanding the genetically modified cell.
- An exemplary subject is a human subject.
- FIG. 1 is a schematic representation of the MAJESTIC system for generating chimeric antigen receptor (CAR) T cells, showing the two core components of the MAJESTIC system: the Adeno-associated virus (AAV) vector including Sleeping Beauty transposon (SB) carrying desired cell therapy transgenes (AAV-SB-CTx), and the engineered mRNA encoding the hyperactive SB SB100x transposase (SB 100X Transposase mRNA); mRNA electroporation is combined with AAV-delivery of the SB-CT plasmid encoding a CAR to facilitate integration of the SB transposon construct, thus enabling targeted CAR knock-in in human primary cells, such as T cells, NK cells, monocyte cells and macrophages, derived from Induced pluripotent stem cells (iPSC); these cells are then expanded into therapeutic immune cells and introduced to a subject for treatment and prevention of cancer.
- AAV Adeno-associated virus
- SB Sleeping Beauty transposon
- Figures 4A-4F are graphs of quantification of the CD22.CAR in human CD4 T cells ( Figure 4A) and human CD8 T cells ( Figure 4B), respectively, for cells transduced with AAV-SB-CD22.CAR vims at various time points, showing % CD22-CAR for each of control samples (no virus or AAV only (iE4), as well as transduction time points (-4h, -2h, Ih, 3h and 4h relative to SB100x mRNA electroporation, respectively), for cells at Day 3 (clear) and Day 5 (shaded) post-transduction, respectively.
- Figures 4C-4F are graphs of flow cytometry of CD22.CAR T cells produced via AAV-SB and a titrated serial of SB100x mRNA, with data plotted for % CD22.CAR each of CD8 T cells (Figs. 4C-4D) and CD4 T cells (Figs. 4E-4F), respectively, at day 7 (Figs. 4C, 4E) and at day 12 (Figs.
- Figures 5A-5C are graphs of quantification of the CD22.CAR T cells.
- Figures 6A-6D are graphs of Cytolysis (%) of NAML6-GL (NAML6 with GFP and luciferase reporters) cancer cells co-cultured with Lenti-CD22.CAR (clear) or AAV-SB-CD22.CAR (shaded) T cells, respectively ( Figures 6A-6B), or co-cultured with Lenti-BCMA.CAR (clear) or AAV-SB-BCMA.CAR (shaded) T cells ( Figures 6C-6D), respectively, seeded at various effector : target (E:T) ratios of 1:2.5, 1:5, 1:10, or 1:20, with luciferase imaging performed at time points 16h ( Figures 6A, 6C), or 40h ( Figures 6B, 6D), respectively.
- E:T effector : target
- FIG. 7A is a schematic representation of how the MAJESTIC system for generating chimeric antigen receptors (CAR) is applied to produce various therapeutic immune cells.
- the MAJESTIC system includes the steps of isolating T cells from a subject, electroporation with SB100X mRNA and AAV-SB-CAR transduction to produce cells including one or more of single scFv CAR, tandem scFv CAR, TCR-T, and kill-switch CAR cells having an externally-activated ICasp9/Caspase 3-mediated apoptosis “switch”.
- Figure 8A is a schematic representation of an AAV-SB-CD19.20.CAR construct, showing: 5’ITR site, Sleeping Beauty (SB) IR/DR site, EFS, leader sequence, single chain variable domain specific for CD 19 (CD 19 scFv) and CD20 scFv CAR sequences joined by a linker to be expressed together as a tandem scFv CAR, CD8 hinge and transmembrane (CD8 TM), 4-1BB, CD3 zeta (CD3z), poly-Adenosine (Poly- A), Sleeping Beauty (SB) IR/DR site and 3’1TR site.
- SB Sleeping Beauty
- Figures 8C-8D are graphs of cytolysis analysis of NALM6-GL cancer cells that were co-cultured with lenti-CD19.20.CAR and AAV-SB-CD19.20.CAR T cells, showing cytolysis (%) for each of WT (No virus); AAV-SB-CD19.20.CAR; and lenti- CD19.20.CAR groups, respectively, with E:T ratios of 1:4 or 1:10, in kill assays with leukemia cells after 3 hours ( Figure 8C) or 17 hours ( Figure 8D), respectively.
- Figure 9A is a schematic representation of a construct used to generate conditional control CAR-T cells with two trans genes, CD22 CAR and a suicide-gene (CD22.CAR.iCasp9 T cells), showing: 5’ITR site, Sleeping Beauty (SB) IR/DR site, EFS, leader sequence, single chain variable domain specific for CD 22 (CD22 scFv), CD8 hinge and transmembrane (CD8 TM), 4-1BB, CD3 zeta (CD3z), T2A site, iCasp9 gene, poly-Adenosine (Poly- A), Sleeping Beauty (SB) IR/DR site and 3’ITR site.
- SB Sleeping Beauty
- Figures 9D-9E are graphs showing quantification of flow cytometry data of CD22.CAR T cells from human primary CD4 (Fig. 9D) or CD8 (Fig.
- Random refers to a set of one million randomly generated genomic coordinates. Insertion coordinates for LV; CD4 (Roth) were obtained from literature (see main for citations).
- LV lenti virus
- MC minicircle
- SB100x hyperactive Sleeping Beauty transposase.
- Figure 9H is a heatmap of relative quantifications of insertions in functional gene regions for various gene transfer methods. For each condition, the proportion of reads falling into a given gene region is first calculated. Then a fold-change relative to the frequency of randomly generated insertions into that same region produces the value shown in the heatmap.
- UTR untranslated regions. The list of cancer genes was taken from COSMIC and included genes from both Tier 1 and Tier 2.
- Figures 10A-10C are graphs showing CAR-NK, CAR-Monocyte, and CAR-Macrophage generation via MAJESTIC.
- Figure 10C is a graph of the quantitation of Cytolysis (0-80%) for each of NK92 and NK92-AAV-SB-HER2.CAR, respectively, at E:T ratios of 1:10 and 1:2 (24hr), respectively.
- Figures 11A-11B are graphs showing quantitation of human monocytic cell line THP-1 cells (Figure 11A) or human CD 14+ macrophages (Figure 11B) transduced with CAR using the MAJESTIC system.
- FIG 12 is a schematic representation of an exemplary method employing the MAJESTIC system for generating chimeric antigen receptor (CAR)T/NK/macrophage/iPSC generation, showing the preparation of the two core components: the Adeno-associated virus (AAV) vector including Sleeping Beauty transposon carrying desired cell therapy transgenes (AAV-SB-CTx), and the engineered mRNA encoding the hyperactive SB SB 100x transposase (SB 100X Transposase mRNA); AAV preparation and expansion; electroporation of CD4 or CD8 T cells with mRNA; AAV-delivery of the SB-CAR plasmid encoding a CAR, PBS washing of transduced and electroporated cells, followed by cell isolation and selection using, e.g., Flow cytometry, and/or cancer cell kill assays.
- AAV Adeno-associated virus
- AAV-SB-CTx Sleeping Beauty transposon carrying desired cell therapy transgenes
- Figures 13A-13D are graphs showing quantitation of cells transduced with CAR using the MAJESTIC system.
- Figure 13C shows % of CD22.CAR.
- FIGs 14A-14B are graphs of vector copy number (VCN) quantification of MAJESTIC-manufactured CAR-T cells.
- VCN vector copy number
- Purified CAR T cells were collected for DNA extraction after three weeks of mRNA electroporation and viral transduction. Data are for each of four donors, showing VCN (SB left arm)(Fig. 14A), and VCN (SB right arm)(Fig. 14B) for each of no treatment; AAV-SB-CD22.CAR only; MC-SB + SB 100X mRNA; and AAV-SB-CD22.CAR + SB100x mRNA groups, respectively.
- VCN vector copy number
- Figures 14C- 14D are graphs of SB100x transposase excision efficiency evaluation, showing VCN (four donors; left arm)(Fig. 14C), and VCN (four donors; right arm)(Fig. 14D) for each of no treatment ; AAV-SB-CD22.CAR only ); MC-SB + SB 100X mRNA ; and AAV-SB-CD22.CAR + SB100x mRNA ) groups, respectively.
- Figures 14E-14F are graphs of SB100x transposase excision efficiency evaluation, showing % excision efficiency for AAV-SB-HER2.CAR + mRNA at days dl-d3 for each of SB left arm (Fig. 14E), and SB right arm (Fig. 14F), respectively.
- Figures 15A-15G and 15H-15N are graphs of Exhaustion and memory marker expression in CD22-CAR T cells ( Figures 15A-15G), and in HER2-CAR T cells ( Figures 15H-15N) before and post transfection for each of PD-1, CTLA4, TIM-3, LAG-3, IL7-Ra, CXCR3 and CXCR7, as indicated.
- Figures 16A-16B are graphs of survival in NALM6-GL-induced leukemia- bearing NSG mice treated with either PBS , untreated CD8 T cells , and AAV-SB- CD22.CAR T cells ), respectively, with data plotted as Luminescence (photons/sec) (Fig. 16A), or probability of survival (Fig. 16B) over DPI. Log-rank (Mantel-Cox) tests were performed to evaluate statistical significance.
- Figure 17A is a graphs of Quantification of Flow cytometry data of CD22.CAR T cells from human primary CD3 T cells produced by plasmid transposon plasmid, transposon MC, transposon MC with mRNA-transposase, and MAJESTIC.
- Figures 18A-18B are graphs of quantitation of the amount of normalized detected chimeric reads, showing numbers of normalized filtered reads per million (RPM) in linear scale ( Figure 18A) or in loglO scale ( Figure 18B), respectively, for each of AAV- SB transduction and mRNA electroporation (AAV-SB & mRNA) ( , as compared to the background AAV-SB transduction alone (AAV-SB only) ), or PBS treated ( ) respectively.
- RPM normalized filtered reads per million
- MAJESTIC mRNA AAV-Sleeping- Beauty Joint Engineering of Stable Therapeutic Immune Cells
- SB Sleeping Beauty
- MAJESTIC utilizes an AAV vector carrying a Sleeping Beauty (SB) transposon including a construct for introduction of a CAR, as well as electroporation of cells to introduce transposase mRNA.
- SB Sleeping Beauty
- the mRNA component encodes a transposase that mediates a pulse of genomic integration of the Sleeping Beauty (SB) transposon, which carries genes-of-interest and is embedded inside the AAV vector.
- This system can transduce diverse immune cell types with minimal cellular toxicity, leading to highly efficient and stable therapeutic cargo delivery.
- MAJESTIC showed higher cell viability, chimeric antigen receptor (CAR) transgene expression, therapeutic cell yield, as well as prolonged transgene expression.
- CAR chimeric antigen receptor
- This system also demonstrated versatility for engineering different cell therapy constructs such as canonical CAR, bi-specific CAR, kill switch CAR and synthetic TCR; and for CAR delivery into various immune cells including T cell, natural killer cells, myeloid cells and induced pluripotent stem cells.
- the targeting CD22-specific CAR-T cells generated by the MAJESTIC system have potency comparable to cells generated by other methods in cancer cell killing.
- the MAJESTIC method is simple, which potentiates large-scale manufacturing, and modular, which enables sophisticated genomic (e.g., T-cell) targeting.
- the MAJESTIC system is readily scalable to high-dimensional CAR-T engineering, such as versatility for engineering different cell therapy constructs such as canonical CAR, bi-specific CAR, kill switch CAR and synthetic T cell receptor (TCR), and for therapeutic cell engineering of various immune cell types including T cell, natural killer (NK) cell and cells in the myeloid lineage (Labanieh, ei al., Nature Biomedical Engineering 2:377 (2018)).
- the MAJESTIC system combines both. Delivery of the transposase enzyme is mediated by the transient expression following electroporation of cells with transposase mRNA, and delivery of the transposon is mediated by stable AAV transduction. This system therefore reduces the potentially unwanted continuous expression of transposase enzyme, while maintaining the need for stable presence of the CAR.
- the simple design of CAR via the MAJESTIC system does not sacrifice other features; rather, it improves CAR stability, transgene expression, effector function, and cancer cell killing ability, while reducing cytotoxicity.
- the comparative study described in the Examples showed that, when tested in standard laboratory settings, alone and side-by-side with conventional gene delivery systems, such as lentiviral vector or DNA transposon electroporation, measuring transduction efficiency, cell viability, therapeutic cell yield, and stable transgene expression, the MAJESTIC system was much more efficient in generating viable and stable CAR-T cells than lentiviral or DNA transposon electroporation approaches.
- transposon or “transposable element” means a nucleic acid sequence, such as a chromosomal segment, that can undergo “transposition”, i.e., to change its position within a genome, especially a segment of DNA encoding one or more genes that can be translocated within a host cell, sometimes creating or reversing mutations and altering the cell's genetic identity and genome size.
- exemplary transpositions include introduction of one or more components of plasmid DNA into chromosomal DNA in the absence of a complementary sequence in the host DNA.
- transposase means an enzyme that binds to the end of a transposon and catalyses its movement, e.g., into a genome at a specific point part, by a cut and paste mechanism or a replicative transposition mechanism.
- “Introduce” in the context of genome modification refers to bringing in to contact.
- to introduce a gene editing composition to a cell is to provide contact between the cell and the composition.
- the term encompasses penetration of the contacted composition to the interior of the cell by any suitable means, e.g., via transfection, electroporation, transduction, gene gun, nanoparticle delivery, etc.
- “Homologous” refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules. When a position in both of two compared sequences is occupied by the same base or amino acid monomer subunit, e.g., if a position in each of two DNA molecules is occupied by adenine, then the molecules are homologous at that position. The percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared X 100. For example, if 6 of 10 of the positions in two sequences are matched or are homologous, then the two sequences are 60% homologous. By way of example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, a comparison is made when two sequences are aligned to give maximum homology.
- operably linked refers to functional linkage between a regulatory sequence (e.g., promoter, enhancer, silencer, poly adenylation signal, 5’ or 3’ untranslated region (UTR), splice acceptor, IRES, triple helix, 2A self- cleaving peptides such as F2A, E2A, P2A and T2A) and a heterologous nucleic acid sequence permitting them to function in their intended manner (e.g., resulting in expression of the latter).
- a regulatory sequence e.g., promoter, enhancer, silencer, poly adenylation signal, 5’ or 3’ untranslated region (UTR), splice acceptor, IRES, triple helix, 2A self- cleaving peptides such as F2A, E2A, P2A and T2A
- a heterologous nucleic acid sequence permitting them to function in their intended manner (e.g., resulting in expression of the latter).
- the term encompasses positioning of a regulatory region (sequence), a sequence to be transcribed, and/or a sequence to be translated in a nucleic acid so as to influence transcription or translation of such a sequence.
- the regulatory sequence can be positioned at any suitable distance from the sequence being regulated (e.g., 1 nucleotide - 10,000 nucleotides).
- the translation initiation site of the translational reading frame of the polypeptide is typically positioned between one and about fifty nucleotides downstream of the promoter.
- a promoter can, however, be positioned as much as about 5,000 nucleotides upstream of the translation initiation site or about 2,000 nucleotides upstream of the transcription start site.
- a promoter typically includes at least a core (basal) promoter.
- Endogenous refers to any material from or produced inside an organism, cell, tissue or system. “Exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.
- antigen as used herein is defined as a molecule capable of being bound by an antibody or T-cell receptor.
- An antigen can additionally be capable of provoking an immune response. This immune response can involve either antibody production, or the activation of specific immunologically competent cells, or both.
- any macromolecule including virtually all proteins or peptides, can serve as an antigen.
- antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which includes a nucleotide sequence or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein.
- an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readily apparent that the disclosed compositions and methods includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
- cancer antigen refers to an antigenic substance that is produced in a tumor cell, which can therefore trigger an immune response in the host.
- cancer antigens can be useful as markers for identifying a tumor cell, which could be a potential candidate/target during treatment or therapy.
- TSA tumor specific antigens
- TAA tumor associated antigens
- the chimeric antigen receptors are specific for tumor specific antigens. In some forms, the chimeric antigen receptors are specific for tumor associated antigens.
- the chimeric antigen receptors are specific both for one or more tumor specific antigens and one or more tumor associated antigens.
- “Bi-specific chimeric antigen receptor” refers to a CAR that includes two domains, wherein the first domain is specific for a first ligand/antigen/target, and wherein the second domain is specific for a second ligand/antigen/target.
- the ligand is a B-cell specific protein, a tumor- specific ligand/antigen/target, a tumor associated ligand/antigen/target, or combinations thereof.
- a bispecific CAR is specific to two different antigens.
- a multi- specific or multivalent CAR is specific to more than one different antigen, e.g., 2, 3, 4, 5, or more.
- a multi-specific or multivalent CAR targets and/or binds three or more different antigens.
- Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
- a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
- Both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
- locus is the specific physical location of a DNA sequence e.g., of a gene) on a chromosome. It is understood that a locus of interest can not only qualify a nucleic acid sequence that exists in the main body of genetic material (i.e., in a chromosome) of a cell but also a portion of genetic material that can exist independently to said main body of genetic material such as plasmids, episomes, virus, transposons or in organelles such as mitochondria as non-limiting examples.
- isolated means altered or removed from the natural state.
- a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.”
- An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
- isolated nucleic acid refers to a nucleic acid segment or fragment which has been separated from sequences which flank it in a naturally occurring state, e.g., a DNA fragment which has been removed from the sequences which are normally adjacent to the fragment, i.e., the sequences adjacent to the fragment in a genome in which it naturally occurs.
- the term also applies to nucleic acids which have been substantially purified from other components which naturally accompany the nucleic acid, e.g., RNA or DNA or proteins, which naturally accompany it in the cell.
- the term therefore includes, for example, a recombinant DNA which is incorporated into a vector, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule i.e., as a cDNA or a genomic or cDNA fragment produced by PCR or restriction enzyme digestion) independent of other sequences.
- a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence, complementary DNA (cDNA), linear or circular oligomers or polymers of natural and/or modified monomers or linkages, including deoxyribonucleosides, ribonucleosides, substituted and alpha- anomeric forms thereof, peptide nucleic acids (PNA), locked nucleic acids (LN A), phosphorothioate, methylphosphonate, and the like.
- cDNA complementary DNA
- PNA peptide nucleic acids
- LN A locked nucleic acids
- isolated also refers to a cell altered or removed from its natural state. That is, the cell is in an environment different from that in which the cell naturally occurs, e.g., separated from its natural milieu such as by concentrating to a concentration at which it is not found in nature. “Isolated cell” is meant to include cells that are within samples that are substantially enriched for the cell of interest and/or in which the cell of interest is partially or substantially purified.
- transformed As used herein, “transformed,” “transduced,” and “transfected” encompass the introduction of a nucleic acid or other material into a cell by one of a number of techniques known in the art.
- a “vector” is a composition of matter which includes an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell.
- vectors include but are not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses.
- the term “vector” encompasses an autonomously replicating plasmid or a virus.
- the term is also construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like.
- tumor burden refers to the number of cancer cells, the size or mass of a tumor, or the total amount of tumor/cancer in a particular region of a subject. Methods of determining tumor burden for different contexts are known in the art, and the appropriate method can be selected by the skilled person. For example, in some forms tumor burden can be assessed using guidelines provided in the Response Evaluation Criteria in Solid Tumors (RECIST).
- RECIST Response Evaluation Criteria in Solid Tumors
- subject includes, but is not limited to, animals, plants, parasites and any other organism or entity.
- the subject can be a vertebrate, more specifically a mammal (e.g., a human, horse, pig, rabbit, dog, sheep, goat, non-human primate, cow, cat, guinea pig or rodent), a fish, a bird or a reptile or an amphibian.
- the subject can be an invertebrate, more specifically an arthropod (e.g., insects and crustaceans).
- the term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.
- a patient refers to a subject afflicted with a disease or disorder.
- patient includes human and veterinary subjects.
- the subject can be any organism in which the disclosed method can be used to genetically modify the organism or cells of the organism.
- inhibitor or other forms of the word such as “inhibiting” or “inhibition” means to decrease, hinder or restrain a particular characteristic such as an activity, response, condition, disease, or other biological parameter. It is understood that this is typically in relation to some standard or expected value, it is relative, but that it is not always necessary for the standard or relative value to be referred to. “Inhibits” can also mean to hinder or restrain the synthesis, expression or function of a protein relative to a standard or control. Inhibition can include, but is not limited to, the complete ablation of the activity, response, condition, or disease.
- “Inhibits” can also include, for example, a 10% reduction in the activity, response, condition, disease, or other biological parameter as compared to the native or control level.
- the reduction can be about I, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51,
- inhibitors expression means hindering, interfering with or restraining the expression and/or activity of the gene/gene product pathway relative to a standard or a control.
- Treatment means to administer a composition to a subject or a system with an undesired condition (e.g. , cancer).
- the condition can include one or more symptoms of a disease, pathological state, or disorder.
- Treatment includes medical management of a subject with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder.
- active treatment that is, treatment directed specifically toward the improvement of a disease, pathological state, or disorder
- causal treatment that is, treatment directed toward removal of the cause of the associated disease, pathological state, or disorder.
- this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological state, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological state, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological state, or disorder.
- palliative treatment that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological state, or disorder
- preventative treatment that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological state, or disorder
- supportive treatment that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological state, or disorder.
- Such measurements and assessments can be made in qualitative and/or quantitative terms.
- characteristics or features of a disease, pathological condition, or disorder and/or symptoms of a disease, pathological condition, or disorder can be reduced to any effect or to any amount.
- “Prevention” or “preventing” means to administer a composition to a subject or a system at risk for an undesired condition (e.g., cancer).
- the condition can include one or more symptoms of a disease, pathological state, or disorder.
- the condition can also be a predisposition to the disease, pathological state, or disorder.
- the effect of the administration of the composition to the subject can be the cessation of a particular symptom of a condition, a reduction or prevention of the symptoms of a condition, a reduction in the severity of the condition, the complete ablation of the condition, a stabilization or delay of the development or progression of a particular event or characteristic, or reduction of the chances that a particular event or characteristic will occur.
- the terms “effective amount” or “therapeutically effective amount” means a quantity sufficient to alleviate or ameliorate one or more symptoms of a disorder, disease, or condition being treated, or to otherwise provide a desired pharmacologic and/or physiological effect. Such amelioration only requires a reduction or alteration, not necessarily elimination. The precise quantity will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, weight, etc.), the disease or disorder being treated, as well as the route of administration, and the pharmacokinetics and pharmacodynamics of the agent being administered.
- subject-dependent variables e.g., age, immune system health, weight, etc.
- the disease or disorder being treated as well as the route of administration, and the pharmacokinetics and pharmacodynamics of the agent being administered.
- pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material can be administered to a subject along with the selected compound without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
- variants refers to a polypeptide or polynucleotide that differs from a reference polypeptide or polynucleotide, but retains essential properties e.g., functional or biological activity).
- a typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical.
- a variant and reference polypeptide may differ in amino acid sequence by one or more modifications (e.g., substitutions, additions, and/or deletions).
- a substituted or inserted amino acid residue may or may not be one encoded by the genetic code.
- a variant of a polypeptide may be naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Modifications and changes can be made in the structure of the polypeptides of the disclosure and still obtain a molecule having similar characteristics as the polypeptide (e.g., a conservative amino acid substitution). For example, certain amino acids can be substituted for other amino acids in a sequence without appreciable loss of activity. Because it is the interactive capacity and nature of a polypeptide that defines that polypeptide’s biological or functional activity, certain amino acid sequence substitutions can be made in a polypeptide sequence and nevertheless obtain a polypeptide with like properties (e.g., functional or biological activity). Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein.
- compositions for genetic modification of cells include a nucleic acid sequence configured to include a transposon, a viral vector, such as an Adeno-associated virus (AAV) vector, and mRNA encoding a transposase enzyme configured to integrate the transposon into a host cell genome.
- the transposon includes nucleic acids encoding one or more genes of interest for insertion at a pre-determined site within a target cell.
- the compositions also include target cells, such as viable cells obtained from a subject, and apparatus for performing genetic manipulation of the target cell using the MAJESTIC system.
- compositions are configured to modify the genome of living cells ex vivo when combined according to the disclosed methods for genetic modification of cells. Therefore, in some forms, the compositions are gene editing compositions for use in methods of modifying the genome of a cell. Pharmaceutical compositions containing the modified cells are also provided. As another example, pharmaceutical compositions for use in methods of treating a subject having a disease, disorder, or condition are disclosed. In exemplary forms, the compositions are configured to modify the antigen-recognition function of living immune cells ex vivo (e.g. , to produce CAR T cells) for use in methods of treating a subject having a disease, disorder, or condition associated with an elevated expression or specific expression of an antigen. In some exemplary forms, the compositions are configured to produce CAR T cells that selectively target antigen exhibiting an elevated expression or specific expression in a disease, disorder, or condition.
