WO2023133424A2 - Compositions et mé de reprogrammation de tcr à l'aide de protéines de fusion et de peptides de fusion anti-pd-1 - Google Patents

Compositions et mé de reprogrammation de tcr à l'aide de protéines de fusion et de peptides de fusion anti-pd-1 Download PDF

Info

Publication number
WO2023133424A2
WO2023133424A2 PCT/US2023/060117 US2023060117W WO2023133424A2 WO 2023133424 A2 WO2023133424 A2 WO 2023133424A2 US 2023060117 W US2023060117 W US 2023060117W WO 2023133424 A2 WO2023133424 A2 WO 2023133424A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
seq
amino acid
nucleic acid
recombinant nucleic
Prior art date
Application number
PCT/US2023/060117
Other languages
English (en)
Other versions
WO2023133424A3 (fr
Inventor
Vania E. Ashminova
Michael Lofgren
Dana GILMORE
Derrick Mccarthy
Dario Gutierrez
Michelle FLEURY
Original Assignee
TCR2 Therapeutics Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by TCR2 Therapeutics Inc. filed Critical TCR2 Therapeutics Inc.
Publication of WO2023133424A2 publication Critical patent/WO2023133424A2/fr
Publication of WO2023133424A3 publication Critical patent/WO2023133424A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4611—T-cells, e.g. tumor infiltrating lymphocytes [TIL], lymphokine-activated killer cells [LAK] or regulatory T cells [Treg]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/4643—Vertebrate antigens
    • A61K39/4644—Cancer antigens
    • A61K39/464466—Adhesion molecules, e.g. NRCAM, EpCAM or cadherins
    • A61K39/464468—Mesothelin [MSLN]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES

Definitions

  • a target can be the programmed cell death (PD-1) receptor, which is expressed on the surface of activated T cells and leads to an intracellular inhibitory signal when bound to one of its ligands, PD-L1 and PD-L2.
  • PD-1 has been shown to play a role in cancer.
  • expression of PD-1 and/or PD- L1 has been found in a number of primary tumor biopsies assessed by immunohistochemistry.
  • Such tissues include cancers of the lung, liver, ovary, cervix, skin, colon, glioma, bladder, breast, kidney, esophagus, stomach, oral squamous cell, urothelial cell, and pancreas as well as tumors of the head and neck.
  • Human T cell therapies rely on enriched or modified human T cells to target and kill cancer cells in a patient.
  • methods have been developed to engineer T cells to express constructs which direct T cells to a particular target cancer cell.
  • the PD-1 antibody described herein can be fused to an enhancing domain to generate an anti-PD-1 fusion peptide.
  • the anti-PD-1 fusion peptide can have increased cytotoxicity.
  • the enhancing domain can be an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof, an interleukin-15 (IL-15) polypeptide or fragment thereof, or an IL-12 polypeptide or fragment thereof.
  • the fragment can be a functional fragment.
  • the antibodies or the fusion peptides that target PD-1 can be used in combination with engineered T- cell receptor such as the T-cell receptor fusion protein (TFP) described herein.
  • such PD-1 antibodies when said PD-1 antibody is expressed in, and secreted from, the same cell as the TFP-expressing T-cell, such PD-1 antibodies can serve to antagonize PD-1 both in the TFP T-cells and also in nearby cytotoxic T-cells, thereby inducing PD-1 blockade in PD-1 expressing cytotoxic T-cells local to the cancer cells having the tumor antigen targeted by the TFP T-cells.
  • the antibodies or the fusion peptides that target PD-1 can be secreted from the cell.
  • the present disclosure provides a recombinant nucleic acid comprising a sequence encoding an anti-PD-1 fusion peptide comprising (i) an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; and (ii) an interleukin-15 (IL-15) polypeptide or fragment thereof; wherein the anti-PD-1 antibody or fragment thereof and the IL-15 polypeptide or fragment thereof are operatively linked.
  • an anti-PD-1 fusion peptide comprising (i) an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; and (ii) an interleukin-15 (IL-15) polypeptide or fragment thereof; wherein the anti-PD-1 antibody or fragment thereof and the IL-15 polypeptide or fragment thereof are operatively linked
  • the present disclosure provides a recombinant nucleic acid comprising a sequence encoding an anti-PD-1 fusion peptide comprising (i) an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; (ii) an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof; and (iii) an interleukin-15 (IL-15) polypeptide or fragment thereof; wherein the anti-PD-1 antibody or fragment thereof, the IL-15R subunit polypeptide or a fragment thereof, and the IL-15 polypeptide or fragment thereof are operatively linked.
  • an anti-PD-1 fusion peptide comprising (i) an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; (ii)
  • the anti-PD-1 fusion peptide is secreted.
  • the IL-15R subunit polypeptide or fragment thereof is a IL-15R alpha (IL-15R ⁇ ) or fragment thereof.
  • the IL-15R subunit polypeptide or fragment thereof comprises a IL-15R alpha fragment (IL-15R ⁇ RD domain).
  • the IL-15R subunit polypeptide or fragment thereof comprises a sequence of SEQ ID NO: 341.
  • the IL-15 polypeptide or fragment thereof is a human IL-15 polypeptide or fragment thereof.
  • the IL-15 polypeptide or fragment thereof comprises a sequence of SEQ ID NO: 345, SEQ ID NO: 245, SEQ ID NO: 452, or SEQ ID NO: 455.
  • the anti-PD-1 fusion peptide comprises, from N-terminal to C- terminal, the anti-PD-1 antibody or fragment thereof operatively linked to the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof.
  • the anti-PD-1 fusion peptide comprises, from N-terminal to C- terminal, the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof.
  • the anti-PD-1 antibody or fragment thereof is operatively linked to the IL-15R subunit polypeptide or a fragment thereof via a first linker.
  • the first linker comprises a sequence of SEQ ID NO: 349.
  • the IL-15R subunit polypeptide or a fragment thereof is operatively linked to the IL-15 polypeptide or fragment thereof via a second linker.
  • the second linker comprises a sequence of SEQ ID NO: 343, SEQ ID NO: 355, or SEQ ID NO: 459.
  • the IL-15 polypeptide or fragment thereof is operatively linked to the anti-PD-1 antibody or fragment thereof via a third linker.
  • the third linker comprises a sequence of SEQ ID NO: 349 or SEQ ID NO: 417.
  • the anti-PD-1 fusion peptide further comprises a 4-1BB ligand ectodomain (4-1BBL ECD). [0023] In some embodiments, the anti-PD-1 fusion peptide further comprises two or more 4- 1BBL ECDs. [0024] In some embodiments, the anti-PD-1 fusion peptide further comprises three 4-1BBL ECDs. [0025] In some embodiments, the 4-1BBL ECD comprises a sequence of SEQ ID NO: 421.
  • the anti-PD-1 fusion peptide comprises, from N-terminal to C- terminal, the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof operatively linked to the 4-1BBL ECD.
  • the anti-PD-1 fusion peptide comprises, from N-terminal to C- terminal, the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof operatively linked to three consecutively linked 4-1BBL ECDs.
  • the anti-PD-1 antibody or fragment thereof operatively linked to the 4-1BBL ECD via a linker.
  • the linker comprises a sequence of SEQ ID NO: 419.
  • the two or more 4-1BBL ECDs are linked by a linker.
  • the linker comprises a sequence of SEQ ID NO: 400.
  • the recombinant nucleic acid further comprises a sequence encoding a His tag, a HA tag, a hFc tag or a combination thereof.
  • the recombinant nucleic acid further comprises a sequence encoding a HA tag followed by a His tag.
  • the HA tag comprises a sequence of SEQ ID NO: 313.
  • the His tag comprises a sequence of SEQ ID NO: 407.
  • the present disclosure provides a recombinant nucleic acid comprising a sequence encoding a first anti-PD-1 fusion peptide comprising (i) a first anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the first anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; and (ii) an IL-12 polypeptide or functional fragment thereof, wherein the first anti-PD-1 antibody or fragment thereof and the IL- 12 polypeptide or functional fragment thereof are operatively linked.
  • the first anti-PD-1 fusion peptide is secreted.
  • the IL-12 polypeptide or functional fragment thereof comprises a p40 subunit polypeptide or functional fragment thereof, a p35 subunit polypeptide or functional fragment thereof, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 311, an amino acid sequence with at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises the amino acid sequence of SEQ ID NO: 311, the amino acid sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 328, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises the amino acid sequence of SEQ ID NO: 328, the amino acid sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 310, an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 327, an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 327, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 332, an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 332, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises a p40 subunit polypeptide or functional fragment thereof operatively linked to a p35 subunit polypeptide or functional fragment thereof.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the p35 subunit polypeptide or functional fragment thereof via a first linker.
  • the first linker comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 401.
  • the first linker comprises the sequence of SEQ ID NO: 401.
  • the first linker comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 329. [0054] In some embodiments, the first linker comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 329. [0055] In some embodiments, the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to the first anti-PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof is operatively linked to the p35 subunit polypeptide or functional fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the p40 subunit polypeptide or functional fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the first anti- PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide further comprises a second anti- PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the second anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2.
  • the first anti-PD-1 antibody or fragment thereof and the second anti-PD-1 antibody or fragment thereof are same.
  • the first anti-PD-1 antibody or fragment thereof and the second anti-PD-1 antibody or fragment thereof are different.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to the first anti-PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the second anti-PD-1 antibody or fragment thereof.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the p35 subunit polypeptide or functional fragment thereof via a first linker.
  • the first linker comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 401. [0063] In some embodiments, the first linker comprises the sequence of SEQ ID NO: 401. [0064] In some embodiments, the first linker comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 329. [0065] In some embodiments, the first linker comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 329.
  • the recombinant nucleic acid further comprises a second nucleic acid sequence encoding a second anti-PD-1 fusion peptide comprising a third anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the third anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2.
  • the first anti-PD-1 antibody or fragment thereof and the third anti- PD-1 antibody or fragment thereof are same.
  • the first anti-PD-1 antibody or fragment thereof and the third anti- PD-1 antibody or fragment thereof are different.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the p40 subunit polypeptide or functional fragment thereof operatively linked to the first anti-PD-1 antibody or fragment thereof
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to a third anti-PD-1 antibody or fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof.
  • the p35 subunit polypeptide or functional fragment thereof further comprises a transmembrane domain of a CD3 epsilon TCR subunit or functional fragments thereof.
  • the sequence encoding the first anti-PD-1 fusion peptide and the second nucleic acid sequence are present on different nucleic acid molecules. [0072] In some embodiments, the sequence encoding the first anti-PD-1 fusion peptide and the second nucleic acid sequence are expressed in the same operon. [0073] In some embodiments, the sequence encoding the first anti-PD-1 fusion peptide and the second nucleic acid sequence are operatively linked by a sequence encoding a second linker. [0074] In some embodiments, the second linker comprises a protease cleavage site. [0075] In some embodiments, the protease cleavage site is a 2A cleavage site.
  • the 2A cleavage site is a T2A cleavage site or a P2A cleavage site.
  • the 2A cleavage site comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 362.
  • the 2A cleavage site comprises the amino acid sequence of SEQ ID NO: 362.
  • the 2A cleavage site comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 322.
  • the 2A cleavage site comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 322.
  • the recombinant nucleic acid further comprises a sequence encoding a His tag, a HA tag, a cMyc tag or a combination thereof.
  • the recombinant nucleic acid further comprises a sequence encoding the cMyc tag followed by the His tag.
  • the recombinant nucleic acid further comprises a sequence encoding the HA tag followed by the His tag.
  • the cMyc tag comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 307. [0085] In some embodiments, the cMyc tag comprises the amino acid sequence of SEQ ID NO: 307. [0086] In some embodiments, the cMyc tag comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 306. [0087] In some embodiments, the cMyc tag comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 306. [0088] In some embodiments, the HA tag comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 313.
  • the HA tag comprises the amino acid sequence of SEQ ID NO: 313. [0090] In some embodiments, the HA tag comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 312. [0091] In some embodiments, the HA tag comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 312. [0092] In some embodiments, the His tag comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 407. [0093] In some embodiments, the His tag comprises the amino acid sequence of SEQ ID NO: 407.
  • the His tag comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 314.
  • the His tag comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 314.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently comprise a variable domain comprising a complementarity determining region 1 (CDR1), a CDR2, and a CDR3, wherein the CDR3 comprises the amino acid sequence of SEQ ID NO:3.
  • the CDR1 comprises the amino acid sequence of SEQ ID NO:1.
  • the CDR2 comprises the amino acid sequence of SEQ ID NO:2.
  • the variable domain comprises an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:4.
  • the variable domain comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:4.
  • the variable domain comprises the amino acid sequence of SEQ ID NO:4.
  • the variable domain is encoded by the nucleic acid sequence of SEQ ID NO:20.
  • variable domain comprises an amino acid sequence having at least 80% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 5-8. [0104] In some embodiments, the variable domain comprises an amino acid sequence having at least 90% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 5-8. [0105] In some embodiments, the variable domain comprises an amino acid sequence having at least 95% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 5-8. [0106] In some embodiments, the variable domain comprises the amino acid sequence of SEQ ID NO:5. [0107] In some embodiments, the variable domain is encoded by the nucleic acid sequence of SEQ ID NO:21.
  • variable domain comprises the amino acid sequence of SEQ ID NO:6.
  • variable domain is encoded by the nucleic acid sequence of SEQ ID NO:22.
  • variable domain comprises the amino acid sequence of SEQ ID NO:7.
  • variable domain is encoded by the nucleic acid sequence of SEQ ID NO:23.
  • variable domain comprises the amino acid sequence of SEQ ID NO:8.
  • the variable domain is encoded by the nucleic acid sequence of SEQ ID NO:24.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently bind to human PD-1.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently bind to human PD-1 with a KD value of about 1 to about 60 nM.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently bind to human PD-1 with a KD value of at most 55 nM.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently are an antagonist.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently are a PD-1 inhibitor.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently compete with PD-L1 for binding to PD-1, inhibits PD-L1 from interacting with PD-1, and/or binds to the same epitope of PD-1 to which PD-L1 binds.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently block an immune checkpoint or blocks immune checkpoint signaling.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently are an immune checkpoint inhibitor or inhibits immune checkpoint signaling.
  • the recombinant nucleic acid promotes anti-tumor activity or inhibits inhibition of anti-tumor activity when expressed in a T cell.
  • the recombinant nucleic acid promotes T cell mediated tumor cell killing or inhibits inhibition of T cell mediated tumor cell killing when expressed in a T cell.
  • the recombinant nucleic acid inhibits tumor growth when expressed in a T cell.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently are a human or humanized antibody or fragment thereof.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently are a single domain antibody (sdAb).
  • the sdAb is a V HH .
  • the VHH is Fc conjugated.
  • the Fc is an effector-function silent IgG4.
  • the anti-PD-1 fusion peptide, the first anti-PD-1 fusion peptide, and the second anti-PD-1 fusion peptide independently further comprises a signal sequence or a leader sequence.
  • the signal sequence or the leader sequence is a IgGk signal peptide, an IL-15R ⁇ signal peptide, or a GM-CSFR leader sequence, or a p40 leader sequence.
  • the signal sequence or the leader sequence comprises an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 303, SEQ ID NO: 339, SEQ ID NO: 359 or SEQ ID NO: 451.
  • the signal sequence comprises the amino acid sequence of SEQ ID NO: 303, SEQ ID NO: 339, SEQ ID NO: 359 or SEQ ID NO: 451.
  • the anti-PD-1 antibody or fragment thereof, the first anti-PD-1 antibody or fragment thereof, the second anti-PD-1 antibody or fragment thereof, and the third anti-PD-1 antibody or fragment thereof independently bind to PD-1 on the surface of the T cell, PD-1 on the surface of a bystander T cell, or a combination thereof.
  • the anti-PD-1 fusion peptide comprises a IgGk signal peptide, an anti-PD-1 antibody or fragment thereof, a first linker, a IL-15R ⁇ RD domain, a second linker, a IL-15 polypeptide, a HA tag and a His tag.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, a IgGk signal peptide, operatively linked to an anti-PD-1 antibody or fragment thereof, operatively linked to an IL-15R ⁇ RD domain via a first linker, operatively linked to a IL-15 polypeptide via a second linker, operatively linked to a HA tag, and operatively linked to a His tag.
  • the anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 303, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 6, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 349, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 341, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 343, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 345, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 313, and an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 349 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 341 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 343 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 345 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 313 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises an amino acid sequence of SEQ ID NO: 303, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 349, an amino acid sequence of SEQ ID NO: 341, an amino acid sequence of SEQ ID NO: 343, an amino acid sequence of SEQ ID NO: 345, an amino acid sequence of SEQ ID NO: 313, and an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, an amino acid sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence of SEQ ID NO: 349 operatively linked to an amino acid sequence of SEQ ID NO: 341 operatively linked to an amino acid sequence of SEQ ID NO: 343 operatively linked to an amino acid sequence of SEQ ID NO: 345 operatively linked to an amino acid sequence of SEQ ID NO: 313 operatively linked to an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 347. [0142] In some embodiments, the anti-PD-1 fusion peptide comprises an amino acid sequence of SEQ ID NO: 347. [0143] In some embodiments, the anti-PD-1 fusion peptide comprises a IL15R ⁇ signal peptide, an IL-15R ⁇ RD domain, a first linker, an IL-15 polypeptide, a second linker, an anti-PD-1 antibody or fragment thereof, a HA tag and a His tag.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, an IL15R ⁇ signal peptide, operatively linked to an IL-15R ⁇ RD domain operatively linked to an IL-15 polypeptide via a first linker operatively linked to an anti-PD-1 antibody or fragment thereof via a second linker, operatively linked to a HA tag, operatively linked to a His tag.
  • the anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 339, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 341, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 355, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 345, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 349, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 6, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 313, and an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 339 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 341 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 355 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 345 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 349 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 313 operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises an amino acid sequence of SEQ ID NO: 339, an amino acid sequence of SEQ ID NO: 341, an amino acid sequence of SEQ ID NO: 355, an amino acid sequence of SEQ ID NO: 345, an amino acid sequence of SEQ ID NO: 349, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 313, and an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, an amino acid sequence of SEQ ID NO: 339 operatively linked to an amino acid sequence of SEQ ID NO: 341 operatively linked to an amino acid sequence of SEQ ID NO: 355 operatively linked to an amino acid sequence of SEQ ID NO: 345 operatively linked to an amino acid sequence of SEQ ID NO: 349 operatively linked to an amino acid sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence of SEQ ID NO: 313 operatively linked to an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 351. [0150] In some embodiments, the anti-PD-1 fusion peptide comprises an amino acid sequence of SEQ ID NO: 351. [0151] In some embodiments, the anti-PD-1 fusion peptide further comprises a 4-1BBL ECD.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, an IL15R ⁇ signal peptide, operatively linked to an IL-15R ⁇ RD domain operatively linked to an IL-15 polypeptide via a first linker operatively linked to an anti-PD-1 antibody or fragment thereof via a second linker, operatively linked to a 4-1BBL ECD via a third linker, operatively linked to a HA tag, operatively linked to a His tag.
  • the anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 339, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 341, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 343, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 345, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 417, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 6, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 419, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 421, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 313, and an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 339, operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 341, operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 343, operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 345, operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 417, operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 6, operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 419, operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 421, operatively linked to an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 313, operatively linked to an amino acid sequence
  • the anti-PD-1 fusion peptide comprises an amino acid sequence of SEQ ID NO: 339, an amino acid sequence of SEQ ID NO: 341, an amino acid sequence of SEQ ID NO: 343, an amino acid sequence of SEQ ID NO: 345, an amino acid sequence of SEQ ID NO: 417, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 419, an amino acid sequence of SEQ ID NO: 421, an amino acid sequence of SEQ ID NO: 313, and an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, an amino acid sequence of SEQ ID NO: 339, operatively linked to an amino acid sequence of SEQ ID NO: 341, operatively linked to an amino acid sequence of SEQ ID NO: 343, operatively linked to an amino acid sequence of SEQ ID NO: 345, operatively linked to an amino acid sequence of SEQ ID NO: 417, operatively linked to an amino acid sequence of SEQ ID NO: 6, operatively linked to an amino acid sequence of SEQ ID NO: 419, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 313, operatively linked to an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 414. [0158] In some embodiments, the anti-PD-1 fusion peptide comprises an amino acid sequence of SEQ ID NO: 414. [0159] In some embodiments, the anti-PD-1 fusion peptide comprises three tandemly linked 4- 1BBL ECDs.
  • the anti-PD-1 fusion peptide comprises, from N-terminus to C- terminus, an amino acid sequence of SEQ ID NO: 339, operatively linked to an amino acid sequence of SEQ ID NO: 341, operatively linked to an amino acid sequence of SEQ ID NO: 343, operatively linked to an amino acid sequence of SEQ ID NO: 345, operatively linked to an amino acid sequence of SEQ ID NO: 417, operatively linked to an amino acid sequence of SEQ ID NO: 6, operatively linked to an amino acid sequence of SEQ ID NO: 419, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 400, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 400, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 400, operatively linked to an amino acid sequence of SEQ
  • the anti-PD-1 fusion protein comprises an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 423.
  • the anti-PD-1 fusion protein comprises an amino acid sequence of SEQ ID NO: 423.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 328, and an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 328 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305.
  • the amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 328 via an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises the sequence of SEQ ID NO: 303, the sequence of SEQ ID NO: 324, the sequence of SEQ ID NO: 328, and the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the sequence of SEQ ID NO: 303 operatively linked to the sequence of SEQ ID NO: 324 operatively linked to the sequence of SEQ ID NO: 328 operatively linked to the sequence of SEQ ID NO: 305.
  • the sequence of SEQ ID NO: 324 is operatively linked to the sequence of SEQ ID NO: 328 via the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 332 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 304.
  • the nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 332 via a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 325.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 332 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the nucleotide sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence of SEQ ID NO: 332 via a nucleotide sequence of SEQ ID NO: 325.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 441 or SEQ ID NO: 443. [0174] In some embodiments, the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 441 or SEQ ID NO: 443. [0175] In some embodiments, the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 440 or SEQ ID NO: 442.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 440 or SEQ ID NO: 442. [0177] In some embodiments, the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 311, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305, and an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 6.
  • the amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305 is operatively linked to the amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 6 via an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 311, the amino acid sequence of SEQ ID NO: 305, and the amino acid sequence of SEQ ID NO: 6. [0181] In some embodiments, the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6. [0182] In some embodiments, the amino acid sequence of SEQ ID NO: 305 is operatively linked to the amino acid sequence of SEQ ID NO: 6 via an amino acid sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 22.
  • the nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 304 is operatively linked to the nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 22 via a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 335.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the nucleotide sequence of SEQ ID NO: 304 is operatively linked to the nucleotide sequence of SEQ ID NO: 22 via the nucleotide sequence of SEQ ID NO: 335.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 445 or SEQ ID NO: 447.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 445 or SEQ ID NO: 447.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 444 or SEQ ID NO: 446. [0190] In some embodiments, the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 444 or SEQ ID NO: 446.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 328, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305, and an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 328 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 6.
  • the amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 328 via an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 303, the amino acid sequence of SEQ ID NO: 324, the amino acid sequence of SEQ ID NO: 328, the amino acid sequence of SEQ ID NO: 305, and the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the amino acid sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence of SEQ ID NO: 328 via the amino acid sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 327 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 22.
  • the nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 327 via a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 325.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the nucleotide sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence of SEQ ID NO: 327 via the nucleotide sequence of SEQ ID NO: 325.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 437 or SEQ ID NO: 439. [0202] In some embodiments, the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 437 or SEQ ID NO: 439. [0203] In some embodiments, the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 436 or SEQ ID NO: 438.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 436 or SEQ ID NO: 438.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 311, and an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 6, and an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 311, and the amino acid sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 303, the amino acid sequence of SEQ ID NO: 6, and the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 22, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 309 or SEQ ID NO: 435
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 301 or SEQ ID NO: 433.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 309 or SEQ ID NO: 435
  • the second anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 301 or SEQ ID NO: 433.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 308 or SEQ ID NO: 434
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 300 or SEQ ID NO: 432.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 308 or SEQ ID NO: 434
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 300 or SEQ ID NO: 432.
  • the sequence encoding the anti-PD-1 fusion peptide or the first anti-PD-1 fusion peptide is a first sequence
  • the recombinant nucleic acid further comprises a second sequence encoding a T-cell receptor (TCR) fusion protein (TFP)
  • TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, (ii) a TCR transmembrane domain, and (iii)a TCR intracellular domain, and (b) a binding domain, and wherein the TCR subunit and the binding domain are operatively linked, and wherein the TFP functionally interacts with an endogenous TCR complex when expressed in a T cell.
  • the first sequence and the second sequence are contained in a single operon.
  • the first sequence and the second sequence are encoded in frame and the first sequence and the second sequence are operatively linked by a linker sequence.
  • the linker sequence encodes a protease cleavage site.
  • the protease cleavage site is a 2A cleavage site.
  • the 2A cleavage site is a T2A cleavage site or a P2A cleavage site.
  • the 2A cleavage site comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 362. [0222] In some embodiments, the 2A cleavage site comprises the amino acid sequence of SEQ ID NO: 362. [0223] In some embodiments, the 2A cleavage site comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 322. [0224] In some embodiments, the 2A cleavage site comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 322. [0225] In some embodiments, the linker sequence is operatively linked to the amino acid sequence of SEQ ID NO: 361.
  • the amino acid sequence of SEQ ID NO: 361 is encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 321. [0227] In some embodiments, the amino acid sequence of SEQ ID NO: 361 is encoded by the nucleotide sequence of SEQ ID NO: 321. [0228] In some embodiments, the first sequence and the second sequence are present on different nucleic acid molecules.
  • the sequence encoding the first anti-PD-1 fusion peptide is a first sequence
  • the sequence encoding the second anti-PD-1 fusion peptide is a second sequence
  • the recombinant nucleic acid further comprises a third sequence encoding a T-cell receptor (TCR) fusion protein (TFP) wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain, and (b) a binding domain, and wherein the TCR subunit and the binding domain are operatively linked, and wherein the TFP functionally interacts with an endogenous TCR complex when expressed in a T cell.
  • TCR T-cell receptor
  • the first sequence and the third sequence are contained in a single operon.
  • the first sequence and the third sequence are encoded in frame and the first sequence and the second sequence are operatively linked by a linker sequence.
  • the second sequence and the third sequence are contained in a single operon.
  • the second sequence and the third sequence are encoded in frame and the second sequence and the third sequence are operatively linked by a linker sequence.
  • the linker sequence encodes a protease cleavage site.
  • the protease cleavage site is a 2A cleavage site.
  • the 2A cleavage site is a T2A cleavage site or a P2A cleavage site.
  • the 2A cleavage site comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 362.
  • the 2A cleavage site comprises the amino acid sequence of SEQ ID NO: 362.
  • the 2A cleavage site comprises an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 322.
  • the 2A cleavage site comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 322.
  • the first sequence and the third sequence are present on different nucleic acid molecules.
  • the second sequence and the third sequence are present on different nucleic acid molecules.
  • the at least a portion of a TCR extracellular domain of the TFP comprises an extracellular domain or portion thereof of a protein selected from the group consisting of a TCR alpha chain, a TCR beta chain, TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, a CD3 delta TCR subunit, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications.
  • the TCR transmembrane domain of the TFP comprises a transmembrane domain of a protein selected from the group consisting of a TCR alpha chain, a TCR beta chain, TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, a CD3 delta TCR subunit, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications.
  • the TCR intracellular domain of the TFP comprises an intracellular domain of a protein selected from the group consisting of TCR alpha, TCR beta, TCR delta, TCR gamma, and amino acid sequences thereof having at least one but not more than 20 modifications.
  • the TCR intracellular domain of the TFP comprises a stimulatory domain from an intracellular signaling domain of CD3 gamma, CD3 delta, or CD3 epsilon, or an amino acid sequence having at least one modification thereto.
  • the TCR intracellular domain of the TFP does not comprise CD3 zeta.
  • the TFP does not comprise a costimulatory domain.
  • the binding domain is connected to the TCR extracellular domain by a linker sequence.
  • the linker is 120 amino acids in length or less.