- Gene editing compositions for use in methods of modifying the genome of a cell are disclosed.
- Exemplary gene editing compositions for modifying the genome of a cell include a viral vector (e.g. , AAV) containing a transposon including a sequence that encodes one or more genes of interest (e.g., a CAR), and mRNA encoding a transposase enzyme capable of directing the insertion of the transposon to one or more chromosomal locations within a target cell.
- a viral vector e.g. , AAV
- a transposon including a sequence that encodes one or more genes of interest (e.g., a CAR)
- mRNA encoding a transposase enzyme capable of directing the insertion of the transposon to one or more chromosomal locations within a target cell.
- the viral vector (e.g., AAV) including the transposon and the mRNA encoding the transposase are typically in different compositions and are typically configured to be introduced to the same target cell.
- a viral vector (e.g. , AAV) containing a transposon including a sequence that encodes one or more genes of interest and the mRNA encoding a transposase can be provided in different compositions that are introduced to the cell together or separately.
- the cells after introduction of the mRNA encoding the transposase, the cells can be introduced with the viral vector (e.g., AAV) containing a transposon including a sequence that encodes one or more genes of interest either immediately, or after a certain period of time such as, about Ih, about 2h, about 3h, about 4h, about 5h, about 6h, about 7h, about 8h, about 9h, about lOh, about 12h, about 24h, about 48h, about 72h, or about 96h.
- the viral vector e.g., AAV
- AAV a transposon including a sequence that encodes one or more genes of interest either immediately, or after a certain period of time such as, about Ih, about 2h, about 3h, about 4h, about 5h, about 6h, about 7h, about 8h, about 9h, about lOh, about 12h, about 24h, about 48h, about 72h, or about 96h.
- compositions including (i) viral vector (e.g., AAV) containing a transposon including a sequence that encodes one or more genes of interest; and (ii) mRNA encoding a transposase enzyme can introduce, induce or otherwise mediate (increase or reduce expression and/or activity) of the one or more genes of interest (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more genes of interest) within a target cell.
- viral vector e.g., AAV
- mRNA encoding a transposase enzyme can introduce, induce or otherwise mediate (increase or reduce expression and/or activity) of the one or more genes of interest (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more genes of interest) within a target cell.
- the combined viral vector e.g., AAV
- a transposon including a sequence that encodes one or more exogenous genes (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) and mRNA encoding transposase can induce expression of the one or more exogenous genes in a target cell.
- exogenous genes e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
- mRNA encoding transposase can induce expression of the one or more exogenous genes in a target cell.
- the combined viral vector e.g., AAV
- a transposon including a sequence that encodes one or more exogenous genes e.g., I, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
- mRNA encoding transposase causes disruption of one or more chromosomal genes within the target cell, for example, including alterations in the genome (such as, but not limited to, insertions, deletions, translocations, DNA or histone methylation, acetylation, and combinations thereof), resulting in reduced or abolished expression and/or activity of one or more chromosomal gene and/or gene product in the target cell.
- Methods of determining the expression and/or activity of a gene product are known in the art.
- PCR northern blot
- southern blot western blot
- nuclease surveyor assays sequencing, ELISA, FACS, mRNA-SEQ, single-cell RNA-SEQ, and other molecular biology, chemical, biochemical, cell biology, and immunology assays.
- the viral vector e.g., AAV
- the viral vector containing a transposon including a sequence that encodes one or more genes of interest can be introduced to the target cell through incubation with the cell.
- the mRNA encoding the transposase enzyme can be introduced to the target cell through non- viral approaches such as physical and/or chemical methods, including via cationic liposomes and polymers, DNA nanoclew, gene gun, microinjection, electroporation, nucleofection, particle bombardment, ultrasound utilization, magnetofection, and conjugation to cell penetrating peptides.
- non- viral approaches such as physical and/or chemical methods, including via cationic liposomes and polymers, DNA nanoclew, gene gun, microinjection, electroporation, nucleofection, particle bombardment, ultrasound utilization, magnetofection, and conjugation to cell penetrating peptides.
- Such methods are described for example, in Nayerossadat N., et al., Adv. Bio
- mRNA encoding transposase enzyme is introduced to the target cell by electroporation.
- the electroporation of the target cell can be carried out before or after induction of the same target cell with the viral vector including the transposon.
- the viral vector including the transposase enzyme is an Adeno-associated virus (AAV) vector.
- compositions include a nucleic acid Transposon.
- Transposons translocate from one DNA site to another in a simple, cut-and-paste manner. Transposition is a precise process in which a defined DNA segment is excised from one DNA molecule and moved to another site in the same or different DNA molecule or genome.
- the transposon includes one or more inverted repeats (ITR ) that mediate integration into the genome of a host cell, and nucleic acid sequences placed between the ITRs that typically include internal repeats (IR)/direct repeats (DR), a promoter, one or more genes of interest, a Poly A region, and a terminator, internal repeats (IR)/direct repeats (DR).
- ITR inverted repeats
- Translocation of transposon requires specific binding of SB transposase to inverted terminal repeats (ITRs) (e.g., about 230 bp) at each end of the transposon, which is followed by a cut-and-paste transfer of the transposon into a target DNA sequence.
- ITRs inverted terminal repeats
- the ITRs contain two imperfect direct repeats (DRs) of about 32 bp.
- the outer DRs are at the extreme ends of the transposon whereas the inner DRs are located inside the transposon, 165-166 bp from the outer DRs.
- At least two DRs are required in each ITR for transposition.
- Each DR appears to have a distinctive role in transposition. Therefore, in some forms, the DRs of a transposase are not interchangeable for efficient transposition.
- the spacing and sequence between the DR elements in an ITR affect transposition rates.
- Transposons are flanked by TA dinucleotide base-pairs that are important for excision. Therefore, in some forms, elimination of the TA motif on one side of the transposon significantly reduces transposition while loss of TAs on both flanks of the transposon abolishes transposition.
- Exemplary transposons include members of the Tcl/mariner superfamily, such as mariner and Sleeping Beauty (SB) transposons.
- the regulation including the strategy to enforce a synapsis of the transposon ends, as well as the requirement for such a synapsis, also varies among recombinases. While mariners have short ITRs with one transposon binding site at each transposon end (Rosenzweig B, et al., 1983. Nucleic Acids Res, 11: 4201-9; Tosi LR and Beverley SM, 2000.
- Sleeping Beauty belongs to the indirect repeat/direct repeat (IR/DR) subfamily of transposons, possessing two transposase binding sites (represented by direct repeats) at each transposon ends (Franz G and Savakis C, 1991. Nucleic Acids Res, 19: 6646; Izsvak, etal., 1995. Mol Gen Genet. 247: 312-22; Ivies, et al., 1997. Cell, 91: 501-10; Miskey, et al., 2003. Nucleic Acids Res, 31: 6873-81; Plasterk, et al., 1999. Trends Genet, 15: 326-32).
- IR/DR indirect repeat/direct repeat
- a preferred transposon is the sleeping beauty (SB) transposon.
- the Sleeping Beauty transposon system is composed of a Sleeping Beauty (SB) transposase and a transposon that was designed in 1997 to insert specific sequences of DNA into genomes of vertebrate animals.
- SB transposition is a cut-and-paste process, during which the transposable element is excised from its original location by the transposase and is integrated into a new location.
- the transposition process can arbitrarily be divided into at least four major steps: (1) binding of the transposase to its sites within the transposon IRs; (2) formation of a synaptic complex in which the two ends of the elements are paired and held together by transposase subunits; (3) excision from the donor site; and (4) reintegration at a target site.
- the cargo nucleic acid within the SB transposon includes one or more genes of interest having a combined size of 10,000 base pairs (bp), or less than 10,000 bp, such as between about 100 bp and 5,000 bp, inclusive, or between about 500 bp and about 2000 bp.
- SB transposons are known in the art (see, e.g., WO 98/40510, US 8,227,432 , Cui, et al., 2002. Structure-function analysis of the inverted terminal repeats of the Sleeping Beauty transposon". J. Mol. Biol. 318 (5): 1221-1235; Izsvak, et al. 2000. Sleeping Beauty, a wide host-range transposon vector for genetic transformation in vertebrates. J. Mol. Biol. 302 (1): 93-102).
- plasmids containing Sleeping Beauty transposons are designated pT (web page addgene.org/26555/sequences/#depositor-partial), pT2 (web page addgene.org/26557/sequences/#depositor-full) or pT3 (Yant, et al. Mutational analysis of the N-terminal DNA-binding domain of sleeping beauty transposase: critical residues for DNA binding and hyperactivity in mammalian cells. Mol Cell Biol. 2004 Oct;24(20):9239-47.)
- the transposon is a polynucleotide including a SB transposon including a cargo nucleic acid flanked by left and right inverted terminal repeats (ITR ) and left and right inverted repeat/direct repeat (IR/DR) sequences.
- the left IR contains an additional a motif (HDR) that acts as an enhancer in SB transposition (Izsvak, et al., 2002. J Biol Chem, 277: 34581 -8.)
- the IR/DR is an absolute requirement of SB transposition (Izsvak, et al. , 2000. J Mol Biol, 302: 93-102.).
- the SB transposon nucleic acid sequence is configured such that the transposon is capable of being mobilized by a Sleeping Beauty transposase protein, i.e., having a left IR/DR including an outer left DR motif and an inner left DR motif, and a right IR/DR including an outer right DR motif and an inner right DR motif, where the IR/DRs each contain binding sites for the SB transposase.
- a Sleeping Beauty transposase protein i.e., having a left IR/DR including an outer left DR motif and an inner left DR motif, and a right IR/DR including an outer right DR motif and an inner right DR motif, where the IR/DRs each contain binding sites for the SB transposase.
- the SB IR/DR (Left hand) motif has a nucleic acid sequence of cagttgaagtcggaagtttacatacacttaagttggagtcattaaaactcgtttttcaa ctactccacaaatttcttgttaacaaacaatagttttggcaagtcagttaggacatcta ctttgtgcatgacacaagtcattttttccaacaattgtttacagacagattatttcactt ataattcactgtatcacaattccagtgggtcagaagttttacatacactaa (SEQ ID NO:27).
- the SB IR/DR (Right hand) motif has a nucleic acid sequence of ttgagtgtatgtaaacttctgacccactgggaatgtgatgaaagaaataaaagctgaaa tgaatcattct ctctactattattctgatatttcacattcttaaaataaagtggtgatc ctaactgacctaagacagggaatttttactaggattaaatgtcaggaattgtgaaaaag tgagtttaaat gtattggctaaggtgtatgtaaactt ccgacttcaactg (SEQ ID NO:28).
- the SB ITR (Left hand) motif has a nucleic acid sequence of cctgcaggcagctgcgcgctcgctcactgaggccgcccgggcaaagcccgggcgt cgggcgacctttggtcgcccggcctcagtgagcgagcgcgcagagagggagtggc caactccatcactaggggttcct (SEQ ID NO:29).
- the SB ITR (Right hand) motif has a nucleic acid sequence of aggaacccctagtgatggagttggccactccctctgcgcgctcgctcactgag gccgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcga gcgcgcagctgcctgcagg (SEQ ID NO:30).
- the transposon integrates into the host cell genome at a known or pre-determined location.
- the nucleic acid sequence formed upon integration of the transposon into the genome include any of the following: GATACAGTGCACATGTGGTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:1) ATCTCAAAATAGTAAATGCTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:2) AGGTGACTGATACCAAAAATACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:3) ATAGTACAAAGAGTTCTCATATACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:4) AGACAGACCTACAAAGAATATACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:5) GCAAACCAAAATGGCACATGTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:6) TATTATCAATAGCACCTAATCTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:7) AAATTTCTAGAAAAGGGTTGGTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:8) AATGATTATGGCATTCATATA
- the transposon includes cargo nucleic acid sequence(s) that is located between the ITR sites in the transposon.
- the nucleic acid cargo typically includes genes of interest that are to be integrated into the host cell genome.
- the cargo nucleic acid typically includes one or more of a promoter, one or more genes of interest and one or more terminators. i. Gene of Interest
- the nucleic acid cargo includes one or more genes of interest.
- the gene(s) of interest include nucleic acid sequences configured to express one or more gene expression products within the host cell.
- a gene of interest is an endogenous or exogenous gene, whose presence or expression within the host cell is desired.
- a gene of interest is a synthetic gene.
- An exemplary synthetic gene is a gene encoding an engineered polypeptide.
- the one or more genes of interest within the transposon is codon optimized for expression in a target cell, such as a eukaryotic cell.
- a target cell such as a eukaryotic cell.
- the eukaryotic cell is, or is derived from a particular organism, such as a plant or a mammal, including but not limited to human, or non-human eukaryote or animal or mammal, e.g., mouse, rat, rabbit, dog, livestock, or non-human mammal or primate. Codon- optimization describes gene engineering approaches that use changes of rare codons to synonymous codons that are more frequently used in the cell type of interest with the aim of increasing protein production.
- codon optimization involves modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g., about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence.
- codons e.g., about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons
- genes are tailored for optimal gene expression in a given target cell based on codon optimization. Codon usage tables are readily available, for example, at the “Codon Usage Database” available at web page kazusa.orjp/codon/ and these tables can be adapted in a number of ways.
- one or more codons in a sequence encoding a gene of interest corresponds to the most frequently used codon for a particular amino acid.
- An exemplary engineered poly peptide is a chimeric antigen receptor (CAR).
- the gene of interest is a Chimeric Antigen Receptor (CAR).
- CAR Chimeric Antigen Receptor
- Immunotherapy using T cells genetically engineered to express a chimeric antigen receptor (CAR) is rapidly emerging as a promising new treatment for haematological and non-haematological malignancies.
- CARs are engineered receptors that possess both antigen-binding and T-cell-activating functions. Based on the location of the CAR in the membrane of the cell, the CAR can be divided into three main distinct domains, including an extracellular antigen-binding domain, followed by a space region, a transmembrane domain, and the intracellular signaling domain.
- the antigen-binding domain typically contains VH and VL chains that are joined up by a linker to form the so-called “scFv.”
- the segment interposing between the antigen-binding domain (e.g., scFv) and the transmembrane domain is a “spacer domain.”
- the spacer domain can include the constant IgGl hinge-CH2-CH3 Fc domain.
- the spacer domain and the transmembrane domain are derived from CD8.
- the intracellular signaling domains mediating T cell activation can include a CD3 ⁇ co-receptor signaling domain derived from C-region of the TCR ⁇ and ⁇ chains and one or more costimulatory domains.
- the antigen-binding domain is derived from an antibody.
- antibody herein refers to natural or synthetic polypeptides that bind a target antigen.
- the term includes polyclonal and monoclonal antibodies, including intact antibodies and functional (e.g., antigen-binding) antibody fragments, including Fab fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rlgG) fragments, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments.
- the term encompasses genetically engineered and/or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, tandem tri-scFv.
- immunoglobulins such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di-scFv, tandem tri-scFv.
- the term also encompasses intact or full-length antibodies, including antibodies of any class or subclass, including IgG and sub-classes thereof, IgM, IgE, IgA, and IgD.
- the antigen- binding domain of a CAR can contain complementary determining regions (CDR) of an antibody, variable regions of an antibody, and/or antigen binding fragments thereof.
- CDR complementary determining regions
- the antigen-binding domain for a CD 19 CAR can be derived from a human monoclonal antibody to CD19, such as those described in U.S. Patent 7,109,304, for use in accordance with the disclosed compositions and methods.
- the antigen- binding domain can include an F(ab')2, Fab', Fab, Fv or scFv.
- the CAR includes one or more spacer domain(s) (also referred to as hinge domain) that is located between the extracellular antigen-binding domain and the transmembrane domain.
- a spacer domain is an amino acid segment that is generally found between two domains of a protein and may allow for flexibility of the protein and movement of one or both of the domains relative to one another. Any amino acid sequence that provides such flexibility and movement of the extracellular antigen- binding domain relative to the transmembrane domain can be used.
- the spacer domain can be a spacer or hinge domain of a naturally occurring protein.
- the hinge domain is derived from CD 8 a, such as, a portion of the hinge domain of CD 8 a, e.g., a fragment containing at least 5 (e.g., 5, 10, 15, 20, 25, 30, 35, or 40) consecutive amino acids of the hinge domain of CD8a.
- Hinge domains of antibodies such as an IgG, IgA, IgM, IgE, or IgD antibodies can also be used.
- the hinge domain is the hinge domain that joins the constant CHI and CH2 domains of an antibody.
- Non-naturally occurring peptides may also be used as spacer domains.
- the spacer domain can be a peptide linker, such as a (GxS)n linker, wherein x and n, independently can be an integer of 3 or more, including 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more.
- the CAR includes a transmembrane domain that can be directly or indirectly fused to the antigen-binding domain.
- the transmembrane domain may be derived either from a natural or a synthetic source.
- a “transmembrane domain” refers to any protein structure that is thermodynamically stable in a cell membrane, preferably a eukaryotic cell membrane.
- the transmembrane domain of the CAR includes a transmembrane domain of an alpha, beta or zeta chain of a T-cell receptor, CD8, CD4, CD28, CD137, CD80, CD86, CD152 or PD1, or a portion thereof.
- Transmembrane domains can also contain at least a portion of a synthetic, non-naturally occurring protein segment.
- the transmembrane domain is a synthetic, non-naturally occurring alpha helix or beta sheet.
- the protein segment is at least about 15 amino acids, e.g., at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids. Examples of synthetic transmembrane domains are known in the art, for example in U.S. Patent No. 7,052,906 and PCT Publication No. WO 2000/032776.
- the intracellular signaling domain is responsible for activation of at least one of the normal effector functions of the immune effector cell expressing the CAR.
- effector function refers to a specialized function of a cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines.
- an intracellular signaling domain includes the zeta chain of the T cell receptor or any of its homologs (e.g., eta, delta, gamma or epsilon), MB1 chain, B29, Fc RIII, Fc RI and combinations of signaling molecules such as CD3 ⁇ and CD28, 4-1BB, 0X40 and combination thereof, as well as other similar molecules and fragments.
- Intracellular signaling portions of other members of the families of activating proteins can be used, such as FcyRIII and FcaRI.
- the CAR includes at least one co-stimulatory signaling domain.
- co-stimulatory signaling domain refers to at least a portion of a protein that mediates signal transduction within a cell to induce an immune response such as an effector function.
- the co-stimulatory signaling domain can be a cytoplasmic signaling domain from a co-stimulatory protein, which transduces a signal and modulates responses mediated by immune cells, such as T cells, NK cells, macrophages, neutrophils, or eosinophils.
- the co-stimulatory signaling domain is derived from a co-stimulatory molecule selected from CD27, CD28, CD137, 0X40, CD30, CD40, CD3, LFA-1, ICOS, CD2, CD7, LIGHT, NKG2C, B7-H3, ligands of CD83 and combinations thereof.
- CARs can be used in order to generate immuno-responsive cells, such as T cells, specific for selected targets, such as malignant cells, with a wide variety of receptor chimera constructs having been described (see U.S. Patent Nos. 5,843,728; 5,851,828; 5,912,170; 6,004,811; 6,284,240; 6,392,013; 6,410,014; 6,753,162; 8,211,422; and PCT Publication WO 9215322).
- Alternative CAR constructs can be characterized as belonging to successive generations.
- First-generation CARs typically include a single- chain variable fragment of an antibody specific for an antigen, for example including a VL linked to a VH of a specific antibody, linked by a flexible linker, for example by a CD8a hinge domain and a CD8a transmembrane domain, to the transmembrane and intracellular signaling domains of either CD3 ⁇ or FcR ⁇ (scFv- CD3 ⁇ or scFv- FcR ⁇ ; see U.S. Patent No. 7,741,465; U.S. Patent No. 5,912,172; U.S. Patent No. 5,906,936).
- Second-generation CARs incorporate the intracellular domains of one or more costimulatory molecules, such as CD28, 0X40 (CD134), or 4-1BB (CD137) within the endodomain (for example scFv-CD28/OX40/4-lBB-CD3 ⁇ ; see U.S. Patent Nos.8, 911, 993; 8,916,381; 8,975,071; 9,101,584; 9,102,760; 9,102,761).
- Third- generation CARs include a combination of costimulatory endodomains, such a CD3 ⁇ -chain, CD97, GDI la-CD18, CD2, ICOS, CD27, CD154, CDS, 0X40, 4-1BB, or CD28 signaling domains (for example scFv-CD28-4-lBB-CD3 ⁇ or scFv-CD28-OX40- CD3 ⁇ ; see U.S. Patent No.8,906,682; U.S. Patent No.8,399,645; U.S. Pat. No. 5,686,281; PCT Publication No. WO2014134165; PCT Publication No. WO2012079000).
- costimulatory endodomains such as CD3 ⁇ -chain, CD97, GDI la-CD18, CD2, ICOS, CD27, CD154, CDS, 0X40, 4-1BB, or CD28 signaling domains (for example scFv-CD28-4-lBB-CD3 ⁇
- co-stimulation can be orchestrated by expressing CARs in antigen- specific T cells, chosen so as to be activated and expanded following engagement of their native ⁇ TCR, for example by antigen on professional antigen-presenting cells, with attendant co-stimulation.
- antigen-specific T cells chosen so as to be activated and expanded following engagement of their native ⁇ TCR, for example by antigen on professional antigen-presenting cells, with attendant co-stimulation.
- Any of the first, second, or third generation CARs described above can be used in accordance with the disclosed compositions and methods.
- the gene of interest within a transposon encodes a CAR targeting one or more antigens specific for cancer, an inflammatory disease, a neuronal disorder, HIV/AIDS, diabetes, a cardiovascular disease, an infectious disease, an autoimmune disease, or combinations thereof.
- a CAR targeting one or more antigens specific for cancer an inflammatory disease, a neuronal disorder, HIV/AIDS, diabetes, a cardiovascular disease, an infectious disease, an autoimmune disease, or combinations thereof.
- Exemplary antigens specific for cancer that could be targeted by the CAR include, but are not limited to, 4-1BB, 5T4, adenocarcinoma antigen, alpha-fetoprotein, BAFF, B-lymphoma cell, C242 antigen, CA-125, carbonic anhydrase 9 (CA-IX), C-MET, CCR4, CD 152, CD 19, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD28, CD30 (TNFRSF8), CD33, CD4, CD40, CD44 v6, CD51, CD52, CD56, CD74, CD80, CEA, CNT0888, CTLA-4, DR5, EGFR, EpCAM, CD3, FAP, fibronectin extra domain-B, folate receptor 1, GD2, GD3 ganglioside, glycoprotein 75, GPNMB, HER2/neu, HGF, human scatter factor receptor kinase, IGF-1 receptor, IGF-I, IgGl, Ll-CAM
- the CAR targets CD19, CD22, or both CD19 and CD22.
- Exemplary antigens specific for an inflammatory disease that could be targeted by the CAR include, but are not limited to, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD 125, CD 147 (basigin), CD 154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (a chain of IL-2 receptor), CD3, CD4, CD5, IFN-a, IFN-y, IgE, IgE Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin a4, integrin ⁇ 4 ⁇ 7, Lama glama, LFA-1 (CD Ila), MEDI-528, myostatin, OX-40, rhuMAb ⁇ 7, scleroscin, SOST, TGF beta 1, TNF-a, VEGF-A, and combinations
- Exemplary antigens specific for a neuronal disorder that could be targeted by the CAR include, but are not limited to, beta amyloid, MABT5102A, and combinations thereof.
- Exemplary antigens specific for diabetes that could be targeted by the CAR include, but are not limited to, L-I P, CD3, and combinations thereof.
- Exemplary antigens specific for a cardiovascular disease that could be targeted by the CAR include, but are not limited to, C5, cardiac myosin, CD41 (integrin alpha- lib), fibrin II, beta chain, ITGB2 (CD 18), sphingosine- 1 -phosphate, and combinations thereof.
- Exemplary antigens specific for an infectious disease that could be targeted by the CAR include, but are not limited to, anthrax toxin, CCR5, CD4, clumping factor A, cytomegalovirus, cytomegalovirus glycoprotein B, endotoxin, Escherichia coli, hepatitis B surface antigen, hepatitis B virus, HIV-1, Hsp90, Influenza A hemagglutinin, lipoteichoic acid, Pseudomonas aeruginosa, rabies virus glycoprotein, respiratory syncytial virus, TNF-a, and combinations thereof.
- the CAR targets one or more antigens selected from an antigen listed in Table 1.
- the CAR is an anti-CD22 CAR.
- An exemplary anti-CD22 CAR is CD22BBz, having a nucleic acid sequence:
- the anti-CD22 CAR has an amino acid sequence:
- the CAR is an anti-CD19 CAR (e.g., CD19BBz).
- An exemplary anti-CD19 CAR is CD19BBz.
- An exemplary anti CD19 CAR has a nucleic acid sequence:
- the anti-CD19 CAR has an amino acid sequence:
- An exemplary anti CD20 CAR has a nucleic acid sequence:
- the anti CD20 CAR has an amino acid sequence:
- the CAR is a bispecific CAR, i.e., that selectively binds to more than a single antigen.
- the CAR can be multivalent. Bispecific or multi- specific (multivalent) CARs, e.g., including, but not limited to, CARs described in WO 2014/4011988 and US20150038684, are contemplated for use in the disclosed methods and compositions.
- the CAR is a CD19/CD20 bispecific CAR (CD20.19BBz), having a nucleic acid sequence of (SEQ ID NO:31).
- the anti-CD20/CD19 bi-specific CAR CD20.19BBz has an amino acid sequence:
- the anti-CD20/CD19 bi-specific CAR CD20.19BBz is designed as a construct (AAV-SB-CD19.20.CAR), including the Sleeping Beauty (SB) IR/DR (left) site, EFS promoter, leader sequence, single chain variable domain specific for CD 19 (CD19 scFv) and CD20 scFv CAR sequences joined by a linker to be expressed together as a tandem scFv CAR, CD8 hinge and transmembrane (CD8 TM), 4-1BB, CD3 zeta (CD3z), poly-Adenosine (Poly-A), and Sleeping Beauty (SB) IR/DR (right) site (See, Figure 8A).
- SB Sleeping Beauty
- IR/DR left
- EFS promoter EFS promoter
- leader sequence single chain variable domain specific for CD 19
- an AAV-SB-CD19.20.CAR construct has a nucleic acid sequence:
- a construct is designed to generate conditional control CAR-T cells with two transgenes, e.g., CD22 CAR and a suicide-gene (CD22.CAR.iCasp9).
- a CD22.CAR.iCasp9 construct includes the Sleeping Beauty (SB) IR/DR site (left), EFS promoter, leader sequence, single chain variable domain specific for CD 22 (CD22 scFv), CD8 hinge and transmembrane (CD8 TM), 4-1BB, CD3 zeta (CD3z), T2A site, iCasp9 gene, poly-Adenosine (Poly-A), and the Sleeping Beauty (SB) IR/DR (right) site (See, Figure 9A).
- a CD22.CAR.iCasp9 construct has a nucleic acid sequence:
- a gene of interest includes one or more reporter genes.
- a reporter gene includes any gene that could be used as an indicator of a successful event, e.g., transfection, transduction, and/or recombination. Reporter genes can allow simple identification and/or measurement of such events. Reporter genes can be fused to regulatory sequences or genes of interest to report expression location or levels, or serve as controls, for example, standardizing transfection efficiencies. Reporter genes include genes that code for fluorescent protein and enzymes that convert invisible substrates to luminescent or colored products.
- reporter genes include, but are not limited to, glutathione- S- transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), dTomato, HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins including blue fluorescent protein (BFP).
- GST glutathione- S- transferase
- HRP horseradish peroxidase
- CAT chloramphenicol acetyltransferase
- beta-galactosidase beta-galactosidase
- beta-glucuronidase beta-galactosidase
- luciferase green fluorescent protein
- GFP green fluorescent protein
- dTomato HcRed
- CFP yellow fluorescent protein
- Reporter genes also include selectable markers that confer the ability to grow in the presence of toxic compounds such as antibiotics or herbicides, which would otherwise kill or compromise the cell.
- a selectable marker can also confer a novel ability to utilize a compound, for example, an unusual carbohydrate or amino acid.
- Non-limiting examples of selectable markers include genes that confer resistance to Blasticidin, G418/Geneticin, Hygromycin B, Puromycin, or Zeocin. ii. Promoter
- the nucleic acid cargo includes one or more promoter elements, configured to control expression of the one or more genes of interest upon integration within the host cell genome.
- the nucleic acid cargo includes genes that are to be kept uncontrol of an endogenous promoter (e.g., a promoter at or near the site of integration).
- the transgene can contain a splice acceptor/donor, 2A peptide, and/or internal ribosome entry site (IRES) operationally linked to a gene of interest (e.g., reporter gene, CAR) to allow expression of the transgene in frame with a gene at the site of integration and/or under the control of the promoter at the site of integration.
- a gene of interest e.g., reporter gene, CAR
- the transgene be under the control of an exogenous promoter, such as a constitutive promoter or an inducible promoter.
- the transgene includes a promoter (e.g., EFS or tetracycline-inducible promoter) operationally linked to a gene of interest (e.g., reporter gene, CAR).
- a promoter e.g., EFS or tetracycline-inducible promoter
- the transposon does not contain a promoter operationally linked to the transgene (e.g. , reporter gene, CAR).
- the promoter is a strong, constitutively active promoter for high-level expression of the gene of interest.
- promoters of this type include the CMV (cytomegalovirus) promoter/enhancer, EFla (elongation factor la), SV40 (simian virus 40), chicken ⁇ -actin and CAG (CMV, chicken P-actin, rabbit P-globin).
- a preferred promoter is the EFl alpha, or EFS (its short, intron-less form) promoter.
- EFS is a cellular-derived enhancer/promoter with decreased cross- activation of nearby promoters, therefore hypothetically decreasing the risk of genotoxicity.
- multiple transcription units may be arranged in close proximity in a space-limited vector. All of these promoters provide constitutively active, high-level gene expression in most cell types. Some of these promoters are subject to silencing in certain cell types, therefore this consideration should be evaluated for each application.
- compositions that encode transposase enzymes.
- Compositions of transposase enzyme mRNA that are provided in combination with a transposon are configured to perform transposition of the specific transposase.
- the mRNA encoding transposase enzyme can be modified or unmodified.
- the mRNA is modified to reduce immunogenicity, to optimize translation, and/or to confer increased stability and/or expression of the transposase enzyme.
- the modified mRNA can incorporate several chemical changes to the nucleotides, including changes to the nucleobase, the ribose sugar, and/or the phosphodiester linkage. These modified mRNAs can improve efficiency of the transposase enzyme (i.e., increase transposase enzyme protein levels), reduce cellular toxicity, and/or increase mRNA stability relative to the unmodified mRNA.
- Li, et al., Nat. Biomed. Eng., 1(5): pii: 0066 (2017) and WO 2017/181107 disclose compositions and methods of modifying mRNAs).
- the mRNA encoding transposase enzyme contains modifications such as N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine ( ⁇ ), N1 -methylpseudouridine (me1 ⁇ ), and 5 -methoxy uridine (5moU); a 5’ cap; a poly(A) tail; one or more nuclear localization signals; or combinations thereof.
- modifications such as N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine ( ⁇ ), N1 -methylpseudouridine (me1 ⁇ ), and 5 -methoxy uridine (5moU); a 5’ cap; a poly(A) tail; one or more nuclear localization signals; or combinations thereof.
- the mRNA encoding transposase enzyme is codon optimized for expression in a target cell, such as a eukaryotic cell.
- a target cell such as a eukaryotic cell.
- the eukaryotic cell is, or is derived from a particular organism, such as a plant or a mammal, including but not limited to human, or non-human eukaryote or animal or mammal, e.g., mouse, rat, rabbit, dog, livestock, or non-human mammal or primate. Codon-optimization describes gene engineering approaches that use changes of rare codons to synonymous codons that are more frequently used in the cell type of interest with the aim of increasing protein production.
- codon optimization involves modifying a nucleic acid sequence for enhanced expression in the host cells of interest by replacing at least one codon (e.g., about or more than about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence.
- codon bias differs in codon usage between organisms
- mRNA messenger RNA
- tRNA transfer RNA
- genes are tailored for optimal gene expression in a given organism based on codon optimization.
- Codon usage tables are readily available, for example, at the “Codon Usage Database” available at web page kazusa.orjp/codon/ and these tables can be adapted in a number of ways. See Nakamura, et al., Nucl. Acids Res., 28:292 (2000).
- Computer algorithms for codon optimizing a particular sequence for expression in a particular host cell are also available, such as Gene Forge (Aptagen; Jacobus, PA), are also available.
- Gene Forge Aptagen; Jacobus, PA
- the transposase is a Sleeping Beauty (SB) transposase, configured to transpose the Sleeping Beauty (SB) transposon within a target cell.
- the transposase binding sites of SB elements are repeated twice per IR in a direct orientation (DRs). This special organization of inverted repeat is termed IR/DR and is a strict requirement for transposition.
- Specific binding of SB transposase to the DRs is mediated by an N-terminal, paired-like DNA-binding domain of the transposase that overlaps with a nuclear localization signal.
- An AT-hook motif has also been identified as a functional subdomain contributing to specific DNA binding.
- the catalytic domain of the SB transposase mediates the DNA breakage and integration reactions and is characterized by the DDE signature, an evolutionarily conserved domain also found in some bacterial transposases, retrotransposon/retrovirus integrases, and the RAG1 immunoglobulin gene recombinase.
- the catalytic domains of DDE recombinases have been shown to be also involved in mediating interactions with the target DNA. i. Hyperactive SB Transposase
- the SB transposase is a hyperactive SB transposase.
- Hyperactive transposases have been derived from the original SB transposase by mutagenesis of the catalytic and DNA-binding domains.
- the hyperactive SB transposase is the SB100X transposase.
- the SB100X transposase engineered using a combination of in vitro molecular evolution and selection, is the most active of the transposases generated so far, and was named molecule of the year for 2009 (internet page iscspm.webnode.com/).
- This powerful transposase directs the highest levels of transposon integration yet demonstrated, presumably due to increased stability (Mates, et al. , Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat. Genet. 2009;41:753-761; Grabundzija, et al., Comparative analysis of transposable element vector systems in human cells. Mol. Ther. 2010;18:1200-1209).
- the transposase is the SB100X transposase having a DNA sequence: atgggaaaatcaaaagaaatcagccaagacctcagaaaagaattgtagacctccacaa gtctggttcat ccttgggagcaatttccaaacgcctggcggtaccacgttcatctgtac aaacaatagtacgcaagtataaacaccatgggaccacgcagccgtcataccgctcagga aggagacgcgttctgtcctagagatgaacgtactttggtgcgaaaagtgcaaatcaa t cccagaacaacagcaaaggaccttgtgaggaaacaggtggtggaggaaaggtggtggaggaaaggtggtggaaacaggtaggtacaaa
- transposase enzyme mRNA is prepared by in vitro transcription, for example, from a plasmid including the transposase nucleic acid sequence.
- plasmids including the SB100X nucleic acid sequence include pcDNA3.1, having a nucleic acid sequence
- Gene editing compositions for modifying the genome of a cell include a viral vector.
- the transposon is contained within a viral vector containing a nucleic acid sequence that encodes one or more transposons.
- the viral vector is an adeno-associated viral (AAV) vector.
- AAV adeno-associated viral
- a preferred vector for inclusion in the gene editing compositions or for providing elements of the gene editing compositions is an adeno-associated viral (AAV) vector.
- AAV adeno-associated viral
- AAV is a non-pathogenic, single- stranded DNA virus that has been actively employed for delivering therapeutic genes in both in vitro and in vivo systems (Choi, et al., Curr. Gene Ther., 5:299-310, (2005)).
- AAV is a replication-deficient virus that belongs to the parvovirus family, and is dependent on co-infection with other viruses, mainly adenoviruses, to replicate. Initially distinguished serologically, molecular cloning of AAV genes has identified hundreds of unique AAV strains in numerous species. Each end of the single-stranded DNA genome contains an inverted terminal repeat (ITR), which is the only cis-acting element required for genome replication and packaging.
- ITR inverted terminal repeat
- the single- stranded AAV genome contains three genes, Rep (Replication), Cap (Capsid), and aap (Assembly). These three genes give rise to at least nine gene products through the use of three promoters, alternative translation start sites, and differential splicing. These coding sequences are flanked by the ITRs.
- the Rep gene encodes four proteins (Rep78, Rep68, Rep52, and Rep40), while Cap expression gives rise to the viral capsid proteins (VP; VP1/VP2/VP3), which form the outer capsid shell that protects the viral genome, as well as being actively involved in cell binding and internalization. It is estimated that the viral coat includes 60 proteins, arranged into an icosahedral structure with the capsid proteins in a molar ratio of 1: 1: 10 (VP1 :VP2: VP3).
- Recombinant AAV which lacks viral DNA, is essentially a protein- based nanoparticle engineered to traverse the cell membrane, where it can ultimately traffic and deliver its DNA cargo into the nucleus of a cell.
- ITR-flanked transgenes encoded within rAAV can form circular concatemers that persist as episomes in the nucleus of transduced cells. Because recombinant episomal DNA does not integrate into host genomes, it will eventually be diluted over time as the cell undergoes repeated rounds of replication. This will eventually result in the loss of the transgene and transgene expression, with the rate of transgene loss dependent on the turnover rate of the transduced cell. These characteristics make rAAV ideal for certain gene therapy applications.
- AAV can be advantageous over other viral vectors due to low toxicity (this can be due to the purification method not requiring ultra centrifugation of cell particles that can activate the immune response) and low probability of causing insertional mutagenesis because AAV does not integrate into the host genome (primarily remaining episomal).
- viral vectors include, without limitation, vectors derived from bacteriophages, baculoviruses, retroviruses (such as lentiviruses), adenoviruses, poxviruses, and Epstein-Barr viruses.
- the viral vector is derived from a DNA virus (e.g., dsDNA or ssDNA virus) or an RNA virus (e.g., an ssRNA virus).
- dsDNA or ssDNA virus e.g., an ssRNA virus
- Numerous vectors and expression systems are commercially available from commercial vendors including Addgene, Novagen (Madison, WI), Clontech (Palo Alto, CA), Stratagene (La Jolla, CA), and Invitrogen/Life Technologies (Carlsbad, CA).
- the AAV vector used in the disclosed compositions and methods can be a naturally occurring serotype of AAV including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, artificial variants such as AAV.rhlO, AAV.rh32/33, AAV.rh43, AAV.rh64Rl, rAAV2- retro, AAV-DJ, AAV-PHP.B, AAV-PHP.S, AAV-PHP.eB, or other engineered versions of AAV.
- the AAV used in the disclosed compositions and methods is AAV6 or AAV9.
- AAV serotypes of AAV have thus far been identified, with the best characterized and most commonly used being AAV2. These serotypes differ in their tropism, or the types of cells they infect, making AAV a very useful system for preferentially transducing specific cell types.
- AAV serotypes 1, 2, 5 or a hybrid capsid AAV1, AAV2, AAV5 or any combination thereof can be used for targeting brain or neuronal cells; AAV4 can be selected for targeting cardiac cells.
- AAV8 is useful for delivery to the liver cells.
- researchers have further refined the tropism of AAV through pseudotyping, or the mixing of a capsid and genome from different viral serotypes.
- AAV2/5 indicates a virus containing the genome of serotype 2 packaged in the capsid from serotype 5.
- Use of these pseudotyped viruses can improve transduction efficiency, as well as alter tropism.
- AAV2/5 targets neurons that are not efficiently transduced by AAV2/2, and is distributed more widely in the brain, indicating improved transduction efficiency.
- the AAV can be AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, artificial variants such as AAV.rhlO, AAV.rh32/33, AAV.rh43, AAV.rh64Rl, rAAV2-retro, AAV-DJ, AAV-PHP.B, AAV-PHP.S, and AAV-PHP.eB, or combinations thereof.
- the AAV vector for inclusion in the gene editing compositions or for providing elements of the gene editing compositions (e.g. , transposon) is AAV6 or AAV9. In some forms, more than one (e.g., 2, 3, 4, 5, 6, 10 or more) AAV vectors are introduced to the same target cell.
- An exemplary nucleic acid sequence for a vector for use with the AAV system is (the transposon sequence is indicated in bold): b.
- Other viral vectors are indicated in bold.
- the vector for inclusion in the gene editing compositions or for providing elements of the gene editing compositions is a viral vector such as a vesicular stomatitis (VSV) vector, a Bocavirus vector, such as a human bocavirus 1 (HBoVl) vector, a Herpes simplex virus (HSV) vector, or an adenovirus vector (AdV).
- VSV vesicular stomatitis
- Bocavirus vector such as a human bocavirus 1 (HBoVl) vector, a Herpes simplex virus (HSV) vector, or an adenovirus vector (AdV).
- the viral vector is a Herpes simplex virus (HSV) vector.
- Herpes simplex viruses HSV are large, enveloped dsDNA viruses characteristic of their lytic and latent nature of infection, which result in life-long latent infection of neurons and allows for long-term transgene expression. Deletion of HSV genes has generated expression vectors with low toxicity and an excellent packaging capacity of >30 kb foreign DNA.ln some forms, the viral vector is a Vesicular stomatitis virus (VSV) vector.
- VSV Vesicular stomatitis virus
- Vesicular stomatitis virus is a non-segmented, negative-stranded RNA virus that belongs to the family Rhabdoviridae, genus Vesiculovirus.
- VSV infects a broad range of animals, including cattle, horses, and swine.
- the genome of the virus codes for five major proteins, glycoprotein (G), matrix protein (M), nucleoprotein (N), large protein (L), and phosphoprotein (P).
- G protein mediates both viral binding and host cell fusion with the endosomal membrane following endocytosis.
- the L and P proteins are subunits of the viral RNA-dependent RNA polymerase.
- the viral vector is a human Bocavirus vector (HBoV).
- HBV human Bocavirus vector
- Exemplary human bocavirus vectors include human bocaviruses 1-4 (HBoV1 -4), As well as Gorilla BoV.
- the viral vector is an adenovirus vector.
- the vector is a chimeric vector, such as a vector that is based on a chimeric virus formed from a combination of one or more components from two or more different viral vectors.
- An exemplary chimeric viral vector is a chimeric bocavirus/adeno-associated virus vector. Therefore, in some forms, the vector is a chimeric HBoVl/AAV2 vector (e.g., rAAV2/HBoVl chimeras).
- the cell can be a prokaryotic cell or a eukaryotic cell.
- the cell is a fungal cell, such as a yeast cell.
- the cell is an algal cell.
- the cell is a eukaryotic cell, such as a mammalian cell.
- the mammalian cell is derived from or is designed to be administered into a non-human mammal, e.g., primate, bovine, ovine, porcine, canine, rodent, Leporidae such as monkey, cow, sheep, pig, dog, rabbit, rat or mouse cell.
- the cell is derived from a non-mammalian eukaryotic cell such as poultry bird (e.g., chicken), vertebrate fish (e.g., salmon) or shellfish (e.g., oyster, claim, lobster, shrimp) cell.
- the cell is a plant cell.
- the cell is derived from a monocot or dicot of a crop or grain plant, such as cassava, corn, sorghum, soybean, wheat, oat or rice, or from a tree or production plant, fruit or vegetable (e.g., trees such as citrus trees, e.g., orange, grapefruit or lemon trees; peach or nectarine trees; apple or pear trees; nut trees such as almond or walnut or pistachio trees; nightshade plants; plants of the genus Brassica; plants of the genus Lactuca; plants of the genus Spinacia; plants of the genus Capsicum; cotton, tobacco, asparagus, carrot, cabbage, broccoli, cauliflower, tomato, eggplant, pepper, lettuce, spinach, strawberry, blueberry, raspberry, blackberry, grape, coffee, cocoa, etc.) ⁇ .
- fruit or vegetable e.g., trees such as citrus trees, e.g., orange, grapefruit or lemon trees; peach or nectarine trees; apple or pear trees; nut trees
- the cell to be modified is a human cell including, but not limited to, skin cells, lung cells, heart cells, kidney cells, pancreatic cells, muscle cells, neuronal cells, human embryonic stem cells, and pluripotent stem cells. More preferably, the cell to be modified can be a T cell (e.g., CD8+ T cells such as effector T cells, memory T cells, central memory T cells, and effector memory T cells, or CD4+ T cells such as Thl cells, Th2 cells, Thl7 cells, and Treg cells), hematopoietic stem cell (HSC), macrophage, natural killer cell (NK), or dendritic cell (DC).
- T cell e.g., CD8+ T cells such as effector T cells, memory T cells, central memory T cells, and effector memory T cells
- CD4+ T cells such as Thl cells, Th2 cells, Thl7 cells, and Treg cells
- HSC hematopoietic stem cell
- NK natural killer cell
- DC dendritic cell
- the cell is from an established cell line, or a primary cell.
- primary cell refers to cells and cell cultures derived from a subject and allowed to grow in vitro for a limited number of passages, i.e. splitting, of the culture.
- the cells are obtained from a human subject.
- the cells are autologous cells, i.e., cells obtained from a subject prior to genetic modification and re-introduction to the same subject following modification.
- the cells are heterologous cells, i.e.. cells obtained from a different subject than the intended recipient.
- the cells are frozen prior to or after genetic modification. Methods and compositions for freezing and thawing viable eukaryotic cells are known in the art.
- the cells are autologous immune cells, such as T cells or progenitor cells/stem cells.
- cells are obtained from a healthy subject. In other forms, cells are obtained from a subject identified as having or at risk of having a disease or disorder, such as cancer and/or an auto-immune disease. a. Sources of T cells
- the cells are human immune cells, such as T cells. Therefore, in some forms, prior to expansion and genetic modification, T cells are obtained from a diseased or healthy subject. T cells can be obtained from a number of samples, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In some forms, T cells are obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan, such as FICOLLTM separation. In one preferred form, cells from the circulating blood of an individual are obtained by apheresis.
- the apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets.
- the cells collected by apheresis can be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps.
- the cells are washed with phosphate buffered saline (PBS).
- PBS phosphate buffered saline
- the wash solution lacks calcium and can lack magnesium or can lack many if not all divalent cations.
- the cells can be resuspended in a variety of biocompatible buffers, such as, for example, Ca2+-free, Mg2+-free PBS, PLASMALYTE A, or other saline solution with or without buffer.
- biocompatible buffers such as, for example, Ca2+-free, Mg2+-free PBS, PLASMALYTE A, or other saline solution with or without buffer.
- the undesirable components of the apheresis sample are removed and the cells directly resuspended in culture media.
- T cells are isolated from peripheral blood lymphocytes by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLLTM gradient or by counterflow centrifugal elutriation.
- a specific subpopulation of T cells such as CD3+, CD28+, CD4+, CD8+, CD45RA+, and CD45RO+ T cells, is further isolated by positive or negative selection techniques.
- T cells are isolated by incubation with anti-CD3/anti-CD28 (i.e., 3x28)-conjugated beads, such as DYNABEADS® M-450 CD3/CD28 T, for a time period sufficient for positive selection of the desired T cells.
- anti-CD3/anti-CD28 i.e., 3x28
- 3x28-conjugated beads such as DYNABEADS® M-450 CD3/CD28 T
- the cell expresses one or more genes of interest that were introduced to the cell in a transposon delivered to the cell by transduction with a viral vector containing the transposon. In some forms, the cell expresses one or more gene products that were not expressed in the same cell prior to transduction by a viral vector containing a transposon including the gene and electroporation with transposase mRNA.
- the genetically modified cell is a human cell, such as a human immune cell. In some forms, the genetically modified cell is a human immune cell. In some forms, the genetically modified cell is a human T cell modified to express a chimeric antigen receptor (CAR T cell). In a particular form, the genetically modified cell is a human T cell modified to express a CAR (CAR T cell) specific for CD22, CD19, or both CD22 and CD19. In some forms, a plurality of genetically modified cells are combined with excipients and/or other reagents suitable for administration to a subject in the form of a “living drug” or therapeutic agent.
- CAR T cell chimeric antigen receptor
- compositions containing CAR T cells include between about 10 4 and about 10 9 cells per kg body weight of the intended recipient (i.e, between 7x 10 5 and 7x10 10 cells for an average adult), preferably 10 5 to 10 7 cells/kg body weight, including all integer values within those ranges.
- compositions containing a genetically modified cell, or a population of genetically modified cells are provided.
- the pharmaceutical compositions include one or more of a pharmaceutically acceptable buffer, carrier, diluent or excipients.
- the pharmaceutical compositions include a specific number or population of cells, for example, expanded by culturing and expanding an isolated genetically modified cell (e.g., CAR T cell), e.g., a homogenous population. Therefore, in some forms, pharmaceutical compositions include a homogenous population of modified cells.
- the pharmaceutical compositions include populations of cells that contain variable or different genetically modified cells, e.g., a heterogeneous population.
- the pharmaceutical compositions include cells that are bispecific or multi-specific.
- the cells have been isolated from a diseased or healthy subject prior to genetic modification.
- Introduction of gene editing compositions e.g., mRNA encoding transposase and the one or more AAV vectors including a transposon) to the cell can be performed ex vivo.