  • the linker sequence comprises (G 4 S) n , wherein G is glycine, S is serine, and n is an integer from 1 to 10, e.g., 1 to 4.
  • at least of two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from the same TCR subunit.
  • At least of two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from TCR alpha.
  • at least of two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from TCR beta.
  • at least of two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from TCR gamma.
  • at least of two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from TCR delta.
  • At least of two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 epsilon. [0258] In some embodiments, at least of two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 delta. [0259] In some embodiments, at least of two of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 gamma. [0260] In some embodiments, all three of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from the same TCR subunit.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain comprise the constant domain of TCR alpha.
  • the constant domain of TCR alpha is murine.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain comprise the constant domain of TCR beta.
  • the constant domain of TCR beta is murine.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain comprise the constant domain of TCR gamma.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain comprise the constant domain of TCR delta.
  • the TCR subunit comprises the amino acid sequence of SEQ ID NO:57.
  • the TCR subunit comprises the amino acid sequence of SEQ ID NO:58.
  • the TCR subunit comprises the amino acid sequence of SEQ ID NO:59.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 epsilon.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 delta. [0272] In some embodiments, the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain are from CD3 gamma. [0273] In some embodiments, the binding domain comprises an antibody or a fragment thereof, a ligand, or a ligand binding protein. [0274] In some embodiments, the ligand or the antibody fragment comprises a scFv or a single domain antibody (sdAb) domain. [0275] In some embodiments, the sdAb is a VHH.
  • the antibody or fragment thereof is camelid, murine, human or humanized.
  • the antibody or fragment thereof comprises an antigen binding domain selected from the group consisting of an anti-CD19 binding domain, an anti-B-cell maturation antigen (BCMA) binding domain, and an anti-mesothelin (MSLN) binding domain, an anti-CD20 binding domain, an anti-CD70 binding domain, an anti-Nectin4 binding domain, an anti-GPC3 binding domain, an anti-Trop2 binding domain, and anti-MUC16 binding domain.
  • BCMA anti-B-cell maturation antigen
  • MSLN anti-mesothelin
  • the binding domain comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1 comprises an amino acid sequence of SEQ ID NO:60, SEQ ID NO:63, or SEQ ID NO:66; wherein the CDR2 comprises an amino acid sequence of SEQ ID NO:61, SEQ ID NO:64, or SEQ ID NO:67; and wherein the CDR3 comprises an amino acid sequence of SEQ ID NO:62, SEQ ID NO:65, or SEQ ID NO:68. [0279] In some embodiments, the binding domain comprises an amino acid sequence having at least 80% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 69-71.
  • the binding domain comprises an amino acid sequence of any one of the amino acid sequences of ID NOs: 69-71.
  • the antigen binding domain comprises an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:69.
  • the binding domain comprises the amino acid sequence of SEQ ID NO:69.
  • the binding domain comprises: (i) a light chain (LC) CDR1, LC CDR2, and LC CDR3 amino acid sequence of SEQ ID NO:26, SEQ ID NO:28, and SEQ ID NO:30, respectively; (ii) a heavy chain (HC) CDR1, HC CDR2, and HC CDR3 amino acid sequence of SEQ ID NO:32, SEQ ID NO:34, and SEQ ID NO:36, respectively; or (iii) a combination thereof.
  • LC light chain
  • HC CDR3 amino acid sequence of SEQ ID NO:26, SEQ ID NO:28, and SEQ ID NO:30 respectively
  • HC heavy chain
  • the binding domain comprises: (i) a light chain variable region comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:38; (ii) a heavy chain variable region comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:40; or (iii) a combination thereof. [0285] In some embodiments, the binding domain comprises: (i) a light chain variable region comprising the amino acid sequence of SEQ ID NO:38; (ii) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:40; or (iii) a combination thereof.
  • the binding domain comprises a CDR1 having an amino acid sequence of SEQ ID NO:204, a CDR2 having an amino acid sequence of SEQ ID NO:205; and a CDR3 having an amino acid sequence of SEQ ID NO:206.
  • the binding domain comprises a variable region having an amino acid sequence of SEQ ID NO:207.
  • the binding domain comprises: (i) a light chain (LC) CDR1, LC CDR2, and LC CDR3 amino acid sequence of SEQ ID NO:228, SEQ ID NO:229, and SEQ ID NO:230, respectively; (ii) a heavy chain (HC) CDR1, HC CDR2, and HC CDR3 amino acid sequence of SEQ ID NO:224, SEQ ID NO:225, and SEQ ID NO:226.
  • LC light chain
  • HC CDR3 amino acid sequence of SEQ ID NO:224 amino acid sequence of SEQ ID NO:224, SEQ ID NO:225, and SEQ ID NO:226.
  • the binding domain comprises: (i) a light chain variable region comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:231; (ii) a heavy chain variable region comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:227 or (iii) a combination thereof.
  • the TFP further comprises a leader sequence.
  • the leader sequence is a GM-CSFR leader sequence or a CSF2RA leader sequence.
  • the leader sequence comprises an amino acid sequence having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:359.
  • the leader sequence comprises the amino acid sequence of SEQ ID NO:359.
  • the second sequence encoding the TFP comprises an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 359, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 69, and an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 383.
  • the second sequence encoding the TFP comprises, from the N- terminus to the C-terminus, an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 359 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 69 operatively linked to an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 383.
  • the amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 69 is operatively linked to the amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 383 via an amino acid sequence with at least 80% sequence identity to the sequence of SEQ ID NO: 118.
  • the second sequence encoding the TFP comprises the amino acid sequence of SEQ ID NO: 359, the amino acid sequence of SEQ ID NO: 69, and the amino acid sequence of SEQ ID NO: 383.
  • the second sequence encoding the TFP comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 359 operatively linked to the amino acid sequence of SEQ ID NO: 69 operatively linked to the amino acid sequence of SEQ ID NO: 383.
  • the amino acid sequence of SEQ ID NO: 69 is operatively linked to the amino acid sequence of SEQ ID NO: 383 via the amino acid sequence of SEQ ID NO: 118.
  • the second sequence encoding the TFP comprises, from the N- terminus to the C-terminus, an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 317 operatively linked to an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 318 operatively linked to an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 320.
  • the amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 318 is operatively linked to the amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 320 via an amino acid sequence encoded by a nucleotide sequence with at least 40% sequence identity to the sequence of SEQ ID NO: 319.
  • the second sequence encoding the TFP comprises, from the N- terminus to the C-terminus, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 317 operatively linked to an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 318 operatively linked to an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 320.
  • the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 318 is operatively linked to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 320 via an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 319.
  • the recombinant nucleic acid encodes an amino acid sequence with at least 80% sequence identity to any one of the sequences selected from SEQ ID NOs: 331, 334 and 316.
  • the recombinant nucleic acid encodes any one of the amino acid sequences selected from SEQ ID NOs: 331, 334 and 316.
  • the recombinant nucleic acid comprises a nucleotide sequence with at least 40% sequence identity to any one of the sequences selected from SEQ ID NOs: 330, 333, and 315. [0307] In some embodiments, the recombinant nucleic acid comprises any one of the nucleotide sequences selected from SEQ ID NOs: 330, 333, and 315. [0308] In some embodiments, the recombinant nucleic acid comprises a sequence encoding an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 429 or SEQ ID NO: 431.
  • the recombinant nucleic acid comprises a sequence encoding an amino acid sequence of SEQ ID NO: 429 or SEQ ID NO: 431. [0310] In some embodiments, the recombinant nucleic acid comprises a DNA or an RNA. [0311] In some embodiments, the recombinant nucleic acid comprises a nucleotide analog.
  • the nucleotide analog is selected from the group consisting of 2’- O-methyl, 2’-O-methoxyethyl (2’-O-MOE), 2’-O-aminopropyl, 2’-deoxy, 2’-deoxy-2’-fluoro, 2’- O-aminopropyl (2’-O-AP), 2'-O-dimethylaminoethyl (2’-O-DMAOE), 2’-O- dimethylaminopropyl (2’-O-DMAP), 2’-O-dimethylaminoethyloxyethyl (2’-O-DMAEOE), 2’-O- N-methylacetamido (2’-O-NMA) modified, a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1’,5’- anhydrohexitol nucleic acid (HNA),
  • LNA locked nucleic
  • the recombinant nucleic acid further comprises a promoter.
  • the recombinant nucleic acid is an in vitro transcribed nucleic acid.
  • the recombinant nucleic acid further comprises a sequence encoding a poly(A) tail.
  • the recombinant nucleic acid further comprises a 3’UTR sequence.
  • the present disclosure provides a vector comprising the recombinant nucleic acid described herein.
  • the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, a Rous sarcoma viral (RSV) vector, or a retrovirus vector.
  • the vector further comprises a promoter.
  • the vector is an in vitro transcribed vector.
  • a nucleic acid sequence in the vector further comprises a poly(A) tail.
  • a nucleic acid sequence in the vector further comprises a 3’UTR.
  • the present disclosure provides an anti-PD-1 fusion peptide encoded by the recombinant nucleic acid described herein or the vector described herein.
  • the anti-PD-1 fusion peptide is encoded by a recombinant nucleic acid further comprising a sequence encoding a T-cell receptor (TCR) fusion protein (TFP); wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain, and (b) a binding domain; and wherein the TCR subunit and the binding domain are operatively linked, and wherein the TFP functionally interacts with an endogenous TCR complex in the T cell.
  • TCR T-cell receptor
  • the present disclosure provides a cell comprising the recombinant nucleic acid described herein, the vector described herein, or the anti-PD-1 fusion peptide described herein.
  • the cell is a T cell.
  • the T cell is a human T cell.
  • the T cell is a CD8+ or CD4+ T cell.
  • the T cell is a human alpha beta T cell.
  • the T cell is a human gamma delta T cell.
  • the cell is a human NKT cell.
  • the present disclosure provides a pharmaceutical composition comprising the cell described herein and a pharmaceutically acceptable carrier.
  • the present disclosure provides a method of treating a disease or a condition in a subject in need thereof, comprising administering to the subject an effective amount of the pharmaceutical composition described herein.
  • the disease or the condition is a cancer or a disease or a condition associated with expression of CD19, B-cell maturation antigen (BCMA), mesothelin (MSLN), CD20, CD70, Nectin-4, GPC3, Trop-2, or MUC16.
  • the cancer is a hematologic cancer selected from the group consisting of B-cell acute lymphoid leukemia (B-ALL), T cell acute lymphoid leukemia (T- ALL), acute lymphoblastic leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt’s lymphoma, diffuse large B cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell-follicular lymphoma, large cell-follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma, Marginal zone lymphoma, multiple myeloma, myelodysplasia, myelodysplastic syndrome, non-Hodgkin’s lymphoma, plasmablastic
  • the cancer is mesothelioma, renal cell carcinoma, stomach cancer, breast cancer, lung cancer, ovarian cancer, prostate cancer, colon cancer, cervical cancer, brain cancer, liver cancer, pancreatic cancer, thyroid cancer, bladder cancer, ureter cancer, kidney cancer, endometrial cancer, esophageal cancer, gastric cancer, thymic carcinoma or cholangiocarcinoma.
  • the subject is a human.
  • the present disclosure provides a method of treating a subject in need thereof comprising administering to the subject (A) a T cell comprising a T-cell receptor (TCR) fusion protein (TFP); wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain, and (b) a binding domain; wherein the TCR subunit and the binding domain are operatively linked, and wherein the TFP functionally interacts with an endogenous TCR complex in the T cell; and (B) the anti-PD-1 fusion peptide described herein.
  • TCR T-cell receptor
  • the T cell comprises the TFP described herein.
  • the anti-PD-1 fusion peptide is administered before administering the T cell, concurrently with the T cell, or after administering the T cell.
  • the T cell, the anti-PD-1 fusion peptide, or a combination thereof is administered in one, two, three or more doses.
  • the present disclosure provides a method of increasing an activity of a cell expressing a recombinant nucleic acid comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), the method comprising expressing the anti-PD-1 fusion peptide encoded by the recombinant nucleic acid described herein in the cell: wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, and (ii) a TCR transmembrane domain, and (b) an antigen binding domain; and wherein the TCR subunit and the antigen binding domain are operatively linked.
  • TCR T cell receptor
  • the cell has enhanced cytotoxic activity compared to a cell that express the recombinant nucleic acid comprising the sequence encoding the TFP and does not express the anti-PD-1 fusion peptide encoded by the recombinant nucleic acid described herein.
  • the cell has increased cytokine production compared to a cell that express the recombinant nucleic acid comprising the sequence encoding the TFP and does not express the anti-PD-1 fusion peptide encoded by the recombinant nucleic acid described herein.
  • IFN ⁇ production, IL-2 production or a combination thereof by the cell is increased compared to a cell that express the recombinant nucleic acid comprising the sequence encoding the TFP and does not express the anti-PD-1 fusion peptide encoded by the recombinant nucleic acid described herein.
  • the present disclosure provides a method of enhancing a cytotoxic activity of a cell expressing a recombinant nucleic acid comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), the method comprising expressing the anti-PD-1 fusion peptide encoded by the recombinant nucleic acid described herein in the cell: wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, and (ii) a TCR transmembrane domain, and (b) an antigen binding domain; and wherein the TCR subunit and the antigen binding domain are operatively linked.
  • TCR T cell receptor
  • the present disclosure provides a method of increasing cytokine production by a cell expressing a recombinant nucleic acid comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), the method comprising expressing the anti-PD-1 fusion peptide encoded by the recombinant nucleic acid described herein in the cell: wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, and (ii) a TCR transmembrane domain, and (b) an antigen binding domain; and wherein the TCR subunit and the antigen binding domain are operatively linked.
  • TCR T cell receptor
  • TFP T cell receptor fusion protein
  • IFN ⁇ production, IL-2 production or a combination thereof by the cell is increased compared to a cell that express the recombinant nucleic acid comprising the sequence encoding the TFP and does not express the anti-PD-1 fusion peptide encoded by the recombinant nucleic acid described herein.
  • the present disclosure provides a method of increasing cell persistence of a cell expressing a recombinant nucleic acid comprising a sequence encoding a T cell receptor (TCR) fusion protein (TFP), the method comprising expressing the anti-PD-1 fusion peptide encoded by the recombinant nucleic acid described herein in the cell: wherein the TFP comprises: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, and (ii) a TCR transmembrane domain, and (b) an antigen binding domain; and wherein the TCR subunit and the antigen binding domain are operatively linked.
  • TCR T cell receptor
  • TFP T cell receptor fusion protein
  • FIG.1 is a schematic illustration of the PD-1/PD-L1 inhibitor assay described in Example 2.
  • FIGs.2A and 2B are graphs showing the ability of the anti-PD-1 VHH antibodies shown to inhibit the interaction of PD-1 and PD-L1 as determined by the PD-1/PD-L1 inhibitor assay described in Example 2.
  • FIG.3 is a series of graphs showing the results of the epitope binning experiment described in Example 2.
  • FIG.4 is a series of graphs showing the results of the octet assay measuring the KD of clone 51 (2PDE172) having a His or Fc tag, or Nivolomab, as is described in Example 3.
  • FIG.5 is a schematic illustration and a series of graphs showing staining of T cells induced to express PD-1 with dynabeads and IL-2 or dynabeads, IL-2 and TGF-beta by the clone 51 VHH antibody or by a commercial anti-PD-1 antibody, as is described in Example 3.
  • FIG.6 is a series of graphs showing the results of an SEB assay described in Example 3.
  • FIG.7 is a graph showing the fold inhibition of PD-1/PD-L1 binding achieved by clone 51 VHH, clone 51 VHH-Fc tag, control anti-PD-1 antibodies, or an hIgG1 control as determined by the PD-1/PD-L1 blockade assay described in Example 3.
  • FIGs.8A-8D are a series of graphs showing binding of clone 51 VHH (CDS parental and Hz and MD codon optimized versions) secreted from T cells binding to antigen presenting cells, as is described in Example 4.
  • FIG.9 is a series of graphs showing binding affinity of non-humanized and four humanized variants of clone 51 VHH as determined by octet assay as described in Example 5.
  • FIGs.10A and 10B show the characterization of humanized clone 51 h12 variants.
  • FIG. 10A is an SDS-page gel of the clone 51 h12 variants described in Example 6.
  • FIG.10B is a graph showing the results of an octet assay to determine the affinity of each of the variants for PD-1 as described in Example 6.
  • Samples shown are (i) clone 51 h12 VHH-hIgG4 tag; (ii) clone 51 h12 VHH- clone 51 h12 VHH – anti-HSA - SrtA tag-His tag; (iii) clone 51 h12 VHH-anti-HSA-SrtA tag-His tag; (iv) clone 51 h12 VHH- clone 51 h12 VHH - SrtA tag-His tag; and (v) clone 51 h12 VHH-SrtA tag-His tag, from top to bottom, at 200 nM PD-1 binder.
  • FIG.11 is a graph showing the mean expansion of three donors of T cells transduced with the constructs shown, as is described in Example 8.
  • FIGs.12A and 12B are a series of graphs showing transduction efficiency as determined by staining for VHH positive T cells transduced with the TFPs shown with an anti-VHH antibody, as is described in Example 8.
  • FIGs.13A-13E are a series of graphs showing phenotyping of T cells transduced with the TFPs shown by flow cytometry, as is described in Example 9.
  • FIGs.14A and 14B are a series of graphs showing VHH and PD-1 expression in T cells transduced with the TFPs shown by flow cytometry, as is described in Example 9.
  • FIG.15 is a series of graphs showing detection of anti-MSLN TFP by anti-VHH and an anti-idiotype antibody to anti-MSLN, as is described in Example 10.
  • FIG.16 is a graph showing transduction efficiency as determined by staining T cells transduced with the TFPs shown with an anti-anti-MSLN antibody by flow cytometry, as is described in Example 10.
  • FIGs.17A-17C are a series of graphs showing detection of anti-PD-1 binding to T-cells transduced with the TFP shown as determined by staining with an anti-HA or anti-Fc antibody by flow cytometry.
  • FIG.17A shows TFP+ T-cells.
  • FIG.17B shows TFP- T cells.
  • FIG.17C shows staining of untransduced T-cells when cultured with supernatants from T cells transduced with the TFPs shown.
  • FIG.18 is a graph showing cytotoxicity of TFP T-cells having the TFP shown when cultured with C30, msto-MSLN, or msto-MLSN-PD-L1 cells, as is described in Example 11.
  • FIGs.19A-19C are a series of graphs showing cytokine secretion of TFP T-cells having the TFP shown when cultured with C30, msto-MSLN, or msto-MLSN-PD-L1 cells, as is described in Example 12.
  • FIG.20 is a series of graphs showing expansion of three donors of T cells transduced with the constructs shown in Table 9.
  • FIG.21 is a series of plots and a graph showing transduction efficiency as determined by staining for VHH positive T cells transduced with the constructs shown with an anti-VHH antibody.
  • FIG.22 is a series of plots and a graph showing the CD4:CD8 T cell ratio of T cells transduced with the constructs shown as determined by flow cytometry. In the graph on the right, the proportion of CD8 T+ cells are shown at the top and the proportion of CD4+ T cells is shown at the bottom.
  • FIG.23 is a series of plots and a graph showing the memory phenotype of T cells transduced with the constructs shown as determined by detection of CD45RA and CCR7 by flow cytometry. In the graphs on the right, the proportion of TEMRA, TEM, TCM, and TNAIVE cells are shown from top to bottom.
  • FIG.24 is a series of plots and a graph showing detection of PD-1 expression in T cells transduced with the constructs shown with an anti-PD-1 antibody by flow cytometry.
  • FIG.25 is a series of plots and a graph showing detection of CD5 and CD25 expression in T cells transduced with the constructs shown by flow cytometry.
  • FIG.26 is a series of graph showing cytotoxicity of TFP T-cells having the constructs shown when cultured with C30, msto-MSLN, or msto-MLSN-PD-L1 cells.
  • FIG.27A and 27B are a series of graphs showing cytokine secretion of TFP T-cells having the constructs shown when cultured with msto-MSLN or msto-MLSN-PD-L1 cells.
  • FIG.28 is a schematic diagram illustrating cis and trans signaling through the anti-PD-1 switch constructs described herein.
  • FIG.29 is a schematic diagram illustrating the experimental protocol described in Example 16 to measure signaling in cis by the anti-PD-1 switch constructs described herein.
  • FIG.30 is a schematic diagram illustrating the experimental protocol described in Example 16 to measure signaling in cis and trans by the anti-PD-1 switch constructs described herein.
  • FIG.31 is a series of plots and a graph showing PD-1 expression in TFP T-cells having the constructs shown after incubation with or without plate bound MSLN and PD-1 in the assay described in Example 16. The graphs on the right show the proportion of PD-1+ CD4+ (in the top graph) TFP T cells and PD-1+ CD8+ TFP T cells (in the bottom graph).
  • FIG.32 is a series of graphs showing cytokine expression of TFP T-cells having the constructs shown after incubation with or without plate bound MSLN and PD-1 in the assay described in Example 16.
  • FIG.33 is a series of graphs showing the proportion of CD4+ TFP T cells having the constructs shown that are CD25+ or CD69+ after incubation with or without plate bound MSLN and PD-1 in the assay described in Example 16.
  • FIGs.34A and 34B are a series of plots and a graph showing PD-1 expression in TFP T- cells having the constructs shown after incubation with or without plate bound MSLN in the assay described in Example 17.
  • the graphs on the right show the proportion of PD- 1+ CD4+ (in the top graph) TFP T cells and PD-1+ CD8+ TFP T cells (in the bottom graph).
  • the graphs on the right show the MFI for PD-1+ CD4+ (in the top graph) TFP T cells and PD-1+ CD8+ TFP T cells (in the bottom graph).
  • FIG.34A and 34B For the graphs shown in FIG.34A and 34B, for each MSLN level, non-transduced cells, TC-210, TC-510, PD-1-41BB(IC), PDS-CD28(IC), hPDS-CD28(IC), hPDS-CD28(IC) #2, hPDS-41BB(IC), and 2X(hPDS)-CD28(IC) are shown from left to right.
  • FIGs.35A and 35B are a series of graphs showing cytokine expression of TFP T-cells having the constructs shown after incubation with or without plate bound MSLN, PD-1, and/or PD-L1 in the assay described in Example 17.
  • IFN- ⁇ and IL-2 levels are shown in FIG.35A and TNF- ⁇ and GM-CSF levels are shown in FIG.35B.
  • non-transduced cells TC-210, TC-510, PD-1-41BB(IC), PDS-CD28(IC), hPDS-CD28(IC), hPDS-CD28(IC) #2, hPDS-41BB(IC), and 2X(hPDS)-CD28(IC) are shown from left to right.
  • FIG.36 is a series of graphs showing the proportion of CD4+ TFP T-cells having the constructs shown that are CD25+ or CD69+ after incubation with or without plate bound MSLN, PD-1, and/or PD-L1 in the assay described in Example 17.
  • MSLN plate bound MSLN
  • PD-1 plate bound MSLN
  • PD-L1 plate bound MSLN
  • PD-L1 plate bound MSLN, PD-1, and/or PD-L1 in the assay described in Example 17.
  • non-transduced cells TC-210, TC-510, PD-1-41BB(IC), PDS-CD28(IC), hPDS-CD28(IC), hPDS-CD28(IC) #2, hPDS-41BB(IC), and 2X(hPDS)-CD28(IC) are shown from left to right.
  • FIG.37 is a series of graphs showing cytokine expression of TFP T-cells from donor R020 having the constructs shown after incubation with or without plate bound MSLN and/or PD-1 in the assay described in Example 18.
  • MSLN level non-transduced cells, TC-210, TC-510, PD-1-41BB(IC), hPDS-CD28(IC), hPDS-CD28(IC) #2, hPDS-41BB(IC), and 2X(hPDS)-CD28(IC) are shown from left to right.
  • FIG.38 is a series of graphs showing cytokine expression of TFP T-cells from donor R024 having the constructs shown after incubation with or without plate bound MSLN and/or PD-1 in the assay described in Example 18.
  • MSLN level non-transduced cells, TC-210, TC-510, PD-1-41BB(IC), hPDS-CD28(IC), hPDS-CD28(IC) #2, hPDS-41BB(IC), and 2X(hPDS)-CD28(IC) are shown from left to right.
  • FIG.39A and FIG.39B show Octet measurement of binding of ⁇ PD1-IL12 fusion by IL- 12 mAb (FIG.39A) and binding of PD1 by ⁇ PD1-IL12 fusion (FIG.39B).
  • FIG.40 shows flow cytometry plots of staining for PD1 and IL12p40 subunit on MH1e- T2A-hPD1 TRuC T cells labeled with ⁇ PD1-IL12 fusion.
  • FIG.41 shows the results of a cytotoxicity assay.
  • FIG.42 shows the results of a cytokine release assay.
  • FIG.43 shows schematics for exemplary constructs for the expression of ⁇ PD1-IL12 fusions in TRuC T cells.
  • FIG.44 shows flow cytometry plots used to assess the transduction efficiency of the noted constructs.
  • FIG.45 shows T cell phenotype (CD4/CD8) of non-transduced (CD3+) and transduced (TRuC+) T cells as determined by flow cytometry.
  • FIG.46 shows memory phenotype (Na ⁇ ve, TCM, TEM, TEMRA) of non-transduced (CD3+) and transduced (TRuC)+ T cells as characterized by flow cytometry.
  • FIG.47 shows results of PD1 blockade assay.
  • FIG.48 shows schematics for exemplary constructs for the expression a ⁇ PD1-IL15 (+/- 4.1BBL) fusion constructs.
  • FIG.49A and FIG.49B provide schematic views of exemplary soluble IL15 ⁇ anti-PD1 (aPD1) antibody constructs (FIG.49A) and membrane bound IL15 constructs (FIG.49B).
  • FIG.51A shows fly cytometry plots showing the expression of CD3 and VHH in cells transduced with the indicated construct.
  • FIG.51B shows the % of VHH+ cells and the mean fluorescence intensity (MFI) staining for VHH.
  • FIG.52 shows the MFI of CD3 staining (left panel) and the CD4/CD8 ratio in VHH+ cells (right panel), for each group.
  • FIG.53A shows the na ⁇ ve and memory phenotypes of CD8+ T cells transduced with the indicated construct.
  • FIG.53B shows the na ⁇ ve and memory phenotypes of CD4+ T cells transduced with the indicated construct.
  • FIG.54 shows secretion and expression IL-15 as measured by MSD. The left and right panels provide the results from cells generated from two different representative donors.
  • FIG.55 shows % VHH+ cells over time (left panel) and fold change in VHH+ at Day 11 (right panel) for sIL15, IL15-aPD1, mIL15-aPD1, mIL15-IL15Ra-aPD1, secreted mutIL15 (mIL15), and secreted mutIL15-IL15Ra (mIL15-IL15RA) expressing cells.
  • FIG.56 shows % VHH+ cells over time (left panel) and fold change in VHH+ at Day 11 (right panel) for sIL15, mbIL15fu, IL15(CD28), mIL15(CD28), mIL15-IL15Ra, and IL15(B7).
  • FIG.57 shows % VHH+ cells over time (left panel, top row), fold change in VHH+ at Day 11 (right panel, top row), and flow cytometry plots showing IL15 and VHH expression on Day 0 (bottom row) for mbIL15fu, IRES mbIL15, and De-op mbIL15 expressing cells.
  • FIG.58 shows expansion as measured by VHH fold change at Day 11 (left panel), and PD-1 induction of VHH+ cells (right panel), after single antigen stimulation of cells expressing the indicated constructs.
  • FIG.59 shows % VHH+ cells over time (left panel) and fold change in VHH+ at Day 11 (right panel), after single antigen stimulation of cells expressing sIL15, mbIL15, IL15(CD28), mIL15(CD28), mIL15-IL15RA, or IL15(B7).
  • FIG.60 shows the % VHH+ over time (left panel, top row), VHH+ cell count (right panel, top row), and total CD45+ cell count (bottom row) in a repeated stimulation assay.
  • FIG.61 shows %PD1+ on VHH+ CD4 or CD8 T cells expressing the indicated construct.