- “Pharmaceutically acceptable carrier” describes a pharmaceutically acceptable material, composition, or vehicle that is involved in carrying or transporting a compound of interest from one tissue, organ, or portion of the body to another tissue, organ, or portion of the body.
- the carrier is a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof.
- Each component of the carrier must be “pharmaceutically acceptable” in that it must be compatible with the other ingredients of the formulation. It must also be suitable for use in contact with any tissues or organs with which it may come in contact, meaning that it must not carry a risk of toxicity, irritation, allergic response, immunogenicity, or any other complication that excessively outweighs its therapeutic benefits.
- compositions include buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
- the pharmaceutical compositions can be formulated for delivery via any route of administration.
- the term “Route of administration” can refer to any administration pathway known in the art, including but not limited to aerosol, nasal, oral, intravenous, intramuscular, intraperitoneal, inhalation, transmucosal, transdermal, parenteral, implantable pump, continuous infusion, topical application, capsules and/or injections.
- the pharmaceutical compositions are preferably formulated for intravenous administration.
- the disclosed pharmaceutical compositions are administered in a manner appropriate to a disease to be treated (or prevented).
- the quantity and frequency of administration is typically determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages can be determined by clinical trials.
- the disclosed pharmaceutical compositions can be delivered in a therapeutically effective amount.
- the precise therapeutically effective amount is that amount of the composition that will yield the most effective results in terms of efficacy of treatment in a given subject. This amount will vary depending upon a variety of factors, including but not limited to the characteristics of the therapeutic compound (including activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (including age, sex, disease type and stage, general physical condition, responsiveness to a given dosage, and type of medication), the nature of the pharmaceutically acceptable carrier or carriers in the formulation, and the route of administration.
- Methods for providing genetically modified cells are provided.
- the methods introduce user-defined genetic modifications into eukaryotic cells in a controllable and highly efficient manner.
- the methods facilitate immune cell engineering.
- the methods provide genetically modified immune cells for production, research and development of cell therapy.
- MAJESTIC mRNA AAV- Sleeping-Beauty Joint Engineering of Stable Therapeutic Immune Cells
- SB Sleeping Beauty
- the MAJESTIC system showed higher cell viability, chimeric antigen receptor (CAR) transgene expression, therapeutic cell yield, as well as prolonged transgene expression as compared with conventional gene delivery systems, such as lenti viral vector or DNA transposon/transposase electroporation alone.
- CAR chimeric antigen receptor
- This system also demonstrated versatility for engineering different cell therapy constructs such as canonical CAR, bi-specific CAR, kill switch CAR and synthetic TCR; and for CAR delivery into various immune cells including T cell, natural killer cells, myeloid cells and induced pluripotent stem cells.
- the methods include one or more steps of introducing a gene of interest into a cell, including introducing:
- mRNA including a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome, wherein the mRNA is introduced to the cell via electroporation.
- Chimeric antigen receptor (CAR) T cells have recently become powerful players in the arsenal of immune-based cancer therapy. More recently, gene-editing technologies have enabled more direct engineering of immune cells.
- current lentiviral, retroviral, or CRISPR/Cas9 based methods have various limitations in CAR targeting efficiency and modularity, especially for generation of multi-component CAR T cells. Therefore, methods for cellular genome engineering that permit simple, efficient, and versatile permutations of combinatorial or simultaneous knockout and knock-in genomic modifications are provided.
- the AAV-SB transposon method which uses a combination of viral transposon delivery and non- viral (electroporation) delivery of transposase in the form of mRNA to the same cell to generate a stable transgenic cell (e.g., CAR-T cell) at high efficiency in one step is provided.
- the mRNA is introduced to the cell via electroporation. Electroporation is temporary destabilization of the cell membrane by insertion of a pair of electrodes into it so that DNA molecules in the surrounding media of the destabilized membrane would be able to penetrate into cytoplasm and nucleoplasm of the cell.
- the mRNA encoding transposase can also be introduced via direct electroporation.
- AAV-transposon/mRNA electroporation method include, but are not limited to, design simplicity, higher delivery efficiency, lower toxicity, reduced exhaustion, increased effector function, and long term CAR enrichment (e.g., compared to standard approaches such as lentiviral CRISPR/Cas9 based approaches).
- This system can be used by, for example, both the scientific and clinical community for CAR-T research and production.
- Gene editing compositions can be introduced to the cells in different compositions at the same time, or the gene editing compositions can be introduced to cells separated by a period of time from one or more minutes, hours, days or weeks.
- cells can be introduced to an mRNA encoding transposase enzyme via electroporation, followed by a vector (e.g., AAV vector) containing a transposon including a sequence that encodes one or more genes of interest.
- cells can be first introduced toa vector (e.g., AAV vector) containing a transposon including a sequence that encodes one or more genes of interest, followed by electroporation to introduce mRNA encoding transposase enzyme.
- a vector e.g., AAV vector
- a transposon including a sequence that encodes one or more genes of interest is introduced to cells at the same time as, or immediately before or after electroporation to introduce mRNA encoding transposase enzyme.
- the cells are isolated from a diseased or healthy subject prior to genetic modification. Therefore, in some forms, where the cells are intended to be genetically modified for use as therapeutic cells in a subject, the methods include one or more steps for obtaining cells from a subject who is the intended recipient of the modified cells. Methods for obtaining live cells from a subject for the purposes of genetic manipulation are known in the art.
- the methods include one or more steps to increase the number or population of cells, for example, by culturing and expanding an isolated genetically modified cell (e.g., CAR T cell), e.g., a homogenous population.
- an isolated genetically modified cell e.g., CAR T cell
- the methods include one or more steps to construct an AAV-SB vector.
- the methods introduce one or more CAR sequences into cells.
- the AAV-SB-CRISPR vector is used as a backbone, which has an sgRNA/SB100x expression cassette nested between SB arms and AAV ITRs.
- the sgRNA/SB100x expression cassette is replaced between the U6 promoter and the short polyA sequence with a CAR, or other expression cassettes (e.g. CD22, BCMA).
- CAR sequences are obtained via either:
- CD22BBz CAR An exemplary method for generation of CD22BBz CAR is as previously described in Haso, et al., Blood., 121(7): 1165-74 (2013).
- An exemplary method generates a CD22 binding scFV (m971) specific for the human CD22 followed by CD8 hinge-transmembrane-regions linked to 4-1BB (CD137) intracellular domains and CD3 ⁇ intracellular domain.
- Another exemplary method generates a CD 19 binding scFv (FMC63) (which can be found from NCBI (GenBank: HM852952)) and is followed by CD8 hinge- transmembrane-regions linked to 4-1BB (CD137) intracellular domains and CD3cJ intracellular domain, as described in Kochenderfer, et al., J. Immunother., 32(7):689-702 (2009)).
- FMC63 CD 19 binding scFv
- the methods include one or more steps to provide transposase mRNA via in vitro mRNA transcription.
- the SB100x transposase is cloned into the Neo I and Hind III restriction endonuclease sites of the empty vector pcDNA3.1, which is used for in vitro transcription of mRNA.
- SB100x mRNA is transcribed from the SB100x plasmid using the HiScribe T7 ARCA mRNA (with tailing) Kit (NEB). Following RNA transcription, DNase treatment, and poly-A tailing, RNA purification is conducted using the Monarch RNA Cleanup Kit (50 ug) (NEB). After the concentration of the product was measured via Nandrop (with default RNA settings), the RNA is aliquoted and stored in -80 °C.
- the methods thaw one or more frozen samples of mRNA encoding transposase enzyme on ice shortly before use in electroporation.
- the methods include one or more steps to obtain isolated cells for genomic modification.
- the cells are obtained from an intended recipient. Therefore, in some forms, the methods include one or more steps to harvest viable cells from a live subject, for example, from a biological sample, such as blood or bone marrow. Methods for obtaining biological sample including cells from a subject are known in the art.
- the cells are one or more selected from HEK293T, NALM6, MM.1R, MCF7, NK-92, THP-1, human CD14+ monocytes, human PBMC, and human iPSC. These cells are available from multiple commercial sources, including, for example, ThermoFisher, American Type Culture Collection (ATCC), and STEMCELL.
- HEK293T and MCF7 cells are cultured in DMEM (Gibco) media supplemented with 10 % FBS (CORNING) and 200 U / mL penicillinstreptomycin (Gibco) (referred to as DIO).
- DMEM Gibco
- CORNING 10 % FBS
- DIO penicillinstreptomycin
- NALM6 and MM.1R cells are cultured in RPMI-1640 (Gibco) media supplemented with 10% FBS and 200 U I mL penicillin-streptomycin.
- NK-92 cells are cultured in Alpha Minimum Essential medium (MEM) (Gibco) supplemented with 12.5% horse serum, 12.5% FBS, 0.2 mM inositol, O.lmM 2-mercaptoethanol, 0.02mM folic acid, and 200U/mL human IL-2.
- MEM Alpha Minimum Essential medium
- THP-1 and CD 14+ monocytes are cultured in RPMI-1640 media supplemented with 10% FBS, 1% Glutamax, and 1% penicillinstreptomycin. 20ng/mL of human GM-CSF (BioLegend) is used to differentiate monocytes into macrophages.
- human PBMCs are cultured in X-VIVOTM 15 media (Lonza) supplied with 5 % human AB serum and IL-2.
- Human iPSCs are cultured in StemFlexTM Medium (Gibco).
- the methods include one or more steps to obtain, purify and titrate viral vectors for use in the methods of introducing transposon nucleic acids to cells.
- the methods prepare HEK293T cells in 150 mm-dishes.
- D10 media is replaced by 13 mL pre-warmed DMEM (FBS-free), and for each 150 mm-dish, HEK293T cells are transiently transfected with 5.2 ⁇ g transfer, 8.9 ⁇ g AAV6 serotype and 10.4 ⁇ g pDF6 plasmids, which are pre-mixed with 130 pL of PEI (1 mg/mL) in 450 pL Opti-MEM medium. After 6h of transfection, DMEM is replaced with 20 mL pre-warmed DIO media.
- Transfected cells are dislodged and collected in 50 mL Falcon tubes 72h post-transfection for AAV purification.
- AAV purification is performed according to methods known in the art, and viral titer is measured via RT-qPCR with a Taqman probe targeting the EFS sequence in the AAV vector.
- An exemplary method for AAV purification and titration includes the following steps:
- (xi) Isolate the aqueous layer and concentrate through a 100-kDa MWCO. Important step: concentrate AAV at high concentration so the volume can be reduced when performing the infection, which can decrease the toxicity of AAV.
- AAV should be aliquoted and stored at -80°C.
- the methods include one or more steps to introduce mRNA encoding transposase enzyme to cells by electroporation.
- the methods include providing between 0.1 ⁇ g and 100 ⁇ g, inclusive, of transposase mRNA per million cells, for example between 1 ⁇ g and 10 ⁇ g, inclusive. In a preferred form, the methods administer about 1 ⁇ g of SB100x mRNA. In an exemplary method, 100 pL Buffer R with the cells and SB100x mRNA mixture is loaded into a Neon Pipette. Typically, the methods include one or more steps to avoid the production of bubbles and/or remove bubbles from the mixture.
- the electroporation parameter is set at about 1600 V, 10 ms, and 3 pulses for T cells, THP-1 cells, and NK-92 cells; 1900 V, 30 ms, and 1 pulse for macrophages. Cells are immediately transferred to a 24-well plate with pre-warmed media after electroporation.
- the methods introduce specific quantities of viral vector including transposon (e.g., AAV-SB) to the same cells at a time point 24 hours prior to or after electroporation.
- the methods introduce specific quantities of viral vector including transposon (e.g., AAV-SB) to the same cells at a time point that is between about 24 hours before to about 24 hours after electroporation, inclusive, such as between 10 hours before and 10 hours after electroporation. Therefore, in some forms, the methods introduce virus-transposon e.g., AAV-SB) 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours or 9 hours before or after electroporation.
- the methods introduce virus-transposon (e.g., AAV-SB) from 1 hour to 4 hours before electroporation. In a preferred from, the methods introduce virus-transposon (e.g., AAV-SB) from 1 hour to 4 hours before electroporation, most preferably about 4 hours before electroporation.
- AAV-SB virus-transposon
- the methods introduce virus-transposon (e.g., AAV-SB) from 1 hour to 4 hours before electroporation, most preferably about 4 hours before electroporation.
- the methods include one or more steps to introduce the transposon into the cells via AAV viral transduction.
- the methods first electroporate the cells (e.g., human CD4 and/or CD8 T cells) with transposase mRNA (e.g., SB100x mRNA), then transduced them with a titration series of AAV-SB virus.
- the methods administer AAV to the cells in an amount that is a multiplicity of infection (MOI) of, for example, between 1E1 and 1E10, for example, 1E1, 1E2, 1E3, 1E4, 1E5, 1E6, 1E7, 1E8, 1E9 and 1E10.
- MOI multiplicity of infection
- the amount of AAV-SB administered to the cells is between 1E3 and 1E5, such as 1E3 or 1E4.
- the methods include one or more steps to identify genetically - modified cells by flow-cytometry.
- T cells or other immune cells
- T cells are collected and washed once with PBS.
- CAR constructs lacking a Flag tag e.g for CD22 and BCMA CARs
- cells are incubated with CD22-Fc or BCMA-Fc protein in PBS for 30 min on ice, then stained with anti-human IgG Fc-PE and other immune markers antibodies and incubated on ice for 30 min.
- Fc protein incubation is skipped and Flag is stained directly with an anti-Flag antibody.
- CD 19.20.CAR detection cells are incubated with biotinylated protein L (R&D) on the ice for 30 min, then stained with APC streptavidin for 30 min on the ice. Cells are washed with MACS buffer (0.5 % BSA and 2 rnM EDTA in PBS) and then analyzed on a BD FACS Aria cytometer. Data analysis is typically performed using techniques known in the art. In exemplary forms, the methods employ software such as FlowJo software 9.9.4 (Threestar, Ashland, OR).
- An electroporation system e.g., Neon® (ThermoFisher), Nucleofactor
- Methods of treatment including cells and other therapeutic agents produced according to the MAJESTIC system are described.
- the methods include Adoptive Cell Therapy (ACT) employing cells prepared according to the described methods for genetic manipulation of cells.
- ACT Adoptive Cell Therapy
- An exemplary method involves treating a subject (e.g., a human) having a disease, disorder, or condition by administering to the subject an effective amount of a pharmaceutical composition including genetically-modified cells prepared according to the MAJESTIC system.
- the methods treat a subject having a disease, disorder, or condition associated with an elevated expression or specific expression of an antigen by administering to the subject an effective amount of a pharmaceutical composition including cells modified according to the disclosed methods.
- the methods treat a subject having a disease, disorder, or condition associated with an elevated expression or specific expression of an antigen by administering to the subject an effective amount of a pharmaceutical composition including T cells modified to contain a CAR that targets the antigen.
- Methods of treating a subject having a disease, disorder, or condition including administering to the subject an effective amount of a pharmaceutical composition including live, viable cells engineered to express a gene of interest are provided.
- the methods treat a subject having a disease, disorder, or condition associated with an elevated expression or specific expression of an antigen.
- the methods include administering to the subject an effective amount of a T cell modified to express a CAR that targets the antigen.
- the methods treat a subject having a disease, disorder, or condition by administering to the subject an effective amount of a pharmaceutical composition having a genetically modified cell, where the cell is modified by introducing to the cell
- mRNA including a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome, wherein the mRNA is introduced to the cell via electroporation.
- the cell can have been isolated from the subject having the disease, disorder, or condition, or from a healthy donor, prior to genetic modification.
- the subject to be treated can have a disease, disorder, or condition such as but not limited to, cancer, an immune system disorder such autoimmune disease, an inflammatory disease, a neuronal disorder, HIV/AIDS, diabetes, a cardiovascular disease, an infectious disease, or combinations thereof.
- the disease, disorder, or condition can be associated with an elevated expression or specific expression of an antigen.
- the methods treat or prevent cancer and/or autoimmune disease in a subject in need thereof.
- the methods treat or prevent a cancer in a subject.
- Cancer is a disease of genetic instability, allowing a cancer cell to acquire the hallmarks proposed by Hanahan and Weinberg, including (i) self-sufficiency in growth signals; (ii) insensitivity to anti-growth signals; (hi) evading apoptosis; (iv) sustained angiogenesis; (v) tissue invasion and metastasis; (vi) limitless replicative potential; (vii) reprogramming of energy metabolism; and (viii) evading immune destruction (Cell., 144:646-674, (2011)).
- Tumors which can be treated in accordance with the disclosed methods, are classified according to the embryonic origin of the tissue from which the tumor is derived.
- Carcinomas are tumors arising from endodermal or ectodermal tissues such as skin or the epithelial lining of internal organs and glands.
- Sarcomas which arise less frequently, are derived from mesodermal connective tissues such as bone, fat, and cartilage.
- the leukemias and lymphomas are malignant tumors of hematopoietic cells of the bone marrow. Leukemias proliferate as single cells, whereas lymphomas tend to grow as tumor masses. Malignant tumors may show up at numerous organs or tissues of the body to establish a cancer.
- Table 2 provides a non- limiting list of cancers for which the CAR of the disclosed methods and compositions can target a specific or an associated antigen.
- compositions and methods can be used in the treatment of one or more cancers provided in Table 4.
- compositions and methods of treatment thereof are generally suited for treatment of carcinomas, sarcomas, lymphomas and leukemias.
- the described compositions and methods are useful for treating, or alleviating subjects having benign or malignant tumors by delaying or inhibiting the growth/proliferation or viability of tumor cells in a subject, reducing the number, growth or size of tumors, inhibiting or reducing metastasis of the tumor, and/or inhibiting or reducing symptoms associated with tumor development or growth.
- the types of cancer that can be treated with the provided compositions and methods include, but are not limited to, cancers such as vascular cancer such as multiple myeloma, adenocarcinomas and sarcomas, of bone, bladder, brain, breast, cervical, colorectal, esophageal, kidney, liver, lung, nasopharangeal, pancreatic, prostate, skin, stomach, and uterine.
- cancers such as vascular cancer such as multiple myeloma, adenocarcinomas and sarcomas, of bone, bladder, brain, breast, cervical, colorectal, esophageal, kidney, liver, lung, nasopharangeal, pancreatic, prostate, skin, stomach, and uterine.
- the compositions are used to treat multiple cancer types concurrently.
- the compositions can also be used to treat metastases or tumors at multiple locations.
- tumor cells include, but are not limited to, tumor cells of cancers, including leukemias including, but not limited to, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemias such as myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemia leukemias and myelodysplastic syndrome, chronic leukemias such as, but not limited to, chronic myelocytic (granulocytic) leukemia, chronic lymphocytic leukemia, hairy cell leukemia; polycythemia vera; lymphomas such as, but not limited to, Hodgkin’s disease, non-Hodgkin’s disease; multiple myelomas such as, but not limited to, smoldering multiple myeloma, nonsecretory myeloma, osteosclerotic myeloma, plasma cell leukemia, solitary plasmacytoma and extramedul
- the methods treat or prevent one or more immune system disorders, including autoimmune diseases.
- immune system disorders including autoimmune diseases.
- the ability of the immune system to distinguish self from foreign antigens can be misdirected against healthy tissues, resulting in the undesirable attack and destruction of normal host cells (i.e., autoimmune diseases).
- Autoimmune diseases include over 100 types of diseases, with varied etiology and prognoses based on factors such as the affected region, the age of onset, response to the therapeutic agents and clinical manifestation may vary among different people (Muhammad, et al., Chimeric Antigen Receptor Based Therapy as a Potential Approach in Autoimmune Diseases: How Close Are We to the Treatment, Frontiers in Immunology, 11 (2020)).
- autoimmunity is classified into two general categories, including organ-specific and systemic autoimmune.
- the former involves a specific area of the body such as type I diabetes (T1D), multiple sclerosis (MS), rheumatoid arthritis (RA), inflammatory bowel diseases (IBDs), and myasthenia gravis (MG), while the latter affects multiple regions of the body, causing systemic lupus erythematosus (SLE) and Sjogren’s syndrome (SS).
- T1D type I diabetes
- MS multiple sclerosis
- RA rheumatoid arthritis
- IBDs inflammatory bowel diseases
- MG myasthenia gravis
- SLE systemic lupus erythematosus
- SS Sjogren’s syndrome
- the methods reduce or prevent one or more physiological processes associated with the development or progression of autoimmune disease in a subject.
- the methods reduce or prevent one or more of epitope spreading, for example, where infections alter the primary epitope into the secondary epitope or form several neoepitopes on antigen-presenting cells; bystander activation or pre-primed autoreactive T cell activation in a T cell receptor (TCR)- independent manner; persistent virus infection, or the constant presence of viral antigens that prompt immune responses; or immunological cross-reactivity between a host and pathogen, for example, due to shared immunologic epitopes or sequence similarities.
- TCR T cell receptor
- Non- limiting examples of immune system disorders include 22qll.2 deletion syndrome, Achondroplasia and severe combined immunodeficiency, Adenosine Deaminase 2 deficiency, Adenosine deaminase deficiency, Adult-onset immunodeficiency with anti-interferon-gamma autoantibodies, Agammaglobulinemia, non-Bruton type, Aicardi-Goutieres syndrome, Aicardi-Goutieres syndrome type 5, Allergic bronchopulmonary aspergillosis, Alopecia, Alopecia totalis, Alopecia universalis, Amyloidosis AA, Amyloidosis familial visceral, Ataxia telangiectasia, Autoimmune lymphoproliferative syndrome, Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsuffiency, Autoimmune polyglandular syndrome type 1, Autosomal dominant hyper IgE syndrome, Autosomal recessive early-onset inflammatory
- compositions and methods can also be used to treat autoimmune diseases or disorders.
- autoimmune diseases or disorders which are not mutually exclusive with the immune system disorders described above, include Achalasia, Addison’s disease, Adult Still's disease, Agammaglobulinemia, Alopecia areata, Amyloidosis, Ankylosing spondylitis, Anti-GBM/Anti-TBM nephritis, Antiphospholipid syndrome, Autoimmune angioedema, Autoimmune dysautonomia, Autoimmune encephalomyelitis, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune pancreatitis, Autoimmune retinopathy, Autoimmune urticarial, Axonal & neuronal neuropathy (AMAN), Bald disease, Behcet’s disease, Benign mucosal pe
- the methods treat one or more additional disease or disorder in a subject in need thereof.
- the methods treat one or more genetic disease or disorders in a subject, such as a hereditary genetic disease or disorder, or a somatic genetic disease or disorder in a subject.
- any of the methods can include treating a subject having an underlying disease or disorder.
- the methods treat a disease or disorder, such as a cancer or auto-immune disease in a patient having another disease or disorder, such as diabetes, a bacterial infection (e.g., Tuberculosis), viral infection (e.g., Hepatitis, HIV, HPV infection, etc.), or a drug-associated disease or disorder.
- the methods treat an immunocompromised subject.
- the methods treat a subject having a disease of the kidney, liver, heart, lung, brain, bladder, reproductive system, bowel/intestines, stomach, bones or skin.
- the effective amount or therapeutically effective amount of a pharmaceutical compositions including modified cells, such as therapeutic T cells can be a dosage sufficient to treat, inhibit, or alleviate one or more symptoms of a disease or disorder, such as a cancer or autoimmune disease, or to otherwise provide a desired pharmacologic and/or physiologic effect, for example, reducing, inhibiting, or reversing one or more of the underlying pathophysiological mechanisms underlying a disease or disorder, such as cancer or autoimmune disease.
- the amount administered when administration of the pharmaceutical compositions including modified cells, such as therapeutic T cells, elicits an anti-cancer response, can be expressed as the amount effective to achieve a desired anti- cancer effect in the recipient.
- the amount of the pharmaceutical compositions including modified cells, such as therapeutic T cells is effective to inhibit the viability or proliferation of cancer cells in the recipient.
- the amount of the pharmaceutical composition including modified cells, such as therapeutic T cells is effective to reduce the tumor burden in the recipient, or reduce the total number of cancer cells, and combinations thereof.
- the amount of the pharmaceutical compositions including modified cells, such as therapeutic T cells is effective to reduce one or more symptoms or signs of cancer in a cancer patient, or signs of an autoimmune disease in a patient having an autoimmune disease or disorder.
- Signs of cancer can include cancer markers, such as PSMA levels in the blood of a patient.
- the effective amount of the pharmaceutical compositions including modified cells, such as therapeutic T cells, that is required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the disorder being treated, and its mode of administration. Thus, it is not possible to specify an exact amount for every pharmaceutical composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. For example, effective dosages and schedules for administering the pharmaceutical compositions including therapeutic T cells can be determined empirically, and making such determinations is within the skill in the art. In some forms, the dosage ranges for the administration of the compositions including therapeutic T cells are those large enough to effect reduction in cancer cell proliferation or viability, or to reduce tumor burden for example.
- the dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like.
- the dosage will vary with the age, condition, and sex of the patient, route of administration, whether other drugs are included in the regimen, and the type, stage, and location of the disease to be treated.
- the dosage can be adjusted by the individual physician in the event of any counter-indications.
- the effective dosage of the composition including therapeutic T cells used for treatment can increase or decrease over the course of a particular treatment. Changes in dosage can result and become apparent from the results of diagnostic assays.
- Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the subject or patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages can vary depending on the relative potency of individual pharmaceutical compositions, and can generally be estimated based on EC50S found to be effective in in vitro and in vivo animal models.
- a pharmaceutical composition containing CAR T cells described herein can be administered at a dosage of 10 4 to 10 9 cells/kg body weight, preferably 10 5 to 10 7 cells/kg body weight, including all integer values within those ranges.
- patients can be treated by infusing a disclosed pharmaceutical composition containing CAR expressing cells ( ⁇ ?.g., T cells) in the range of about 10 4 to 10 12 or more cells per square meter of body surface (cells/m).
- the infusion can be repeated as often and as many times as the patient can tolerate until the desired response is achieved.
- CAR T cell compositions can also be administered once or multiple times at these dosages.
- the cells can be administered by using infusion techniques that are commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319:1676, 1988).
- the optimal dosage and treatment regime for a particular patient can readily be determined by one skilled in the art of medicine by monitoring the patient for signs of disease and adjusting the treatment accordingly.
- the unit dosage is in a unit dosage form for intravenous injection.
- the unit dosage is in a unit dosage form for oral administration.
- the unit dosage is in a unit dosage form for inhalation.
- the unit dosage is in a unit dosage form for intra-tumoral injection.
- Treatment can be continued for an amount of time sufficient to achieve one or more desired therapeutic goals, for example, a reduction of the amount of cancer cells relative to the start of treatment, or complete absence of cancer cells in the recipient. Treatment can be continued for a desired period of time, and the progression of treatment can be monitored using any means known for monitoring the progression of anti-cancer treatment in a patient.
- administration is carried out every day of treatment, or every week, or every fraction of a week.
- treatment regimens are carried out over the course of up to two, three, four or five days, weeks, or months, or for up to 6 months, or for more than 6 months, for example, up to one year, two years, three years, or up to five years.
- the efficacy of administration of a particular dose of the pharmaceutical compositions including modified cells, such as therapeutic T cells, according to the methods described herein can be determined by evaluating the aspects of the medical history, signs, symptoms, and objective laboratory tests that are known to be useful in evaluating the status of a subject in need for the treatment of cancer or other diseases and/or conditions. These signs, symptoms, and objective laboratory tests will vary, depending upon the particular disease or condition being treated or prevented, as will be known to any clinician who treats such patients or a researcher conducting experimentation in this field. For example, if, based on a comparison with an appropriate control group and/or knowledge of the normal progression of the disease in the general population or the particular individual: (1) a subject’s physical condition is shown to be improved (e.g.
- a tumor has partially or fully regressed), (2) the progression of the disease or condition is shown to be stabilized, or slowed, or reversed, or (3) the need for other medications for treating the disease or condition is lessened or obviated, then a particular treatment regimen will be considered efficacious.
- efficacy is assessed as a measure of the reduction in tumor volume and/or tumor mass at a specific time point (e.g., 1-5 days, weeks, or months) following treatment.
- compositions described herein can be conveniently formulated into pharmaceutical compositions composed of one or more of the compounds in association with a pharmaceutically acceptable carrier.
- a pharmaceutically acceptable carrier See, e.g., Remington's Pharmaceutical Sciences, latest edition, by E.W. Martin Mack Pub. Co., Easton, PA, which discloses typical carriers and conventional methods of preparing pharmaceutical compositions that can be used in conjunction with the preparation of formulations of the therapeutics described herein and which is incorporated by reference herein.
- these include solutions such as sterile water, saline, and buffered solutions at physiological pH.
- Other therapeutics can be administered according to standard procedures used by those skilled in the art.
- compositions including modified cells, such as therapeutic T cells, described herein can include, but are not limited to, carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the therapeutic(s) of choice.
- compositions containing one or more modified cells, such as therapeutic T cells, and optionally one or more additional therapeutic agents can be administered to the subject in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated.
- a pharmaceutical composition including modified cells, such as therapeutic T cells can be administered as an intravenous infusion, or directly injected into a specific site, for example, into or surrounding a tumor.
- a pharmaceutical composition can be administered to a subject as an ophthalmic solution and/or ointment to the surface of the eye, vaginally, rectally, intranasally, orally, by inhalation, or parenterally, for example, by intradermal, subcutaneous, intramuscular, intraperitoneal, intrarectal, intraarterial, intralymphatic, intravenous, intrathecal and intratracheal routes.
- the compositions are administered directly into a tumor or tissue, e.g., stereotactically.
- Parenteral administration if used, is generally characterized by injection.
- Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions.
- a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
- Suitable parenteral administration routes include intravascular administration e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue injection (e.g., intraocular injection, intra-retinal injection, or sub-retinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct application by a catheter or other placement device (e.g. , an implant including a porous, non-porous, or gelatinous material).
- intravascular administration e.g., intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature
- peri- and intra-tissue injection e.g., intraocular injection, intra-retinal injection, or sub-retinal injection
- Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions which can also contain buffers, diluents and other suitable additives.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives can also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
- compositions containing one or more genetically modified cells can be localized (i.e., to a particular region, physiological system, tissue, organ, or cell type) or systemic.
- compositions including modified cells can be used alone, or in combination with other therapeutic agents or treatment modalities, for example, chemotherapy or stem-cell transplantation.
- modified cells such as therapeutic T cells (e.g., containing a population of CAR cells)
- other therapeutic agents or treatment modalities for example, chemotherapy or stem-cell transplantation.
- “combination” or “combined” refer to either concomitant, simultaneous, or sequential administration of the therapeutics.
- the pharmaceutical compositions and other therapeutic agents are administered separately through the same route of administration. In other forms, the pharmaceutical compositions and other therapeutic agents are administered separately through different routes of administration.
- the combinations can be administered either concomitantly (e.g., as an admixture), separately but simultaneously (e.g., via separate intravenous lines into the same subject; one agent is given orally while the other agent is given by infusion or injection, etc.,), or sequentially (e.g., one agent is given first followed by the second).
- the therapeutic agent is one or more other targeted therapies (e.g. , a targeted cancer therapy) and/or immune-checkpoint blockage agents (e.g. , anti-CTLA-4, anti-PDl, and/or anti-PDLl agents such as antibodies).
- targeted therapies e.g. , a targeted cancer therapy
- immune-checkpoint blockage agents e.g. , anti-CTLA-4, anti-PDl, and/or anti-PDLl agents such as antibodies.
- compositions and methods described herein may be used as a first therapy, second therapy, third therapy, or combination therapy with other types of therapies known in the art, such as chemotherapy, surgery, radiation, gene therapy, immunotherapy, bone marrow transplantation, stem cell transplantation, targeted therapy, cryotherapy, ultrasound therapy, photodynamic therapy, radio-frequency ablation or the like, in an adjuvant setting or a neoadjuvant setting.
- therapies known in the art, such as chemotherapy, surgery, radiation, gene therapy, immunotherapy, bone marrow transplantation, stem cell transplantation, targeted therapy, cryotherapy, ultrasound therapy, photodynamic therapy, radio-frequency ablation or the like, in an adjuvant setting or a neoadjuvant setting.
- the disclosed pharmaceutical compositions and/or other therapeutic agents, procedures or modalities can be administered during periods of active disease, or during a period of remission or less active disease.
- the pharmaceutical compositions can be administered before the additional treatment, concurrently with the treatment, post- treatment, or during remission of the disease or disorder.
- the disclosed pharmaceutical compositions and the additional therapeutic agents e.g., second or third agent
- the disclosed pharmaceutical compositions and the additional therapeutic agents can be administered in an amount or dose that is higher, lower or the same than the amount or dosage of each agent used individually, e.g., as a monotherapy.
- the administered amount or dosage of the disclosed pharmaceutical composition, the additional therapeutic agent (e.g., second or third agent), or all is lower (e.g., at least 20%, at least 30%, at least 40%, or at least 50%) than the amount or dosage of each agent used individually, e.g., as a monotherapy (e.g., required to achieve the same therapeutic effect).
- the methods administer one or more additional anti-cancer agents to a subject.
- targeted therapies are therapeutic agents that block the growth and spread of cancer by interfering with specific molecules ("molecular targets") that are involved in the growth, progression, and spread of cancer.
- molecules molecules that are involved in the growth, progression, and spread of cancer.
- Many different targeted therapies have been approved for use in cancer treatment. These therapies include hormone therapies, signal transduction inhibitors, gene expression modulators, apoptosis inducers, angiogenesis inhibitors, immunotherapies, and toxin delivery molecules.
- Numerous antineoplastic drugs can be used in combination with the disclosed pharmaceutical compositions.
- the additional therapeutic agent is a chemotherapeutic or antineoplastic drug. The majority of chemotherapeutic drugs can be divided into alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, monoclonal antibodies, and other anti-tumor agents.
- the methods also include administering one or more conventional therapies for autoimmune diseases to the subject.
- Exemplary therapies for autoimmune diseases include immunosuppressive agents, such as steroids or cytostatic drugs, analgesics, non-steroidal anti-inflammatory drugs, glucocorticoids, immunosuppressive and immunomodulatory agents, such as methotrexate, leflunomide, hydroxychloroquine, and sulfasalazine.
- the methods administer one or more disease-modifying antirheumatic drugs (DMARDs).
- DMARDs disease-modifying antirheumatic drugs
- the methods administer one or more biologic agents for localized treatment (i.e., agents that do not affect the entire immune system), such as TNF- ⁇ inhibitors, belimumab and rituximab depleting B cells, T-cell co-stimulation blocker, anti- interleukin 6 (IL-6), anti-IL-1, and protein kinase inhibitors.
- the methods also administer one or more monoclonal antibodies (mAbs), such as anti-TNFa, anti-CD19, anti-CD20, anti-CD22, and anti-IL6R, or other mAbs that target multiple B cell subtypes, and other aberrant cells in autoimmune diseases.
- mAbs monoclonal antibodies
- kits with one or more compositions for administration to a subject may include a pre-measured dosage of the composition in a sterile needle, ampule, tube, container, or other suitable vessel.
- the kits may include instructions for dosages and dosing regimens.
- kits containing a transposon e.g., SB transposon
- an AAV vector e.g., an AAV vector
- mRNA encoding a transposase enzyme e.g., SB100X transposase
- a vector suitable of expressing the mRNA e.g., a vector suitable of expressing the mRNA
- instructional material for use thereof.
- the kit includes a plurality of vectors, where each vector independently contains a transposon encoding one or more genes for insertion into a host cell genome, such as a CAR expression cassette.
- the kit contains a population of cells (e.g., T cells) collectively containing the AAV and/or transposon.
- the instructional material can include a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the kit.
- the instructional material may provide instructions for methods using the kit components, such as performing transfections, transductions, infections, and conducting screens.
- kits include a Sleeping Beauty transposon, such as the Sleeping Beauty SB100x hyperactive transposase.
- kits include an Adeno- associated virus (AAV) vector.
- kits include a transposon including a gene of interest having a reporter gene, a Chimeric Antigen Receptor (CAR), or combinations thereof.
- AAV Adeno- associated virus
- kits include a transposon that includes a promoter and/or polyadenylation signal operationally linked to a reporter gene and/or a CAR; in some forms, the kit includes a transposon including a CAR that is specific for an antigen selected from the group including a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof; for example, in some forms the CAR targets one or more antigens selected from the group including AFP, AKAP 4, ALK, Androgen receptor, B7H3, BCMA, Bcr Abl, BORIS, Carbonic, CD123, CD138, CD174, CD19, PSMA, Ras mutant, RGS5, RhoC, R0R1, SART3, sLe(a),
- the kit includes a transposon including a CAR that is specific for an antigen that is selected from a cancer antigen selected from 4 IBB, 5T4, adenocarcinoma antigen, alpha fetoprotein, BAFF, B lymphoma cell, C242 antigen, CA 125, carbonic anhydrase 9 (CA IX), C MET, CCR4, CD 152, CD 19, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD28, CD30 (TNFRSF8), CD33, CD4, CD40, CD44 v6, CD51, CD52, CD56, CD74, CD80, CEA, CNT0888, CTLA 4, DR5, EGFR, EpCAM, CD3, FAP, fibronectin extra domain B, folate receptor 1, GD2, GD3 ganglioside, glycoprotein 75, GPNMB, HER2/neu, HGF, human scatter factor receptor kinase, IGF 1 receptor, IGF I, IgGl
- the kit includes mRNA encoding transposase that incorporates N6 methyladenosine (m6A), 5 methylcytosine (m5C), pseudouridine ( ⁇ ), N1 methylpseudouridine (mel ⁇ ), 5 methoxyuridine (5moU), a 5’ cap, a poly(A) tail, one or more nuclear localization signals, or combinations thereof; in some forms, the mRNA, or the transposon, or both are codon optimized for expression in a eukaryotic cell.
- the kits include a viral vector that is AAV6 or AAV9, and/or cells.
- Exemplary cells include a T cell, hematopoietic stem cell (HSC), macrophage, natural killer cell (NK), or dendritic cell (DC).
- the T cell is a CD8+ T cell selected from effector T cells, memory T cells, central memory T cells, and effector memory T cells.
- the T cell is a CD4+ T cell selected from the group including Thl cells, Th2 cells, Thl7 cells, and Treg cells.
- a method of introducing a gene of interest into a cell comprising introducing to the cell:
- a viral vector comprising a transposon encoding the gene of interest; and (ii) mRNA comprising a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome, wherein the mRNA is introduced to the cell via electroporation.
- transposase enzyme is the Sleeping Beauty SB100x hyperactive transposase.
- the viral vector is an Adeno-associated virus (AAV) vector, or an adenovirus vector, or a Herpes Simplex virus (HSV) vector, or a vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV), or a chimeric vector comprising a combination of any two or more of a Adeno- associated virus (AAV) vector, Herpes Simplex virus (HSV) vector, vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV).
- AAV Adeno-associated virus
- HSV Herpes Simplex virus
- VSV vesicular stomatitis
- hBoV human Bocavirus vector
- transposon comprises a gene of interest comprising a reporter gene, a Chimeric Antigen Receptor (CAR), or combinations thereof.
- CAR Chimeric Antigen Receptor
- transposon further comprises a promoter and/or polyadenylation signal operationally linked to the reporter gene and/or the CAR.
- the CAR is specific for an antigen selected from the group consisting of a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- an antigen selected from the group consisting of a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- the CAR targets one or more antigens selected from the group consisting of AFP, AKAP-4, ALK, Androgen receptor, B7H3, BCMA, Bcr-Abl, BORIS, Carbonic, CD123, CD138, CD174, CD19, IL13RA2, IM19, IX, LCK, Legumain, IgK, LMP2, MAD-CT-1, MAD-CT-2, MAGE, MelanA/MARTl, Mesothelin, MET, ML-IAP, MUC1, Mutant p53, MYCN, NA17, NKG2D-L, NY-BR-1, NY-ESO-1, NY-ESO-1, OY-TES1, p53, Page4, PAP, PAX3, PAX5, PD-L1, PDGFR- ⁇ , PLAC1, Polysialic acid, Proteinase3 (PR1), PSA, PSCA, PSMA, Ras mutant, RGS5, RhoC, R0R
- the antigen is a cancer antigen selected from the group consisting of 4-1BB, 5T4, adenocarcinoma antigen, alpha-fetoprotein, BAFF, B-lymphoma cell, C242 antigen, CA-125, carbonic anhydrase 9 (CA-IX), C-MET, CCR4, CD 152, CD 19, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD28, CD30 (TNFRSF8), CD33, CD4, CD40, CD44 v6, CD51, CD52, CD56, CD74, CD80, CEA, CNT0888, CTLA-4, DR5, EGFR, EpCAM, CD3, FAP, fibronectin extra domain-B, folate receptor 1, GD2, GD3 ganglioside, glycoprotein 75, GPNMB, HER2/neu, HGF, human scatter factor receptor kinase, IGF-1 receptor, IGF-I, IgGl, Ll-CAM,
- mRNA comprises N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine ( ⁇ ),
- the cell is a T cell, hematopoietic stem cell (HSC), macrophage, natural killer cell (NK), or dendritic cell (DC).
- HSC hematopoietic stem cell
- NK natural killer cell
- DC dendritic cell
- T cell is a CD8+ T cell selected from the group consisting of effector T cells, memory T cells, central memory T cells, and effector memory T cells.
- T cell is a CD4+ T cell selected from the group consisting of Thl cells, Th2 cells, Thl7 cells, and Treg cells.
- a pharmaceutical composition comprising the population of cells of paragraph 26 and a pharmaceutically acceptable buffer, carrier, diluent or excipient.
- a method of treating a subject having a disease, disorder, or condition comprising administering to the subject an effective amount of the pharmaceutical composition of paragraph 27.
- a method of treating a subject having a disease, disorder, or condition associated with an elevated expression or specific expression of an antigen comprising administering to the subject an effective amount of a T cell modified according to the method of any one of paragraphs 5-22, wherein the T cell comprises a CAR that targets the antigen.
- a method of treating a subject having a disease, disorder, or condition comprising administering to the subject an effective amount of a pharmaceutical composition comprising a genetically modified cell, wherein the cell is genetically modified by a method comprising introducing to the cell:
- mRNA comprising a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome, wherein the mRNA is introduced to the cell via electroporation.
- transposase enzyme is the SB100x hyperactive transposase.
- the viral vector is an Adeno-associated virus (AAV) vector, or an adenovirus vector, or a Herpes Simplex virus (HSV) vector, or a vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV), or a chimeric vector comprising a combination of any two or more of a Adeno- associated virus (AAV) vector, Herpes Symplex virus (HSV) vector, vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV).
- AAV Adeno-associated virus
- HSV Herpes Simplex virus
- VSV vesicular stomatitis
- hBoV human Bocavirus vector
- transposon comprises a gene of interest comprising a reporter gene, a chimeric antigen receptor (CAR), or combinations thereof.
- transposon further comprises a promoter and/or polyadenylation signal operationally linked to the reporter gene and/or the CAR.
- the CAR is specific for an antigen selected from the group consisting of a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- an antigen selected from the group consisting of a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- the antigen is a cancer antigen selected from the group consisting of 4-1BB, 5T4, adenocarcinoma antigen, alpha-fetoprotein, BAFF, B-lymphoma cell, C242 antigen, CA-125, carbonic anhydrase 9 (CA-IX), C-MET, CCR4, CD 152, CD 19, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD28, CD30 (TNFRSF8), CD33, CD4, CD40, CD44 v6, CD51, CD52, CD56, CD74, CD80, CEA, CNT0888, CTLA-4, DR5, EGFR, EpCAM, CD3, FAP, fibronectin extra domain-B, folate receptor 1, GD2, GD3 ganglioside, glycoprotein 75, GPNMB, HER2/neu, HGF, human scatter factor receptor kinase, IGF-1 receptor, IGF-I, IgGl, Ll-
- the AAV vectors is AAV6 or AAV9.
- the genetically modified cell is a T cell, hematopoietic stem cell (HSC), macrophage, natural killer cell (NK), or dendritic cell (DC).
- HSC hematopoietic stem cell
- NK natural killer cell
- DC dendritic cell
- T cell is a CD8+ T cell selected from the group consisting of effector T cells, memory T cells, central memory T cells, and effector memory T cells.
- T cell is a CD4+ T cell selected from the group consisting of Thl cells, Th2 cells, Thl7 cells, and Treg cells.
- a system for introducing a gene of interest into a cell comprising:
- mRNA comprising a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome.
- transposase enzyme is the Sleeping Beauty SB100x hyperactive transposase.
- the viral vector is an Adeno-associated virus (AAV) vector, or an adenovirus vector, or a Herpes Simplex virus (HSV) vector, or a vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV), or a chimeric vector comprising a combination of any two or more of a Adeno- associated virus (AAV) vector, Herpes Simplex virus (HSV) vector, vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV).
- AAV Adeno-associated virus
- HSV Herpes Simplex virus
- VSV vesicular stomatitis
- transposon comprises a gene of interest comprising a reporter gene, a Chimeric Antigen Receptor (CAR), or combinations thereof.
- CAR Chimeric Antigen Receptor
- transposon further comprises a promoter and/or polyadenylation signal operationally linked to the reporter gene and/or the CAR.
- the CAR is specific for an antigen selected from the group consisting of a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- an antigen selected from the group consisting of a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- the antigen is a cancer antigen selected from the group consisting of 4-1BB, 5T4, adenocarcinoma antigen, alpha-fetoprotein, BAFF, B-lymphoma cell, C242 antigen, CA-125, carbonic anhydrase 9 (CA-IX), C-MET, CCR4, CD 152, CD 19, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD28, CD30 (TNFRSF8), CD33, CD4, CD40, CD44 v6, CD51 , CD52, CD56, CD74, CD80, CEA, CNT0888, CTLA-4, DR5, EGFR, EpCAM, CD3, FAP, fibronectin extra domain-B, folate receptor 1, GD2, GD3 ganglioside, glycoprotein 75, GPNMB, HER2/neu, HGF, human scatter factor receptor kinase, IGF-1 receptor, IGF-I, IgGl,
- mRNA comprises N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine ( ⁇ ),
- 66 The system of any one of paragraphs 51-65, wherein the cell is a T cell, hematopoietic stem cell (HSC), macrophage, natural killer cell (NK), or dendritic cell (DC).
- HSC hematopoietic stem cell
- NK natural killer cell
- DC dendritic cell
- T cell is a CD8+ T cell selected from the group consisting of effector T cells, memory T cells, central memory T cells, and effector memory T cells.
- T cell is a CD4+ T cell selected from the group consisting of Thl cells, Th2 cells, Thl7 cells, and Treg cells.
- kits for introducing a gene of interest into a cell comprising:
- a viral vector comprising a transposon encoding the gene of interest; and (ii) mRNA comprising a sequence that encodes one or more transposase enzymes configured to specifically mediate targeted integration of the transposon into the cellular genome.
- transposon is the Sleeping Beauty transposon.
- transposase enzyme is the Sleeping Beauty SB100x hyperactive transposase.
- the viral vector is an Adeno- associated virus (AAV) vector, or an adenovirus vector, or a Herpes Simplex virus (HSV) vector, or a vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV), or a chimeric vector comprising a combination of any two or more of a Adeno- associated virus (AAV) vector, Herpes Simplex virus (HSV) vector, vesicular stomatitis (VSV) vector, or a human Bocavirus vector (hBoV).
- AAV Adeno- associated virus
- HSV Herpes Simplex virus
- VSV vesicular stomatitis
- transposon comprises a gene of interest comprising a reporter gene, a Chimeric Antigen Receptor (CAR), or combinations thereof.
- CAR Chimeric Antigen Receptor
- transposon further comprises a promoter and/or polyadenylation signal operationally linked to the reporter gene and/or the CAR.
- an antigen selected from the group consisting of a cancer antigen, an inflammatory disease antigen, a neuronal disorder antigen, HIV/AIDS, a diabetes antigen, a cardiovascular disease antigen, an infectious disease antigen (including a viral antigen, a protozoan antigen, a bacterial antigen, and an allergen), an autoimmune disease antigen and an autoimmune disease antigen, or combinations thereof.
- the antigen is a cancer antigen selected from the group consisting of 4-1BB, 5T4, adenocarcinoma antigen, alpha-fetoprotein, BAFF, B-lymphoma cell, C242 antigen, CA-125, carbonic anhydrase 9 (CA-IX), C-MET, CCR4, CD 152, CD 19, CD20, CD200, CD22, CD221, CD23 (IgE receptor), CD28, CD30 (TNFRSF8), CD33, CD4, CD40, CD44 v6, CD51, CD52, CD56, CD74, CD80, CEA, CNT0888, CTLA-4, DR5, EGFR, EpCAM, CD3, FAP, fibronectin extra domain-B, folate receptor 1, GD2, GD3 ganglioside, glycoprotein 75, GPNMB, HER2/neu, HGF, human scatter factor receptor kinase, IGF-1 receptor, IGF-I, IgGl, Ll
- mRNA comprises N6-methyladenosine (m6A), 5-methylcytosine (m5C), pseudouridine ( ⁇ ),
- kits of any one of paragraphs 72-82, wherein the AAV vectors is AAV6 or AAV9.
- the cell is a T cell, hematopoietic stem cell (HSC), macrophage, natural killer cell (NK), or dendritic cell (DC).