  • FIG.62 shows % tumor lysis by effector cells expressing the indicated construct, of target MSLN expressing tumor cells (left panel) or target MSLN and PD-L1 expressing tumor cells (right panel) at decreasing E:T ratios.
  • FIG.63 shows IL2 expression (pg/mL) by effector cells expressing the indicated construct, of target MSLN expressing tumor cells (left panel) or target MSLN and PD-L1 expressing tumor cells (right panel) at decreasing E:T ratios.
  • FIG.64 shows IFN ⁇ expression (pg/mL) by effector cells expressing the indicated construct, of target MSLN expressing tumor cells (left panel) or target MSLN and PD-L1 expressing tumor cells (right panel) at decreasing E:T ratios.
  • FIG.65 shows the fold change in phosphorylated STAT5 (pSTAT5) in response to exogenous IL2 or IL15, as indicated in the graph.
  • the present disclosure provides antigen-binding proteins such as antibodies that can specifically bind a programmed cell death protein 1 (PD-1) on T cells and block the interaction between PD-1 and PD-L1, thereby modulating immune responses by the T cells.
  • PD-1 programmed cell death protein 1
  • the present disclosure also provides anti-PD-1 fusion peptides comprising an anti-PD-1 antibody or fragment thereof fused to an enhancing domain.
  • a T-cell receptor fusion protein T-cell receptor fusion protein
  • the present disclosure also provides T cells expressing a T-cell receptor fusion protein (TFP) comprising a binding domain, e.g., an antibody or antibody fragment, a ligand, or a ligand binding protein, that binds specifically to an antigen such as a tumor-associated antigen (TAA) and further expressing the PD-1 binding antibody or anti-PD-1 fusion peptide.
  • TFP T-cell receptor fusion protein
  • the invention described herein is particularly advantageous because the anti-PD-1 antibody or anti-PD-1 fusion peptide is delivered to the site of the cancer cells having the tumor-associated antigen by the TFP T cells, thereby allowing for targeted co-administration of the anti-PD-1 antibodies or anti-PD-1 fusion peptides and TFP cells at the site of the cancer.
  • the secreted PD-1 antibody or anti-PD-1 fusion peptide advantageously, can then block PD-1/PD-L1 and/or PD-1/PD-L2 signaling not only in the TFP T-cells, but also in nearby cytotoxic T cells.
  • the anti-PD-1 fusion peptides described herein can enhance cytotoxicity of the T cells expressing both TFPs and the fusion peptides. In such cases, not only does the anti-PD-1 antibody domain block PD-1 signaling, as described above, but binding of the anti-PD-1 antibody to PD-1 in the tumor microenvironment activates co-stimulatory signaling by the intracellular co-stimulatory domains, thereby increasing activity of the TFP-expressing T cells.
  • an anti-PD-1 fusion peptide comprising an anti- PD-1 antibody or fragment thereof that specifically binds PD-1 and an enhancing domain.
  • the anti-PD-1 antibody or fragment thereof can inhibit an interaction of PD-1 with PD-L1 or PD-L2.
  • the enhancing domain can be a cytokine or fragment thereof.
  • the enhancing domain can be a cytokine receptor or fragment thereof.
  • the cytokine can be IL-15 or IL-12.
  • the anti-PD-1 antibody fusion peptide can further comprise a cytokine receptor such as IL-15R or fragment thereof.
  • Exemplary IL-15 polypeptides are disclosed in PCT Application No. PCT/US2021/65069, the entire contents of which are hereby incorporated by reference.
  • T cells e.g., TFP-expressing T cells
  • expressing a membrane bound IL-15 can provide IL-15 signals, while minimizing potential systemic toxicity.
  • T cells e.g., TFP-expressing T cells
  • TFP-expressing T cells expressing secreted IL-15 constructs may provide additional effects in the tumor microenvironment, for example, by enhancing survival and/or persistence of the TFP expressing cell.
  • the T cells e.g., TFP-expressing T cells
  • the present disclosure provides a modified T cell for T cell therapy.
  • the modified T cell can comprise a nucleic acid sequence encoding the TFP disclosed herein or a TFP encoded by the nucleic acid sequence disclosed herein.
  • the modified T cell can further comprise an anti-PD-1 antibody or a fusion peptide comprising the PD-1 antibody or a nucleic acid sequence encoding an anti-PD-1 antibody or fragment thereof or a fusion peptide comprising the PD-1 antibody or fragment thereof.
  • the anti-PD-1 antibody blocks the interaction between PD-1 and PD-L1.
  • the anti-PD-1 antibody blocks the interaction between PD-1 and PD-L2.
  • the nucleic acid sequence encoding an anti-PD- 1 antibody or fusion peptide comprising the PD-1 antibody and the nucleic acid sequence encoding the TFP can be on a same nucleic acid molecule or two separate nucleic acid molecules.
  • the anti-PD-1 antibody or fragment thereof may be membrane bound, or may not be membrane bound (e.g., may be secreted).
  • the modified T cell may secrete the anti-PD-1 antibody or fragment thereof or the fusion peptide.
  • the anti-PD-1 antibody or fragment thereof can be an scFv or sdAb.
  • are modified allogenic T cells comprising (i) the TFP or the anti-PD-1 antibody (or the fusion peptide comprising the anti-PD-1 antibody) or (ii) a sequence encoding the TFP or the anti-PD-1 antibody (or the fusion peptide comprising the anti-PD-1 antibody).
  • the present disclosure provides pharmaceutical compositions comprising a modified T cell.
  • the modified T cell can comprise a TFP or a sequence encoding a TFP.
  • the modified T cell can further comprise an anti-PD-1 antibody or the fusion peptide comprising the anti-PD-1 antibody, or a sequence encoding the anti-PD-1 antibody or the fusion peptide comprising the anti-PD-1 antibody, such as PD-1 antibody that can be secreted by the modified T cell.
  • the modified T cells e.g., a TFP-T cell
  • the modified T cells may be useful for the treatment of any disease or condition involving the TFP. Methods of treating a subject in need thereof are also provided.
  • compositions and methods are inclusive and does not exclude additional, unrecited integers or method/process steps.
  • “comprising” may be replaced with “consisting essentially of” or “consisting of”.
  • the phrase “consisting essentially of” is used herein to require the specified integer(s) or steps as well as those which do not materially affect the character or function of the claimed invention.
  • the term “consisting” is used to indicate the presence of the recited integer (e.g.
  • antibody refers to a protein, or polypeptide sequences derived from an immunoglobulin molecule, which specifically binds to an antigen. Antibodies can be intact immunoglobulins of polyclonal or monoclonal origin, or fragments thereof and can be derived from natural or from recombinant sources.
  • antigen-binding domain means the portion of an antibody that is capable of specifically binding to an antigen or epitope.
  • an antigen-binding domain is an antigen-binding domain formed by a VH -VL dimer of an antibody.
  • an antigen-binding domain is an antigen-binding domain formed by diversification of certain loops from the tenth fibronectin type III domain of an AdnectinTM.
  • the terms “antibody fragment” or “antibody binding domain” refer to at least one portion of an antibody, or recombinant variants thereof, that contains the antigen binding domain, i.e., an antigenic determining variable region of an intact antibody, that is sufficient to confer recognition and specific binding of the antibody fragment to a target, such as an antigen and its defined epitope.
  • antibody fragments include, but are not limited to, Fab, Fab’, F(ab’) 2 , and Fv fragments, single-chain (sc)Fv (“scFv”) antibody fragments, linear antibodies, single domain antibodies (abbreviated “sdAb”) (either VL or VH, or VL or VH), camelid VHH or VHH domains, and multi-specific antibodies formed from antibody fragments.
  • scFv refers to a fusion protein comprising at least one antibody fragment comprising a variable region of a light chain and at least one antibody fragment comprising a variable region of a heavy chain, wherein the light and heavy chain variable regions are contiguously linked via a short flexible polypeptide linker, and capable of being expressed as a single polypeptide chain, and wherein the scFv retains the specificity of the intact antibody from which it is derived.
  • “Heavy chain variable region” or “VH” or “V H ” refers to the fragment of the heavy chain that contains three CDRs interposed between flanking stretches known as framework regions, these framework regions are generally more highly conserved than the CDRs and form a scaffold to support the CDRs.
  • a scFv may have the VL and VH variable regions in either order, e.g., with respect to the N-terminal and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH or may comprise VH-linker-VL.
  • the portion of the TFP composition of the disclosure comprising an antibody or antibody fragment thereof may exist in a variety of forms where the antigen binding domain is expressed as part of a contiguous polypeptide chain including, for example, a single domain antibody fragment (sdAb) or heavy chain antibodies HCAb, a single chain antibody (scFv) derived from a murine, humanized or human antibody (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, N.Y.; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, N.Y.; Houston et al., 1988, Proc. Natl. Acad. Sci.
  • sdAb single domain antibody fragment
  • HCAb heavy chain antibodies
  • scFv single chain antibody
  • the antigen binding domain of a TFP composition of the present disclosure comprises an antibody fragment.
  • the TFP comprises an antibody fragment that comprises a scFv or a sdAb.
  • antibody heavy chain refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which normally determines the class to which the antibody belongs.
  • antibody light chain refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations.
  • Kappa (“ ⁇ ”) and lambda (“ ⁇ ”) light chains refer to the two major antibody light chain isotypes.
  • the term “recombinant antibody” refers to an antibody that is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage or yeast expression system.
  • the term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using recombinant DNA or amino acid sequence technology which is available and well known in the art.
  • antigen refers to a molecule that is capable of being bound specifically by an antibody, or otherwise provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.
  • antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequence or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein.
  • an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is readily apparent that the present disclosure includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to encode polypeptides that elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample or might be macromolecule besides a polypeptide.
  • Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a fluid with other biological components.
  • CD70 is a is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF27/CD27. It is a surface antigen on activated, but not on resting, T and B lymphocytes. CD70 induces proliferation of costimulated T cells, enhances the generation of cytolytic T cells, and contributes to T cell activation. CD70 is also reported to play a role in regulating B-cell activation, cytotoxic function of natural killer cells, and immunoglobulin synthesis.
  • TNF tumor necrosis factor
  • CD19 also known as B-lymphocyte antigen CD19, B4, CVID3, and CD19 molecule, refers to the Cluster of Differentiation 19 protein, which is an antigenic determinant detectable on B cell leukemia precursor cells, other malignant B cells and most cells of the normal B cell lineage.
  • CD19 includes any of the recombinant or naturally-occurring forms of CD19 or variants or homologs thereof that have or maintain CD19 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD19.
  • CD19 is substantially identical to the protein identified by the UniProt reference number P15391 or a variant or homolog having substantial identity thereto.
  • BCMA refers to the B-cell maturation antigen, also known as tumor necrosis factor receptor superfamily member 17 (TNFRSF17), Cluster of Differentiation 269 protein (CD269), BCM, TNFRSF13A, tumor necrosis factor receptor superfamily member 17, and TNF receptor superfamily member 17, which is a protein that in humans is encoded by the TNFRSF17 gene.
  • TNFRSF17 is a cell surface receptor of the TNF receptor superfamily which recognizes B-cell activating factor (BAFF) (see, e.g., Laabi et al., EMBO 11 (11): 3897– 904 (1992).
  • BCMA includes any of the recombinant or naturally-occurring forms of BCMA or variants or homologs thereof that have or maintain BCMA activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring BCMA.
  • BCMA is substantially identical to the protein identified by the UniProt reference number Q02223 or a variant or homolog having substantial identity thereto.
  • CD16 also known as Fc ⁇ RIII, refers to a cluster of differentiation molecule found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes, and macrophages. CD16 has been identified as Fc receptors Fc ⁇ RIIIa (CD16a) and Fc ⁇ RIIIb (CD16b), which participate in signal transduction. In some embodiments, CD16 is a molecule of the immunoglobulin superfamily (IgSF) involved in antibody-dependent cellular cytotoxicity (ADCC).
  • IgSF immunoglobulin superfamily
  • CD16 includes any of the recombinant or naturally-occurring forms of CD16 or variants or homologs thereof that have or maintain CD16 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD16.
  • CD16 is substantially identical to the protein identified by the UniProt reference number P08637 (CD16a) or a variant or homolog having substantial identity thereto or the protein identified by the UniProt reference number O7501 (CD16b) or a variant or homolog having substantial identity thereto.
  • the term “NKG2D,” also known as KLRK1, CD314, D12S2489E, KLR, NKG2-D, NKG2D, natural killer group 2D, killer cell lectin-like receptor K1, and killer cell lectin like receptor K1 refers to a transmembrane protein belonging to the CD94/NKG2 family of C-type lectin-like receptors.
  • NKG2D is expressed by NK cells, ⁇ T cells and CD8+ ⁇ T cells.
  • NKG2D recognizes induced-self proteins from MIC and RAET1/ULBP families which appear on the surface of stressed, malignant transformed, and infected cells.
  • NKG2D includes any of the recombinant or naturally-occurring forms of NKG2D or variants or homologs thereof that have or maintain NKG2D activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring NKG2D.
  • NKG2D is substantially identical to the protein identified by the UniProt reference number P26718 or a variant or homolog having substantial identity thereto.
  • mesothelin also known as MPF and SMRP, refers to a tumor differentiation antigen that is normally present on the mesothelial cells lining the pleura, peritoneum and pericardium. In some embodiments, mesothelin is over-expressed in several human tumors, including mesothelioma and ovarian and pancreatic adenocarcinoma.
  • MSLN includes any of the recombinant or naturally-occurring forms of MSLN or variants or homologs thereof that have or maintain MSLN activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring MSLN.
  • MSLN is substantially identical to the protein identified by the UniProt reference number Q13421 or a variant or homolog having substantial identity thereto.
  • ROR1 includes any of the recombinant or naturally- occurring forms of ROR1 or variants or homologs thereof that have or maintain ROR1 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring ROR1.
  • ROR1 is substantially identical to the protein identified by the UniProt reference number Q01973 or a variant or homolog having substantial identity thereto.
  • MUC16 also known as mucin 16, cell-surface associated, ovarian cancer- related tumor marker CA125, CA-125 (cancer antigen 125, carcinoma antigen 125, or carbohydrate antigen 125), mucin 16, and CA125, refers to a membrane-tethered mucin that contains an extracellular domain at its amino terminus, a large tandem repeat domain, and a transmembrane domain with a short cytoplasmic domain.
  • products of this gene have been used as a marker for different cancers, with higher expression levels associated with poorer outcomes.
  • MUC16 includes any of the recombinant or naturally- occurring forms of MUC16 or variants or homologs thereof that have or maintain MUC16 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring MUC16.
  • MUC16 is substantially identical to the protein identified by the UniProt reference number Q8WXI7 or a variant or homolog having substantial identity thereto.
  • the “CD79 ⁇ (Cluster of Differentiation 79 ⁇ )” and “CD79 ⁇ (Cluster of Differentiation 79 ⁇ )” genes encode proteins that make up the B lymphocyte antigen receptor, a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta (encoded by CD79 ⁇ and its paralog CD79 ⁇ , respectively) which are necessary for expression and function of the B-cell antigen receptor.
  • CD79 ⁇ protein includes any of the recombinant or naturally-occurring forms of CD79 ⁇ protein or variants or homologs thereof that have or maintain CD79 ⁇ protein activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD79 ⁇ protein.
  • CD79 ⁇ protein is substantially identical to the protein identified by the UniProt reference number P11912 or a variant or homolog having substantial identity thereto.
  • CD79 ⁇ protein includes any of the recombinant or naturally- occurring forms of CD79 ⁇ protein or variants or homologs thereof that have or maintain CD79 ⁇ protein activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD79 ⁇ protein.
  • CD79 ⁇ protein is substantially identical to the protein identified by the UniProt reference number P40259 or a variant or homolog having substantial identity thereto.
  • B cell activating factor or “BAFF,” also known as tumor necrosis factor ligand superfamily member 13B, TNFSF13B, BLYS, CD257, DTL, TALL-1, TALL1, THANK, TNFSF20, ZTNF4, TNLG7A, tumor necrosis factor superfamily member 13b, and TNF superfamily member 13b, refers to a cytokine that belongs to the tumor necrosis factor (TNF) ligand family.
  • TNF tumor necrosis factor
  • This cytokine is a ligand for receptors TNFRSF13B/TACI, TNFRSF17/BCMA, and TNFRSF13C/BAFF-R. This cytokine is expressed in B cell lineage cells, and acts as a potent B cell activator.
  • BAFF plays an important role in the proliferation and differentiation of B cells.
  • BAFF includes any of the recombinant or naturally- occurring forms of BAFF or variants or homologs thereof that have or maintain BAFF activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring BAFF.
  • BAFF is substantially identical to the protein identified by the UniProt reference number Q9Y275 or a variant or homolog having substantial identity thereto.
  • PSMA Prostate-specific membrane antigen
  • GCPII glutamate carboxypeptidase II
  • NAALADase I N-acetyl-L-aspartyl-L-glutamate peptidase I
  • NAAG peptidase FOLH1, FGCP, FOLH, GCP2, GCPII, NAALAD1, NAALAdase, PSM, mGCP
  • folate hydrolase prostate-specific membrane antigen
  • folate hydrolase 1 is a type II membrane protein expressed in all forms of prostate tissue, including carcinoma.
  • the PSMA protein has a unique 3-part structure: a 19-amino-acid internal portion, a 24-amino-acid transmembrane portion, and a 707-amino-acid external portion.
  • PSMA acts as a glutamate- preferring carboxypeptidase.
  • PMSA expression is increased in cancer tissue in the prostate.
  • PSMA includes any of the recombinant or naturally-occurring forms of PSMA or variants or homologs thereof that have or maintain PSMA activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring PSMA.
  • PSMA is substantially identical to the protein identified by the UniProt reference number Q04609 or a variant or homolog having substantial identity thereto.
  • HER2 also known as receptor tyrosine-protein kinase erbB-2, CD340 (cluster of differentiation 340), proto-oncogene Neu, ERBB2, human epidermal growth factor receptor 2, HER2/neu, HER-2, HER-2/neu, HER2, MLN 19, NEU, NGL, TKR1, erb-b2 receptor tyrosine kinase 2, encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors.
  • EGF epidermal growth factor
  • HER2 is amplified and/or overexpressed in 20-30% of invasive breast carcinomas.
  • HER2-positive breast cancer is treated in a separate manner from other subtypes of breast cancer and commonly presents as more aggressive disease.
  • HER2 includes any of the recombinant or naturally-occurring forms of HER2 or variants or homologs thereof that have or maintain HER2 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring HER2.
  • HER2 is substantially identical to the protein identified by the UniProt reference number P04626 or a variant or homolog having substantial identity thereto.
  • anti-tumor effect refers to a biological effect which can be manifested by various means, including but not limited to, e.g., a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, decrease in tumor cell proliferation, decrease in tumor cell survival, or amelioration of various physiological symptoms associated with the cancerous condition.
  • An “anti-tumor effect” can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies of the disclosure in prevention of the occurrence of tumor in the first place.
  • CD22 also known as cluster of differentiation-22, sialic acid binding Ig-like lectin 2, SIGLEC-2, SIGLEC2, CD22 molecule, T cell surface antigen leu-14, and B cell receptor CD22, refers to a protein that mediates B cell/B cell interactions, and is thought to be involved in, e.g., the localization of B cells in lymphoid tissues.
  • CD22 is associated with diseases including, but not limited to, refractory hematologic cancer and hairy cell leukemia.
  • CD22 includes any of the recombinant or naturally-occurring forms of CD22 or variants or homologs thereof that have or maintain CD22 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring CD22.
  • CD22 is substantially identical to the protein identified by the UniProt reference number P20273 or a variant or homolog having substantial identity thereto.
  • PD-1 is a cell surface receptor that belongs to the immunoglobulin superfamily and is expressed on T cells and pro-B cells. PD-1 binds two ligands, PD-L1 and PD-L2.
  • PD-1 includes any of the recombinant or naturally-occurring forms of PD-1 or variants or homologs thereof that have or maintain PD-1 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring PD-1.
  • PD-1 is substantially identical to the protein identified by the UniProt reference number Q15116 or a variant or homolog having substantial identity thereto.
  • PD-L1 may play a major role in suppressing the adaptive arm of immune system during particular events such as, e.g., pregnancy, tissue allografts, autoimmune disease and other disease states such as, e.g., hepatitis.
  • the adaptive immune system reacts to antigens that are associated with immune system activation by exogenous or endogenous danger signals.
  • clonal expansion of antigen-specific CD8+ T cells and/or CD4+ helper cells is propagated.
  • the binding of PD-L1 to the inhibitory checkpoint molecule PD-1 transmits an inhibitory signal based on interaction with phosphatases (SHP-1 or SHP-2) via Immunoreceptor Tyrosine-Based Switch Motif (ITSM) motif.
  • SHP-1 or SHP-2 phosphatases
  • IRS Immunoreceptor Tyrosine-Based Switch Motif
  • PD-L1 includes any of the recombinant or naturally-occurring forms of PD-L1 or variants or homologs thereof that have or maintain PD-L1 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring PD-L1.
  • PD-L1 is substantially identical to the protein identified by the UniProt reference number Q9NZQ7 or a variant or homolog having substantial identity thereto.
  • the term “PD-L2”, also known as B7-DC, is a ligand of PD-1.
  • the amino acid sequence of full length PD-L2 is provided in the Gene Bank under accession number NP_079515.2.
  • the term “PD-L1” also includes protein variants of PD-L1.
  • the term “PD-L2” includes recombinant PD-L2 or fragments thereof.
  • the term also includes, for example, affinity tagged (e.g., histidine tagged) PD-L2 or fragments thereof, mouse or human Fc tagged PD-L2 or fragments thereof, or PD-L2 or fragments thereof coupled to a signal sequence, for example, ROR1.
  • PD- L2 includes any of the recombinant or naturally-occurring forms of PD- L2 or variants or homologs thereof that have or maintain PD-L2 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring PD-L2.
  • PD-L2 is substantially identical to the protein identified by the UniProt reference number Q9BQ51 or a variant or homolog having substantial identity thereto.
  • humanized forms of non-human antibodies are chimeric antibodies that contain minimal sequence derived from the non-human antibody.
  • a humanized antibody is generally a human antibody (recipient antibody) in which residues from one or more CDRs are replaced by residues from one or more CDRs of a non-human antibody (donor antibody).
  • the donor antibody can be any suitable non-human antibody, such as a mouse, rat, rabbit, chicken, or non-human primate antibody having a desired specificity, affinity, or biological effect.
  • selected framework region residues of the recipient antibody are replaced by the corresponding framework region residues from the donor antibody.
  • Humanized antibodies may also comprise residues that are not found in either the recipient antibody or the donor antibody. Such modifications may be made to further refine antibody function. For further details, see Jones et al., Nature, 1986, 321:522-525; Riechmann et al., Nature, 1988, 332:323-329; and Presta, Curr. Op. Struct. Biol., 1992, 2:593-596, each of which is incorporated by reference in its entirety.
  • a “human antibody” is one which possesses an amino acid sequence corresponding to that of an antibody produced by a human or a human cell, or derived from a non-human source that utilizes a human antibody repertoire or human antibody-encoding sequences (e.g., obtained from human sources or designed de novo). Human antibodies specifically exclude humanized antibodies.
  • “Affinity” refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope).
  • affinity refers to intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen or epitope).
  • the affinity of a molecule X for its partner Y can be represented by the dissociation equilibrium constant (K D ).
  • K D dissociation equilibrium constant
  • the kinetic components that contribute to the dissociation equilibrium constant are described in more detail below.
  • Affinity can be measured by common methods known in the art, including those described herein, such as surface plasmon resonance (SPR) technology (e.g., BIACORE ® ) or biolayer interferometry (e.g., FORTEBIO ® ).
  • SPR surface plasmon resonance
  • BIACORE ® BIACORE ®
  • biolayer interferometry e.g., FORTEBIO ®
  • the terms “bind,” “specific binding,” “specifically binds to,” “specific for,” “selectively binds,” and “selective for” a particular antigen (e.g., a polypeptide target) or an epitope on a particular antigen mean binding that is measurably different from a non-specific or non-selective interaction (e.g., with a non-target molecule).
  • Specific binding can be measured, for example, by measuring binding to a target molecule and comparing it to binding to a non-target molecule.
  • Specific binding can also be determined by competition with a control molecule that mimics the epitope recognized on the target molecule.
  • autologous refers to any material derived from the same individual to whom it is later to be re-introduced into the individual.
  • allogeneic refers to any material derived from a different animal of the same species or different patient as the individual to whom the material is introduced. Two or more individuals are said to be allogeneic to one another when the genes at one or more loci are not identical. In some aspects, allogeneic material from individuals of the same species may be sufficiently unlike genetically to interact antigenically.
  • xenogeneic refers to a graft derived from an animal of a different species.
  • treating refers to clinical intervention in an attempt to alter the natural course of a disease or condition in a subject in need thereof. Treatment can be performed both for prophylaxis and during the course of clinical pathology. Desirable effects of treatment include preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
  • a “therapeutically effective amount” is the amount of a composition or an active component thereof sufficient to provide a beneficial effect or to otherwise reduce a detrimental non-beneficial event to the individual to whom the composition is administered.
  • therapeutically effective dose herein is meant a dose that produces one or more desired or desirable (e.g., beneficial) effects for which it is administered, such administration occurring one or more times over a given period of time. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g. Lieberman, Pharmaceutical Dosage Forms (vols.1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); and Pickar, Dosage Calculations (1999)).
  • a “T cell receptor (TCR) fusion protein” or “TFP” includes a recombinant polypeptide derived from the various polypeptides comprising the TCR that is generally capable of i) binding to a surface antigen on target cells and ii) interacting with other polypeptide components of the intact TCR complex, typically when co-located in or on the surface of a T cell.
  • TCR T cell receptor
  • TFP T cell receptor
  • the T cell is a CD4+ T cell, a CD8+ T cell, or a CD4+ / CD8+ T cell.
  • the TFP-T cell is an NK cell or a regulatory T cell.
  • T cell receptor and “T cell receptor complex” are used interchangeably to refer to a molecule found on the surface of T cells that is, in general, responsible for recognizing antigens.
  • the TCR comprises a heterodimer consisting of a TCR alpha and TCR beta chain in 95% of T cells, whereas 5% of T cells have TCRs consisting of TCR gamma and TCR delta chains.
  • the TCR further comprises one or more of CD3 ⁇ , CD3 ⁇ , and CD3 ⁇ .
  • the TCR comprises CD3 ⁇ .
  • the TCR comprises CD3 ⁇ .
  • the TCR comprises CD3 ⁇ .
  • the TCR comprises CD3 ⁇ .
  • the TCR comprises CD3 ⁇ .
  • the TCR comprises CD3 ⁇ .
  • the constant domain of human TCR alpha has a sequence of SEQ ID NO:101.
  • the constant domain of human TCR alpha has an IgC domain having a sequence of SEQ ID NO:102, a transmembrane domain having a sequence of SEQ ID NO:103, and an intracellular domain having a sequence of SS.
  • the constant domain of human TCR beta has a sequence of SEQ ID NO:105.
  • the constant domain of human TCR beta has an IgC domain having a sequence of SEQ ID NO:106, a transmembrane domain having a sequence of SEQ ID NO:107, and an intracellular domain having a sequence of SEQ ID NO:109.
  • the constant domain of murine TCR alpha has a sequence of SEQ ID NO:386.
  • the constant domain of murine TCR beta has a sequence of SEQ ID NO:395.
  • the constant domain of TCR delta has a sequence of SEQ ID NO:115.
  • the constant domain of TCR delta has an IgC domain having a sequence of SEQ ID NO:116, a transmembrane domain having a sequence of SEQ ID NO:117, and an intracellular domain having a sequence of L.
  • the constant domain of TCR gamma has a sequence of SEQ ID NO:111.
  • the constant domain of TCR gamma has an IgC domain having a sequence of SEQ ID NO:112, a transmembrane domain having a sequence of SEQ ID NO:113, and an intracellular domain having a sequence of SEQ ID NO:114.
  • CD3 epsilon has a sequence of SEQ ID NO:57.
  • CD3 epsilon has an extracellular domain having a sequence of SEQ ID NO:89, a transmembrane domain having a sequence of SEQ ID NO:89, and an intracellular domain, e.g., an intracellular signaling domain, having a sequence of SEQ ID NO:90.