- HSC hematopoietic stem cell
- NK natural killer cell
- DC dendritic cell
- T cell is a CD8+ T cell selected from the group consisting of effector T cells, memory T cells, central memory T cells, and effector memory T cells.
- T cell is a CD4+ T cell selected from the group consisting of Thl cells, Th2 cells, Thl7 cells, and Treg cells.
- Example 1 Establishment of the MAJESTIC system and high efficiency generation of CAR-T cells
- the MAJESTIC system has two core components: 1) the AAV-SB vector carrying desired cell therapy transgenes (AAV-SB-CTx), and 2) the engineered mRNA encoding the SB transposase (mRNA-Transposase).
- the hybrid AAV-SB-CAR vectors were created based on the previously established AAV-SB-CRISPR vector as a backbone, which has an sgRNA/SB100x expression cassette nested between SB arms and AAV ITRs (see, Ye, el al. In vivo CRISPR screening in CD8 T cells with AAV-Sleeping Beauty hybrid vectors identifies membrane targets for improving immunotherapy for glioblastoma. Nat Biotechnol 37, 1302-1313, doi: 10.1038/s41587-019-0246-4 (2019)).
- This expression cassette wasreplaced between the U6 promoter and the short polyA sequence with a CAR or other expression cassettes.
- This study utilized multiple types of CARs (e.g.
- each CAR sequence via was obtained either 1) PCR amplification of CAR sequences from existing CAR constructs in the lab or 2) IDT gene synthesis.
- the SB100x transposase was cloned into the Neo I and Hind III restriction endonuclease sites of the empty vector pcDNA3.1, which was used for in vitro transcription of mRNA.
- HEK293T NALM6, MM.1R, MCF7, NK-92, THP-1, human CD14+ monocytes, human PBMC, and human iPSC were purchased from commercial sources (ThermoFisher, American Type Culture Collection (ATCC), and STEMCELL).
- HEK293T and MCF7 cells were cultured in DMEM (Gibco) media supplemented with 10 % FBS (CORNING) and 200 U / mL penicillin-streptomycin (Gibco), hereafter referred to as DIO.
- DIO penicillin-streptomycin
- NALM6 and MM.1R cells were cultured in RPMI 1640 (Gibco) media supplemented with 10% FBS and 200 U / mL penicillin-streptomycin.
- NK-92 cells were cultured in Alpha Minimum Essential medium (MEM) (Gibco) supplemented with 12.5% horse serum, 12.5% FBS, 0.2 mM inositol, O.lmM 2-mercaptoethanol, 0.02mM folic acid, and 200U/mL human IL-2.
- MEM Alpha Minimum Essential medium
- THP-1 and CD14+ monocytes were cultured in RPMI 1640 media supplemented with 10% FBS, 1% Glutamax, and 1 % penicillin-streptomycin.
- GM-CSF human GM-CSF
- Human PBMCs CD4, and CD8 T cells were purchased from the StemCell and were cultured in X-VIVOTM 15 media (Lonza) supplied with 5 % human AB serum and (MP Biomedicals) and 400U/mL human IL-2. (BioLegend). T cells were activated with Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) with a T cell: Beads ratio at 1:1. In this study, multiple T cell donors were involved in various experiments; the donors for each experiment are clarified in figure legends. Human iPSCs were cultured in StemFlexTM Medium (Gibco).
- HEK293T cells were prepared in 150mm-dishes as above. D10 media was replaced by 13 mL pre-warmed DMEM (FBS-free). For each 150 mm-dish, HEK293T cells were transiently transfected with 5.2 ⁇ g transfer, 8.9 ⁇ g AAV6 serotype and 10.4 ⁇ g pDF6 plasmids, which was pre- mixed with 130 pL of PEI (1 mg/mL) in 450 ⁇ L Opti-MEM medium. After 6h of transfection, DMEM was replaced with 20 mL pre-warmed D10 media. Transfected cells were dislodged and collected in 50 mL Falcon tubes 72 h post-transfection for AAV purification. AAV purification was performed as previously reported. Viral titer was measured via RT-qPCR with a Taqman probe targeting the EFS sequence in the AAV vector.
- T cells (or other immune cells) were collected and washed once with PBS.
- CAR constructs lacking a Flag tag e.g. for CD22 and BCMA CARs
- cells were incubated with CD22-Fc or BCMA-Fc protein in PBS for 30 min on ice, then stained with anti-human IgG Fc-PE and other immune markers antibodies and incubated on ice for 30 min.
- Fc protein incubation was skipped and Flag was stained directly with an anti-Flag antibody.
- CD19.20.CAR detection cells were incubated with biotinylated protein L (R&D) on the ice for 30 min, then stained with APC streptavidin for 30 min on the ice.
- Electroporation using Maxcyte system follows a similar procedure except with the manufacturer’s suggested electroporation presets.
- Scripts used to process the insertion site mapping data will be available on the world wide web at github.com/stanleyzlam/SB-CAR.
- DNA was fragmented for 20 minutes using the Ultra II FS Enzyme Mix from NEB.
- 100 pM Splinkerette V1.2TS and V1.2BS oligos from IDT were annealed in an Eppendorf tube by heating the mixture to 98 C for 10 min in a heat block and then unplugging the heat block to allow the reaction to cool to room temperature.
- the final 15 pM annealed Splinkerette adaptor was ligated to the fragmented DNA reactions for 15 mins at 20 °C using NEB Next Ultra II Ligation Master Mix and Ligation Enhancer. Size selection was performed to achieve an insert size distribution of roughly 200-350 bp using NEBNext Sample Purification beads: 30 pL for 1st bead selection 15 pL for 2nd selection.
- the first PCR (98 °C 30s for one cycle; 98 °C 10s, 65 °C 75s for 18 cycles; and 65 °C 5 min for one cycle) was used to amplify genomic fragments containing the SB-left arm using two oligos: one specific to the Splinkerette adaptor, and another specific to the SB-left arm.
- the second PCR (98 °C 30s for one cycle; 98 °C 10s, 65 °C 75s for 12 cycles; and 65 °C 5 min for one cycle) was used to attach i7 index to the library.
- PCR cleanup using SPRIselect Purification Beads was performed. QC of each key step was performed by running 1 pL of sample on a Tapestation. To quantify each library, aliquots were first diluted 1: 10,000. A 1 nM to 0.01 pM dilution series of Illumina PhiX library was then prepared to serve as a standard. The qPCR reaction was prepared using 2x PowerUp SYBR Green, qPCR2.1 and qPCR 2.2 primers at a final concentration of 250 nM, and 5 pL of the diluted libraries in 20 pL total volume. Quantified libraries were diluted to 2 nM and then pooled in equal volumes and denatured according to the Miseq System Denature and Dilute libraries Guide.
- PhiX was spiked in at 50%, and the denatured pool was diluted to 8 pM and sequenced on Miseq system.
- a 300-cycles Miseq v2 kit was used to sequence the library with a single- end setting (150 cycles for R1 and 8 cycles for the index 1).
- AAV-SB-CTx plasmid To generate the AAV-SB-CTx plasmid, it was first established the AAV-SB plasmid by cloning the SB transposon, which is flanked by inverted repeats/direct repeats (IR/DR), in between the inverted terminal repeats (ITRs) of the AAV plasmid backbone (Ye, et al. In vivo CRISPR screening in CD8 T cells with AAV-Sleeping Beauty hybrid vectors identifies membrane targets for improving immunotherapy for glioblastoma. Nat Biotechnol 37, 1302-1313, doi:10.1038/s41587-019-0246-4 (2019)).
- IR/DR inverted repeats/direct repeats
- CAR-T cell generation was first tested.
- Human CD4 and CD8 T cells were first electroporated with SB100x mRNA, then transduced them with a titration series of AAV-SB-CD22.CAR virus, as depicted in the schematic of AAV-SB-CD22.CAR, AAV-SB-BCMA.CAR, and SB100x constructs and key procedures of mRNA in vitro transcription, AAV production, mRNA electroporation, flow cytometry, and kill assay in Figure 12, using multiplicities of infection (MOIs) of 1E3, 1E4, and 1E5.
- MOIs multiplicities of infection
- CD22.CAR expression was then monitored via flow cytometry from day 3 to day 14: human CD4 T cells were first electroporated with SB100x mRNA, then transduced with a titration series of AAV-SB-CD22.CAR virus; Human CD8 T cells were first electroporated with SB100x mRNA, then transduced with a titration series of AAV-SB-CD22.CAR virus.
- Flow cytometry plots of the human CD4 AAV-SB-CD22.CAR T cells and human CD8 AAV-SB-CD22.CAR T were used to monitor CAR-expression levels at various time points from day 3 to day 14.
- CD22 CAR-positive ratio positively correlated with virus titer, and CAR constructs were stably expressed in all time points tested.
- CAR-positive ratio positively correlated with virus titer, and CAR constructs were stably expressed in all time points tested.
- 21.8%, 53.9%, and 60.3% of the total CD4 T cell population were CAR-positive ( Figure 2A), and 17.8%, 39.2%, and 48.7% of CD8 T cells were CAR-positive ( Figure 3A).
- the experiments were repeated using a different CAR transgene, a BCMA-targeting CAR: at day 5 and at an MOI of 1E5, 35.6% and 32% of CD4 and CD8 T cells were BCMA.CAR-positive, respectively ( Figures 2B and 3B).
- T cells in the AAV-SB-CAR condition can be quickly enriched for CAR-positive cells to nearly a pure CAR population following one-time antigen-specific cancer cell stimulation (day 12 post-stimulation), where CD22 CAR+ and BCMA CAR+ T cells were 99.1% and 94.5% of cell populations, respectively, as determined in flow- cytometry of AAV-SB-CD22.CAR and AAV-SB-BCMA.CAR T cells after cancer stimulation.
- CD22 CAR+ and BCMA CAR+ T cells were 99.1% and 94.5% of cell populations, respectively, as determined in flow- cytometry of AAV-SB-CD22.CAR and AAV-SB-BCMA.CAR T cells after cancer stimulation.
- Both CD4 and CD8 T cells electroporated with 1 ⁇ g mRNA per 2x10 6 T cells yielded around 40% CAR-positive T cells.
- the CAR ratio is higher with 2 ⁇ g as compared to 1 ⁇ g mRNA in both CD4 and CD8 T cells; beyond 2 ⁇ g of mRNA the CAR ratio appeared to be saturated (Figs. 4C-4D and 4E-4F).
- a ratio of 2 ⁇ g of mRNA per 2x10 6 cells was used hereafter.
- Example 2 The MAJESTIC system efficiently produces CAR-T cells with high viability and yield
- HEK293T cells Low-passage (less than 15 passages) HEK293T cells were used for lentiviral packaging.
- 2e7 HEK293T cells were seeded per 150 mm- dish.
- DIO media was replaced with 13 mL pre-warmed Opti-MEM medium (Invitrogen) before transfection.
- 20 ⁇ g transgene plasmid, L5 ⁇ g psPAX2 (Addgene),10 ⁇ g pMD2.G (Addgene) and 90pL lipofectamine 2000 (Thermo Fisher) were mixed in 450pL Opti-MEM. The mixture was vortexed briefly and incubated for 10-15min at room temperature, then added dropwise to cells.
- Opti-MEM media was replaced with pre- warmed 20mL D10 media 5-6 h after transfection.
- Viral supernatant was collected 48h post-transfection and then concentrated using the Amicon Ultra- 15 Centrifugal filter unit (Millipore) or purified with Lenti-X Concentrator (Takara). All virus was titrated with Lenti-X GoStix Plus (Takara) before being aliquoted and stored in -80 °C.
- NALM6-GL GFP-Luciferase
- MM.1R-GL MCF7-PL (Puromycin- Luciferase) cancer cell lines were seeded in 96- well plates.
- CAR-T or CAR-NK cells were then added according to various effector to target (T/NK cell : cancer cell) ratios. Cytolysis was measured through luciferase assays. 150 ⁇ g / mL D-Luciferin (PerkinElmer) was added to the plate using a multi-channel pipette. Following a 5 minutes incubation at room temperature, luciferin intensity was measured by a Plate Reader (PerkinElmer).
- the functional multiplicity of infection (MOI) for AAV is usually 3-4 orders of magnitude lower than that of genomic MOI (in genome copies; GCs, gcs)(Francois, et al. Accurate Titration of Infectious AAV Particles Requires Measurement of Biologically Active Vector Genomes and Suitable Controls. Mol Ther Methods Clin Dev 10, 223-236, doi:10.1016/j.omtm.2018.07.004 (2018)); therefore, AAV genomic MOIs between 1E4-5E5, and a lentiviral MOIs between 1-10 were used in these experiments.
- Lenti-CAR and MAJESTIC-CAR T cells were sorted on day 2. Both normal Lenti-CD22.CAR and spin-infected Lenti-CD22. CAR groups demonstrated reduction of CAR+ percentages by day 5 (68.3% and 61.3%), falling even further by day 13 (52% and 43%).
- MAJESTIC-CAR T cells maintained a stable CAR+ ratio of around 85% (89.3% right after sorting). Although it is not entirely certain why lend viral CAR ratios decline, it has been known that lentivirus transgenes can often get silenced, potentially leading to reduced CAR percentages.
- the yield was estimated on day 5, 9, and 14.
- the yields of CAR+ T cells from the MAJESTIC groups were much higher than those of lentivirus and of plasmid electroporation (e.g. 4.5x and 73.7x higher at high dose, respectively) ( Figures 5B/5C).
- MAJESTIC was also tested using the Maxcyte electroporation platform: applying the MAJESTIC method using both the Neon and Maxcyte electroporators for introduction of the SB transposase (SB100x) mRNA component into cells yielded CAR percentages of over 36%, suggesting that MAJESTIC is not limited to one electroporation platform.
- T cells were collected at d21 after electroporation and washed with PBS twice to remove media.
- Cells were incubated with CD22-Fc protein (R&D Systems) in PBS for 30 min on ice and washed with PBS twice to remove the unbonded protein.
- the cells were then stained with anti-human IgG Fc-APC (Biolegend, Cat#366906) on ice for 30 min and washed with PBS twice.
- the CAR-positive T cells were purified by Anti-APC MicroBeads (Miltenyi). After that, genomic DNA was extracted using the QIAGEN Blood Mini Kit.
- the extracted genomic DNA samples were separated on a 1% agarose gel, and DNA bands over lOkbp were gel isolated and purified with the QIAquick Gel Extraction Kit (QIAGEN). qPCR was conducted to determine copy number, using primers that specifically target the SB transposon:
- IRDR-left, “Forward” from 5 ’-3’ CTCGTTTTTCAACTACTCCACAAATTTCT (SEQ ID NO:44).
- IRDR-left, “Reverse” from 5 ’-3’ GTGTCATGCACAAAGTAGATGTCCTA (SEQ ID NO:45).
- IRDR-right, “Reverse” from 5’ -3’ AATTCCCTGTCTTAGGTCAGTTAGGA (SEQ ID NO:47).
- PCR 1 primer on transposon end (“SB_R_pr_l”) from 5 ’-3’ :
- qPCR primer for library quantification (“qPCR2.1”) from 5’ -3’: A*ATGATACGGCGACCACCGAGAT*C (SEQ ID NO:52).
- qPCR primer for library quantification (“qPCR2.2”) from 5’-3’: C*AAGCAGAAGACGGCATACGAGA*T (SEQ ID NO: 53).
- Splinkerette adaptor (anneal with V1.2TS) “SplinkeretteV1.2BS” from 5’-3’:
- Splinkerette adaptor (anneal with V1.2BS) "SplinkeretteV1.2TS” from 5’-3’:
- PCR 1 on Splink end “SplAPl” from 5 ’-3’ G*TTCCCATGGTACTACTCAT*A (SEQ ID NO:59).
- CACTATAG*G (SEQ ID NO:77).
- the qPCR reactions were set up with 30 ng of genomic DNA (using three technical replicates), forward and reverse primers at a final concentration of 250 nM, and SYBR Green PowerUp Master Mix (ThermoFisher). Reactions were run in standard mode: a 2 min hold at 95 °C followed by 40 cycles of 15 s at 95 °C to denature and 60 s at 60 °C to anneal and extend.
- T cells were harvested at different time points after SB100x mRNA and viral transduction for transposase excision efficiency evaluation.
- Primers 5 ’-3’ CCGCACGCGTTCTAGACT (SEQ ID NO:20) targeting AAV backbone and 5’-3’: ACAAAGTAGATGTCCTAACTGACTTGCC (SEQ ID NO:21) targeting SB left arm were designed to evaluate SB left arm excision efficiency.
- Primers are 5’ -3’ : GCCGCTCGGTCCGCACGTG (SEQ ID NO:22) targeting AAV backbone and 5’-3’: AGTGAGTTTAAATGTATTTGGCTAAGGTGTATG (SEQ ID NO:23) targeting SB right arm were designed to evaluate SB right arm excision efficiency.
- the SYBR Green master Mix (ThermoFisher) was applied for qPCR quantification as previously described.
- AAV-SB-CAR only group (only transduced with AAV) was determined as baseline level of viral copy number that was existed in the T cells, then viral copy number in AAV-SB-CAR + SB100x mRNA group was divided by the baseline viral copy number, which was determined as excision efficiency.
- NSG mice were intravenously injected with 5x10 5 NALM6-GL cancer cells. After four days of cancer inoculation, 5x10 6 CD22.CAR T cells were tail vein injected as treatments. Bioluminescent imaging was performed via IVIS system to monitor leukemia progression. Animal survival study followed an approved death-as-endpoint protocol. Results
- VCN vector copy number
- MC-SB + SB100X mRNA group had a VCN of approximately 1-9 copies/cell.
- MAJESTIC group was observed with VCNs of approximately 1-4 copies / cell (Fig. 14A-14D).
- VCN measurement using both left arm and right arm probes showed consistent results (Fig. 14A-14D) excision circles were also quantified as a proxy for the excision efficiency of the SB100X transposase.
- AAV-SB- CAR constructs were significantly processed after one day of SB100X mRNA electroporation. qPCR primers amplifying the junction between the AAV arms and SB arms were used, for both the left and right sides separately to verify the assay.
- cancer killing assays were performed by co-culturing cancer cells and CAR-T cells, generated either via MAJESTIC or lentivirus.
- CAR-T cancer models were evaluated in co-culture, including CD22.CAR vs. NALM6-GL cancer cells and BCMA.CAR vs. MM.1R-GL cancer cells: Cytolysis analysis of NAML6-GL (NAML6 with GFP and luciferase reporters) cancer cells that were co-cultured with Lenti-CD22.CAR and AAV-SB-CD22.CAR T cells was carried out with CAR-Ts seeded at various effector : target (E:T) ratios, and luciferase imaging was performed at two time points (16h and 40h); likewise, cytolysis analysis of MM.1R-GL (MM.1R with GFP and luciferase reporters) cancer cells that were co-cultured with Lenti-BCMA.CAR and AAV-SB-BCMA.CAR T cells was carried out with CAR-Ts seeded at various effector : target (E:T) ratios, and luciferase imaging
- excision efficiency was around 55% on day 2 and 36% on day 3 (Figs. 14E-4F). With the right arm, excision efficiency was consistent, at around 53% on day 2, and 34% on day 3 (Figs. 14E-4F). Of note, the excision efficiency was slightly higher on day 2 compared to day 3, which may be due to the degradation of SB100X mRNA. This aligns with the goal of using mRNA in the MAJESTIC system to avoid prolong expression or existence of the transposase to minimize unnecessary transposon jumping or excision after transgene delivery.
- T cell exhaustion and memory markers before and after electroporation and viral transduction were evaluated by staining for CD22.CAR and HER2.CAR T cells.
- the flow cytometry data showed that PD-1 was slightly decreased post MAJESTIC; while CTLA-4, TIM-3, and LAG-3 were increased; nevertheless, PD-1, CLTA-4, and TIM- 3 all remained at baseline level as measured by mean fluorescence intensity (MFI) (Figs. 15A-15N).
- MFI mean fluorescence intensity
- IL- 7Ra remained at baseline for CD22.CAR and decreased for HER2.CAR (Figs. 15A- 15N).
- CXCR3 demonstrated differing expression patterns, potentially due to differences in the CAR constructs (e.g., regarding costimulatory domains, CD22.CAR has 4- IBB, while HER2.CAR has 4- IBB and CD28).
- a CAR-T efficacy testing experiment was performed in vivo using an animal model of B cell leukemia with adoptive cell transfer treatment. This in vivo experiment was intended only to validate that MAJESTIC-generated CAR-T were indeed functional, but not to compare with cells generated by other platforms.
- Example 4 Application of MAJESTIC in an array of different types of therapeutic transgenes in human T cells
- Splinkerette PCR was performed to amplify integration sites of the Sleeping Beauty cassette. Fourteen days after SB100x mRNA electroporation and AAV transduction of human NK-92 cells, cells were harvested and genomic DNA was extracted using the QIamp Blood Mini Kit. Sau3AI (NEB) was used to digest 1 ⁇ g genomic DNA for 4h at 37 °C, which was followed by 65 °C heat inactivation for 20 min. Forward and reverse Splinkerette adaptors were mixed to a final concentration of 25 pM and annealed as follows: denaturing 95 °C for 5 min and then cooling to room temperature at a ramp down rate of 5°C/min.
- annealed adaptors 25 pM were ligated overnight to Sau3AI digested genomic DNA using T4 Ligase (NEB).
- T4 Ligase T4 Ligase
- a nested PCR was performed with Splink 1 and SB -Left 1 primers for the 1 st PCR and Splink 2 and SB-Left 2 primers for the 2 nd PCR.
- the products were run on Invitrogen 2% E-Gels, and bands roughly within the 100-700bp range were excised. Gel purification was performed with the QIAGEN kit and the products were stored at -20°C.
- Preparation of the sequencing library was performed using the Nextera XT Library Prep Kit. Briefly, gel-purified Splinkerette PCR products were diluted to 0.4ng/pL, separated into three technical replicates, and subjected to tagmentation at 55°C for 8 min. Then, tagmented DNA was amplified and Nextera index adaptors (N701-706 and S506-508) were added via a 13-cycle PCR. Then, a TapeStation 4150 was used to measure the concentration of bands within the 100-700bp range for each of the PCR products to normalize samples for pooling. Pooled samples were purified using the QIAGEN PCR Cleanup Kit and stored at -20°C.
- Samples were prepared for sequencing via the Illumina Miseq System following manufacturer’s instructions. Specifically, the library was diluted to under lOpM and spiked with 5% PhiX Control, and the 150-cycle MiSeq Reagent Kit was used. Splinkerette data processing and analysis, and visualization
- Samtools view was used to filter out mapped reads with a quality score of less than 30, and the files were subsequently converted to the BED format using samtools view (Li, et al. Bioinformatics 25, 2078-2079 (2009), and bedtools bamtobed (Quinlan, & Hall, Bioinformatics 26, 841-842, (2010)).
- Genomic coordinate files in .bed format were loaded into R, keeping only the starting genomic coordinate. They were further processed and formatted into GRanges objects for data visualization. Key packages used for R processing and visualization include GenomicRanges (Lawrence, et al.
- Sample size was determined according to the lab's prior work, cited literature, or similar approaches in the field.
- Bispecific CAR-Ts can recognize two antigens and may thereby reduce the chance of immune escape; such systems have demonstrated potent efficacy against relapsed B cell malignancies that down-regulated single target antigen expression (Kustikova, et al. Clonal dominance of hematopoietic stem cells triggered by retroviral gene marking. Science 308, 1171-1174, doi: 10.1126/science.1105063 (2005)).
- an anti-CD19/anti-CD20 tandem scFv construct was designed (AAV-SB-CD19.20.CAR construct) according to the Schematic representation in Figure 8A.
- the construct includes the CD19 scFv and CD20 scFv CAR sequences joined by a linker to be expressed together as a tandem scFv CAR.
- This construct was used to transduce primary human T cells, again comparing MAJESTIC to lentivirus and DNA transposon systems in parallel. Flow cytometry was performed on days 5 and 10, after electroporation and viral transduction.
- Conditional inactivation of CAR-T cells is important to control potential toxicity, using kill-switch elements such as induced Caspase 9 (iCasp9) (Straathof, et al. An inducible caspase 9 safety switch for T-cell therapy.
- kill-switch elements such as induced Caspase 9 (iCasp9) (Straathof, et al. An inducible caspase 9 safety switch for T-cell therapy.
- conditional control CAR-T cells were generated with two transgenes, CD22 CAR and a suicide-gene (CD22.CAR.iCasp9 T cells), as depicted in the chematic representation of the AAV-SB-CD19.20.CAR construct in Figure 9A (CD19 scFv and CD20 scFv CAR sequences are joined by a linker and are expressed together as a tandem scFv CAR).
- mice were housed in standard conditions in Yale vivarium, maintained on a 12h light/dark cycle (07:00 to 19:00 light on). Mice, both female and male, aged 8-12 weeks were used for experiments. NOD-scid IL2Rgammanull (NSG) mice were purchased from JAX and bred in-house for T cell-based anti-tumor therapeutic efficacy testing experiments. Mouse health was monitored daily after tumor induction.
- the mini-circle (minicircle, MC) vector is a recently developed non- viral strategy that has shown significant improvement compared to conventional plasmid vector - specifically, the SB MC delivery of a CAR transgene has been proven to be more effective and less toxic compared with SB plasmid gene transfer, a head-to-head comparison of the MAJESTIC system with both MC and plasmid DNA systems was performed, using CD3 T cells as a source. 7-AAD staining data of SB/SB100X plasmid DNA and MC-SB/MC-SB100X groups showed similar cell viability (-70%), with MC- SB + SB100X mRNA group showing slightly higher cell viability.
- AAV- SB-CD22.CAR + SB100X mRNA group (MAJESTIC) attained 86% viability, which was higher than SB/SB100X plasmid DNA, MC-SB/MC-SB100X, and MC-SB + SB100X mRNA groups.
- CAR-T ratio on day 4 after electroporation confirmed higher CAR-T production efficiency compared of minicircle vs. plasmid DNA electroporation (19.7% vs. 8.01%). Efficiency could be further improved if MC-SB was electroporated with transposase supplied as SB100x mRNA (24.4%) (Fig. 17A).
- the MAJESTIC (AAV-SB-CD22.CAR + SB100x mRNA) group yielded the highest CAR-T ratio (51.8%) at day 4, substantially higher than those of MC/MC-transposase, MC/mRNA-transposase, and transposon plasmids (Fig. 17A).
- the MC-SB + SB100x mRNA group showed CD22.CAR T ratios of 29.1 %, 29.4%, and 37.0% at day 3, 8, and 14, respectively (Fig. 9D), and the AAV-SB-CD22.CAR + SB100X mRNA group showed CD22.CAR T ratios of 60.4%, 76.3%, and 82.4% at day 3, 8, and 14, respectively (Fig. 9D).
- the yield of MAJESTIC and MC/mRNA-transposase is shown from aggregated replicates (Figs. 17B-17C).
- MAJESTIC is consistently the group with highest efficiency in matched comparisons, across each donor and in all time points (Fig. 9F). Electroporation involving either the plasmid or the MC form of DNA appears to have lower viability and CAR% vs. MAJESTIC even in different cell types and donors (Fig. 9D-9F; Fig. 17A- 17C). Together, the data demonstrated the efficiency and reduced cellular toxicity of the MAJESTIC gene transfer platform compared with plasmid and MC gene transfer methods.
- Example 6 Analyzing the genomic integration profile of the MAJESTIC system in CAR-T cells
- next-generation sequencing (NGS) (Methods).
- CAR-positive T cells were first purified, then isolated genomic DNA from three sets (three independent donors) of MAJESTIC-generated and MC/mRNA- generated CAR-T samples collected d21 after electroporation. The gDNA for these two donors was fragmented and then a two-step Splinkerette PCR conducted to generate insertion site libraries. Analysis of next-generation sequencing data allowed us to map insertion locations in karyograms. These data showed that MAJESTIC indeed mediates cargo integration into the genome of human T cells, across all major chromosomes.
- MAJESTIC-mediated safe harbor insertion frequencies were found to be similar to that for MC/mRNA (around 17% vs. 15% on average). Importantly, MAJESTIC-mediated insertions were much more likely to be within safe harbors compared to that of lentivirus (around 2 ⁇ 3%) (Fig. 9G). Furthermore, the proportion of insertions into functional gene regions were determined, including exons, introns, and cancer genes and calculated the frequencies as fold-change relative to the randomly generated sites (Fig. 9H).
- MAJESTIC mediated a reasonably favorable safety profile, comparable to that of MC/mRNA and better than that of the lentiviral vector (Fig. 9G- 9G). Together, these data reveal the integration site profile of the MAJESTIC system and demonstrate a trend towards safer insertions compared to lentiviral transduction.
- the functional gene region data shows differences in the frequencies of integration into exons, coding exons, and 5’ UTRs in MC-SB + SB100X mRNA group as compared with a previous study. This may be due to technical reasons, e.g., different sample preparation, different time points used). For example, unlike a previous study which used unselected bulk samples, CAR+ cell population in our workflow were selected, which may explain the elevated exon integration. CAR+ selection enriches for T cells that have the CAR transgene inserted in genomic loci that avoid transgene silencing. Additionally, integration profile differences were observed between MAJESTIC and MC systems, despite the fact that both use the same SB transposon. While differences here could be due to technical reasons (e.g., sample prep) and/or biological reasons associated with the differences in transposon delivery approaches, the cause of which is beyond the scope of this study.
- ATCTCAAAATAGTAAATGCTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:2) AGGTGACTGATACCAAAAATACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:3) ATAGTACAAAGAGTTCTCATATACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:4) AGACAGACCTACAAAGAATATACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:5) GCAAACCAAAATGGCACATGTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:6) TATTATCAATAGCACCTAATCTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:7) AAATTTCTAGAAAAGGGTTGGTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:8)
- AATGATTATGGCATTCATATATACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:9) CCAGACTTGGTGGCACACACCTACAGTTGAAGTCGGAAGTTTA (SEQ ID NQ:10) AAGAGCTTTTATTTACATGAACTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO: 11) CGGAACGTGTAGGTTCGTTACATACAGTTGAAGTCGGAAGTTTA (SEQ ID NO: 12) AATCCTAGAACTGGAAAATATAGTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:13) CTGTGAGTGTGGACTGATCAAATATACAGTTGAAGTCGGAAGTTTA (SEQ ID NO: 14) ATGACTGTGTCTGCACCTCTATCTACAGTTGAAGTCGGAAGTTTA (SEQ ID NO:15)
- the Genomic sequence is indicated in text and the SB transposon (IR/DR) sequence is indicated in bold.
- NK cells natural killer cells have been explored as an alternative to T cells for immunotherapy, because they utilize a different set of signaling pathways, have rapid activation despite being innate immune cells, can exhibit TCR-independent cytotoxicity , and are relatively simpler to develop into an off-the- shelf product (Marofi, et al. CAR-NK Cell: A New Paradigm in Tumor Immunotherapy. Front Oncol 11, 673276, doi:10.3389/fonc.2021.673276 (2021)). Therefore, it is of interest to expand cell therapy to other immune cell types, such as NK cells and myeloid cells to overcome the inherent limitations of T cell based therapy. (Bailey, et al.. Gene editing for immune cell therapies. Nat Biotechnol 37, 1425-1434, doi: 10.1038/s41587- 019-0137-8 (2019)).
- NK92 is an immortalized NK cell line that has been used to produce CAR-NKs which have achieved use in clinical trials (Tang, X. et al. First-in-man clinical trial of CAR NK-92 cells: safety test of CD33-CAR NK-92 cells in patients with relapsed and refractory acute myeloid leukemia. Am J Cancer Res 8, 1083-1089 (2016)).
- NK92 cells were transduced to engineer HER2-specific CAR-NK cells.
- Flow cytometry revealed that the MAJESTIC system efficiently generated HER2 CAR-NK cells (near 50% at high dose on day 14), which was significantly higher than those by lentiviral or DNA transposon electroporation in the conditions tested ( Figure 10A).
- HER2 CAR-NK cells Near 50% at high dose on day 14
- Figure 10A Flow cytometry revealed that the MAJESTIC system efficiently generated HER2 CAR-NK cells (near 50% at high dose on day 14), which was significantly higher than those by lentiviral or DNA transposon electroporation in the conditions tested (Figure 10A).
- MOI Lenti-HER2.CAR at a high MOI
- MOI HER2.CAR-positive NK92 cells
- Plasmid DNA transposon electroporation groups achieved 16.1% and 8.06% HER2. CAR-positive NK92 cells.
- THP-1 a human monocytic and myeloid cell line
- Auwerx The human leukemia cell line, THP-1: a multifacetted model for the study of monocyte-macrophage differentiation. Experientia 47, 22-31, doi:10.1007/BF02041244 (1991)).
- THP-1 human monocytic and myeloid cell line
- HER2.CAR-positive THP-1 with AAV- SB-HER2 (MOI 3E5) on day 5 and 10, compared to -30% with lentiviral transduction at MOI 5 ( Figure 11A).
- MOI 3E5 AAV- SB-HER2
- Figure 11A For the DNA transposon plasmid electroporation group, cell viability was extremely low, with the vast majority of cells (>99%) dead due to the high cellular toxicity of plasmid electroporation, making it impossible to generate sufficient cells for subsequent analysis.
- CAR-MAs were engineered using primary human CD14 + macrophages, again comparing MAJESTIC with lentivirus and DNA transposon systems.
- Flow cytometry revealed a 25.5% CD22-specific CAR-MA population for the AAV-SB-CD22.CAR+mRNA group, which increased to 69.1% by day 11 ( Figure 11B).
- Lentiviral transduction worked reasonably well in primary macrophages, with CAR-positive percentages of 52.9% on day 5 and 48.1% on day 11 ( Figure 11B).
- AAV-SB-CAR alone without the mRNA-transposase yielded nearly 30% CAR+ MAs by day 5, which fell by more than half by day 11 ( Figure 11B).
- MAJESTIC was applied to iPSCs. Results showed MAJESTIC can transduce iPSCs carrying a HER2.CAR transgene at high efficiency (>75% HER2.CAR+) ( Figure 13D). Along with MAJESTIC, lentiviral vector can also transduce iPSCs at high efficiency, but not transposon DNA electroporation ( Figure 13D). Although differentiation of iPSCs into other cell types takes additional time, Delivery of cell therapy transgenes into iPSCs by MAJESTIC provides another versatile means to generate various therapeutic immune cells efficiently.
- the MAJESTIC system is capable of efficiently engineering stable functional therapeutic immune cells, and is applicable to various types of transgenes and across multiple lineages of immune cells.
- Adoptive cell therapy most notably CAR T therapy, has demonstrated clinical success in patients with several indications of hematological.
- a vital and potentially limiting step of this therapy is the manufacturing of engineered immune cells: to produce sufficient therapeutic cells for therapy would ideally require 1) a sizeable pool of patient immune cells to begin with and 2) a highly efficient genetic engineering technology.
- low transfer efficiency can be alleviated in part by increased culturing time, high initial efficiency would expedite the manufacturing process.
- increasing culturing time necessitates extended exposure of the cells to their target antigens during production, which may shift cells in favor of a differentiated phenotype, reducing long-term memory function (Morgan, et al., Genetic Modification of T Cells.
- ⁇ -retroviral vectors are indeed capable of efficient genome integration, but their tendency to insert into promoters of actively transcribed genes raises concerns about potential genotoxicity.
- Lentiviruses are commonly used in clinical trials today, and recent advances have improved their safety. However, there are still certain safety risks associated with the pathogenic origin of such viruses.
- AAV is a commonly used gene therapy vector, however, due to the dilution effect, AAV-transduced T cells will have gradual reduction in transgene expression, making an AAV-only system not ideal for delivery of CAR transgenes into T cells.
- Electroporation of 1) DNA transposon/transposase or 2) CAR-encoding mRNA construct are two non- viral gene transfer strategies, but key limitations include low viability /high toxicity for the former, and transient transgene expression for the latter.
- immune cell-based cell therapies has invited the introduction of other technologies to enhance immune cell engineering.
- CRISPR is one such technology that is being rapidly and broadly applied to immune cell editing (Roth, et al. Reprogramming human T cell function and specificity with non-viral genome targeting. Nature 559, 405-409, doi:10.1038/s41586-018-0326-5 (2016)).
- Such strategies rely on Cas9, Casl2a/Cpfl or other DNA-targeting endonucleases to generate DSBs, which is then repaired with a donor template via homology-directed repair (HDR).
- HDR homology-directed repair
- knockout efficiency depends on the availability of an optimal guide because poorly designed guides may not cut efficiently and may cause undesired off- target effects (Fu, et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol 31, 822-826, doi:10.1038/nbt.2623 (2013); Anderson, et al. CRISPR off-target analysis in genetically engineered rats and mice. Nat Methods 15, 512-514, doi:10.1038/s41592-018-0011-5 (2016); Frock, et al. Genome- wide detection of DNA double- stranded breaks induced by engineered nucleases.
- CRISPR knockout generates exposed DSBs that may trigger mutagenic non-homologous end-joining (NHEJ) pathways rather than HDR, which is especially hazardous for off-target editing, when no repair template is available for HDR to occur.
- NHEJ non-homologous end-joining
- HDR is limited to the late S and G2 phases of the cell cycle (Zhang, et al. Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells. PLoS One 8, e76771, doi:10.1371/joumal.pone.0076771 (2013)), restricting the interval in which the second step can occur.
- SB reduces the likelihood of genotoxicity as studies have shown that this class of transposons has close to a random genomic integration profile
- introduction of the SB system into cells by DNA transfection or electroporation can lead to higher cellular toxicity.
- SB can leave behind a tri-nucleotide footprint; thus, continuous remobilization of the transposon is a potential limitation of an all-in-one AAV-SB system, where both the transposon and transposase are delivered by AAV.
- the described platform addresses this issue by separating the transposase into a transient delivery component (mRNA).
- mRNA transient delivery component
- the SB system has also been engineered in the form of combinations or hybrid vectors, e.g., dCas9- SB100X to retarget SB transposition, and an adenovirus-SB hybrid system to achieve higher transduction efficiency.
- the MAJESTIC system differs from all such efforts by combining the advantages of all three delivery vehicles (AAV, transposon, mRNA) in an organic way: transducing cells with the hybrid AAV-transposon vector with electroporation of transposase mR A.
- AAV -SB transduction retains the benefits of high cell viability and stable transgene expression.
- the process of gene transfer of the MAJESTIC system is similar to conventional SB nucleofection, with mRNA electroporation instead of plasmid or MC electroporation and an extra AAV transduction step in which virus is added directly into the media.
- MAJESTIC avoids introducing double-stranded, circular DNA into cells and instead uses AAV and mRNA, both of which have reasonably low cellular toxicity.
- the MAJESTIC system will be limited by AAV’s packaging size of ⁇ 4.75kb ( ⁇ 4.3kb without SB arms). This is usually sufficient to include the CAR construct and additional elements (e.g., iCasp9), but will face challenges with significantly larger transgenes, which could be accommodated with DNA transposon plasmid/MC systems as transposons can in principle carry large transgene cargos although the efficiency may drop as the size increases.
- MAJESTIC is a composite system
- the generation of therapeutic immune cells is a two-step process including electroporation/nucleofection + viral transduction, although they can be streamlined to be performed at the same period of time (as demonstrated in our Oh transduction/electroporation experiments); while lenti virus or plasmid electroporation are both one-step methods.
- GMP good manufacturing practice
- MAJESTIC Without considering yield, MAJESTIC, KIKO, AAV and lentiviral/retroviral approaches all have higher GMP cost as compared to non- viral approaches such as transposon/MC, which is more economic to manufacture per today’s GMP landscape (Table 4). Also, MAJESTIC itself cannot achieve precisely targeted gene editing as CRISPR; rather, its advantage is being a high-efficiency gene-editing-free delivery approach. MAJESTIC is an alternative cargo delivery and therapeutic cell generation strategy with the strength of producing CAR+ cells with high viability at high yield - and thus the MAJESTIC system is effective where viability and/or yield is particularly important.
- MAJESTIC does not replace nor diminish other methods; instead, it provides a novel alternative gene delivery technology that offers superiority and advantages in certain feature areas, such as high viability, efficiency and yield, with naturally associated with limitations such as cargo size, additional procedures, and cost.
- the versatility of the MAJESTIC system makes it not limited to application in cell therapy for cancer - any therapy or research effort utilizing engineered immune cells could, in principle, benefit by using this system.
- MAJESTIC can, for example, generate CAR-Ts from cancer patient-derived T cells in a more clinically relevant scenario.
- Table 4 Comparison of cell engineering tools
- DSB double-stranded break
- GMP Good Manufacturing Practice
- RNP ribonucleoprotein
- BSL biosafety level
- KIKO homology -directed-repair knock-in and immune-checkpoint knockout
- TSS transcription start site.
- the sub-group of A-E, B-F, and C-E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D.
- each of the materials, compositions, components, etc. contemplated and disclosed as above can also be specifically and independently included or excluded from any group, subgroup, list, set, etc. of such materials.
- nucleic acid sequence includes a plurality of such nucleic acids
- nucleic acids is a reference to one or more nucleic acid and equivalents thereof known to those skilled in the art, and so forth.
- use of the word “can” indicates an option or capability of the object or condition referred to. Generally, use of “can” in this way is meant to positively state the option or capability while also leaving open that the option or capability could be absent in other forms or embodiments of the object or condition referred to. Unless the context clearly indicates otherwise, use of the word “may” indicate an option or capability of the object or condition referred to. Generally, use of “may” in this way is meant to positively state the option or capability while also leaving open that the option or capability could be absent in other forms or embodiments of the object or condition referred to. Unless the context clearly indicates otherwise, use of “may” herein does not refer to an unknown or doubtful feature of an object or condition.
- Ranges can be expressed herein as from “about” one particular value, and/or to "about” another particular value. When such a range is expressed, also specifically contemplated, and considered disclosed is the range from the one particular value and/or to the other particular value unless the context specifically indicates otherwise. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the value forms another, specifically contemplated embodiment that should be considered disclosed unless the context specifically indicates otherwise. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint unless the context specifically indicates otherwise.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Virology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
L'invention concerne des compositions et des méthodes d'ingénierie génomique cellulaire efficace qui transduisent divers types de cellules avec une toxicité minimale, conduisant à des modifications génomiques efficaces et stables. Les compositions et les méthodes sont applicables au développement d'une thérapie à base de lymphocytes T modifiés par un récepteur antigénique chimérique (CAR-T). Une méthode donnée à titre d'exemple consiste à introduire un gène d'intérêt dans des cellules par introduction dans la cellule d'un vecteur viral comprenant un transposon codant pour le gène d'intérêt et de l'ARNm comprenant une séquence codant pour des enzymes de transposase conçues pour induire une intégration ciblée du transposon dans le génome cellulaire, ce qui permet d'introduire l'ARNm dans la cellule par électroporation. L'invention concerne également des cellules génétiquement modifiées et des compositions pharmaceutiques ainsi que des méthodes d'utilisation de celles-ci pour le traitement de sujets atteints de maladies ou de troubles.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US202263319070P | 2022-03-11 | 2022-03-11 | |
US63/319,070 | 2022-03-11 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2023173137A1 true WO2023173137A1 (fr) | 2023-09-14 |
Family
ID=85873741
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2023/064244 WO2023173137A1 (fr) | 2022-03-11 | 2023-03-13 | Compositions et méthodes de modification génétique efficace et stable de cellules eucaryotes |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2023173137A1 (fr) |
Citations (25)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3610795A (en) | 1968-10-17 | 1971-10-05 | Intitut De Rech De La Siderurg | Apparatus for continuously melting of metal |
WO1992015322A1 (fr) | 1991-03-07 | 1992-09-17 | The General Hospital Corporation | Redirection de l'immunite cellulaire par des recepteurs chimeres |
US5686281A (en) | 1995-02-03 | 1997-11-11 | Cell Genesys, Inc. | Chimeric receptor molecules for delivery of co-stimulatory signals |
WO1998040510A1 (fr) | 1997-03-11 | 1998-09-17 | Regents Of The University Of Minnesota | Systeme transposon a base d'adn permettant d'introduire de l'acide nucleique dans l'adn d'une cellule |
US5843728A (en) | 1991-03-07 | 1998-12-01 | The General Hospital Corporation | Redirection of cellular immunity by receptor chimeras |
US5851828A (en) | 1991-03-07 | 1998-12-22 | The General Hospital Corporation | Targeted cytolysis of HIV-infected cells by chimeric CD4 receptor-bearing cells |
US5906936A (en) | 1988-05-04 | 1999-05-25 | Yeda Research And Development Co. Ltd. | Endowing lymphocytes with antibody specificity |
US5912170A (en) | 1991-03-07 | 1999-06-15 | The General Hospital Corporation | Redirection of cellular immunity by protein-tyrosine kinase chimeras |
US6004811A (en) | 1991-03-07 | 1999-12-21 | The Massachussetts General Hospital | Redirection of cellular immunity by protein tyrosine kinase chimeras |
WO2000032776A2 (fr) | 1998-12-01 | 2000-06-08 | Genentech, Inc. | Polypeptides secretes et transmembranaires et acides nucleiques les codant |