  • CD3 delta has a sequence of SEQ ID NO:59.
  • CD3 delta has an extracellular domain having a sequence of SEQ ID NO:96, a transmembrane domain having a sequence of SEQ ID NO:97, and an intracellular domain, e.g., an intracellular signaling domain, having a sequence of SEQ ID NO:98.
  • CD3 gamma has a sequence of SEQ ID NO:58. In some embodiments, CD3 gamma has an extracellular domain having a sequence of SEQ ID NO:92, a transmembrane domain having a sequence of SEQ ID NO:93, and an intracellular domain, e.g., an intracellular signaling domain, having a sequence of SEQ ID NO:94.
  • the term “subject” means a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, and sheep. In certain embodiments, the subject is a human.
  • a “patient” is a subject suffering from or at risk of developing a disease, disorder or condition or otherwise in need of the compositions and methods provided herein.
  • the subject has cancer, e.g., a cancer described herein.
  • “preventing” refers to the prevention of the disease or condition, e.g., tumor formation, in the patient. For example, if an individual at risk of developing a tumor or other form of cancer is treated with the methods of the present disclosure and does not later develop the tumor or other form of cancer, then the disease has been prevented, at least over a period of time, in that individual.
  • kits therapeutic or diagnostic products
  • cytotoxic agent refers to a substance that inhibits or prevents a cellular function and/or causes cell death or destruction.
  • a “chemotherapeutic agent” refers to a chemical compound useful in the treatment of cancer. Chemotherapeutic agents include “anti-hormonal agents” or “endocrine therapeutics” which act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer.
  • tumor refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • cancer cancer
  • tumor is a solid tumor.
  • tumor is a hematologic malignancy.
  • cancer refers to a disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers are described herein and include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, primary or metastatic melanoma, thymoma, Non-Hodgkin lymphoma (NHL), solid cancer, sarcoma, colon cancer, kidney cancer, stomach cancer, bladder cancer, uterine cancer and the like.
  • NDL Non-Hodgkin lymphoma
  • composition refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective in treating a subject, and which contains no additional components which are unacceptably toxic to the subject in the amounts provided in the pharmaceutical composition.
  • modulate and “modulation” refer to reducing or inhibiting or, alternatively, activating or increasing, a recited variable.
  • the terms “increase” and “activate” refer to an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater in a recited variable.
  • the terms “reduce” and “inhibit” refer to a decrease of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100- fold, or greater in a recited variable.
  • the term “agonize” refers to the activation of receptor signaling to induce a biological response associated with activation of the receptor.
  • An “agonist” is an entity that binds to and agonizes a receptor.
  • the term “antagonize” refers to the inhibition of receptor signaling to inhibit a biological response associated with activation of the receptor.
  • An “antagonist” is an entity that binds to and antagonizes a receptor.
  • effector T cell includes T helper (i.e., CD4+) cells and cytotoxic (i.e., CD8+) T cells.
  • CD4+ effector T cells contribute to the development of several immunologic processes, including maturation of B cells into plasma cells and memory B cells, and activation of cytotoxic T cells and macrophages.
  • CD8+ effector T cells destroy virus-infected cells and tumor cells. See Seder and Ahmed, Nature Immunol., 2003, 4:835-842, incorporated by reference in its entirety, for additional information on effector T cells.
  • the term “regulatory T cell” includes cells that regulate immunological tolerance, for example, by suppressing effector T cells.
  • the regulatory T cell has a CD4+CD25+Foxp3+ phenotype.
  • the regulatory T cell has a CD8+CD25+ phenotype.
  • the term “dendritic cell” refers to a professional antigen-presenting cell capable of activating a na ⁇ ve T cell and stimulating growth and differentiation of a B cell.
  • the phrase “disease associated with expression of a tumor-associated antigen (TAA)” includes, but is not limited to, a disease associated with expression of any TAA described herein or condition associated with cells which express a TAA including, e.g., proliferative diseases such as a cancer or malignancy or a precancerous condition.
  • the disease is a disease associated with expression of PD-1, PD-L1, or PD-L2.
  • the disease is a cancer.
  • the cancer is a solid tumor.
  • the cancer is a hematological malignancy.
  • the cancer is a leukemia.
  • the cancer is a lymphoma.
  • the cancer is a mesothelioma.
  • the cancer is a pancreatic cancer.
  • the cancer is an ovarian cancer.
  • the cancer is a stomach cancer.
  • the cancer is a lung cancer.
  • the cancer is an endometrial cancer.
  • cancers include but are not limited to, breast cancer, prostate cancer, cervical cancer, skin cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lung cancer, primary or metastatic melanoma, thymoma, Non-Hodgkin lymphoma (NHL), solid cancer, sarcoma, colon cancer, kidney cancer, stomach cancer, bladder cancer, uterine cancer, and the like.
  • NDL Non-Hodgkin lymphoma
  • Non-cancer related indications associated with expression of a target described herein such as PD-1, PD-L1, or PD-L2 include, but are not limited to, e.g., autoimmune disease, (e.g., lupus, rheumatoid arthritis, colitis), inflammatory disorders (allergy and asthma), and transplantation.
  • autoimmune disease e.g., lupus, rheumatoid arthritis, colitis
  • inflammatory disorders allergy and asthma
  • transplantation e.g., autoimmune disease, (e.g., lupus, rheumatoid arthritis, colitis), inflammatory disorders (allergy and asthma), and transplantation.
  • conservative sequence modifications refers to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody or antibody fragment containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into an antibody or antibody fragment of the disclosure by standard techniques known in the art, such
  • Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • basic side chains
  • stimulation refers to a primary response induced by binding of a stimulatory domain or stimulatory molecule (e.g., a TCR/CD3 complex) with its cognate ligand thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR/CD3 complex. Stimulation can mediate altered expression of certain molecules, and/or reorganization of cytoskeletal structures, and the like.
  • a stimulatory domain or stimulatory molecule e.g., a TCR/CD3 complex
  • the term “stimulatory molecule” or “stimulatory domain” refers to a molecule or portion thereof expressed by a T cell that provides the primary cytoplasmic signaling sequence(s) that regulate primary activation of the TCR complex in a stimulatory way for at least some aspect of the T cell signaling pathway.
  • the primary signal is initiated by, for instance, binding of a TCR/CD3 complex with an MHC molecule loaded with peptide, and which leads to mediation of a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like.
  • a primary cytoplasmic signaling sequence (also referred to as a “primary signaling domain”) that acts in a stimulatory manner may contain a signaling motif which is known as immunoreceptor tyrosine-based activation motif or “ITAM”.
  • ITAM immunoreceptor tyrosine-based activation motif
  • Examples of an ITAM containing primary cytoplasmic signaling sequence that is of particular use in the disclosure includes, but is not limited to, those derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (also known as “ICOS”) and CD66d.
  • the term “antigen presenting cell” or “APC” refers to an immune system cell such as an accessory cell (e.g., a B-cell, a dendritic cell, and the like) that displays a foreign antigen complexed with major histocompatibility complexes (MHC’s) on its surface. T cells may recognize these complexes using their T cell receptors (TCRs). APCs process antigens and present them to T cells.
  • the intracellular signaling domain generates a signal that promotes an immune effector function of the TFP containing cell, e.g., a TFP-expressing T cell.
  • immune effector function e.g., in a TFP-expressing T cell
  • examples of immune effector function, e.g., in a TFP-expressing T cell include cytolytic activity and T helper cell activity, including the secretion of cytokines.
  • the intracellular signaling domain can comprise a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from the molecules responsible for primary stimulation, or antigen dependent simulation.
  • the intracellular signaling domain can comprise a costimulatory intracellular domain. Exemplary costimulatory intracellular signaling domains include those derived from molecules responsible for costimulatory signals, or antigen independent stimulation.
  • a primary intracellular signaling domain can comprise an ITAM (“immunoreceptor tyrosine-based activation motif”).
  • ITAM immunoglobulin-based activation motif
  • Examples of ITAM containing primary cytoplasmic signaling sequences include, but are not limited to, those derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD66d, DAP10 and DAP12.
  • costimulatory molecule refers to the cognate binding partner on a T cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation.
  • Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an efficient immune response.
  • Costimulatory molecules include, but are not limited to, an MHC class 1 molecule, BTLA and a Toll ligand receptor, as well as DAP10, DAP12, CD30, LIGHT, OX40, CD2, CD27, CD28, CDS, ICAM-1, LFA-1 (CD11a/CD18) and 4-1BB (CD137).
  • a costimulatory intracellular signaling domain can be the intracellular portion of a costimulatory molecule.
  • a costimulatory molecule can be represented in the following protein families: TNF receptor proteins, Immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocytic activation molecules (SLAM proteins), and activating NK cell receptors.
  • Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, SLAMF7, NKp80, CD160, B7-H3, and a ligand that specifically binds with CD83, and the like.
  • the intracellular signaling domain can comprise the entire intracellular portion, or the entire native intracellular signaling domain, of the molecule from which it is derived, or a functional fragment thereof.
  • 4-1BB refers to a member of the TNFR superfamily with an amino acid sequence provided as GenBank Acc. No.
  • AAA62478.2 or the equivalent residues from a non-human species, e.g., mouse, rodent, monkey, ape and the like; and a “4-1BB costimulatory domain” is defined as amino acid residues 214-255 of GenBank Acc. No. AAA62478.2, or equivalent residues from non-human species, e.g., mouse, rodent, monkey, ape and the like.
  • the term “encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (e.g., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
  • a gene, cDNA, or RNA encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.
  • nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some versions contain one or more introns.
  • the term “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.
  • the term “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.
  • the term “expression” refers to the transcription and/or translation of a particular nucleotide sequence driven by a promoter.
  • the term “functional disruption” refers to a physical or biochemical change to a specific (e.g., target) nucleic acid (e.g., gene, RNA transcript, of protein encoded thereby) that prevents its normal expression and/or behavior in the cell.
  • a functional disruption refers to a modification of the gene via a gene editing method.
  • a functional disruption prevents expression of a target gene (e.g., an endogenous gene).
  • a target gene e.g., an endogenous gene.
  • the term “transfer vector” refers to a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “transfer vector” includes an autonomously replicating plasmid or a virus.
  • the term should also be construed to further include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, a polylysine compound, liposome, and the like.
  • viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
  • expression vector refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed.
  • An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system.
  • Expression vectors include all those known in the art, including cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno- associated viruses) that incorporate the recombinant polynucleotide.
  • viruses e.g., lentiviruses, retroviruses, adenoviruses, and adeno- associated viruses
  • lentivirus refers to a genus of the Retroviridae family.
  • Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses.
  • the term “lentiviral vector” refers to a vector derived from at least a portion of a lentivirus genome, including especially a self-inactivating lentiviral vector as provided, e.g., in Milone et al., Mol. Ther.17(8): 1453-1464 (2009).
  • lentivirus vectors that may be used in the clinic, include but are not limited to, e.g., the LENTIVECTOR TM gene delivery technology from Oxford BioMedica, the LENTIMAX TM vector system from Lentigen Technology, and the like. Nonclinical types of lentiviral vectors are also available and would be known to one skilled in the art.
  • the term “circularized RNA” or “circRNA” refers to a class of single-stranded RNAs with a contiguous structure that have enhanced stability and a lack of end motifs necessary for interaction with various cellular proteins. CircRNAs are 3-5’ covalently closed RNA rings, and circRNAs do not display Cap or poly(A) tails.
  • CircRNAs lack the free ends necessary for exonuclease-mediated degradation, rendering them resistant to several mechanisms of RNA turnover and granting them extended lifespans as compared to their linear mRNA counterparts. For this reason, circularization may allow for the stabilization of mRNAs that generally suffer from short half-lives and may therefore improve the overall efficacy of mRNA in a variety of applications. CircRNAs are produced by the process of splicing, and circularization occurs using conventional splice sites mostly at annotated exon boundaries (Starke et al., 2015; Szabo et al., 2015).
  • RNA circularization For circularization, splice sites are used in reverse: downstream splice donors are “backspliced” to upstream splice acceptors (see Jeck and Sharpless, 2014; Barrett and Salzman, 2016; Szabo and Salzman, 2016; Holdt et al., 2018 for review).
  • Three general strategies have been reported so far for RNA circularization: chemical methods using cyanogen bromide or a similar condensing agent, enzymatic methods using RNA or DNA ligases, and ribozymatic methods using self-splicing introns.
  • precursor RNA is synthesized by run-off transcription and then heated in the presence of magnesium ions and GTP to promote circularization. RNA so produced can efficiently transfect different kinds of cells.
  • the template includes sequences for the TFP, CAR, and TCR, or combination thereof.
  • a ribozymatic method utilizing a permuted group I catalytic intron is used. This method is more applicable to long RNA circularization and requires only the addition of GTP and Mg2+ as cofactors.
  • This permuted intron-exon (PIE) splicing strategy consists of fused partial exons flanked by half-intron sequences. In vitro, these constructs undergo the double transesterification reactions characteristic of group I catalytic introns, but because the exons are fused, they are excised as covalently 5’ and 3’linked circles.
  • homologous refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypeptide molecules.
  • two nucleic acid molecules such as, two DNA molecules or two RNA molecules
  • polypeptide molecules between two polypeptide molecules.
  • a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous or identical at that position.
  • the homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 of 10), are matched or homologous, the two sequences are 90% homologous.
  • isolated means altered or removed from the natural state.
  • nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.”
  • An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
  • nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
  • operably linked refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter.
  • a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
  • Operably linked DNA sequences can be contiguous with each other and, e.g., where necessary to join two protein coding regions, are in the same reading frame.
  • nucleic acid or “polynucleotide” refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
  • nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res.19:5081 (1991); Ohtsuka et al., J. Biol. Chem.260:2605-2608 (1985); and Rossolini et al., Mol. Cell.
  • peptide refers to a compound comprised of amino acid residues covalently linked by peptide bonds.
  • a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence.
  • Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
  • polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
  • a polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof.
  • promoter refers to a DNA sequence recognized by the transcription machinery of the cell, or introduced synthetic machinery, that can initiate the specific transcription of a polynucleotide sequence.
  • promoter/regulatory sequence refers to a nucleic acid sequence which can be used for expression of a gene product operably linked to the promoter/regulatory sequence. In some instances, this sequence may be the core promoter sequence and in other instances, this sequence may also include an enhancer sequence and other regulatory elements which are required for expression of the gene product.
  • the promoter/regulatory sequence may, for example, be one which expresses the gene product in a tissue specific manner.
  • the term “constitutive” promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
  • the term “inducible” promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
  • tissue-specific promoter refers to a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
  • linker and “flexible polypeptide linker” as used in the context of a scFv refers to a peptide linker that consists of amino acids such as glycine and/or serine residues used alone or in combination, to link variable heavy and variable light chain regions together.
  • the flexible polypeptide linkers include, but are not limited to, (Gly4Ser)4 or (Gly4Ser)3.
  • the linkers include multiple repeats of (Gly2Ser), (GlySer) or (Gly3Ser).
  • a 5’ cap (also termed an RNA cap, an RNA 7-methylguanosine cap or an RNA m7G cap) is a modified guanine nucleotide that has been added to the “front” or 5’ end of a eukaryotic messenger RNA shortly after the start of transcription.
  • the 5’ cap consists of a terminal group which is linked to the first transcribed nucleotide.
  • in vitro transcribed RNA refers to RNA, preferably mRNA, which has been synthesized in vitro.
  • the in vitro transcribed RNA is generated from an in vitro transcription vector.
  • the in vitro transcription vector comprises a template that is used to generate the in vitro transcribed RNA.
  • a “poly(A)” is a series of adenosines attached by polyadenylation to the mRNA.
  • the polyA is between 50 and 5000, preferably greater than 64, more preferably greater than 100, most preferably greater than 300 or 400.
  • Poly(A) sequences can be modified chemically or enzymatically to modulate mRNA functionality such as localization, stability or efficiency of translation.
  • polyadenylation refers to the covalent linkage of a polyadenylyl moiety, or its modified variant, to a messenger RNA molecule.
  • mRNA messenger RNA
  • the 3’ poly(A) tail is a long sequence of adenine nucleotides (often several hundred) added to the pre-mRNA through the action of an enzyme, polyadenylate polymerase.
  • poly(A) tail is added onto transcripts that contain a specific sequence, the polyadenylation signal.
  • the poly(A) tail and the protein bound to it aid in protecting mRNA from degradation by exonucleases.
  • Polyadenylation is also important for transcription termination, export of the mRNA from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after transcription of DNA into RNA, but additionally can also occur later in the cytoplasm. After transcription has been terminated, the mRNA chain is cleaved through the action of an endonuclease complex associated with RNA polymerase.
  • the cleavage site is usually characterized by the presence of the base sequence AAUAAA (SEQ ID NO:119) near the cleavage site.
  • transient refers to expression of a non-integrated transgene for a period of hours, days or weeks, wherein the period of time of expression is less than the period of time for expression of the gene if integrated into the genome or contained within a stable plasmid replicon in the host cell.
  • signal transduction pathway refers to the biochemical relationship between a variety of signal transduction molecules that play a role in the transmission of a signal from one portion of a cell to another portion of a cell.
  • cell surface receptor includes molecules and complexes of molecules capable of receiving a signal and transmitting signal across the membrane of a cell.
  • a “substantially purified” cell refers to a cell that is essentially free of other cell types.
  • a substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state.
  • a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state.
  • the cells are cultured in vitro. In other aspects, the cells are not cultured in vitro.
  • terapéutica means a treatment. A therapeutic effect is obtained by reduction, suppression, remission, or eradication of a disease state.
  • proliferative means the prevention of or protective treatment for a disease or disease state.
  • proliferative disorder or “antigen associated with a hyperproliferative disorder” refers to antigens that are common to specific hyperproliferative disorders.
  • the hyperproliferative disorder antigens of the present disclosure are derived from, cancers including but not limited to primary or metastatic melanoma, thymoma, lymphoma, sarcoma, mesothelioma, renal cell carcinoma, stomach cancer, breast cancer, lung cancer, gastric cancer, ovarian cancer, Non- Hodgkin lymphoma (NHL), leukemias, uterine cancer, prostate cancer, colon cancer, cervical cancer, bladder cancer, kidney cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, brain cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, endometrial cancer, primary or metastatic melanoma, thymoma, solid cancer, sarcoma, uterine cancer, and stomach cancer.
  • NDL Non- Hodgkin lymphoma
  • leukemias uterine cancer
  • prostate cancer colon cancer
  • cervical cancer bladder cancer
  • kidney cancer prostate
  • the disease is a cancer selected from the group consisting of mesothelioma, papillary serous ovarian adenocarcinoma, clear cell ovarian carcinoma, mixed Mullerian ovarian carcinoma, endometroid mucinous ovarian carcinoma, malignant pleural disease, pancreatic adenocarcinoma, ductal pancreatic adenocarcinoma, uterine serous carcinoma, lung adenocarcinoma, extrahepatic bile duct carcinoma, gastric adenocarcinoma, esophageal adenocarcinoma, colorectal adenocarcinoma, breast adenocarcinoma, a disease associated with a TAA expression, relapsed or refractory neoplastic disease, and any combination thereof.
  • the TFP targets CD70 and the disease is a cancer selected from the group consisting of T cell lymphoma, diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), an Epstein-Barr virus (EBV) + cancer, a human papilloma virus (HPV) + cancer, kidney cancer, renal cell carcinoma, lung cancer, pancreatic cancer, ovarian cancer, esophageal cancer, nasopharyngeal carcinoma, mesothelioma, glioblastoma, thymic carcinoma, breast cancer, head and neck cancer, gastric cancer, and any combinations thereof.
  • DLBCL diffuse large B-cell lymphoma
  • MCL mantle cell lymphoma
  • AML acute myeloid leukemia
  • MDS myelodysplastic syndrome
  • EBV Epstein-Barr virus
  • HPV human papilloma
  • the TFP targets mesothelin (MSLN) and the disease is a cancer selected from mesothelioma, renal cell carcinoma, stomach cancer, breast cancer, lung cancer, ovarian cancer, prostate cancer, colon cancer, cervical cancer, brain cancer, liver cancer, pancreatic cancer, thyroid cancer, bladder cancer, ureter cancer, kidney cancer, endometrial cancer, esophageal cancer, gastric cancer, thymic carcinoma, cholangiocarcinoma, stomach cancer, papillary serous ovarian adenocarcinoma, clear cell ovarian carcinoma, mixed Mullerian ovarian carcinoma, endometroid mucinous ovarian carcinoma, pancreatic adenocarcinoma, ductal pancreatic adenocarcinoma, uterine serous carcinoma, lung adenocarcinoma, extrahepatic bile duct carcinoma, gastric adenocarcinoma, esophageal adenocarcinoma, colorec
  • the TFP targets CD19 and the disease is a cancer selected from the group consisting of B-cell acute lymphoid leukemia (“BALL”), T-cell acute lymphoid leukemia (“TALL”), acute lymphoid leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt’s lymphoma, diffuse large B cell lymphoma, Follicular lymphoma, Hairy cell leukemia, small cell- or a large cell-follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma, Marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin’s lymphoma, plasmablastic lymphoma, plasmacyto
  • the TFP targets MUC16 and the disease is a cancer selected from the group consisting of pancreatic cancer, ovarian cancer, stomach cancer, lung cancer, endometrial cancer, atypical cancers expressing MUC16, or any combinations thereof.
  • the TFP targets BCMA and the disease is a cancer selected from the group consisting of B-cell acute lymphoid leukemia (“BALL”), T-cell acute lymphoid leukemia (“TALL”), acute lymphoid leukemia (ALL), chronic myelogenous leukemia (CML), chronic lymphocytic leukemia (CLL), B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt’s lymphoma, diffuse large B cell lymphoma, Follicular lymphoma, Hairy cell leukemia, small cell- or a large cell-follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mant
  • the TFP targets CD79B and the disease is a cancer selected from the group consisting of lymphoma, myeloma, non-Hodgkin lymphoma (NHL), diffuse large-cell B-cell lymphoma, aggressive NHL, asymptomatic NHL, follicular lymphoma, recurrent aggressive NHL, recurrent non-chronic non- treatable NHL, non-treatable asymptomatic NHL, chronic lymphocytic leukemia (CLL), small cell lymphocytic lymphoma, leukemia, reticuloendotheliosis (RE), acute lymphocytic leukemia (ALL), lymphoma of the head cortex brain, and any combinations thereof.
  • NHL non-Hodgkin lymphoma
  • NHL non-Hodgkin lymphoma
  • NHL non-Hodgkin lymphoma
  • NHL non-Hodgkin lymphoma
  • NHL non-Hodgkin lymphoma
  • NHL non-Hodgkin lymphom
  • the TFP targets HER2 and the disease is a cancer selected from breast cancer, ovarian cancer, endometrial cancer, gastric cancer, pancreatic cancer, prostate cancer, salivary gland cancer, and any combinations thereof.
  • the TFP targets PSMA and the disease is a cancer selected from the group consisting of prostate cancer, endometrial cancer, breast cancer, kidney cancer, colon cancer, and any combinations thereof.
  • the TFP targets CD20 and the disease is a cancer selected from the group consisting of non-Hodgkin lymphomas, Hodgkin's disease, acute lymphoblastic leukemias, myelomas, chronic lymphocytic leukemias, myeloblastic leukemias, and any combinations thereof.
  • transfected or “transformed” or “transduced” refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell.
  • a “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid.
  • the cell includes the primary subject cell and its progeny.
  • the term “specifically binds,” refers to an antibody, an antibody fragment or a specific ligand, which recognizes and binds a cognate binding partner present in a sample, but which does not necessarily and substantially recognize or bind other molecules in the sample.
  • stably linked refers to non-cleavably linked or non-cleavable linkage.
  • stably linked refers to operatively linked or operative linkage.
  • Ranges throughout this disclosure, various aspects of the present disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the present disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range.
  • a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6.
  • a range such as 95-99% identity includes something with 95%, 96%, 97%, 98% or 99% identity, and includes subranges such as 96-99%, 96-98%, 96-97%, 97-99%, 97-98% and 98-99% identity. This applies regardless of the breadth of the range.
  • IL-15 also known as IL15 and interleukin 15, as used herein, includes any of the recombinant or naturally-occurring forms of IL-15 or variants or homologs thereof that have or maintain IL-15 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring IL-15.
  • IL-15 is substantially identical to the protein identified by the UniProt reference number P40933 or a variant or homolog having substantial identity thereto.
  • IL-15R is composed of three subunits: IL-15 receptor alpha chain (“IL-15R ⁇ ” or CD215), IL-2 receptor beta chain (“IL- 2R ⁇ ” or CD122) and IL-2 receptor gamma/the common gamma chain (“IL-2R ⁇ / ⁇ c” or CD132).
  • IL-15R ⁇ IL-15 receptor alpha chain
  • IL-2R ⁇ IL-2 receptor beta chain
  • IL-2R ⁇ / ⁇ c the common gamma chain
  • human IL-15R ⁇ precursor protein has a 30 amino acid signal peptide, a 175 amino acid extracellular domain, a 23 amino acid single membrane- spanning transmembrane stretch, and a 39 amino acid cytoplasmic (or intracellular) domain and contains N- and O-linked glycosylation sites.
  • IL-15R ⁇ contains a Sushi domain (amino acid 31-95), which is essential for IL-15 binding.
  • IL-15R ⁇ exists as a soluble form (sIL-15R ⁇ ).
  • sIL-15R ⁇ is constitutively generated from the transmembrane receptor through a defined proteolytic cleavage.
  • IL-15R ⁇ also known as CD215, IL-15 receptor subunit alpha, IL-15R-alpha, IL-15RA, and Interleukin-15 receptor subunit alpha, as used herein, includes any of the recombinant or naturally-occurring forms of IL-15R ⁇ or variants or homologs thereof that have or maintain IL-15R ⁇ activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring IL-15R ⁇ .
  • IL-15R ⁇ is substantially identical to the protein identified by the UniProt reference number Q13261 or a variant or homolog having substantial identity thereto.
  • IL-12 also known as Interleukin 12, as used herein, refers to an interleukin that is a heterodimeric cytokine encoded by two separate genes, IL-12A (p35) and IL-12B (p40).
  • IL-12 is naturally produced by dendritic cells, macrophages, neutrophils, and human B-lymphoblastoid cells in response to antigenic stimulation.
  • p35 subunit also known as interleukin-12 subunit alpha, IL-12 p35, IL-12A, IL12A, CLMF, NFSK, NKSF1, P35, and interleukin 12A, as used herein, includes any of the recombinant or naturally-occurring forms of p35 or variants or homologs thereof that have or maintain p35 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring p35.
  • p35 is substantially identical to the protein identified by the UniProt reference number P29459 or a variant or homolog having substantial identity thereto.
  • p40 subunit also known as subunit beta of interleukin 12, IL-12B, natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor p40, interleukin-12 subunit p40, L12B, CLMF, CLMF2, IL-12B, IMD28, NKSF, NKSF2, IMD29, Interleukin 12 subunit beta, and interleukin 12B, as used herein, includes any of the recombinant or naturally-occurring forms of p40 or variants or homologs thereof that have or maintain p40 activity (e.g., at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity).
  • the variants or homologs have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g., a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring p40.
  • p40 is substantially identical to the protein identified by the UniProt reference number P29460 or a variant or homolog having substantial identity thereto.
  • Anti-PD-1 antibodies and anti-PD-1 fusion peptides [0540]
  • Co-receptor signaling may be a mechanism for coordinating and tightly regulating immune responses.
  • alpha beta ( ⁇ ) T cells can rely on positive signals given by peptide antigens presented by HLA class I or II. Co-receptor signals can either increase or prevent this activation.
  • the negative signaling molecules can include those belonging to CD28/B7 families. Three members of this family have been described: CTL-associated antigen-4 (CTLA-4), programmed death-1 (PD-1) and B and T lymphocyte attenuator (BTLA). They can play a role in the control of tolerance. They can provide negative signals that limit, terminate and/or attenuate immune responses. [0541] PD-1 (or CD279) can be expressed on activated T and B cells as well as on activated myeloid cells.
  • PD-1 Upon colligation with the T-cell receptor (TCR), PD-1 can elicit inhibitory signals.
  • the PD-1 cytoplasmic domain can contain two tyrosines, one that constitutes an immunoreceptor tyrosine inhibitory receptor (ITIM) and the other one an immunoreceptor tyrosine based switch motif (ITSM).
  • ITIM immunoreceptor tyrosine inhibitory receptor
  • ITMS immunoreceptor tyrosine based switch motif
  • the phosphorylation of the second tyrosine can lead to the recruitment of the tyrosine phosphatases SHP2 and to some extent SHP1. These phosphatases can dephosphorylate ZAP70, CD3 ⁇ and PKC ⁇ and consequently can attenuate T cell signals.
  • PD-1 may inhibit T and B cell proliferation by causing cell arrest in G0/G1 and inhibiting cytokine production in T cells.
  • PD-1 can bind to its ligand(s) including but not limited to PD-L1/B7H1/CD274 and PD- L2/B7-DC/CD273.
  • PD-L1 can be expressed at low levels on immune cells such as B cells, dendritic cells, macrophages and T cells and is up regulated following activation.
  • PD-L1 can also be expressed on non-lymphoid organs such as endothelial cells, heart, lung, pancreas, muscle, keratinocytes and placenta.
  • PD-L1 may regulate the function of self-reactive T and B cells as well as myeloid cells in peripheral tissues or may regulate inflammatory responses in the target organs.
  • PD-L1 expression can be regulated by type 1 and 2 interferon on endothelial and epithelial cells.
  • PD-L1 can be expressed in tumor samples and may be associated to poor prognosis.
  • PD-L2/B7-DC cell surface expression can be restricted to macrophages and dendritic cells, though PD-L2 transcript may be found in non-hematopoietic tissues such as heart, liver and pancreas. Its surface expression can depend on the production of IFN ⁇ and Th2 cytokines.
  • Both PD-L1 and PD-L2 may inhibit T cell proliferation, cytokine production and ⁇ 1 and ⁇ 2 integrins mediated adhesion.
  • the expression patterns of PD-L1 and PD-L2 suggest both overlapping and differential roles in immune regulation.
  • PD-L1 may be abundant in a variety of human cancers.
  • the interaction between PD-1 and PD-L1 can result in a decrease in tumor infiltrating lymphocytes, a decrease in T-cell receptor mediated proliferation, and immune evasion by the cancerous cells.
  • Immune suppression can be reversed by inhibiting the local interaction of PD-1 with PD-L1, and the effect can be additive when the interaction of PD-1 with PD-L2 is blocked as well.
  • the present disclosure provides anti-PD-1 antibodies or fragment thereof.
  • the present disclosure also provides anti-PD-1 fusion peptides comprising the anti-PD-1 antibodies or fragment thereof described herein.
  • the present disclosure provides a nucleic acid sequence encoding an antibody or fragment thereof that specifically binds programmed cell death protein 1 (PD-1).
  • the antibody or fragment thereof that specifically binds PD-1 can be referred to as anti-PD-1 antibody.
  • the anti- PD-1 antibody can block the interaction between PD-1 and PD-L1 and/or PD-L2.
  • the anti-PD-1 antibody can be a fragment or a binding domain of an antibody.
  • the nucleic acid sequence can be a DNA or an RNA.
  • the nucleic acid sequence can be a sequence within a vector.
  • the present disclosure also provides a polypeptide encoded by the nucleic acid sequence.
  • the polypeptide can be the antibody or fragment thereof that specifically binds PD-1.
  • the antibody or fragment thereof provided herein can be any domain that binds to PD-1 including but not limited to a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a human antibody, a humanized antibody, and a functional fragment thereof, including but not limited to a single-domain antibody such as a heavy chain variable domain (V H ), a light chain variable domain (V L ) and a variable domain (V HH ) of a camelid derived nanobody, and to an alternative scaffold to function as antigen binding domain, such as a recombinant fibronectin domain, anticalin, DARPIN and the like.
  • V H heavy chain variable domain
  • V L light chain variable domain
  • V HH variable domain of a camelid derived nanobody
  • the antibody or fragment thereof that specifically binds PD-1 can be a humanized or non-humanized antibody or fragment thereof.
  • the antigen binding domain is a fragment, e.g., a single chain variable fragment (scFv).
  • the antigen binding domain is a Fv, a Fab, a (Fab’)2, or a bi- functional (e.g., bi-specific) hybrid antibody.
  • the antibodies and fragments thereof disclosed herein bind a PD-1 protein with wild-type or enhanced affinity.
  • a humanized antibody or antibody fragment may retain a similar antigenic specificity as the original antibody, e.g., in the present disclosure, the ability to bind human PD-1.
  • a humanized antibody or antibody fragment may have improved affinity and/or specificity of binding to PD-1.
  • Various methods can be used to humanize an antibody, including but not limited to the methods described here in “T cell receptor (TCR) fusion proteins (TFPs)” section below.
  • TCR T cell receptor
  • TFPs T cell receptor fusion proteins
  • the present disclosure provides an antibody or fragment thereof that specifically binds PD-1.
  • the anti-PD-1 antibody or antibody fragment can comprise a variable domain comprising a complementarity determining region 1 (CDR1), a CDR2, and a CDR3.
  • the CDR3 can comprise the amino acid sequence of SEQ ID NO:3.
  • the CDR1 can comprise the amino acid sequence of SEQ ID NO:1.
  • the CDR2 can comprise the amino acid sequence of SEQ ID NO:2.
  • variable domain can further comprise a framework region 1 (FR1) comprising the amino acid sequence of SEQ ID NO:9 or SEQ ID NO:10.
  • the variable domain can further comprise a framework region 2 (FR2) comprising the amino acid sequence of SEQ ID NO:11, SEQ ID NO:12, or SEQ ID NO:13.
  • the variable domain can further comprise a framework region 3 (FR3) comprising the amino acid sequence of SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, or SEQ ID NO:17.
  • FR4 framework region 4 comprising the amino acid sequence of SEQ ID NO:18 or SEQ ID NO:19.
  • variable domain can comprise one or more mutations in one or more of framework region 1 (FR1), FR2, FR3, or FR4 relative to FR1, FR2, FR3, and/or FR4 of the amino acid sequence of SEQ ID NO. 4.
  • the variable domain can have at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:4.
  • the variable domain can have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to the amino acid sequence of SEQ ID NO:4.
  • the variable domain can comprise the amino acid sequence of SEQ ID NO:4.
  • the variable domain can be encoded by the nucleic acid sequence of SEQ ID NO:20.
  • the variable domain can comprise one or more mutations at amino acid position selected from the group consisting of amino acid positions 1, 5, 14, 34, 35, 49, 75, 76, 78, 79, 87, 88, 93, and 115 of the amino acid sequence of SEQ ID NO:4.
  • the variable domain can comprise a mutation at amino acid positions 1, 5, 14, 34, 49, 76, 78, 79, 87, 93, and 115 of the amino acid sequence of SEQ ID NO:4.
  • the variable domain can comprise a mutation at amino acid positions 1, 5, 14, 34, 49, 75, 76, 78, 79, 87, 93, and 115 of the amino acid sequence of SEQ ID NO:4.
  • the variable domain can comprise a mutation at amino acid positions 1, 5, 14, 34, 35, 49, 75, 76, 78, 79, 87, 93, and 115 of the amino acid sequence of SEQ ID NO:4.
  • the variable domain can comprise a mutation at amino acid positions 1, 5, 14, 34, 35, 49, 75, 76, 78, 79, 87, 88, 93, and 115 of the amino acid sequence of SEQ ID NO:4.
  • the variable domain can comprise one or more mutations selected from the group consisting of Q1E, Q5V, A14P, I34M, G35S, A49S, A75S, N76K, A78T, V79L, K87R, P88A, I93V and Q115L relative to the amino acid sequence of SEQ ID NO:4.
  • the variable domain can comprise Q1E, Q5V, A14P, I34M, A49S, N76K, A78T, V79L, K87R, I93V and Q115L mutations relative to the amino acid sequence of SEQ ID NO:4.
  • the variable domain can comprise Q1E, Q5V, A14P, I34M, A49S, A75S, N76K, A78T, V79L, K87R, I93V and Q115L mutations relative to the amino acid sequence of SEQ ID NO:4.
  • the variable domain can comprise Q1E, Q5V, A14P, I34M, G35S, A49S, A75S, N76K, A78T, V79L, K87R, I93V and Q115L mutations relative to the amino acid sequence of SEQ ID NO:4.
  • variable domain can comprise Q1E, Q5V, A14P, I34M, G35S, A49S, A75S, N76K, A78T, V79L, K87R, P88A, I93V and Q115L mutations relative to the amino acid sequence of SEQ ID NO:4.
  • the variable domain can have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to the amino acid sequence of SEQ ID NO:4.
  • variable domain can have at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to the amino acid sequence of any one of SEQ ID NOs: 5-8.
  • the variable domain can have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to the amino acid sequence of any one of SEQ ID NOs: 5-8.
  • the variable domain can have at least 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to the amino acid sequence of any one of SEQ ID NOs: 5-8.
  • the variable domain can comprise the amino acid sequence of SEQ ID NO:5.
  • the variable domain can be encoded by the nucleic acid sequence of SEQ ID NO:21.
  • the variable domain can comprise the amino acid sequence of SEQ ID NO:6.
  • the variable domain can be encoded by the nucleic acid sequence of SEQ ID NO:22.
  • the variable domain can comprise the amino acid sequence of SEQ ID NO:7.
  • the variable domain can be encoded by the nucleic acid sequence of SEQ ID NO:23.
  • the variable domain can comprise the amino acid sequence of SEQ ID NO:8.
  • the variable domain can be encoded by the nucleic acid sequence of SEQ ID NO:24.
  • the anti-PD-1 antibody or fragment thereof can bind to human PD-1 with a K D value of about 1 to about 60 nM. In some cases, the K D value is at least about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 or more nM.
  • the anti-PD-1 antibody or fragment thereof can bind to human PD-1 with a KD value of at most 55 nM. In some cases, the KD value is at most about 100, 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30 or less nM.
  • the anti-PD-1 antibody or fragment thereof can be fused to an enhancing domain to generate an anti-PD-1 fusion peptide.
  • the anti-PD-1 antibody or fragment thereof can be fused to an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof. In some cases, the anti-PD-1 antibody or fragment thereof can be further fused to an interleukin-15 (IL-15) polypeptide or fragment thereof. In some cases, the anti-PD-1 fusion peptide can be fused to an IL-12 polypeptide or functional fragment thereof. The anti-PD-1 antibody or fragment thereof or the anti-PD-1 fusion peptide can be secreted when expressed in a cell. [0557] The anti-PD-1 antibody or fragment thereof can be an antagonist. The anti-PD-1 antibody or fragment thereof can be a PD-1 inhibitor.
  • the anti-PD-1 antibody or fragment thereof can compete with PD-L1 and/or PD-L2 for binding to PD-1, inhibit PD-L1 and/or PD-L2 from interacting with PD-1, and/or bind to the same epitope of PD-1 to which PD-L1 and/or PD-L2 binds.
  • the anti-PD-1 antibody or fragment thereof can block an immune checkpoint or block immune checkpoint signaling.
  • the anti-PD-1 antibody or fragment thereof can be an immune checkpoint inhibitor or can inhibit immune checkpoint signaling.
  • the anti-PD-1 antibody or fragment thereof can promote anti-tumor activity or inhibit inhibition of anti-tumor activity.
  • the anti-PD-1 antibody or fragment thereof can promote antibody or antibody fragment mediated tumor cell killing or inhibit inhibition of antibody or antibody fragment mediated tumor cell killing.
  • the anti-PD-1 antibody or fragment thereof can inhibit tumor growth.
  • the anti-PD-1 antibody or fragment thereof can be a human or humanized antibody or antibody fragment.
  • the anti-PD-1 antibody or fragment thereof can be a single domain antibody (sdAb).
  • the sdAb can be a V HH .
  • the V HH can be Fc conjugated.
  • the Fc can be a variant of IgG.
  • the Fc can be from an effector-function silent IgG.
  • the effector-function silent IgG can contain point mutations that abrogate binding of Fc receptors (Fc ⁇ R, FcR), abolishing antibody directed cytotoxicity (ADCC) effector function.
  • the effector-function silent IgG Fc can comprise one or more mutations. The one or more mutations can be in the hinge and/or CH 2 regions.
  • the Fc can be from an effector-function silent IgG4.
  • the Fc can be from an effector-function silent IgG2, which can be engineered with V234A/G237A /P238S/H268A/V309L/A330S/P331S substitutions to eliminate affinity for Fc ⁇ R and C1q complement protein and consequently, immune effector functions.
  • the Fc can be from an effector-function silent IgG1 (e.g., aglycosylated IgG1).
  • the Fc can be from an effector-function silent IgG2m4 (H268Q/V309L/A330S/P331S, changes to IgG4).
  • the Fc can be from an effector-function silent IgG4 ProAlaAla (S228P/L234A/L235A).
  • the anti-PD-1 antibody or fragment thereof as described herein comprises a sequence encoded by a nucleic acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the nucleic acid sequences listed in Table 10.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises a sequence encoded by any one of the nucleotide sequences listed in Table 10.
  • the anti-PD-1 antibody or fragment thereof as described herein is encoded by a nucleic acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the nucleic acid sequences listed in Table 10.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises a sequence encoded by any one of the nucleic acid sequences listed in Table 10.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences listed in Table 10. In some embodiments, the anti-PD-1 antibody or fragment thereof as described herein comprises any one of the CDR sequences listed in Table 10.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences of the anti-PD-1 antibody or fragment thereof sequences listed in Table 10.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises a CDR sequence of any one of the CDR sequences of the anti-PD-1 antibody or fragment thereof sequences listed in Table 10.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the anti-PD-1 antibody or fragment thereof sequences listed in Table 10.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises any one of the anti-PD-1 antibody or fragment thereof sequences listed in Table 10.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the sequences of SEQ ID NOs: 1-3.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises a CDR sequence of SEQ ID NOs: 1-3.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences of SEQ ID NOs: 4-8.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises the CDR sequence of SEQ ID NOs: 4-8.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the amino acid sequences selected from SEQ ID NOs: 1-24, 75, 77, 79, 81, 83, and 85.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises the amino acid sequences selected from SEQ ID NOs : 1-24, 75, 77, 79, 81, 83, and 85.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to the amino acid sequence of SEQ ID NO:4 or 6.
  • the anti-PD-1 antibody or fragment thereof as described herein comprises the amino acid sequence of SEQ ID NOs : 4 or 6.
  • sequence of the anti-PD-1 antibody or fragment thereof as described herein is an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to the amino acid sequence of SEQ ID NO:4 or 6.
  • sequence of the anti-PD-1 antibody or fragment thereof as described herein is the amino acid sequence of SEQ ID NOs : 4 or 6.
  • the recombinant nucleic acid molecule as described herein comprises a sequence encoding an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the amino acid sequences selected from SEQ ID NOs: 1-24, 75, 77, 79, 81, 83, and 85.
  • the recombinant nucleic acid molecule as described herein comprises a sequence encoding any one of the amino acid sequences selected from SEQ ID NOs: 1-24, 75, 77, 79, 81, 83, and 85.
  • the recombinant nucleic acid molecule as described herein comprises a sequence encoding an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to the amino acid sequence of SEQ ID NO:4 or 6.
  • the recombinant nucleic acid molecule as described herein comprises the amino acid sequence of SEQ ID NOs : 4 or 6.
  • the anti-PD-1 antibody or fragment thereof that specifically binds programmed cell death protein 1 (PD-1) inhibits an interaction of PD-1 with PD-L1 or PD-L2.
  • the anti-PD-1 antibody or fragment thereof that specifically binds programmed cell death protein 1 (PD-1) is secreted by the T cell.
  • an anti-PD-1 fusion peptide comprising an anti- PD-1 antibody or fragment thereof that specifically binds PD-1 and an enhancing domain.
  • the enhancing domain can be a cytokine or fragment thereof.
  • the enhancing domain can be a cytokine receptor or fragment thereof.
  • the anti-PD-1 antibody or fragment thereof can inhibit an interaction of PD-1 with PD-L1 or PD-L2.
  • the cytokine can be IL-15 or IL-12.
  • the anti-PD-1 antibody fusion peptide can further comprise a cytokine receptor such as IL-15R or fragment thereof.
  • the anti-PD-1 antibody fusion peptide can comprise an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, where the anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof; and an interleukin-15 (IL-15) polypeptide or fragment thereof.
  • the anti-PD-1 antibody is any of the PD-1 antibodies described above and in Table 10.
  • the PD-1 antibody of the anti-PD-1 antibody fusion peptide can be an off-the-shelf anti-PD-1 antibody.
  • the fusion peptide as described herein further comprises a signal sequence or a leader sequence.
  • the signal sequence or the leader sequence comprises a PD-1 signal peptide.
  • the signal sequence or the leader sequence is a PD-1 signal peptide.
  • the signal sequence or the leader sequence comprises a IgGk signal peptide.
  • the signal sequence or the leader sequence comprises an IL-15R ⁇ signal peptide.
  • the signal sequence or the leader sequence comprises a GM-CSFR leader sequence.
  • the signal sequence or the leader sequence comprises a p40 leader sequence.
  • the fusion peptide comprises at least two, three, four, five, six, seven, eight, nine, ten or more anti-PD-1 antibodies or fragments thereof. In some embodiments, the at least two, three, four, five, six, seven, eight, nine, ten or more anti-PD-1 antibodies or fragments thereof are operatively linked tandemly. In some embodiments, the at least two, three, four, five, six, seven, eight, nine, ten or more anti-PD-1 antibodies or fragments thereof are identical.
  • the at least two, three, four, five, six, seven, eight, nine, ten or more anti-PD-1 antibodies or fragments thereof are different. In some embodiments, the at least two, three, four, five, six, seven, eight, nine, ten or more anti-PD-1 antibodies or fragments thereof are operatively linked by a linker.
  • T cell receptor (TCR) fusion proteins T cell receptor (TCR) [0568]
  • TFP T cell receptor
  • TFP T cell receptor
  • the present disclosure encompasses recombinant nucleic acid constructs encoding TFPs and variants thereof, wherein the TFP comprises a binding domain, e.g., an antibody or antibody fragment, a ligand, or a ligand binding protein, that binds specifically to a tumor-associated antigen (TAA), e.g., human TAA, wherein the sequence of the binding domain is contiguous with and in the same reading frame as a nucleic acid sequence encoding a TCR subunit or portion thereof.
  • TAA tumor-associated antigen
  • the TFPs provided herein are able to associate with one or more endogenous (or alternatively, one or more exogenous, or a combination of endogenous and exogenous) TCR subunits in order to form a functional TCR complex.
  • the recombinant nucleic acid encoding the TFP can be on the same nucleic acid molecule encoding the anti-PD-1 fusion peptide or on a different nucleic acid molecule separate from the nucleic acid molecule or sequence encoding the anti-PD-1 fusion peptide.
  • TFPs provide substantial benefits as compared to Chimeric Antigen Receptors.
  • CAR Chimeric Antigen Receptor
  • a CAR refers to a recombinant polypeptide comprising an extracellular antigen binding domain in the form of, e.g., a single domain antibody or scFv, a transmembrane domain, and cytoplasmic signaling domains (also referred to herein as “intracellular signaling domains”) comprising a functional signaling domain derived from a stimulatory molecule as defined below.
  • intracellular signaling domains also referred to herein as “intracellular signaling domains”
  • the central intracellular signaling domain of a CAR is derived from the CD3 zeta chain that is normally found associated with the TCR complex.
  • the CD3 zeta signaling domain can be fused with one or more functional signaling domains derived from at least one co-stimulatory molecule such as 4-1BB (i.e., CD137), CD27 and/or CD28.
  • the TFP of the present disclosure comprises a target-specific binding element otherwise referred to as an antigen binding domain.
  • the choice of moiety depends upon the type and number of target antigen that define the surface of a target cell.
  • the antigen binding domain may be chosen to recognize a target antigen that acts as a cell surface marker on target cells associated with a particular disease state.
  • examples of cell surface markers that may act as target antigens for the antigen binding domain in a TFP of the present disclosure include those associated with viral, bacterial and parasitic infections; autoimmune diseases; and cancerous diseases (e.g., malignant diseases).
  • the TFP-mediated T cell response can be directed to an antigen of interest by way of engineering an antigen-binding domain into the TFP that specifically binds a desired antigen.
  • the antigen binding domain can be any domain that binds to the antigen including but not limited to a monoclonal antibody, a polyclonal antibody, a recombinant antibody, a human antibody, a humanized antibody, and a functional fragment thereof, including but not limited to a single-domain antibody such as a heavy chain variable domain (VH), a light chain variable domain (V L ) and a variable domain (V HH ) of a camelid derived nanobody, and to an alternative scaffold known in the art to function as antigen binding domain, such as a recombinant fibronectin domain, anticalin, DARPIN and the like.
  • VH heavy chain variable domain
  • V L light chain variable domain
  • V HH variable domain of a camelid derived nanobody
  • the TFP comprises an antigen-binding domain comprises a humanized or human antibody or an antibody fragment, or a murine antibody or antibody fragment.
  • the murine, human, or humanized antigen binding domain is, e.g., an antibody or antibody fragment.
  • the antibody or antibody fragment is an scFv or single domain antibody (sdAb).
  • the antibody is an scFv and comprises one or more (e.g., all three) light chain complementary determining region 1 (LC CDR1), light chain complementary determining region 2 (LC CDR2), and light chain complementary determining region 3 (LC CDR3) of a humanized or human anti-tumor- associated antigen binding domain described herein, and/or one or more (e.g., all three) heavy chain complementary determining region 1 (HC CDR1), heavy chain complementary determining region 2 (HC CDR2), and heavy chain complementary determining region 3 (HC CDR3) of a humanized or human anti-tumor-associated antigen binding domain described herein, e.g., a humanized or human anti-CD19, anti-BCMA, anti-MUC16, anti-mesothelin (anti-MSLN), anti-CD79B, anti-HER2, anti-PSMA, anti-CD20, anti-CD70
  • the humanized or human anti-tumor-associated antigen (anti-TAA) binding domain comprises a humanized heavy chain variable region described herein, e.g., at least two humanized or human heavy chain variable regions described herein.
  • the anti-TAA binding domain is a scFv comprising a light chain and a heavy chain of an amino acid sequence provided herein.
  • the anti-TAA binding domain (e.g., a scFv) comprises: a light chain variable region comprising an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 30, 20 or 10 modifications (e.g., substitutions) of an amino acid sequence of a light chain variable region provided herein, or a sequence with 95-99% identity with an amino acid sequence provided herein; and/or a heavy chain variable region comprising an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 30, 20 or 10 modifications (e.g., substitutions) of an amino acid sequence of a heavy chain variable region provided herein, or a sequence with 95-99% identity to an amino acid sequence provided herein.
  • a light chain variable region comprising an amino acid sequence having at least one, two or three modifications (e.g., substitutions) but not more than 30, 20 or 10 modifications (e.g., substitutions) of an amino acid sequence of a heavy chain variable region provided here
  • the anti-TAA binding domain is a scFv, and a light chain variable region comprising an amino acid sequence described herein, is attached to a heavy chain variable region comprising an amino acid sequence described herein, via a linker, e.g., a linker described herein.
  • the humanized anti-TAA binding domain includes a (Gly4-Ser)n linker, wherein n is 1, 2, 3, 4, 5, or 6, preferably 3 or 4.
  • the light chain variable region and heavy chain variable region of a scFv can be, e.g., in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.
  • a non-human antibody is humanized, where specific sequences or regions of the antibody are modified to increase similarity to an antibody naturally produced in a human or fragment thereof.
  • the antigen binding domain is humanized.
  • a humanized antibody including those of the antigen binding domains and the anti-PD-1 antibodies described herein, can be produced using a variety of techniques known in the art, including but not limited to, CDR-grafting (see, e.g., European Patent No. EP 239,400; International Publication No.
  • a humanized antibody or antibody fragment has one or more amino acid residues remaining in it from a source which is nonhuman. These nonhuman amino acid residues are often referred to as “import” residues, which are typically taken from an “import” variable domain.
  • humanized antibodies or antibody fragments comprise one or more CDRs from nonhuman immunoglobulin molecules and framework regions wherein the amino acid residues comprising the framework are derived completely or mostly from human germline.
  • Multiple techniques for humanization of antibodies or antibody fragments are well-known in the art and can essentially be performed following the method of Winter and co-workers (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody, i.e., CDR-grafting (EP 239,400; PCT Publication No.
  • WO 91/09967 and U.S. Pat. Nos.4,816,567; 6,331,415; 5,225,539; 5,530,101; 5,585,089; 6,548,640, the contents of which are incorporated herein by reference in their entirety).
  • Humanized antibodies and antibody fragments substantially less than an intact human variable domain has been substituted by the corresponding sequence from a nonhuman species.
  • Humanized antibodies are often human antibodies in which some CDR residues and possibly some framework (FR) residues are substituted by residues from analogous sites in rodent antibodies.
  • the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable-domain sequences.
  • the human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol., 151:2296 (1993); Chothia et al., J. Mol. Biol., 196:901 (1987), the contents of which are incorporated herein by reference herein in their entirety).
  • Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains.
  • the same framework may be used for several different humanized antibodies (see, e.g., Nicholson et al., Mol. Immun.34 (16-17): 1157-1165 (1997); Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993), the contents of which are incorporated herein by reference herein in their entirety).
  • the framework region e.g., all four framework regions, of the heavy chain variable region are derived from a V H 4-4-59 germline sequence.
  • the framework region can comprise, one, two, three, four or five modifications, e.g., substitutions, e.g., from the amino acid at the corresponding murine sequence.
  • the framework region e.g., all four framework regions of the light chain variable region are derived from a VK3-1.25 germline sequence.
  • the framework region can comprise, one, two, three, four or five modifications, e.g., substitutions, e.g., from the amino acid at the corresponding murine sequence.
  • the portion of a TFP composition of the present disclosure that comprises an antibody fragment is humanized with retention of high affinity for the target antigen and other favorable biological properties.
  • humanized antibodies and antibody fragments are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences.
  • Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art.
  • Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, e.g., the analysis of residues that influence the ability of the candidate immunoglobulin to bind the target antigen.
  • a humanized antibody or antibody fragment may retain a similar antigenic specificity as the original antibody, e.g., in the present disclosure, the ability to bind a human TAA or PD-1.
  • a humanized antibody or antibody fragment may have improved affinity and/or specificity of binding to human CD19, human BCMA, human MUC16, human mesothelin (MSLN), human CD79B, human HER2, human PSMA, human CD20, human CD70, human Nectin-4, human GPC3, human TROP-2, or human PD-1.
  • the binding domain is characterized by particular functional features or properties of an antibody or antibody fragment.
  • the portion of a TFP composition of the present disclosure that comprises an antigen binding domain specifically binds human CD19, human BCMA, human MUC16, human mesothelin, human CD79B, human HER2, human PSMA, human CD70, human CD20, human Nectin-4, human GPC3, human TROP-2, or human PD-1.
  • the antigen binding domain has the same or a similar binding specificity to human CD19 as the FMC63 scFv described in Nicholson et al., Mol. Immun.34 (16-17): 1157- 1165 (1997).
  • the antibody has the antigen binding domain of FMC63 or another anti-CD19 antibody.
  • exemplary antibodies that bind CD19 include, but are not limited to, inebilizumab, MDX-1342, tafasitamab, obexelimab, B4 (Merck), immunomedics hA19, and those described in WO2019112347, WO2010142952, WO2018108106, WO2009086514, WO2006121852, WO2010095031, WO2016059253, WO2009102473, WO2001058916, WO2012010561, WO2005012493, WO2008031056, WO2019214332, WO2017126587, WO2000035409, WO2019137518, WO2007002223, WO2012067981, WO2007076950, WO2002020615, WO2001070266, WO2005035582, WO2015179236, WO2013184218, WO2018101448, WO2016112855, WO2010021697, WO2001057226, WO2017165
  • the antigen-binding domain comprises an anti-CD19 humanized or human antibody or an antibody fragment, or a murine antibody or antibody fragment having a light chain CDR1 of SEQ ID NO:26, a CDR2 of SEQ ID NO:28, and a CDR3 of SEQ ID NO:30 and a heavy chain CDR1 of SEQ ID NO:32, a CDR2 of SEQ ID NO:34, and a CDR3 of SEQ ID NO:36.