US6753162B1 (en) | 1991-03-07 | 2004-06-22 | The General Hospital Corporation | Targeted cytolysis of HIV-infected cells by chimeric CD4 receptor-bearing cells |
US7052906B1 (en) | 1999-04-16 | 2006-05-30 | Celltech R & D Limited | Synthetic transmembrane components |
US7109304B2 (en) | 2003-07-31 | 2006-09-19 | Immunomedics, Inc. | Humanized anti-CD19 antibodies |
US7741465B1 (en) | 1992-03-18 | 2010-06-22 | Zelig Eshhar | Chimeric receptor genes and cells transformed therewith |
WO2012079000A1 (fr) | 2010-12-09 | 2012-06-14 | The Trustees Of The University Of Pennsylvania | Utilisation de lymphocytes t modifiés par un récepteur chimérique d'antigènes chimérique pour traiter le cancer |
US8211422B2 (en) | 1992-03-18 | 2012-07-03 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Chimeric receptor genes and cells transformed therewith |
US8227432B2 (en) | 2002-04-22 | 2012-07-24 | Regents Of The University Of Minnesota | Transposon system and methods of use |
US8399645B2 (en) | 2003-11-05 | 2013-03-19 | St. Jude Children's Research Hospital, Inc. | Chimeric receptors with 4-1BB stimulatory signaling domain |
WO2014011988A2 (fr) | 2012-07-13 | 2014-01-16 | The Trustees Of The University Of Pennsylvania | Renforcement de l'activité des lymphocytes t car grâce à la co-introduction d'un anticorps bispécifique |
WO2014134165A1 (fr) | 2013-02-26 | 2014-09-04 | Memorial Sloan-Kettering Cancer Center | Compositions et procédés d'immunothérapie |
US20150038684A1 (en) | 2012-02-13 | 2015-02-05 | Seattle Children's Hospital (dba Seattle Children's Research Institute) | Bispecific chimeric antigen receptors and therapeutic uses thereof |
WO2017181107A2 (fr) | 2016-04-16 | 2017-10-19 | Ohio State Innovation Foundation | Arnm de cpf1 modifié, arn-guide modifié et leurs utilisations |
WO2018068022A1 (fr) * | 2016-10-06 | 2018-04-12 | Poseida Therapeutics, Inc. | Caspases inductibles et procédés d'utilisation |
US20200085929A1 (en) * | 2013-05-14 | 2020-03-19 | Board Of Regents, The University Of Texas System | Human application of engineered chimeric antigen receptor (car) t-cells |
US20210139583A1 (en) * | 2014-04-10 | 2021-05-13 | Seattle Children's Hospital (dba Seattle Children's Research Institute) | Production of engineered t-cells by sleeping beauty transposon coupled with methotrexate selection |
-
2023
- 2023-03-13 WO PCT/US2023/064244 patent/WO2023173137A1/fr unknown
Patent Citations (36)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3610795A (en) | 1968-10-17 | 1971-10-05 | Intitut De Rech De La Siderurg | Apparatus for continuously melting of metal |
US5906936A (en) | 1988-05-04 | 1999-05-25 | Yeda Research And Development Co. Ltd. | Endowing lymphocytes with antibody specificity |
US5912172A (en) | 1988-05-04 | 1999-06-15 | Yeda Research And Development Co. Ltd. | Endowing lymphocytes with antibody specificity |
US5912170A (en) | 1991-03-07 | 1999-06-15 | The General Hospital Corporation | Redirection of cellular immunity by protein-tyrosine kinase chimeras |
US5843728A (en) | 1991-03-07 | 1998-12-01 | The General Hospital Corporation | Redirection of cellular immunity by receptor chimeras |
US5851828A (en) | 1991-03-07 | 1998-12-22 | The General Hospital Corporation | Targeted cytolysis of HIV-infected cells by chimeric CD4 receptor-bearing cells |
US6004811A (en) | 1991-03-07 | 1999-12-21 | The Massachussetts General Hospital | Redirection of cellular immunity by protein tyrosine kinase chimeras |
US6284240B1 (en) | 1991-03-07 | 2001-09-04 | The General Hospital Corporation | Targeted cytolysis of HIV-infected cells by chimeric CD4 receptor-bearing cells |
US6392013B1 (en) | 1991-03-07 | 2002-05-21 | The General Hospital Corporation | Redirection of cellular immunity by protein tyrosine kinase chimeras |
US6410014B1 (en) | 1991-03-07 | 2002-06-25 | The General Hospital Corporation | Redirection of cellular immunity by protein-tyrosine kinase chimeras |
US6753162B1 (en) | 1991-03-07 | 2004-06-22 | The General Hospital Corporation | Targeted cytolysis of HIV-infected cells by chimeric CD4 receptor-bearing cells |
WO1992015322A1 (fr) | 1991-03-07 | 1992-09-17 | The General Hospital Corporation | Redirection de l'immunite cellulaire par des recepteurs chimeres |
US7741465B1 (en) | 1992-03-18 | 2010-06-22 | Zelig Eshhar | Chimeric receptor genes and cells transformed therewith |
US8211422B2 (en) | 1992-03-18 | 2012-07-03 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Chimeric receptor genes and cells transformed therewith |
US5686281A (en) | 1995-02-03 | 1997-11-11 | Cell Genesys, Inc. | Chimeric receptor molecules for delivery of co-stimulatory signals |
WO1998040510A1 (fr) | 1997-03-11 | 1998-09-17 | Regents Of The University Of Minnesota | Systeme transposon a base d'adn permettant d'introduire de l'acide nucleique dans l'adn d'une cellule |
WO2000032776A2 (fr) | 1998-12-01 | 2000-06-08 | Genentech, Inc. | Polypeptides secretes et transmembranaires et acides nucleiques les codant |
US7052906B1 (en) | 1999-04-16 | 2006-05-30 | Celltech R & D Limited | Synthetic transmembrane components |
US8227432B2 (en) | 2002-04-22 | 2012-07-24 | Regents Of The University Of Minnesota | Transposon system and methods of use |
US7109304B2 (en) | 2003-07-31 | 2006-09-19 | Immunomedics, Inc. | Humanized anti-CD19 antibodies |
US8399645B2 (en) | 2003-11-05 | 2013-03-19 | St. Jude Children's Research Hospital, Inc. | Chimeric receptors with 4-1BB stimulatory signaling domain |
WO2012079000A1 (fr) | 2010-12-09 | 2012-06-14 | The Trustees Of The University Of Pennsylvania | Utilisation de lymphocytes t modifiés par un récepteur chimérique d'antigènes chimérique pour traiter le cancer |
US8975071B1 (en) | 2010-12-09 | 2015-03-10 | The Trustees Of The University Of Pennsylvania | Compositions for treatment of cancer |
US9102761B2 (en) | 2010-12-09 | 2015-08-11 | The Trustees Of The University Of Pennsylvania | Compositions for treatment of cancer |
US8906682B2 (en) | 2010-12-09 | 2014-12-09 | The Trustees Of The University Of Pennsylvania | Methods for treatment of cancer |
US8911993B2 (en) | 2010-12-09 | 2014-12-16 | The Trustees Of The University Of Pennsylvania | Compositions for treatment of cancer |
US8916381B1 (en) | 2010-12-09 | 2014-12-23 | The Trustees Of The University Of Pennyslvania | Methods for treatment of cancer |
US9101584B2 (en) | 2010-12-09 | 2015-08-11 | The Trustees Of The University Of Pennsylvania | Methods for treatment of cancer |
US9102760B2 (en) | 2010-12-09 | 2015-08-11 | The Trustees Of The University Of Pennsylvania | Compositions for treatment of cancer |
US20150038684A1 (en) | 2012-02-13 | 2015-02-05 | Seattle Children's Hospital (dba Seattle Children's Research Institute) | Bispecific chimeric antigen receptors and therapeutic uses thereof |
WO2014011988A2 (fr) | 2012-07-13 | 2014-01-16 | The Trustees Of The University Of Pennsylvania | Renforcement de l'activité des lymphocytes t car grâce à la co-introduction d'un anticorps bispécifique |
WO2014134165A1 (fr) | 2013-02-26 | 2014-09-04 | Memorial Sloan-Kettering Cancer Center | Compositions et procédés d'immunothérapie |
US20200085929A1 (en) * | 2013-05-14 | 2020-03-19 | Board Of Regents, The University Of Texas System | Human application of engineered chimeric antigen receptor (car) t-cells |
US20210139583A1 (en) * | 2014-04-10 | 2021-05-13 | Seattle Children's Hospital (dba Seattle Children's Research Institute) | Production of engineered t-cells by sleeping beauty transposon coupled with methotrexate selection |
WO2017181107A2 (fr) | 2016-04-16 | 2017-10-19 | Ohio State Innovation Foundation | Arnm de cpf1 modifié, arn-guide modifié et leurs utilisations |
WO2018068022A1 (fr) * | 2016-10-06 | 2018-04-12 | Poseida Therapeutics, Inc. | Caspases inductibles et procédés d'utilisation |
Non-Patent Citations (91)
Title |
---|
AKALIN ET AL., , BIOINFORMATICS, vol. 31, 2015, pages 1127 - 1129 |
ANDERSON ET AL.: "CRISPR off-target analysis in genetically engineered rats and mice.", NAT METHODS, vol. 15, 2018, pages 512 - 514, XP036542157, DOI: 10.1038/s41592-018-0011-5 |
AUWERX: "The human leukemia cell line, THP-1: a multifacetted model for the study of monocyte-macrophage differentiation.", EXPERIENTIA, vol. 47, 1991, pages 22 - 31, XP000218599, DOI: 10.1007/BF02041244 |
BULCHA ET AL.: "G. Viral vector platforms within the gene therapy landscape.", SIGNAL TRANSDUCT TARGET THER, vol. 6, 2021, pages 53, XP055954625, DOI: 10.1038/s41392-021-00487-6 |
CAMERON ET AL.: "Mapping the genomic landscape of CRISPR-Cas9 cleavage.", NAT METHODS, vol. 14, 2017, pages 600 - 606, XP055852913, DOI: 10.1038/nmeth.4284 |
CELL, vol. 144, 2011, pages 646 - 674 |
CHICAYBAM ET AL.: "Transposon-mediated generation of CAR-T cells shows efficient anti B-cell leukemia response after ex vivo expansion.", GENE THER, vol. 27, 2020, pages 85 - 95, XP037053523, DOI: 10.1038/s41434-020-0121-4 |
CHOI ET AL., , CURR. GENE THER., vol. 5, 2005, pages 299 - 310 |
CHU ET AL.: "CSl-specific chimeric antigen receptor (CAR)-engineered natural killer cells enhance in vitro and in vivo antitumor activity against human multiple myeloma.", LEUKEMIA, vol. 28, 2014, pages 917 - 927 |
CHU ET AL.: "Targeting CD20+ Aggressive B-cell Non-Hodgkin Lymphoma by Anti-CD20 CAR mRNA-Modified Expanded Natural Killer Cells In Vitro and in NSG Mice.", CANCER IMMUNOL RES, vol. 3, 2015, pages 333 - 344, XP055982329, DOI: 10.1158/2326-6066.CIR-14-0114 |
CUI ET AL.: "Structure-function analysis of the inverted terminal repeats of the Sleeping Beauty transposon", J. MOL. BIOL., vol. 318, no. 5, 2002, pages 1221 - 1235, XP002972867, DOI: 10.1016/S0022-2836(02)00237-1 |
DAI ET AL.: "One-step generation of modular CAR-T cells with AAV-Cpf1 .", NAT METHODS, vol. 16, 2019, pages 247 - 254, XP036713091, DOI: 10.1038/s41592-019-0329-7 |
DI STASI ET AL.: "Inducible apoptosis as a safety switch for adoptive cell therapy.", N ENGL J MED, vol. 365, 2011, pages 1673 - 1683, XP055181696, DOI: 10.1056/NEJMoa1106152 |
DOHERTY ET AL., HYPERACTIVE PIGGYBAC GENE TRANSFER IN HUMAN CELLS AND IN VIVO. HUM GENE THER, vol. 23, pages 311 - 320 |
ELLIS: "Silencing and variegation of gammaretrovirus and lentivirus vectors.", HUM GENE THER, vol. 16, 2005, pages 1241 - 1246 |
ENACHE ET AL.: ", Cas9 activates the p53 pathway and selects for p53-inactivating mutations.", NAT GENET, vol. 52, 2020, pages 662 - 668, XP037525537, DOI: 10.1038/s41588-020-0623-4 |
EYQUEM ET AL.: "Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection.", NATURE, vol. 543, 2017, pages 113 - 117, XP055397283, DOI: 10.1038/nature21405 |
FISHMAN ET AL.: "Medicine", 1985, J.B. LIPPINCOTT CO |
FRANCOIS ET AL.: "Accurate Titration of Infectious AAV Particles Requires Measurement of Biologically Active Vector Genomes and Suitable Controls.", MOL THER METHODS CLIN DEV, vol. 10, 2018, pages 223 - 236, XP055653716, DOI: 10.1016/j.omtm.2018.07.004 |
FRANZ GSAVAKIS C, NUCLEIC ACIDS RES, vol. 19, 1991, pages 6646 |
FROCK ET AL.: "Genome-wide detection of DNA double-stranded breaks induced by engineered nucleases.", NAT BIOTECHNOL, vol. 33, 2015, pages 179 - 186, XP055555709, DOI: 10.1038/nbt.3101 |
FU ET AL.: "High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells.", NAT BIOTECHNOL, vol. 31, 2013, pages 822 - 826, XP055548416, DOI: 10.1038/nbt.2623 |
GENSSLER ET AL.: "Dual targeting of glioblastoma with chimeric antigen receptor-engineered natural killer cells overcomes heterogeneity of target antigen expression and enhances antitumor activity and survival.", ONCOIMMUNOLOGY, vol. 5, 2016, pages e1119354, XP055545397, DOI: 10.1080/2162402X.2015.1119354 |
GRABUNDZIJA ET AL.: "Comparative analysis of transposable element vector systems in human cells.", MOL. THER., vol. 18, 2010, pages 1200 - 1209, XP055605020, DOI: 10.1038/mt.2010.47 |
HASO ET AL., BLOOD, vol. 121, no. 7, 2013, pages 1165 - 74 |
HAYES: "Cellular immunotherapies for cancer", IR J MED SCI, vol. 190, 2021, pages 41 - 57, XP055840420, DOI: 10.1007/s11845-020-02264-w |
HOU ET AL., NAT REV DRUG DISCOV, vol. 20, 2021, pages 531 - 550 |
IVICS ET AL., CELL, vol. 91, 1997, pages 501 - 10 |
IZSVAK ET AL., J BIOL CHEM, vol. 277, 2002, pages 34581 - 8 |
IZSVAK ET AL., J MOL BIOL, vol. 302, 2000, pages 93 - 102 |
IZSVAK ET AL., MOL GEN GENET., vol. 247, 1995, pages 312 - 22 |
IZSVAK ET AL.: "Sleeping Beauty, a wide host-range transposon vector for genetic transformation in vertebrates.", J. MOL. BIOL., vol. 302, no. 1, 2000, pages 93 - 102, XP004469118, DOI: 10.1006/jmbi.2000.4047 |
JAITIP TIPANEE ET AL: "Transposons: Moving Forward from Preclinical Studies to Clinical Trials", HUMAN GENE THERAPY, vol. 28, no. 11, 1 November 2017 (2017-11-01), GB, pages 1087 - 1104, XP055640966, ISSN: 1043-0342, DOI: 10.1089/hum.2017.128 * |
JOHNSON ET AL.: "Gene therapy with human and mouse T-cell receptors mediates cancer regression and targets normal tissues expressing cognate antigen.", BLOOD, vol. 114, 2009, pages 535 - 546, XP055568588, DOI: 10.1182/blood-2009-03-211714 |
JUNE ET AL.: "CAR T cell immunotherapy for human cancer", SCIENCE, vol. 359, 2018, pages 1361 - 1365 |
KEBRIAEI ET AL.: ", Z. Gene Therapy with the Sleeping Beauty Transposon System.", TRENDS GENET, vol. 33, 2017, pages 852 - 870 |
KEBRIAEI ET AL.: "Gene Therapy with the Sleeping Beauty Transposon System.", TRENDS GENET, vol. 33, 2017, pages 852 - 870 |
KLICHINSKY ET AL.: "Human chimeric antigen receptor macrophages for cancer immunotherapy.", NAT BIOTECHNOL, vol. 38, 2020, pages 947 - 953, XP055926928, DOI: 10.1038/s41587-020-0462-y |
KOCHENDERFER ET AL., J. IMMUNOTHER, vol. 32, no. 7, 2009, pages 689 - 702 |
KOLACSEK ET AL., MOB DNA, vol. 2, 2011, pages 5 |
KRUSCHINSKI ET AL.: "Engineering antigen-specific primary human NK cells against HER-2 positive carcinomas.", PROC NATL ACAD SCI U S A, vol. 105, 2008, pages 17481 - 17486, XP055911709, DOI: 10.1073/pnas.0804788105 |
KUSTIKOVA ET AL.: "Clonal dominance of hematopoietic stem cells triggered by retroviral gene marking.", SCIENCE, vol. 308, 2005, pages 1171 - 1174, XP002455801, DOI: 10.1126/science.1105063 |
LABANIEH ET AL., NATURE BIOMEDICAL ENGINEERING, vol. 2, 2018, pages 377 |
LASKOWSKIREZVANI: "Adoptive cell therapy: Living drugs against cancer.", J EXP MED, vol. 217, 2020 |
LAWRENCE ET AL., PLOS COMPUT BIOL, vol. 9, 2013, pages e1003118 |
LI ET AL., BIOINFORMATICS, vol. 25, 2009, pages 2078 - 2079 |
LI ET AL., NAT. BIOMED. ENG., vol. 1, no. 5, 2017, pages 0066 |
LI ET AL.: ", Human iPSC-Derived Natural Killer Cells Engineered with Chimeric Antigen Receptors Enhance Anti-tumor Activity.", CELL STEM CELL, vol. 23, 2018, pages 181 - 192,e185 |
LINO CA ET AL., DRUG DELIV., vol. 25, no. 1, 2018, pages 1234 - 1257 |
LIU ET AL.: "Cord blood NK cells engineered to express IL-15 and a CD19-targeted CAR show long-term persistence and potent antitumor activity.", LEUKEMIA, vol. 32, 2018, pages 520 - 531, XP055664776, DOI: 10.1038/leu.2017.226 |
LUKJANOV ET AL.: "CAR T-Cell Production Using Nonviral Approaches.", J IMMUNOL RES, 2021, pages 6644685 |
MAJZNER ET AL.: "Clinical lessons learned from the first leg of the CAR T cell journey.", NAT MED, vol. 25, 2019, pages 1341 - 1355, XP036881214, DOI: 10.1038/s41591-019-0564-6 |
MAROFI ET AL.: "CAR-NK Cell: A New Paradigm in Tumor Immunotherapy.", FRONT ONCOL, vol. 11, 2021, pages 673276 |
MATES ET AL.: "Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates", NAT GENET, vol. 41, 2009, pages 753 - 761, XP055041328, DOI: 10.1038/ng.343 |
MATES ET AL.: "Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates.", NAT. GENET., vol. 41, 2009, pages 753 - 761, XP055041328, DOI: 10.1038/ng.343 |
MISKEY ET AL., NUCLEIC ACIDS RES, vol. 31, 2003, pages 6873 - 81 |
MONJEZI ET AL.: "Enhanced CAR T-cell engineering using non-viral Sleeping Beauty transposition from minicircle vectors.", LEUKEMIA, vol. 31, 2017, pages 186 - 194, XP037653748, DOI: 10.1038/leu.2016.180 |
MORGAN ET AL.: ", Genetic Modification of T Cells.", BIOMEDICINES, vol. 4, 2016 |
MORGAN ET AL.: "Genetic Modification of T Cells.", BIOMEDICINES, vol. 4, 2016 |
MORGANBOYERINAS: "Genetic Modification of T Cells", BIOMEDICINES, pages 4 |
MUHAMMAD ET AL.: "Chimeric Antigen Receptor Based Therapy as a Potential Approach in Autoimmune Diseases: How Close Are We to the Treatment", FRONTIERS IN IMMUNOLOGY, 2020, pages 11 |
NAKAMURA ET AL., , NUCL. ACIDS RES., vol. 28, 2000, pages 292 |
NASO ET AL.: ", Adeno-Associated Virus (AAV) as a Vector for Gene Therapy.", BIODRUGS, vol. 31, 2017, pages 317 - 334, XP055547503, DOI: 10.1007/s40259-017-0234-5 |
NAT BIOTECHNOL, vol. 38, 2020, pages 509 - 511 |
NAYEROSSADAT N. ET AL., ADV. BIOMED. RES., vol. 1, 2012, pages 27 |
PHILADELPHIAMURPHY ET AL.: "Treatment, and Recovery", 1997, PENGUIN BOOKS U.S.A., INC., article "Informed Decisions: The Complete Book of Cancer Diagnosis" |
PLASTERK ET AL., TRENDS GENET, vol. 15, 1999, pages 326 - 32 |
QUERQUES ET AL.: "Gene editing for immune cell therapies.", NAT BIOTECHNOL, vol. 37, 2019, pages 1425 - 1434 |
QUINLANHALL, BIOINFORMATICS, vol. 26, 2010, pages 841 - 842 |
ROSENZWEIG B ET AL., NUCLEIC ACIDS RES, vol. 11, 1983, pages 4201 - 9 |
ROTH ET AL.: ", Pooled Knockin Targeting for Genome Engineering of Cellular Immunotherapies.", CELL, vol. 181, 2020, pages 728 - 744 |
ROTH ET AL.: ", Reprogramming human T cell function and specificity with non-viral genome targeting.", NATURE, vol. 559, 2018, pages 405 - 409, XP036544239, DOI: 10.1038/s41586-018-0326-5 |
ROTH ET AL.: "Reprogramming human T cell function and specificity with non-viral genome targeting.", NATURE, vol. 559, 2018, pages 405 - 409, XP036544239, DOI: 10.1038/s41586-018-0326-5 |
SHAH ET AL.: ", Bispecific anti-CD20, anti-CD19 CAR T cells for relapsed B cell malignancies: a phase 1 dose escalation and expansion trial.", NAT MED, vol. 26, 2020, pages 1569 - 1575, XP037263516, DOI: 10.1038/s41591-020-1081-3 |
STRAATHOF ET AL.: "An inducible caspase 9 safety switch for T-cell therapy.", BLOOD, vol. 105, 2005, pages 4247 - 4254, XP008126232, DOI: 10.1182/blood-2004-11-4564 |
TANG, X. ET AL.: "First-in-man clinical trial of CAR NK-92 cells: safety test of CD33-CAR NK-92 cells in patients with relapsed and refractory acute myeloid leukemia.", AM J CANCER RES, vol. 8, 2018, pages 1083 - 1089, XP055545365 |
THEMELI ET AL.: "Generation of tumor-targeted human T lymphocytes from induced pluripotent stem cells for cancer therapy.", NAT BIOTECHNOL, vol. 31, 2013, pages 928 - 933, XP055485171, DOI: 10.1038/nbt.2678 |
THOMAS ET AL.: "NY-ESO-1 Based Immunotherapy of Cancer: Current Perspectives.", FRONT IMMUNOL, vol. 9, 2018, pages 947 |
TOSI LRBEVERLEY SM, NUCLEIC ACIDS RES., vol. 28, 2000, pages 784 - 90 |
TSAI ET AL.: "CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-Cas9 nuclease off-targets.", NAT METHODS, vol. 14, 2017, pages 607 - 614, XP055424040, DOI: 10.1038/nmeth.4278 |
TSAI ET AL.: "GUIDE-seq enables genome-wide profiling of off-target cleavage by CRISPR-Cas nucleases.", NAT BIOTECHNOL, vol. 33, 2015, pages 187 - 197, XP055555627, DOI: 10.1038/nbt.3117 |
UPADHAYA ET AL.: "The clinical pipeline for cancer cell therapies.", NAT REV DRUG DISCOV, vol. 20, 2021, pages 503 - 504, XP037497160, DOI: 10.1038/d41573-021-00100-z |
VERDEGAAL ET AL.: "Neoantigen landscape dynamics during human melanoma-T cell interactions.", NATURE, vol. 536, 2016, pages 91 - 95, XP037556000, DOI: 10.1038/nature18945 |
WILSON ET AL., , JR. PIGGYBAC TRANSPOSON-MEDIATED GENE TRANSFER IN HUMAN CELLS. MOL THER, vol. 15, 2007, pages 139 - 145 |
YANT ET AL.: "Mutational analysis of the N-terminal DNA-binding domain of sleeping beauty transposase: critical residues for DNA binding and hyperactivity in mammalian cells.", MOL CELL BIOL., vol. 24, no. 20, October 2004 (2004-10-01), pages 9239 - 47, XP002466097, DOI: 10.1128/MCB.24.20.9239-9247.2004 |
YE ET AL.: "In vivo CRISPR screening in CD8 T cells with AAV-Sleeping Beauty hybrid vectors identifies membrane targets for improving immunotherapy for glioblastoma.", NAT BIOTECHNOL, vol. 37, 2019, pages 1302 - 1313 |
YIN ET AL., ,GENOME BIOL, vol. 13, 2012 |
ZHANG ET AL.: "Hybrid adeno-associated viral vectors utilizing transposase-mediated somatic integration for stable transgene expression in human cells.", PLOS ONE, vol. 8, 2013, pages e76771, XP055225378, DOI: 10.1371/journal.pone.0076771 |
ZHANG ET AL.: "Pluripotent stem cell-derived CAR-macrophage cells with antigen-dependent anti-cancer cell functions.", J HEMATOL ONCOL, vol. 13, 2020, pages 153, XP093025521, DOI: 10.1186/s13045-020-00983-2 |
ZHANG ET AL.: "Synergistic Effects of Cabozantinib and EGFR-Specific CAR-NK-92 Cells in Renal Cell Carcinoma.", J IMMUNOL RES, 2017, pages 6915912 |
ZSUZSANNA IZSVÁK ET AL: "Sleeping Beauty Transposition: Biology and Applications for Molecular Therapy", MOLECULAR THERAPY, ELSEVIER INC, US, vol. 9, no. 2, 1 February 2004 (2004-02-01), pages 147 - 156, XP002622340, ISSN: 1525-0016, DOI: 10.1016/J.YMTHE.2003.11.009 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20210388389A1 (en) | Compositions and methods for rapid and modular generation of chimeric antigen receptor t cells | |
CN112204148B (zh) | 具有增强功能的修饰的免疫细胞及其筛选方法 | |
JP7399866B2 (ja) | CARTyrin組成物とその利用方法 | |
ES2781073T3 (es) | Receptores de antígenos quiméricos del promotor MND | |
US20190241910A1 (en) | Genome edited immune effector cells | |
JP2020530307A (ja) | 遺伝子治療のためのアデノ随伴ウイルスベクター | |
US20230061455A1 (en) | Methods, compositions and components for crispr-cas9 editing of tgfbr2 in t cells for immunotherapy | |
KR20190038479A (ko) | 유전자 조작된 세포 및 그의 제조방법 | |
WO2017177137A1 (fr) | Compositions de lymphocytes t récepteurs d'antigènes chimériques | |
CN110913871A (zh) | 生成哺乳动物t细胞活化诱导型合成启动子(syn+pro)以改善t细胞疗法 | |
WO2021197391A1 (fr) | Procédé de préparation d'une cellule immunitaire modifiée | |
KR102249982B1 (ko) | 트랜스포존 시스템, 이를 포함한 키트, 및 이들의 용도 | |
KR20230029603A (ko) | 필수 유전자 녹-인에 의한 선택 | |
JP2023182711A (ja) | 免疫療法のためのt細胞におけるcblbのcrispr-cas9編集のための方法、組成物および構成要素 | |
KR20210120019A (ko) | 세포-특이적 전사 조절 서열 및 이의 용도 | |
WO2022012531A1 (fr) | Procédé de préparation d'une cellule immunitaire modifiée | |
WO2023173137A1 (fr) | Compositions et méthodes de modification génétique efficace et stable de cellules eucaryotes | |
Lucibello et al. | Methods to edit T cells for cancer immunotherapy | |
US20230302134A1 (en) | Compositions and methods for engineering and selection of car t cells with desired phenotypes | |
Mosti | Generation of safe CAR T cells to target B cell malignancies | |
KR20240090127A (ko) | 개선된 면역치료법을 위한 방법 및 조성물 | |
WO2024062138A1 (fr) | Cellules immunitaires comprenant un gène suv39h1 modifié | |
WO2023126458A1 (fr) | Cellules immunitaires avec suv39h1 inactivé et tcr modifié | |
WO2024064824A2 (fr) | Compositions et procédés d'identification de cibles membranaires pour l'amélioration d'une thérapie par cellules nk |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23715392 Country of ref document: EP Kind code of ref document: A1 |