  • the anti-CD19 antibody is a murine scFv.
  • the anti-CD-19 antibody comprises a VL of SEQ ID NO:38 and a VH of SEQ ID NO:40.
  • the anti-CD19 antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences listed in Table 11.
  • the anti-CD19 antibody or fragment thereof as described herein comprises any one of the CDR sequences listed in Table 11.
  • the anti-CD19 antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences of the anti-CD19 antibody or fragment thereof sequences listed in Table 11.
  • the anti-CD19 antibody or fragment thereof as described herein comprises a CDR sequence of any one of the CDR sequences of the anti-CD19 antibody or fragment thereof sequences listed in Table 11.
  • the anti-CD19 antibody or fragment thereof as described herein comprises an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the anti-CD19 antibody or fragment thereof sequences listed in Table 11.
  • the anti-CD19 antibody or fragment thereof as described herein comprises any one of the anti-CD19 antibody or fragment thereof sequences listed in Table 11. [0585]
  • the antibody has the antigen binding domain of an anti-BCMA antibody.
  • Exemplary antibodies that bind BCMA include, but are not limited to, SEA-BCMA (Seattle Genetics) and those described in WO2010104949, WO2011108008, WO2014122143, WO2016090327, WO2017143069, WO2017211900, WO2018133877, WO2019066435, WO2019149269.
  • SEA-BCMA ttle Genetics
  • WO2010104949 WO2011108008, WO2014122143
  • WO2016090327 WO2017143069
  • WO2017211900 WO2018133877
  • WO2019066435 WO2019149269.
  • WO2019190969, and WO2019195017 the contents of each of which are incorporated by reference herein in their entirety.
  • the anti-BCMA antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences listed in Table 11.
  • the anti-BCMA antibody or fragment thereof as described herein comprises any one of the CDR sequences listed in Table 11.
  • the anti-BCMA antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences of the anti-BCMA antibody or fragment thereof sequences listed in Table 11.
  • the anti-BCMA antibody or fragment thereof as described herein comprises a CDR sequence of any one of the CDR sequences of the anti-BCMA antibody or fragment thereof sequences listed in Table 11.
  • the anti-BCMA antibody or fragment thereof as described herein comprises an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the anti-BCMA antibody or fragment thereof sequences listed in Table 11.
  • the anti-BCMA antibody or fragment thereof as described herein comprises any one of the anti-BCMA antibody or fragment thereof sequences listed in Table 11. [0587]
  • the antibody has the antigen binding domain of an anti-mesothelin antibody.
  • Exemplary antibodies that bind mesothelin include, but are not limited to, amatuximab and those described in WO2006099141, WO2006124641, WO2009120769, WO2010111282, WO2014004549, WO2014031476, WO2014052064, WO2017032293, and WO2017052241, the contents of each of which are incorporated by reference herein in their entirety.
  • the antigen-binding domain comprises an anti-mesothelin humanized or human single domain antibody or an antibody fragment having a CDR1 of SEQ ID NO:60, a CDR2 of SEQ ID NO:61, and a CDR3 of SEQ ID NO:62 or a CDR1 of SEQ ID NO:63, a CDR2 of SEQ ID NO:64, and a CDR3 of SEQ ID NO:65 or a CDR1 of SEQ ID NO:66, a CDR2 of SEQ ID NO:67, and a CDR3 of SEQ ID NO:68.
  • the anti-mesothelin antibody has a variable domain of SEQ ID NO:69, SEQ ID NO:70, or SEQ ID NO:71.
  • the anti-mesothelin antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences listed in Table 11.
  • the anti-mesothelin antibody or fragment thereof as described herein comprises any one of the CDR sequences listed in Table 11.
  • the anti-mesothelin antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences of the anti-mesothelin antibody or fragment thereof sequences listed in Table 11.
  • the anti-mesothelin antibody or fragment thereof as described herein comprises a CDR sequence of any one of the CDR sequences of the anti-mesothelin antibody or fragment thereof sequences listed in Table 11.
  • the anti-mesothelin antibody or fragment thereof as described herein comprises an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the anti-mesothelin antibody or fragment thereof sequences listed in Table 11.
  • the anti-mesothelin antibody or fragment thereof as described herein comprises any one of the anti-mesothelin antibody or fragment thereof sequences listed in Table 11. [0590]
  • the antibody has the antigen binding domain of an anti- MUC16 antibody.
  • Exemplary antibodies that bind MUC16 include, but are not limited to, oregovomab, 4H11 (Memorial Sloan Kettering Cancer Center), sofituzumab, and those described in WO2018058003, the contents of which is incorporated by reference herein in its entirety.
  • the antibody has the antigen binding domain of an anti- CD79B antibody.
  • Exemplary antibodies that bind CD79B include, but are not limited to, those described in WO2017009474 and WO2016021621, the contents of each of which are incorporated by reference herein in their entirety.
  • the antibody has the antigen binding domain of an anti-HER2 antibody.
  • Exemplary antibodies that bind HER2 include, but are not limited to, trastuzumab, pertuzumab, margetuximab, trastuzumab-pkrb, ertumaxomab, SB3, PF-05280014, CMAB302, trastuzumab-dkst, HD201, GB221, BCD-022, trastuzumab-anns, HLX02, DMB-3111, timigutuzumab, UB-921, IBI315, RG6194, HLX22, SIBP-01, TX05, and DXL702. [0593] In one embodiment, the antibody has the antigen binding domain of an anti-PSMA antibody.
  • Exemplary antibodies that bind PSMA include, but are not limited to, MDX1201-A488 and those described in WO2001009192, WO200303490, WO2007002222, WO2009130575, WO2010118522, WO2013185117, WO2013188740, WO2014198223, WO2016145139, WO2017121905, WO2017180713, WO2017212250, WO2018033749, WO2018129284, WO2018142323, and WO2019191728, the contents of each of which are incorporated by reference herein in their entirety.
  • the antibody has the antigen binding domain of an anti-CD70 antibody.
  • Exemplary antibodies that bind CD70 include, but are not limited to, cusatuzumab, MDX-1411, vorsetuzumab and those described in WO2014158821 and WO2018152181, the contents of each of which are incorporated by reference herein in their entirety.
  • the antigen-binding domain comprises an anti-CD70 humanized or human single domain antibody or an antibody fragment having a CDR1 of SEQ ID NO:188, a CDR2 of SEQ ID NO:189, and a CDR3 of SEQ ID NO:190, or a CDR1 of SEQ ID NO:192, a CDR2 of SEQ ID NO:193, and a CDR3 of SEQ ID NO:194, or a CDR1 of SEQ ID NO:196, a CDR2 of SEQ ID NO:197, and a CDR3 of SEQ ID NO:198, or a CDR1 of SEQ ID NO:200, a CDR2 of SEQ ID NO:201, and a CDR3 of SEQ ID NO:202, or a CDR1 of SEQ ID NO:204, a CDR2 of SEQ ID NO:205, and a CDR3 of SEQ ID NO:206, or a CDR1 of SEQ ID NO:208, a CDR1 of SEQ ID NO:
  • the anti-CD70 antibody fragment thereof can comprise a variable (VL) domain having at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO:207.
  • the antigen-binding domain comprises an anti-CD70 single chain Fv (scFv) or an antibody fragment thereof.
  • the anti-CD70 scFv or antibody fragment thereof can comprise a heavy chain complementary determining region 1 (CDRH1) having a sequence of SEQ ID NO:224, a CDRH2 having a sequence of SEQ ID NO:225, and a CDRH3 having a sequence of SEQ ID NOs: 226.
  • the anti-CD70 scFv or antibody fragment thereof can comprise a light chain complementary determining region 1 (CDRL1) having a sequence of SEQ ID NO:228, a CDRL2 having a sequence of SEQ ID NO:229, and a CDRL3 having a sequence of SEQ ID NO:230.
  • the anti-CD70 scFv or antibody fragment thereof can comprise a heavy chain variable (VH) domain having at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO:227.
  • the anti-CD70 scFv or antibody fragment thereof can comprise a light chain variable (VL) domain having at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to SEQ ID NO:231.
  • the anti-CD70 antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences listed in Table 11.
  • the anti-CD70 antibody or fragment thereof as described herein comprises any one of the CDR sequences listed in Table 11.
  • the anti-CD70 antibody or fragment thereof as described herein comprises a CDR sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences of the anti-CD70 antibody or fragment thereof sequences listed in Table 11.
  • the anti-CD70 antibody or fragment thereof as described herein comprises a CDR sequence of any one of the CDR sequences of the anti-CD70 antibody or fragment thereof sequences listed in Table 11.
  • the anti-CD70 antibody or fragment thereof as described herein comprises an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the anti-CD70 antibody or fragment thereof sequences listed in Table 11.
  • the anti-CD70 antibody or fragment thereof as described herein comprises any one of the anti-CD70 antibody or fragment thereof sequences listed in Table 11.
  • a TFP that specifically binds human CD19 comprises a heavy chain variable region having the sequence of SEQ ID NO:40 and a light chain variable region having the sequence of SEQ ID NO:38.
  • a TFP that specifically binds human MSLN comprises or consists of a V HH having a sequence of SEQ ID NO:69, SEQ ID NO:70 or SEQ ID NO:71.
  • the antigen-binding domain or fragment thereof as described herein comprises a sequence encoding an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the amino acid sequences listed in Table 11.
  • the antigen-binding domain or fragment thereof as described herein comprises a sequence encoding any one of the amino acid sequences listed in Table 11.
  • the antigen-binding domain or fragment thereof as described herein comprises a nucleic acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the nucleic acid sequences listed in Table 11.
  • the antigen-binding domain or fragment thereof as described herein comprises a nucleic acid sequence encoding any one of the nucleic acid sequences listed in Table 11.
  • the antigen-binding domain or fragment thereof as described herein comprises a sequences encoding CDR sequences having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the CDR sequences listed in Table 11.
  • the antigen-binding domain or fragment thereof as described herein comprises a sequence encoding any one of the CDR sequences listed in Table 11.
  • the antigen-binding domain or fragment thereof as described herein comprises a sequence encoding CDR sequences having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to the CDR sequences of any one of the sequences listed in Table 11.
  • the antigen-binding domain or fragment thereof as described herein comprises a sequence encoding CDR sequences of any one of the sequences listed in Table 11.
  • the present disclosure relates to an antigen binding domain comprising an antibody or antibody fragment, wherein the antibody binding domain specifically binds to a tumor-associated protein or fragment thereof, wherein the antibody or antibody fragment comprises a variable light chain and/or a variable heavy chain that includes an amino acid sequence provided herein.
  • the binding domain is contiguous with and in the same reading frame as a leader sequence.
  • the anti-tumor-associated antigen binding domain is a fragment, e.g., a single chain variable fragment (scFv).
  • the anti-TAA binding domain is a Fv, a Fab, a (Fab’)2, or a bi-functional (e.g.
  • the antibodies and fragments thereof of the present disclosure binds a tumor-associated protein with wild-type or enhanced affinity.
  • the anti-TAA binding domain comprises a single domain antibody (sdAb or V HH ).
  • an antigen binding domain specific for a target antigen e.g., CD19, BCMA, MUC16, MSLN, CD20, CD70, CD79B, HER2, PSMA, Nectin-4, GPC3, TROP-2, PD-1 or any target antigen described elsewhere herein for targets of fusion moiety binding domains
  • the method comprising providing by way of addition, deletion, substitution or insertion of one or more amino acids in the amino acid sequence of a VH domain set out herein a VH domain which is an amino acid sequence variant of the VH domain, optionally combining the V H domain thus provided with one or more V L domains, and testing the V H domain or V H /V L combination or combinations to identify a specific binding member or an antibody antigen binding domain specific for a target antigen of interest and optionally with one or more desired properties.
  • a target antigen e.g., CD19, BCMA, MUC16, MSLN, CD20, CD70, CD79B, HER2, PSMA, Nect
  • V H domains and scFvs can be prepared according to method known in the art (see, for example, Bird et al., (1988) Science 242:423-426 and Huston et al., (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883).
  • ScFv molecules can be produced by linking VH and VL regions together using flexible polypeptide linkers.
  • the scFv molecules comprise a linker (e.g., a Ser-Gly linker) with an optimized length and/or amino acid composition. The linker length can greatly affect how the variable regions of a scFv fold and interact.
  • linker orientation and size see, e.g., Hollinger et al., 1993, Proc Natl Acad. Sci. U.S.A.90:6444-6448, U.S.
  • An scFv can comprise a linker of about 10, 11, 12, 13, 14, 15 or greater than 15 residues between its VL and VH regions.
  • the linker sequence may comprise any naturally occurring amino acid.
  • the linker sequence comprises amino acids glycine and serine.
  • the linker sequence comprises sets of glycine and serine repeats such as (Gly4Ser)n, where n is a positive integer equal to or greater than 1.
  • the linker can be (Gly 4 Ser) 4 or (Gly 4 Ser) 3 . Variation in the linker length may retain or enhance activity, giving rise to superior efficacy in activity studies.
  • Stability and Mutations The stability of a tumor associated antigen binding domain or an anti-PD-1 antibody described herein, e.g., scFv or sdAb molecules (e.g., soluble scFv or sdAb) can be evaluated in reference to the biophysical properties (e.g., thermal stability) of a conventional control scFv or sdAb molecule or a full-length antibody.
  • scFv or sdAb molecules e.g., soluble scFv or sdAb
  • the humanized or human scFv or sdAb has a thermal stability that is greater than about 0.1, about 0.25, about 0.5, about 0.75, about 1, about 1.25, about 1.5, about 1.75, about 2, about 2.5, about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, about 9, about 9.5, about 10 degrees, about 11 degrees, about 12 degrees, about 13 degrees, about 14 degrees, or about 15 degrees Celsius than a parent scFv or sdAb in the described assays.
  • the improved thermal stability of the anti-TAA binding domain is subsequently conferred to the entire TAA-TFP construct, leading to improved therapeutic properties of the anti-TAA TFP construct.
  • the thermal stability of the binding domain or anti- PD-1 antibody, e.g., scFv or sdAb can be improved by at least about 2 °C or 3 °C as compared to a conventional antibody.
  • the binding domain has a 1 °C improved thermal stability as compared to a conventional antibody.
  • the binding domain has a 2 °C improved thermal stability as compared to a conventional antibody.
  • the scFv or sdAb has a 4 °C, 5 °C, 6 °C, 7 °C, 8 °C, 9 °C, 10 °C, 11 °C, 12 °C, 13 °C, 14 °C, or 15 °C improved thermal stability as compared to a conventional antibody. Comparisons can be made, for example, between the scFv or sdAb molecules disclosed herein and scFv or sdAb molecules or Fab fragments of an antibody from which the scFv VH and VL or sdAb V H were derived. Thermal stability can be measured using methods known in the art. For example, in one embodiment, T M can be measured.
  • the binding domain or anti-PD-1 antibody comprises at least one mutation arising from the humanization process such that the mutated scFv or sdAb confers improved stability to the anti-PD-1 antibody or anti-TAA TFP construct.
  • the anti-TAA binding domain or anti-PD-1 antibody e.g., scFv or sdAb, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 mutations arising from the humanization process such that the mutated scFv or sdAb confers improved stability to the TAA-TFP construct or anti-PD-1 antibody.
  • the antigen binding domain of the TFP or anti-PD-1 antibody comprises an amino acid sequence that is homologous to an antigen binding domain amino acid sequence described herein, and the antigen binding domain retains the desired functional properties of the anti-tumor-associated antigen antibody fragments or anti-PD-1 antibody described herein.
  • the TFP composition of the present disclosure comprises an antibody fragment.
  • that antibody fragment comprises a scFv or sdAb.
  • the antigen binding domain of the TFP or anti-PD-1 antibody is engineered by modifying one or more amino acids within one or both variable regions (e.g., VH and/or V L ), for example within one or more CDR regions and/or within one or more framework regions.
  • the TFP composition of the present disclosure comprises an antibody fragment.
  • that antibody fragment comprises a scFv.
  • the antibody or antibody fragment of the present disclosure may further be modified such that they vary in amino acid sequence (e.g., from wild-type), but not in desired activity.
  • nucleotide substitutions leading to amino acid substitutions at “non-essential” amino acid residues may be made to the protein.
  • a nonessential amino acid residue in a molecule may be replaced with another amino acid residue from the same side chain family.
  • a string of amino acids can be replaced with a structurally similar string that differs in order and/or composition of side chain family members, e.g., a conservative substitution, in which an amino acid residue is replaced with an amino acid residue having a similar side chain, may be made.
  • Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • basic side chains e.g., lysine, arginine, histidine
  • acidic side chains e.g., aspartic acid
  • Percent identity in the context of two or more nucleic acids or polypeptide sequences refers to two or more sequences that are the same. Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 60% identity, optionally 70%, 71% , 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
  • sequence comparison algorithm typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • the sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, (1970) Adv. Appl. Math.2:482c, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol.48:443, by the search for similarity method of Pearson and Lipman, (1988) Proc. Nat’l. Acad. Sci.
  • the present disclosure contemplates modifications of the starting antibody or fragment (e.g., scFv or sdAb) amino acid sequence that generate functionally equivalent molecules.
  • the V H or V L of a binding domain or anti-PD-1 antibody, e.g., scFv or sdAb, comprised in the TFP can be modified to retain at least about 70%, 71%.72%.73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity of the starting V H or V L framework region of the starting antibody fragment, e.g., scFv or sdAb.
  • the present disclosure contemplates modifications of the entire TFP construct, e.g., modifications in one or more amino acid sequences of the various domains of the TFP construct in order to generate functionally equivalent molecules.
  • the TFP construct can be modified to retain at least about 70%, 71%. 72%.73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity of the starting TFP construct.
  • the TFP comprises an antigen-binding domain that comprises a ligand.
  • the ligand or fragment thereof is capable of binding to an antibody or fragment thereof. In some instances, the ligand binds to the polypeptide expressed on a surface of a cell. In some instances, the receptor or polypeptide expressed on a surface of a cell comprises a stress response receptor or polypeptide. In some instances, the receptor or polypeptide expressed on a surface of a cell is an MHC class I-related glycoprotein.
  • the MHC class I- related glycoprotein is selected from the group consisting of MICA (MHC class I polypeptide- related sequence A; UniProt ID: Q29983), MICB (MHC class I polypeptide-related sequence B; UniProt ID: Q29980), RAET1E (Retinoic acid early transcript 1E; UniProt ID: Q8TD07), RAET1G (UL-16 binding protein 5; UniProt ID: Q6H3X3), ULBP1 (UL16-binding protein 1; UniProt ID: Q9BZM6), ULBP2 (UL16-binding protein 2; UniProt ID: Q9BZM5), ULBP3 (UL16-binding protein 3; UniProt ID: Q9BZM4), ULBP4 (Retinoic acid early transcript 1E; UniProt ID: Q8TD07) and combinations thereof.
  • MICA MHC class I polypeptide- related sequence A
  • MICB MHC class I polypeptide-related sequence
  • the antigen binding domain comprises a monomer, a dimer, a trimer, a tetramer, a pentamer, a hexamer, a heptamer, an octomer, a nonamer, or a decamer.
  • the antigen binding domain comprises a monomer or a dimer of the ligand or fragment thereof.
  • the ligand or fragment thereof is a monomer, a dimer, a trimer, a tetramer, a pentamer, a hexamer, a heptamer, an octomer, a nonamer, or a decamer.
  • the ligand or fragment thereof is a monomer or a dimer.
  • the antigen binding domain does not comprise an antibody or fragment thereof.
  • the antigen binding domain does not comprise a variable region.
  • the antigen binding domain does not comprise a CDR.
  • the ligand or fragment thereof is a Natural Killer Group 2D (NKG2D) ligand or a fragment thereof.
  • Extracellular domain may be derived either from a natural or from a recombinant source. Where the source is natural, the domain may be derived from any protein, but in particular a membrane-bound or transmembrane protein.
  • the extracellular domain is capable of associating with the transmembrane domain.
  • An extracellular domain of particular use in this present disclosure may include at least the extracellular region(s) of e.g., the alpha, beta, gamma, or delta chain of the T cell receptor, or CD3 epsilon, CD3 gamma, or CD3 delta, or in alternative embodiments, CD28, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154.
  • the TCR extracellular domain comprises an extracellular domain or portion thereof of a protein selected from the group consisting of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, a CD3 delta TCR subunit, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications.
  • the TCR extracellular domain comprises an extracellular domain or portion thereof of a TCR alpha chain, a TCR beta chain, a TCR delta chain, or a TCR gamma chain.
  • the TCR extracellular domain comprises the extracellular region of a constant domain or IgC domain of a TCR alpha chain, a TCR beta chain, a TCR delta chain, or a TCR gamma chain.
  • the extracellular domain comprises, or comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92,
  • the extracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to a sequence encoding the extracellular domain of a TCR alpha chain, a TCR beta chain, a TCR delta chain, or a TCR gamma chain.
  • the extracellular domain comprises a sequence encoding the extracellular domain of a TCR alpha chain, a TCR beta chain, a TCR delta chain, or a TCR gamma chain having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids at the N- or C-terminus or at both the N- and C-terminus.
  • the extracellular domain comprises, or comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues of the extracellular region of a constant domain or IgC domain of TCR alpha, a TCR beta, a TCR delta,
  • the extracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to a sequence encoding the extracellular region of a constant domain or IgC domain of TCR alpha, a TCR beta, a TCR delta, or a TCR gamma.
  • the extracellular domain comprises a sequence encoding the extracellular region of a constant domain or IgC domain of TCR alpha, TCR beta, TCR delta, or TCR gamma having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids at the N- or C-terminus or at both the N- and C-terminus.
  • the extracellular domain comprises, or comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more consecutive amino acid residues of the extracellular domain of a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit
  • the extracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to a sequence encoding the extracellular domain of a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit.
  • the extracellular domain comprises a sequence encoding the extracellular domain of a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids at the N- or C-terminus or at both the N- and C-terminus.
  • the extracellular domain can be a TCR extracellular domain.
  • the TCR extracellular domain can be derived from a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit or a CD3 delta TCR subunit.
  • the extracellular domain can be a full-length TCR extracellular domain or fragment (e.g., functional fragment) thereof.
  • the extracellular domain can comprise a variable domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain or a TCR delta chain.
  • the extracellular domain can comprise a variable domain and a constant domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain or a TCR delta chain. In some cases, the extracellular domain may not comprise a variable domain.
  • the extracellular domain can comprise an extracellular portion of a constant domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain or a TCR delta chain.
  • the extracellular domain can comprise the extracellular portion of a full-length constant domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain or a TCR delta chain.
  • the extracellular domain can comprise a fragment (e.g., functional fragment) of the extracellular portion of the full-length constant domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain or a TCR delta chain.
  • the extracellular domain can comprise at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid residues of the extracellular portion of the constant domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain or a TCR delta chain.
  • the TCR alpha chain, a TCR beta chain, a TCR gamma chain or a TCR delta chain described herein can be derived from various species.
  • the TCR chain can be a murine or human TCR chain.
  • the extracellular domain can comprise a constant domain of a murine TCR alpha chain, a murine TCR beta chain, a human TCR gamma chain or a human TCR delta chain.
  • Transmembrane Domain [0624]
  • a TFP sequence contains an extracellular domain and a transmembrane domain encoded by a single genomic sequence.
  • a TFP can be designed to comprise a transmembrane domain that is heterologous to the extracellular domain of the TFP.
  • a transmembrane domain can include one or more additional amino acids adjacent to the transmembrane region, e.g., one or more amino acid associated with the extracellular region of the protein from which the transmembrane was derived (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids of the extracellular region) and/or one or more additional amino acids associated with the intracellular region of the protein from which the transmembrane protein is derived (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more amino acids of the intracellular region).
  • the transmembrane domain can include at least 30, 35, 40, 45, 50, 55, 60 or more amino acids of the extracellular region. In some cases, the transmembrane domain can include at least 30, 35, 40, 45, 50, 55, 60 or more amino acids of the intracellular region. In one aspect, the transmembrane domain is one that is associated with one of the other domains of the TFP is used. In some instances, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, e.g., to minimize interactions with other members of the receptor complex.
  • the transmembrane domain is capable of homodimerization with another TFP on the TFP- T cell surface.
  • the amino acid sequence of the transmembrane domain may be modified or substituted so as to minimize interactions with the binding domains of the native binding partner present in the same TFP.
  • the transmembrane domain may be derived either from a natural or from a recombinant source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein.
  • the transmembrane domain is capable of signaling to the intracellular domain(s) whenever the TFP has bound to a target.
  • the TCR- integrating subunit comprises a transmembrane domain comprising a transmembrane domain of a protein selected from the group consisting of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a TCR zeta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, a CD3 delta TCR subunit, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137, CD154, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications.
  • the transmembrane domain comprises, or comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more consecutive amino acid residues of the transmembrane domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit.
  • the transmembrane domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to a sequence encoding the transmembrane domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit.
  • the transmembrane domain comprises a sequence encoding the transmembrane domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more amino acids at the N- or C-terminus or at both the N- and C-terminus.
  • the transmembrane domain can be attached to the extracellular region of the TFP, e.g., the antigen binding domain of the TFP, via a hinge, e.g., a hinge from a human protein.
  • the hinge can be a human immunoglobulin (Ig) hinge, e.g., an IgG4 hinge, or a CD8a hinge.
  • Ig immunoglobulin
  • Linkers [0628]
  • a short oligo- or polypeptide linker between 2 and 10 amino acids in length may form the linkage between the binding element and the TCR extracellular domain of the TFP.
  • a glycine-serine doublet provides a particularly suitable linker.
  • the linker may be at least about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more in length.
  • the linker comprises the amino acid sequence of GGGGSGGGGS (SEQ ID NO:120) or a sequence (GGGGS)x wherein X is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more (SEQ ID NO:122).
  • X is 2.
  • X is 4.
  • the linker is encoded by a nucleotide sequence of GGTGGCGGAGGTTCTGGAGGTGGAGGTTCC (SEQ ID NO:121).
  • Cytoplasmic Domain [0629] The cytoplasmic domain of the TFP can include an intracellular domain.
  • the intracellular domain is from CD3 gamma, CD3 delta, CD3 epsilon, TCR alpha, TCR beta, TCR gamma, or TCR delta.
  • the intracellular domain comprises a signaling domain, if the TFP contains CD3 gamma, delta or epsilon polypeptides; TCR alpha, TCR beta, TCR gamma, and TCR delta subunits generally have short (e.g., 1-19 amino acids in length) intracellular domains and are generally lacking in a signaling domain.
  • An intracellular signaling domain is generally responsible for activation of at least one of the normal effector functions of the immune cell in which the TFP has been introduced.
  • intracellular domains of TCR alpha, TCR beta, TCR gamma, and TCR delta do not have signaling domains, they are able to recruit proteins having a primary intracellular signaling domain described herein, e.g., CD3 zeta, which functions as an intracellular signaling domain.
  • effector function refers to a specialized function of a cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines.
  • intracellular signaling domain refers to the portion of a protein which transduces the effector function signal and directs the cell to perform a specialized function.
  • intracellular signaling domain While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal.
  • the term intracellular signaling domain is thus meant to include any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.
  • intracellular domains for use in the TFP of the present disclosure include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that are able to act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivative or variant of these sequences and any recombinant sequence that has the same functional capability.
  • the intracellular domain comprises the intracellular domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, a TCR delta chain, a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit.
  • the intracellular domain comprises, or comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 or more consecutive amino acid residues of the intracellular domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain.
  • the intracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to a sequence encoding the intracellular domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain.
  • the transmembrane domain comprises a sequence encoding the intracellular domain of a TCR alpha chain, a TCR beta chain, a TCR gamma chain, or a TCR delta chain having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more amino acids at the N- or C-terminus or at both the N- and C-terminus.
  • the intracellular domain comprises, or comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, or 62 or more consecutive amino acid residues of the intracellular domain of a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit.
  • the intracellular domain comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to a sequence encoding the intracellular domain of a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit.
  • the intracellular domain comprises a sequence encoding the intracellular domain of a CD3 epsilon TCR subunit, a CD3 gamma TCR subunit, or a CD3 delta TCR subunit having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids at the N- or C-terminus or at both the N- and C-terminus.
  • the TFPs described herein may comprise a TCR extracellular domain, a TCR transmembrane domain, and a TCR intracellular domain, wherein all three of the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain can be from the same TCR subunit.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain can be from CD3 epsilon.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain can be from CD3 delta.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain can be from CD3 gamma.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain may comprise the constant domain of TCR alpha.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain may comprise the constant domain of TCR beta.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain may comprise the constant domain of TCR gamma.
  • the TCR extracellular domain, the TCR transmembrane domain, and the TCR intracellular domain may comprise the constant domain of TCR delta.
  • the TCR subunit can comprise (i) at least a portion of a TCR extracellular domain, (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain of a TCR gamma chain or a TCR delta chain.
  • the TCR extracellular domain can comprise the extracellular portion of a constant domain of a TCR gamma chain or a TCR delta chain, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications.
  • the TCR subunit comprising (i) at least a portion of a TCR extracellular domain, (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain is or comprises a delta constant domain, or a fragment thereof, e.g., a delta constant domain described herein, or a gamma constant domain, e.g., a gamma constant domain described herein.
  • the extracellular domain of the TFP may not comprise the variable domain of a gamma chain or a delta chain.
  • the TCR subunit comprising at least a portion of a murine TCR alpha or murine TCR beta extracellular domain and a murine TCR alpha or murine TCR beta transmembrane domain is or comprises a TCR alpha constant domain or a TCR beta constant domain.
  • the TCR subunit can comprise an intracellular domain of murine TCR alpha or murine TCR beta.
  • the TCR constant domain can be a TCR alpha constant domain, e.g., a TCR alpha constant domain described herein.
  • the sequence encoding the TCR alpha constant domain can further encode a second antigen binding domain or ligand binding domain that is operatively linked to the sequence encoding the TCR alpha constant domain.
  • the second antigen binding domain or ligand binding domain can be the same or different as the antigen binding domain or ligand binding domain of the TFP.
  • the TCR alpha constant domain can comprise a murine TCR alpha constant domain.
  • the murine TCR alpha constant domain can comprise amino acids 2-137 of the murine TCR alpha constant domain.
  • the TCR constant domain can be a TCR beta constant domain, e.g., a TCR beta constant domain described herein.
  • the sequence encoding the TCR beta constant domain can further encode a second antigen binding domain or ligand binding domain that is operatively linked to the sequence encoding the TCR beta constant domain.
  • TCR beta constant domain can comprise a murine TCR beta constant domain.
  • the murine TCR beta constant domain can comprise amino acids 2-173 of the murine TCR beta constant domain.
  • the murine TCR alpha constant domain can comprise amino acids 2-137 of SEQ ID NO:386.
  • the murine TCR alpha constant domain can comprise truncations, additions, or substitutions of a sequence of a constant domain described herein.
  • the constant domain can comprise a truncated version of a constant domain described herein having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid residues of positions 2-137 of SEQ ID NO:386.
  • the constant domain can comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more additional amino acid residues of positions 2-137 of SEQ ID NO:386.
  • the constant domain can comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid substitutions of positions 2-137 of SEQ ID NO:386.
  • the constant domain can comprise a sequence or fragment thereof of positions 2-137 of SEQ ID NO:386.
  • the constant domain can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications, mutations or deletions of the sequence of positions 2-137 of SEQ ID NO:386.
  • the constant domain can comprise at most 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 modification, mutations or deletions of the sequence of positions 2-137 of SEQ ID NO:386.
  • the constant domain can comprise a sequence having a sequence identity of at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% to the sequence of positions 2-137 of SEQ ID NO:386.
  • the murine TCR beta constant domain can comprise amino acids 2-173 of SEQ ID NO:395.
  • the murine TCR beta constant domain can comprise truncations, additions, or substitutions of a sequence of a constant domain described herein.
  • the constant domain can comprise a truncated version of a constant domain described herein having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid residues of positions 2-173 of SEQ ID NO:395.
  • the constant domain can comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more additional amino acid residues of positions 2-173 of SEQ ID NO:395.
  • the constant domain can comprise a sequence having at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150 or more amino acid substitutions of positions 2-173 of SEQ ID NO:395.
  • the constant domain can comprise a sequence or fragment thereof of positions 22-173 of SEQ ID NO:395.
  • the constant domain can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modifications, mutations or deletions of the sequence of positions 2-173 of SEQ ID NO:395.
  • the constant domain can comprise at most 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 modification, mutations or deletions of the sequence of positions 2-173 of SEQ ID NO:395.
  • the constant domain can comprise a sequence having a sequence identity of at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% to the sequence of positions 2-173 of SEQ ID NO:395.
  • the TCR alpha chain, a TCR beta chain, a TCR gamma chain or a TCR delta chain described herein can be derived from various species.
  • the TCR chain can be a murine or human TCR chain.
  • the extracellular domain can comprise a constant domain of a murine TCR alpha chain, a murine TCR beta chain, a human TCR gamma chain or a human TCR delta chain.
  • na ⁇ ve T cell activation can be said to be mediated by two distinct classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation through the TCR (primary intracellular signaling domains) and those that act in an antigen-independent manner to provide a secondary or costimulatory signal (secondary cytoplasmic domain, e.g., a costimulatory domain).
  • primary signaling domain regulates primary activation of the TCR complex either in a stimulatory way, or in an inhibitory way.
  • Primary intracellular signaling domains that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine- based activation motifs (ITAMs).
  • ITAMs containing primary intracellular signaling domains include those of CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d.
  • a TFP of the present disclosure comprises an intracellular signaling domain, e.g., a primary signaling domain of CD3 epsilon, CD3 delta, or CD3 gamma.
  • a primary signaling domain comprises a modified ITAM domain, e.g., a mutated ITAM domain which has altered (e.g., increased or decreased) activity as compared to the native ITAM domain.
  • a primary signaling domain comprises a modified ITAM-containing primary intracellular signaling domain, e.g., an optimized and/or truncated ITAM-containing primary intracellular signaling domain.
  • a primary signaling domain comprises one, two, three, four or more ITAM motifs.
  • the intracellular signaling domain of the TFP can comprise a CD3 signaling domain, e.g., CD3 epsilon, CD3 delta, CD3 gamma, or CD3 zeta, by itself or it can be combined with any other desired intracellular signaling domain(s) useful in the context of a TFP of the present disclosure.
  • the intracellular signaling domain of the TFP can comprise a CD3 epsilon chain portion and a costimulatory signaling domain.
  • the costimulatory signaling domain refers to a portion of the TFP comprising the intracellular domain of a costimulatory molecule.
  • a costimulatory molecule is a cell surface molecule other than an antigen receptor or its ligands that is required for an efficient response of lymphocytes to an antigen.
  • examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83, and the like.
  • the intracellular signaling sequences within the cytoplasmic portion of the TFP of the present disclosure may be linked to each other in a random or specified order.
  • a short oligo- or polypeptide linker for example, between 2 and 10 amino acids (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) in length may form the linkage between intracellular signaling sequences.
  • a glycine-serine doublet can be used as a suitable linker.
  • a single amino acid e.g., an alanine, a glycine, can be used as a suitable linker.
  • the TFP-expressing cell described herein can further comprise a second TFP, e.g., a second TFP that includes a different antigen binding domain, e.g., to the same target (e.g., CD70) or a different target (e.g., MSLN, CD19, or MUC16).
  • the antigen binding domains of the different TFPs can be such that the antigen binding domains do not interact with one another.
  • a cell expressing a first and second TFP can have an antigen binding domain of the first TFP, e.g., as a fragment, e.g., a scFv, that does not form an association with the antigen binding domain of the second TFP, e.g., the antigen binding domain of the second TFP is a VHH.
  • the TFP-expressing cell described herein can further express another agent, e.g., an agent which enhances the activity of a modified T cell.
  • the agent can be an agent which inhibits an inhibitory molecule.
  • Inhibitory molecules e.g., PD-1
  • inhibitory molecules include PD-1, PD-L1, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4 and TGFR beta.
  • the agent which inhibits an inhibitory molecule comprises a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein.
  • the agent comprises a first polypeptide, e.g., of an inhibitory molecule such as PD-1, LAG3, CTLA4, CD160, BTLA, LAIR1, TIM3, 2B4 and TIGIT, or a fragment of any of these (e.g., at least a portion of an extracellular domain of any of these), and a second polypeptide which is an intracellular signaling domain described herein (e.g., comprising a costimulatory domain (e.g., 4- 1BB, CD27 or CD28, e.g., as described herein) and/or a primary signaling domain (e.g., a CD3 zeta signaling domain described herein).
  • an inhibitory molecule such as PD-1, LAG3, CTLA4, CD160, BTLA, LAIR1, TIM3, 2B4 and TIGIT
  • a fragment of any of these e.g., at least a portion of an extracellular domain of any of these
  • a second polypeptide which is an intra
  • the agent comprises a first polypeptide of PD-1 or a fragment thereof (e.g., at least a portion of an extracellular domain of PD-1), and a second polypeptide of an intracellular signaling domain described herein (e.g., a CD28 signaling domain described herein and/or a CD3 zeta signaling domain described herein).
  • PD-1 is an inhibitory member of the CD28 family of receptors that also includes CD28, CTLA-4, ICOS, and BTLA.
  • PD-1 is expressed on activated B cells, T cells and myeloid cells (Agata et al., 1996, Int. Immunol 8:765-75).
  • PD-L1 Two ligands for PD-1, PD-L1 and PD-L2, have been shown to downregulate T cell activation upon binding to PD-1 (Freeman et al., 2000 J. Exp. Med. 192:1027-34; Latchman et al., 2001 Nat. Immunol.2:261-8; Carter et al., 2002 Eur. J. Immunol. 32:634-43).
  • PD-L1 is abundant in human cancers (Dong et al., 2003 J. Mol. Med.81:281-7; Blank et al., 2005 Cancer Immunol. Immunother.54:307-314; Konishi et al., 2004 Clin. Cancer Res.10:5094).
  • the agent comprises the extracellular domain (ECD) of an inhibitory molecule, e.g., Programmed Death 1 (PD-1) can be fused to a transmembrane domain and optionally an intracellular signaling domain such as 41BB and CD3 zeta (also referred to herein as a PD-1 TFP).
  • PD-1 TFP when used in combinations with an anti- TAA TFP described herein, improves the persistence of the T cell.
  • the TFP is a PD-1 TFP comprising the extracellular domain of PD 1.
  • TFPs containing an antibody or antibody fragment such as a scFv that specifically binds to the Programmed Death-Ligand 1 (PD-L1) or Programmed Death-Ligand 2 (PD-L2).
  • the agent that inhibits an inhibitory molecule is a fusion protein that comprises an extracellular domain having an antibody or antibody fragment that specifically binds PD-1, e.g., an anti-PD-1 antibody described herein, and further comprises a transmembrane domain.
  • transmembrane domains for use with the present disclosure include, but are not limited to, transmembrane domains derived from CD28, CD3 ⁇ , CD3 ⁇ , CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD41, CD64, CD68, CD80, CD86, CD134, CD137, CD154, ICOS, 4-1BB, OX40, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications.
  • the fusion protein further comprises a co-stimulatory domain.
  • Suitable co-stimulatory domains for use with the present disclosure include, but are not limited to, co-stimulatory domains derived from CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, NKG2D, B7-H3, a ligand that specifically binds with CD83, PD-1, CD258, ICAM-1, functional fragments thereof, and amino acid sequences thereof having at least one but not more than 20 modifications.
  • the present disclosure provides a population of TFP-expressing T cells, e.g., TFP-T cells.
  • the population of TFP-expressing T cells comprises a mixture of cells expressing different TFPs.
  • the population of TFP-T cells can include a first cell expressing a TFP having a binding domain described herein, and a second cell expressing a TFP having a different anti-TAA binding domain, e.g., a binding domain described herein that differs from the binding domain in the TFP expressed by the first cell.
  • the population of TFP-expressing cells can include a first cell expressing a TFP that includes a first binding domain binding domain, e.g., as described herein, and a second cell expressing a TFP that includes an antigen binding domain to a target other than the binding domain of the first cell (e.g., another tumor-associated antigen).
  • the present disclosure provides a population of cells wherein at least one cell in the population expresses a TFP having a domain described herein, and a second cell expressing another agent, e.g., an agent which enhances the activity of a modified T cell.
  • the agent can be an agent which inhibits an inhibitory molecule.
  • Inhibitory molecules can, in some embodiments, decrease the ability of a modified T cell to mount an immune effector response.
  • inhibitory molecules include PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4 and TGFR beta.
  • the agent that inhibits an inhibitory molecule comprises a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein.
  • the agent is a cytokine.
  • the cytokine is IL-15.
  • IL-15 increases the persistence of the T cells described herein.
  • Recombinant Nucleic Acids [0652] Disclosed herein, in some embodiments, is a recombinant nucleic acid encoding a TFP disclosed herein. Also provided herein is a recombinant nucleic acid encoding an anti-PD-1 fusion peptide that specifically binds PD-1. The recombinant nucleic acid provided herein can comprise a first sequence encoding the anti-PD-1 fusion peptide that specifically binds PD-1 and a second sequence encoding the TFP.
  • a recombinant nucleic acid comprising a first sequence encoding an anti-PD-1 fusion peptide that specifically binds programmed cell death protein 1 (PD-1), and a second sequence encoding a T-cell receptor (TCR) fusion protein (TFP).
  • the TFP can comprise (i) a TCR subunit comprising: at least a portion of a TCR extracellular domain, a TCR transmembrane domain, and a TCR intracellular domain, and a binding domain.
  • the anti-PD-1 fusion peptide can be secreted when expressed in a T cell.
  • the anti-PD-1 fusion peptide can inhibit the interaction between PD-1 and PD-L1 and/or PD-L2.
  • the TCR subunit and the binding domain can be operatively linked.
  • the TFP can functionally interact with an endogenous TCR complex when expressed in the T cell.
  • the anti-PD-1 antibody can comprise an anti-PD-1 antibody or fragment thereof fused to an enhancing domain.
  • a recombinant nucleic acid comprising a sequence encoding an anti-PD-1 fusion peptide comprising (i) an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; (ii) an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof; and (iii) an interleukin-15 (IL-15) polypeptide or fragment thereof; wherein the anti-PD-1 antibody or fragment thereof, the IL-15R subunit polypeptide or a fragment thereof, and the IL-15 polypeptide or fragment thereof are operatively linked.
  • an anti-PD-1 fusion peptide comprising (i) an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; (ii) an interleuk
  • a recombinant nucleic acid comprising a sequence encoding a first anti-PD-1 fusion peptide comprising (i) a first anti- PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the first anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; and (ii) an IL-12 polypeptide or functional fragment thereof, wherein the first anti-PD-1 antibody or fragment thereof and the IL-12 polypeptide or functional fragment thereof are operatively linked.
  • the first sequence encoding the anti-PD-1 fusion peptide and the second sequence encoding the TFP can be contained in a single operon.
  • the first sequence and the second sequence can be encoded in frame.
  • the recombinant nucleic acid can further comprise a third sequence in between the first and second sequences encoding a self-cleaving peptide.
  • the self- cleaving peptide can be a T2A peptide.
  • the anti-PD-1 antibody can comprise an anti-PD-1 antibody or fragment thereof.
  • the anti-PD-1 antibody or fragment thereof can comprise a variable domain comprising a complementarity determining region 1 (CDR1), a CDR2, and a CDR3.
  • the CDR3 can comprise the encoded amino acid sequence of SEQ ID NO:3.
  • the CDR1 can comprise the encoded amino acid sequence of SEQ ID NO:1.
  • the CDR2 can comprise the encoded amino acid sequence of SEQ ID NO:2.
  • the variable domain of the anti-PD-1 antibody or fragment thereof can comprise a sequence of the variable domain described herein.
  • the binding domain of the TFP encoded by the recombinant nucleic acid can specifically bind to a TAA described herein.
  • the binding domain can specifically bind to CD19, BCMA, MUC16, MSLN, CD79B, HER2, PSMA, CD20, CD70, Nectin-4, GPC3, TROP-2, or PD-1.
  • the binding domain can comprise an antibody domain of an anti-CD19, anti-BCMA, anti- MUC16, anti-mesothelin (anti-MSLN), anti-CD79B, anti-HER2, anti-PSMA, anti-CD20, anti- CD70, anti-Nectin-4, anti-GPC3, anti-TROP-2, or anti-PD-1 antibody.
  • the recombinant nucleic acid further comprises a leader sequence. In some instances, the recombinant nucleic acid further comprises a promoter sequence. In some instances, the recombinant nucleic acid further comprises a sequence encoding a poly(A) tail.
  • the recombinant nucleic acid further comprises a 3’UTR sequence.
  • the nucleic acid is an isolated nucleic acid or a non-naturally occurring nucleic acid. Non-naturally occurring nucleic acids are well known to those of skill in the art.
  • the nucleic acid is an in vitro transcribed nucleic acid. [0659] Disclosed herein are methods for producing in vitro transcribed RNA encoding TFPs.
  • the present disclosure also includes a TFP encoding RNA construct that can be directly transfected into a cell.
  • the RNA encoding TFP further encodes the anti-PD-1 antibody.
  • a method for generating mRNA for use in transfection can involve in vitro transcription (IVT) of a template with specially designed primers, followed by polyA addition, to produce a construct containing 3’ and 5’ untranslated sequence (“UTR”), a 5’ cap and/or Internal Ribosome Entry Site (IRES), the nucleic acid to be expressed, and a polyA tail, typically 50-2000 bases in length.
  • RNA so produced can efficiently transfect different kinds of cells.
  • the template includes sequences for the TFP.
  • the anti-TAA TFP e.g., anti-TAA TFP or anti-TFP and anti-PD-1 antibody
  • mRNA messenger RNA
  • the mRNA encoding the anti-TAA TFP (e.g., anti-TAA TFP or anti-TFP and anti-PD-1 antibody, e.g., in the same coding sequence) is introduced into a T cell for production of a TFP-T cell.
  • the in vitro transcribed RNA TFP can be introduced to a cell as a form of transient transfection.
  • the RNA is produced by in vitro transcription using a polymerase chain reaction (PCR)-generated template. DNA of interest from any source can be directly converted by PCR into a template for in vitro mRNA synthesis using appropriate primers and RNA polymerase.
  • PCR polymerase chain reaction
  • the source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence or any other appropriate source of DNA.
  • the desired template for in vitro transcription is a TFP of the present disclosure.
  • the DNA to be used for PCR contains an open reading frame.
  • the DNA can be from a naturally occurring DNA sequence from the genome of an organism.
  • the nucleic acid can include some or all of the 5’ and/or 3’ untranslated regions (UTRs).
  • the nucleic acid can include exons and introns.
  • the DNA to be used for PCR is a human nucleic acid sequence.
  • the DNA to be used for PCR is a human nucleic acid sequence including the 5’ and 3’ UTRs.
  • the DNA can alternatively be an artificial DNA sequence that is not normally expressed in a naturally occurring organism.
  • An exemplary artificial DNA sequence is one that contains portions of genes that are ligated together to form an open reading frame that encodes a fusion protein.
  • the portions of DNA that are ligated together can be from a single organism or from more than one organism.
  • PCR is used to generate a template for in vitro transcription of mRNA which is used for transfection. Methods for performing PCR are well known in the art. Primers for use in PCR are designed to have regions that are substantially complementary to regions of the DNA to be used as a template for the PCR.
  • “Substantially complementary,” as used herein, refers to sequences of nucleotides where a majority or all of the bases in the primer sequence are complementary, or one or more bases are non-complementary, or mismatched. Substantially complementary sequences are able to anneal or hybridize with the intended DNA target under annealing conditions used for PCR.
  • the primers can be designed to be substantially complementary to any portion of the DNA template. For example, the primers can be designed to amplify the portion of a nucleic acid that is normally transcribed in cells (the open reading frame), including 5’ and 3’ UTRs. The primers can also be designed to amplify a portion of a nucleic acid that encodes a particular domain of interest.
  • the primers are designed to amplify the coding region of a human cDNA, including all or portions of the 5’ and 3’ UTRs.
  • Primers useful for PCR can be generated by synthetic methods that are well known in the art.
  • “Forward primers” are primers that contain a region of nucleotides that are substantially complementary to nucleotides on the DNA template that are upstream of the DNA sequence that is to be amplified.
  • Upstream is used herein to refer to a location 5, to the DNA sequence to be amplified relative to the coding strand.
  • “Reverse primers” are primers that contain a region of nucleotides that are substantially complementary to a double-stranded DNA template that are downstream of the DNA sequence that is to be amplified.
  • Downstream is used herein to refer to a location 3’ to the DNA sequence to be amplified relative to the coding strand.
  • Any DNA polymerase useful for PCR can be used in the methods disclosed herein. The reagents and polymerase are commercially available from a number of sources.
  • Chemical structures with the ability to promote stability and/or translation efficiency may also be used.
  • the RNA preferably has 5’ and 3’ UTRs. In one embodiment, the 5’ UTR is between one and 3,000 nucleotides in length. The length of 5’ and 3’ UTR sequences to be added to the coding region can be altered by different methods, including, but not limited to, designing primers for PCR that anneal to different regions of the UTRs.
  • the 5’ and 3’ UTRs can be the naturally occurring, endogenous 5’ and 3’ UTRs for the nucleic acid of interest.
  • UTR sequences that are not endogenous to the nucleic acid of interest can be added by incorporating the UTR sequences into the forward and reverse primers or by any other modifications of the template.
  • the use of UTR sequences that are not endogenous to the nucleic acid of interest can be useful for modifying the stability and/or translation efficiency of the RNA.
  • 3’ UTRs can be selected or designed to increase the stability of the transcribed RNA based on properties of UTRs that are well known in the art.
  • the 5’ UTR can contain the Kozak sequence of the endogenous nucleic acid.
  • a consensus Kozak sequence can be redesigned by adding the 5’ UTR sequence.
  • Kozak sequences can increase the efficiency of translation of some RNA transcripts, but does not appear to be required for all RNAs to enable efficient translation.
  • the 5’ UTR can be 5’UTR of an RNA virus whose RNA genome is stable in cells.
  • various nucleotide analogues can be used in the 3’ or 5’ UTR to impede exonuclease degradation of the mRNA.
  • a promoter of transcription should be attached to the DNA template upstream of the sequence to be transcribed. When a sequence that functions as a promoter for an RNA polymerase is added to the 5’ end of the forward primer, the RNA polymerase promoter becomes incorporated into the PCR product upstream of the open reading frame that is to be transcribed.
  • the promoter is a T7 polymerase promoter, as described elsewhere herein.
  • Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for T7, T3 and SP6 promoters are known in the art.
  • the mRNA has both a cap on the 5’ end and a 3’ poly(A) tail which determine ribosome binding, initiation of translation and stability mRNA in the cell.
  • RNA polymerase produces a long concatameric product which is not suitable for expression in eukaryotic cells.
  • phage T7 RNA polymerase can extend the 3’ end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003).
  • the conventional method of integration of polyA/T stretches into a DNA template is molecular cloning.
  • polyA/T sequence integrated into plasmid DNA can cause plasmid instability, which is why plasmid DNA templates obtained from bacterial cells are often highly contaminated with deletions and other aberrations. This makes cloning procedures not only laborious and time consuming but often not reliable. That is why a method which allows construction of DNA templates with polyA/T 3’ stretch without cloning highly desirable.
  • the polyA/T segment of the transcriptional DNA template can be produced during PCR by using a reverse primer containing a polyT tail, such as 100 T tail (size can be 50-5000 Ts), or after PCR by any other method, including, but not limited to, DNA ligation or in vitro recombination.
  • Poly(A) tails also provide stability to RNAs and reduce their degradation. Generally, the length of a poly(A) tail positively correlates with the stability of the transcribed RNA. In one embodiment, the poly(A) tail is between 100 and 5000 adenosines. [0671] Poly(A) tails of RNAs can be further extended following in vitro transcription with the use of a poly(A) polymerase, such as E. coli polyA polymerase (E-PAP). In one embodiment, increasing the length of a poly(A) tail from 100 nucleotides to between 300 and 400 nucleotides results in about a two-fold increase in the translation efficiency of the RNA. Additionally, the attachment of different chemical groups to the 3’ end can increase mRNA stability.
  • E-PAP E. coli polyA polymerase
  • RNAs produced by the methods disclosed herein include a 5’ cap.
  • the 5’ cap is provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res.
  • the RNAs produced by the methods disclosed herein can also contain an internal ribosome entry site (IRES) sequence.
  • IRES sequence may be any viral, chromosomal or artificially designed sequence which initiates cap-independent ribosome binding to mRNA and facilitates the initiation of translation. Any solutes suitable for cell electroporation, which can contain factors facilitating cellular permeability and viability such as sugars, peptides, lipids, proteins, antioxidants, and surfactants can be included.
  • RNA can be introduced into target cells using any of a number of different methods, for instance, commercially available methods which include, but are not limited to, electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg Germany), cationic liposome mediated transfection using lipofection, polymer encapsulation, peptide mediated transfection, or biolistic particle delivery systems such as “gene guns” (see, for example, Nishikawa, et al.
  • the modified T cells disclosed herein are engineered using a gene editing technique such as clustered regularly interspaced short palindromic repeats (CRISPR®, see, e.g., U.S. Patent No.8,697,359), transcription activator-like effector (TALE) nucleases (TALENs, see, e.g., U.S.
  • CRISPR® clustered regularly interspaced short palindromic repeats
  • TALE transcription activator-like effector
  • Patent No.9,393,257 discloses, meganucleases (endodeoxyribonucleases having large recognition sites comprising double-stranded DNA sequences of 12 to 40 base pairs), zinc finger nuclease (ZFN, see, e.g., Urnov et al., Nat. Rev. Genetics (2010) v11, 636-646), or megaTAL nucleases (a fusion protein of a meganuclease to TAL repeats) methods.
  • ZFN zinc finger nuclease
  • megaTAL nucleases a fusion protein of a meganuclease to TAL repeats
  • one or more of the extracellular domain, the transmembrane domain, or the cytoplasmic domain of a TFP subunit are engineered to have aspects of more than one natural TCR subunit domain (i.e., are chimeric).
  • TCR subunit domain i.e., are chimeric.
  • mentioned endogenous TCR gene encodes a TCR alpha chain, a TCR beta chain, or a TCR alpha chain and a TCR beta chain. In some embodiments, mentioned endogenous TCR gene encodes a TCR gamma chain, a TCR delta chain, or a TCR gamma chain and a TCR delta chain. In some embodiments, gene editing techniques pave the way for multiplex genomic editing, which allows simultaneous disruption of multiple genomic loci in endogenous TCR gene.
  • multiplex genomic editing techniques are applied to generate gene-disrupted T cells that are deficient in the expression of endogenous TCR, and/or B2M, and/or human leukocyte antigens (HLAs), and/or programmed cell death protein 1 (PD-1), and/or other genes. Techniques to reduce expression of these genes, such as RNAi, can also be used.
  • Current gene editing technologies comprise meganucleases, zinc-finger nucleases (ZFN), TAL effector nucleases (TALEN), and clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) system.
  • DSB double-stranded DNA break
  • NHEJ non-homologous end joining
  • HR homologous recombination
  • DSBs may be repaired by single strand DNA incorporation (ssDI) or single strand template repair (ssTR), an event that introduces the homologous sequence from a donor DNA.
  • Genome DNA can be performed using site-specific, rare-cutting endonucleases that are engineered to recognize DNA sequences in the locus of interest.
  • Methods for producing engineered, site-specific endonucleases are known in the art.
  • ZFNs zinc- finger nucleases
  • ZFNs are chimeric proteins comprising a zinc finger DNA-binding domain fused to the nuclease domain of the Fokl restriction enzyme.
  • the zinc finger domain can be redesigned through rational or experimental means to produce a protein that binds to a pre-determined DNA sequence -18 base pairs in length.
  • TAL-effector nucleases can be generated to cleave specific sites in genomic DNA.
  • a TALEN comprises an engineered, site-specific DNA-binding domain fused to the Fokl nuclease domain (reviewed in Mak et al. (2013), Curr Opin Struct Biol.23:93-9).
  • the DNA binding domain comprises a tandem array of TAL-effector domains, each of which specifically recognizes a single DNA base pair.
  • Compact TALENs have an alternative endonuclease architecture that avoids the need for dimerization (Beurdeley et al. (2013), Nat Commun.4: 1762).
  • a Compact TALEN comprises an engineered, site-specific TAL-effector DNA-binding domain fused to the nuclease domain from the I-TevI homing endonuclease. Unlike Fokl, I-TevI does not need to dimerize to produce a double-strand DNA break so a Compact TALEN is functional as a monomer.
  • Engineered endonucleases based on the CRISPR/Cas9 system are also known in the art (Ran et al. (2013), Nat Protoc.8:2281-2308; Mali et al. (2013), Nat Methods 10:957-63).
  • the CRISPR gene-editing technology is composed of an endonuclease protein whose DNA-targeting specificity and cutting activity can be programmed by a short guide RNA or a duplex crRNA/TracrRNA.
  • a CRISPR endonuclease comprises two components: (1) a caspase effector nuclease, typically microbial Cas9; and (2) a short "guide RNA” or an RNA duplex comprising a 18 to 20 nucleotide targeting sequence that directs the nuclease to a location of interest in the genome.
  • a caspase effector nuclease typically microbial Cas9
  • a short "guide RNA” or an RNA duplex comprising a 18 to 20 nucleotide targeting sequence that directs the nuclease to a location of interest in the genome.
  • Class II contains type II, IV, V, and VI CRISPR systems.
  • CRISPR/Cas system is the type II CRISPR- Cas9 system
  • CRISPR/Cas systems have been repurposed by researchers for genome editing. More than 10 different CRISPR/Cas proteins have been remodeled within last few years (Adli (2016) Nat. Commun.9:1911).
  • Cas12a (Cpf1) proteins from Acid- aminococcus sp (AsCpf1) and Lachnospiraceae bacterium (LbCpf1) are particularly interesting.
  • Homing endonucleases are a group of naturally occurring nucleases that recognize 15-40 base-pair cleavage sites commonly found in the genomes of plants and fungi. They are frequently associated with parasitic DNA elements, such as group 1 self-splicing introns and inteins. They naturally promote homologous recombination or gene insertion at specific locations in the host genome by producing a double -stranded break in the chromosome, which recruits the cellular DNA-repair machinery (Stoddard (2006), Q. Rev. Biophys.38: 49-95).
  • meganucleases are monomeric proteins with innate nuclease activity that are derived from bacterial homing endonucleases and engineered for a unique target site (Gersbach (2016), Molecular Therapy.24: 430–446).
  • meganuclease is engineered I-CreI homing endonuclease. In other embodiments, meganuclease is engineered I-SceI homing endonuclease.
  • chimeric proteins comprising fusions of meganucleases, ZFNs, and TALENs have been engineered to generate novel monomeric enzymes that take advantage of the binding affinity of ZFNs and TALENs and the cleavage specificity of meganucleases (Gersbach (2016), Molecular Therapy.24: 430–446).
  • a megaTAL is a single chimeric protein, which is the combination of the easy-to- tailor DNA binding domains from TALENs with the high cleavage efficiency of meganucleases.
  • nucleases In order to perform the gene editing technique, the nucleases, and in the case of the CRISPR/ Cas9 system, a gRNA, must be efficiently delivered to the cells of interest. Delivery methods such as physical, chemical, and viral methods are also know in the art (Mali (2013). Indian J. Hum. Genet.19: 3-8.). In some instances, physical delivery methods can be selected from the methods but not limited to electroporation, microinjection, or use of ballistic particles. On the other hand, chemical delivery methods require use of complex molecules such calcium phosphate, lipid, or protein. In some embodiments, viral delivery methods are applied for gene editing techniques using viruses such as but not limited to adenovirus, lentivirus, and retrovirus.
  • viruses such as but not limited to adenovirus, lentivirus, and retrovirus.
  • the present disclosure provides a recombinant nucleic acid comprising a sequence encoding an anti-PD-1 fusion peptide comprising (i) an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, where the anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; and (ii) an interleukin-15 (IL-15) polypeptide or fragment thereof.
  • the anti-PD-1 antibody or fragment thereof and the IL-15 polypeptide or fragment thereof can be operatively linked.
  • the present disclosure in some cases, provides a recombinant nucleic acid comprising a sequence encoding an anti-PD-1 fusion peptide comprising (i) an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, where the anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; (ii) an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof; and (iii) an interleukin-15 (IL-15) polypeptide or fragment thereof.
  • the anti-PD-1 antibody or fragment thereof, the IL-15R subunit polypeptide or a fragment thereof, and the IL-15 polypeptide or fragment thereof can be operatively linked.
  • the anti-PD-1 fusion peptide can be secreted.
  • the anti-PD-1 fusion peptide may not be membrane-bound.
  • the IL-15R subunit polypeptide or fragment thereof can be an IL-15R alpha (IL-15R ⁇ ) or fragment thereof.
  • the IL-15R subunit polypeptide or fragment thereof can comprise a IL-15R alpha fragment.
  • the IL-15R alpha fragment can comprise an IL-15R ⁇ RD domain.
  • the IL-15R subunit polypeptide or fragment thereof can comprise a sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity of SEQ ID NO: 341.
  • the IL-15 polypeptide or fragment thereof can be a human IL-15 polypeptide or fragment thereof.
  • the IL-15 polypeptide or fragment thereof can comprise a sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity of SEQ ID NO: 345.
  • the anti-PD-1 fusion peptide can comprise, from N-terminal to C-terminal, the IL-15 polypeptide or fragment thereof operatively linked to the IL-15R subunit polypeptide or a fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof.
  • the anti-PD-1 fusion peptide can comprise, from N-terminal to C-terminal, the anti-PD-1 antibody or fragment thereof operatively linked to the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof.
  • the anti-PD-1 fusion peptide can comprise, from N-terminal to C-terminal, the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof.
  • the anti-PD-1 antibody or fragment thereof can be operatively linked to the IL-15R subunit polypeptide or a fragment thereof via a first linker.
  • the first linker can comprise a sequence of SEQ ID NO: 349.
  • the IL-15R subunit polypeptide or a fragment thereof can be operatively linked to the IL- 15 polypeptide or fragment thereof via a second linker.
  • the second linker can comprise a sequence of SEQ ID NO: 343 or SEQ ID NO: 355.
  • the IL-15 polypeptide or fragment thereof can be operatively linked to the anti-PD-1 antibody or fragment thereof via a third linker.
  • the third linker can comprise a sequence of SEQ ID NO: 349 or SEQ ID NO: 417.
  • the anti-PD-1 fusion peptide can further comprise a 4-1BB ligand ectodomain (4-1BBL ECD).
  • the anti-PD-1 fusion peptide can further comprise two or more 4-1BBL ECDs.
  • the anti- PD-1 fusion peptide can further comprise three 4-1BBL ECDs.
  • the 4-1BBL ECD can comprise a sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity of SEQ ID NO: 421.
  • the anti-PD-1 fusion peptide can comprise, from N-terminal to C- terminal, the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof operatively linked to the 4-1BBL ECD.
  • the anti-PD-1 fusion peptide can comprise, from N- terminal to C-terminal, the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof operatively linked to three consecutively linked 4-1BBL ECDs.
  • the anti-PD-1 antibody or fragment thereof can be operatively linked to the 4-1BBL ECD via a linker.
  • the linker can comprise a sequence of SEQ ID NO: 419.
  • the two or more 4-1BBL ECDs can be linked by a linker.
  • the linker can comprise a sequence of SEQ ID NO: 400.
  • the recombinant nucleic acid can further comprise a sequence encoding a His tag, a HA tag, a hFc tag or a combination thereof.
  • the recombinant nucleic acid can further comprise a sequence encoding a HA tag followed by a His tag.
  • the HA tag can comprise a sequence of SEQ ID NO: 313.
  • the His tag can comprise a sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide described herein can comprise a signal sequence or a leader sequence.
  • the signal sequence or the leader sequence can be a IgGk signal peptide, an IL-15R ⁇ signal peptide, or a GM-CSFR leader sequence, or a p40 leader sequence.
  • the signal sequence or the leader sequence can comprise an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to the amino acid sequence of SEQ ID NO: 303, SEQ ID NO: 339, SEQ ID NO: 359 or SEQ ID NO: 451.
  • the signal sequence can comprise the amino acid sequence of SEQ ID NO: 303, SEQ ID NO: 339, SEQ ID NO: 359 or SEQ ID NO: 451.
  • the anti-PD-1 fusion peptide can comprise a IgGk signal peptide, an anti-PD-1 antibody or fragment thereof, a first linker, an IL-15R ⁇ RD domain, a second linker, a IL-15 polypeptide, a HA tag and a His tag.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C- terminus, a IgGk signal peptide, operatively linked to an anti-PD-1 antibody or fragment thereof, operatively linked to an IL-15R ⁇ RD domain via a first linker, operatively linked to an IL-15 polypeptide via a second linker, operatively linked to a HA tag, and operatively linked to a His tag.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 303, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 6, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 349, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 341, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 343, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 303 operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 6 operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 349 operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 341 operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 343 operatively linked to an
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 303, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 349, an amino acid sequence of SEQ ID NO: 341, an amino acid sequence of SEQ ID NO: 343, an amino acid sequence of SEQ ID NO: 345, an amino acid sequence of SEQ ID NO: 313, and an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence of SEQ ID NO: 349 operatively linked to an amino acid sequence of SEQ ID NO: 341 operatively linked to an amino acid sequence of SEQ ID NO: 343 operatively linked to an amino acid sequence of SEQ ID NO: 345 operatively linked to an amino acid sequence of SEQ ID NO: 313 operatively linked to an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 347.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 347.
  • the anti-PD-1 fusion peptide can comprise an IL15R ⁇ signal peptide, an IL-15R ⁇ RD domain, a first linker, an IL-15 polypeptide, a second linker, an anti-PD-1 antibody or fragment thereof, a HA tag and a His tag.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an IL15R ⁇ signal peptide, operatively linked to an IL-15R ⁇ RD domain operatively linked to an IL-15 polypeptide via a first linker operatively linked to an anti-PD-1 antibody or fragment thereof via a second linker, operatively linked to a HA tag, operatively linked to a His tag.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 339, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 341, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 355, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 345, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 349, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 339 operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 341 operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 355 operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 345 operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 349 operatively linked to
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 339, an amino acid sequence of SEQ ID NO: 341, an amino acid sequence of SEQ ID NO: 355, an amino acid sequence of SEQ ID NO: 345, an amino acid sequence of SEQ ID NO: 349, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 313, and an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence of SEQ ID NO: 339 operatively linked to an amino acid sequence of SEQ ID NO: 341 operatively linked to an amino acid sequence of SEQ ID NO: 355 operatively linked to an amino acid sequence of SEQ ID NO: 345 operatively linked to an amino acid sequence of SEQ ID NO: 349 operatively linked to an amino acid sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence of SEQ ID NO: 313 operatively linked to an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide comprises an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 351.
  • the anti- PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 351.
  • the anti-PD-1 fusion peptide can further comprise a 4-1BBL ECD.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an IL15R ⁇ signal peptide, operatively linked to an IL-15R ⁇ RD domain operatively linked to an IL-15 polypeptide via a first linker operatively linked to an anti-PD-1 antibody or fragment thereof via a second linker, operatively linked to a 4-1BBL ECD via a third linker, operatively linked to a HA tag, operatively linked to a His tag.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 339, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 341, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 343, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 345, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 417, an amino acid sequence with at least 80% sequence identity to SEQ ID NO: 6, an amino acid sequence with at least about 70%, 75%, 99% or
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 339, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 341, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 343, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 345, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 417
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 339, an amino acid sequence of SEQ ID NO: 341, an amino acid sequence of SEQ ID NO: 343, an amino acid sequence of SEQ ID NO: 345, an amino acid sequence of SEQ ID NO: 417, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 419, an amino acid sequence of SEQ ID NO: 421, an amino acid sequence of SEQ ID NO: 313, and an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence of SEQ ID NO: 339, operatively linked to an amino acid sequence of SEQ ID NO: 341, operatively linked to an amino acid sequence of SEQ ID NO: 343, operatively linked to an amino acid sequence of SEQ ID NO: 345, operatively linked to an amino acid sequence of SEQ ID NO: 417, operatively linked to an amino acid sequence of SEQ ID NO: 6, operatively linked to an amino acid sequence of SEQ ID NO: 419, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 313, operatively linked to an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 414.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 414.
  • the anti-PD-1 fusion peptide can comprise three tandemly linked 4-1BBL ECDs.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence of SEQ ID NO: 339, operatively linked to an amino acid sequence of SEQ ID NO: 341, operatively linked to an amino acid sequence of SEQ ID NO: 343, operatively linked to an amino acid sequence of SEQ ID NO: 345, operatively linked to an amino acid sequence of SEQ ID NO: 417, operatively linked to an amino acid sequence of SEQ ID NO: 6, operatively linked to an amino acid sequence of SEQ ID NO: 419, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 400, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 400, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 400, operatively linked to an amino acid sequence of S
  • the anti-PD-1 fusion protein can comprise an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 423.
  • the anti-PD-1 fusion protein can comprise an amino acid sequence of SEQ ID NO: 423.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 242, 245, 345, 452, or 455, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 459, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 249, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 6, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to S
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 242, 245, 345, 452, or 455, an amino acid sequence of SEQ ID NO: 459, an amino acid sequence of SEQ ID NO: 249, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 471.
  • the present disclosure encompasses recombinant nucleic acid molecules encoding an interleukin-15 (IL-15) polypeptide or a fragment thereof.
  • IL-15 interleukin-15
  • the IL-15 polypeptide or a fragment thereof comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114,
  • the IL-15 polypeptide or a fragment thereof comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to a sequence encoding IL-15.
  • the IL-15 polypeptide or a fragment thereof comprises a sequence encoding IL-15 having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids at the N- or C-terminus or at both the N- and C-terminus.
  • the IL-15 polypeptide or a fragment thereof may comprise an IL- 15 signal peptide. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 1-29 of IL-15. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 1-29 of SEQ ID NO:245. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO:246. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 30-162 of IL-15. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 30-162 of SEQ ID NO:245.
  • the IL-15 polypeptide or a fragment thereof may comprise any one of the sequences listed in Table 12 or a fragment thereof. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions relative to SEQ ID NO: 245. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO: 452 or 455. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO:242. In some embodiments, the IL-15 polypeptide or a fragment thereof may comprise amino acids 1-162 of SEQ ID NO: 245, 452, or 455.
  • the IL-15 polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO:246 and a sequence of SEQ ID NO:242.
  • IL-15 polypeptide is secreted when expressed in a cell, such as a T cell.
  • the present disclosure further encompasses recombinant nucleic acid molecules encoding an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof.
  • IL-15R interleukin-15 receptor
  • the IL-15R subunit may be IL-15 receptor alpha chain (“IL-15R ⁇ ” or CD215), IL-2 receptor beta chain (“IL-2R ⁇ ” or CD122) and IL-2 receptor gamma/the common gamma chain (“IL-2R ⁇ / ⁇ c” or CD132).
  • the IL-15R subunit is an IL-15R ⁇ or a fragment thereof.
  • the IL-15R ⁇ polypeptide or a fragment thereof comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114
  • the IL-15R ⁇ polypeptide or a fragment thereof comprises a sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to a sequence encoding IL-15R ⁇ .
  • the IL- 15R ⁇ polypeptide or a fragment thereof comprises a sequence encoding IL-15R ⁇ having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more amino acids at the N- or C-
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise IL- 15R ⁇ signal peptide. In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 1-30 of IL-15R ⁇ . In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 1-30 of SEQ ID NO:247. In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof does not comprise IL-15R ⁇ signal peptide. In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof does not comprise amino acids 1- 30 of IL-15R ⁇ .
  • the IL-15R ⁇ polypeptide or a fragment thereof does not comprise amino acids 1-30 of SEQ ID NO:247.
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise IL- 15R ⁇ Sushi domain.
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 31-95 of IL-15R ⁇ .
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 31-95 of SEQ ID NO:247.
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO:250.
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise an intracellular domain of IL-15R ⁇ . In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 229-267 of IL-15R ⁇ . In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 229-267 of a sequence of SEQ ID NO:247. In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO:248. [0728] In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise IL- 15R ⁇ Sushi domain, transmembrane domain, and intracellular domain.
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 31-267 of IL-15R ⁇ . In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 31-267 of SEQ ID NO:247. In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO:250. In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO:251. In some embodiments, the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 96-267 of SEQ ID NO:247.
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO:250 and a sequence of SEQ ID NO:251.
  • the IL-15R ⁇ polypeptide or a fragment thereof may be a soluble IL-15R ⁇ (sIL-15R ⁇ ).
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 21-205 of IL-15R ⁇ .
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise amino acids 21-205 of a sequence of SEQ ID NO:247.
  • the IL-15R ⁇ polypeptide or a fragment thereof may comprise a sequence of SEQ ID NO:249.
  • the present disclosure encompasses recombinant nucleic acid molecules encoding a fusion peptide comprising an IL-15R subunit linked to an IL-15 polypeptide.
  • IL-15R and IL-15 subunit are operatively linked by a linker.
  • the IL-15R subunit is IL-15R alpha (IL-15R ⁇ ).
  • IL-15 polypeptide may be linked to N-terminus of IL-15R ⁇ subunit.
  • IL-15 polypeptide may be linked to C-terminus of IL-15R ⁇ subunit.
  • IL-15 and IL-15R ⁇ are operatively linked by a linker.
  • the linker is not a cleavable linker.
  • the linker may comprise a sequence comprising (G 4 S)n, wherein G is glycine, S is serine, and n is an integer from 1 to 10. In some embodiments, n is an integer from 1 to 4. In some embodiments, n is 3.
  • the linker comprises a sequence of SEQ ID NO:243. [0731] SG 3 (SG 4 ) 3 SG 3 SLQ Linker SGGGSGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO:243) [0732]
  • the fusion peptide may comprise amino acids 30-162 of IL-15.
  • the fusion peptide may comprise amino acids 30-162 of a sequence of SEQ ID NO:245. In some embodiments, the fusion peptide may comprise any one of the sequences listed in Table 12 or a fragment thereof. In some embodiments, the fusion peptide may comprise a sequence of SEQ ID NO:242. In some embodiments, the fusion peptide does not comprise IL- 15 signal peptide. In some embodiments, the fusion peptide does not comprise amino acids 1-29 of IL-15. In some embodiments, the fusion peptide does not comprise amino acids 1-29 of a sequence of SEQ ID NO:245. In some embodiments, the fusion peptide does not comprise a sequence of SEQ ID NO:246.
  • the fusion peptide may comprise a Sushi domain. In some embodiments, the fusion peptide may comprise amino acids 31-95 of IL-15R ⁇ . In some embodiments, the fusion peptide may comprise amino acids 31-95 of a sequence of SEQ ID NO:247. In some embodiments, the fusion peptide may comprise a sequence of SEQ ID NO:250. [0734] In some embodiments, the fusion peptide may comprise the intracellular domain of IL- 15R ⁇ . In some embodiments, the fusion peptide may comprise amino acids 229-267 of IL-15R ⁇ . In some embodiments, the fusion peptide may comprise amino acids 229-267 of a sequence of SEQ ID NO:247.
  • the fusion peptide may comprise a sequence of SEQ ID NO:248.
  • the fusion peptide may comprise a soluble IL-15R ⁇ (sIL-15R ⁇ ).
  • the fusion peptide may comprise amino acids 21-205 of IL-15R ⁇ .
  • the fusion peptide may comprise amino acids 21-205 of a sequence of SEQ ID NO:247.
  • the fusion peptide may comprise a sequence of SEQ ID NO:249.
  • the fusion peptide further comprises an epitope tag.
  • An epitope tag as described herein can be a peptide epitope tag or a protein epitope tag.
  • Examples of a peptide epitope tag includes, but are not limited to, 6X His (also known as His-tag or hexahistidine tag), FLAG (e.g., 3X FLAG), HA, Myc, and V5.
  • Examples of a protein epitope tag include, but are not limited to, green fluorescent protein (GFP), glutathione-S-transferase (GST), ⁇ -galactosidase ( ⁇ -GAL), Luciferase, Maltose Binding Protein (MBP), Red Fluorescence Protein (RFP), and Vesicular Stomatitis Virus Glycoprotein (VSV-G).
  • the fusion peptide further comprises a FLAG tag.
  • the fusion peptide further comprises a 3X FLAG tag. In some embodiments, the fusion peptide further comprises a sequence of SEQ ID NO:255. [0737] Flag x3 DYKDDDDKDYKDDDDKDYKDDDDK (SEQ ID NO:255) [0738] In some embodiments, the fusion peptide may not be expressed on cell surface when expressed in a cell, e.g., a T cell. In some embodiments, the fusion peptide is secreted when expressed in a cell, e.g., a T cell. [0739] Disclosed herein, in some embodiments, are polypeptides encoded by any of recombinant nucleic acid molecules described herein.
  • Membrane bound IL-15 or IL-15 receptor alpha polypeptide fusions are membrane bound IL-15 or IL-15 receptor alpha polypeptide fusions.
  • the fusions comprise, from N-terminus to C- terminus, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 245 or 455, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 459, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 463.
  • the fusion can comprise an amino acid sequence of SEQ ID NO: 245 or 455, an amino acid sequence of SEQ ID NO: 459, and an amino acid sequence of SEQ ID NO: 463.
  • the fusion can comprise a B7 domain and/or a CD28 domain.
  • the fusion can comprise a CD28 transmembrane domain.
  • the fusion can comprise, from N-terminus to C-terminus, an IL-15 or fragment thereof and/or variant thereof, operatively linked to a B7 domain and/or a CD28 domain, such as a CD28 transmembrane domain.
  • the fusion can comprise, from N- terminus to C-terminus, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 245 or 455, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 459, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 467.
  • the fusion can comprise an amino acid sequence of SEQ ID NO: 245 or 455, SEQ ID NO: 459, and SEQ ID NO: 467.
  • the fusion can comprise, from N-terminus to C-terminus, an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 245 or 455, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 461, operatively linked to an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 469.
  • the fusion can comprise an amino acid sequence of SEQ ID NO: 245 or 455, SEQ ID NO: 461, and SEQ ID NO: 469.
  • membrane bound IL15 or IL15 receptor alpha fusions comprising a sequence designed to reduce the expression or dose of IL15, e.g., via a de-optimized IL15 sequence (e.g., SEQ ID NO: 456) and/or via incorporation of an IRES.
  • the present disclosure provides a recombinant nucleic acid comprising a sequence encoding a first anti-PD-1 fusion peptide comprising (i) a first anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the first anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2; and (ii) an IL-12 polypeptide or functional fragment thereof, wherein the first anti-PD-1 antibody or fragment thereof and the IL-12 polypeptide or functional fragment thereof are operatively linked.
  • the first anti-PD-1 fusion peptide is secreted.
  • the IL-12 polypeptide or functional fragment thereof comprises a p40 subunit polypeptide or functional fragment thereof, a p35 subunit polypeptide or functional fragment thereof, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94
  • the IL-12 polypeptide or a fragment thereof comprises a sequence encoding IL-12 p35 subunit having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids at the N- or C-terminus or at both the N- and C-terminus or a sequence encoding IL- 12 p40 subunit having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids at the N- or C-terminus or at both the N- and C-terminus.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the amino acid sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises the amino acid sequence of SEQ ID NO: 311, the amino acid sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises the amino acid sequence of SEQ ID NO: 328, the amino acid sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310, an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310, an amino acid sequence
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 327, an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 327, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 332, an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 332, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the IL-12 amino acid sequences listed in Table 14, or any combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises any one of the IL-12 amino acid sequences listed in Table 14, or any combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the IL-12-encoding nucleotide sequences listed in Table 14, or any combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by any one of the IL-12-encoding nucleotide sequences listed in Table 14, or any combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises a p40 subunit polypeptide or functional fragment thereof operatively linked to a p35 subunit polypeptide or functional fragment thereof.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the N-terminus of the p35 subunit polypeptide or functional fragment thereof.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the C-terminus of the p35 subunit polypeptide or functional fragment thereof.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the p35 subunit polypeptide or functional fragment thereof via a first linker.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the N-terminus of the p35 subunit polypeptide or functional fragment thereof via a first linker.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the C-terminus of the p35 subunit polypeptide or functional fragment thereof via a first linker.
  • the first linker comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 401.
  • the first linker comprises the sequence of SEQ ID NO: 401.
  • the first linker comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 329.
  • the first linker comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 329.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to the first anti-PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof is operatively linked to the p35 subunit polypeptide or functional fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, a leader sequence operatively linked to the first anti-PD-1 antibody or fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof is operatively linked to the p40 subunit polypeptide or functional fragment thereof.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9%sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, and an amino acid sequence with
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises the sequence of SEQ ID NO: 303, the sequence of SEQ ID NO: 324, the sequence of SEQ ID NO: 328, and the sequence of SEQ ID NO: 305. In some embodiments, the first anti-PD-1 fusion peptide comprises the sequence of SEQ ID NO: 324, the sequence of SEQ ID NO: 328, and the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the sequence of SEQ ID NO: 303 operatively linked to the sequence of SEQ ID NO: 324 operatively linked to the sequence of SEQ ID NO: 328 operatively linked to the sequence of SEQ ID NO: 305. In some embodiments, the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the sequence of SEQ ID NO: 303 operatively linked to the sequence of SEQ ID NO: 324 operatively linked to the sequence of SEQ ID NO: 305 operatively linked to the sequence of SEQ ID NO: 328.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the sequence of SEQ ID NO: 324 operatively linked to the sequence of SEQ ID NO: 328 operatively linked to the sequence of SEQ ID NO: 305. In some embodiments, the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the sequence of SEQ ID NO: 324 operatively linked to the sequence of SEQ ID NO: 305 operatively linked to the sequence of SEQ ID NO: 328. [0761] In some embodiments, the sequence of SEQ ID NO: 324 is operatively linked to the sequence of SEQ ID NO: 328 via the sequence of SEQ ID NO: 326.
  • the sequence of SEQ ID NO: 324 is operatively linked to the sequence of SEQ ID NO: 305 via a sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operative
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 9
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 332 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 332 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.5%, 99.5%, 99.
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 332 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 332.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 332 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 332.
  • the nucleotide sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence of SEQ ID NO: 332 via a nucleotide sequence of SEQ ID NO: 325.
  • the nucleotide sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence of SEQ ID NO: 304 via a nucleotide sequence of SEQ ID NO: 325.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 441 or SEQ ID NO: 443.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 441 or SEQ ID NO: 443.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 440 or SEQ ID NO: 442.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 440 or SEQ ID NO: 442. [0768] In some embodiments, the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the p40 subunit polypeptide or functional fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the first anti- PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the p35 subunit polypeptide or functional fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof operatively linked to the first anti-PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to the p40 subunit polypeptide or functional fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the first anti-PD-1 antibody or fragment thereof.
  • the first anti- PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof operatively linked to the first anti-PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 311, the amino acid sequence of SEQ ID NO: 305, and the amino acid sequence of SEQ ID NO: 6. In some embodiments, the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the amino acid sequence of SEQ ID NO: 305 is operatively linked to the amino acid sequence of SEQ ID NO: 6 via an amino acid sequence of SEQ ID NO: 326.
  • the amino acid sequence of SEQ ID NO: 311 is operatively linked to the amino acid sequence of SEQ ID NO: 6 via an amino acid sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • nucleotide sequence of SEQ ID NO: 304 is operatively linked to the nucleotide sequence of SEQ ID NO: 22 via the nucleotide sequence of SEQ ID NO: 335.
  • nucleotide sequence of SEQ ID NO: 310 is operatively linked to the nucleotide sequence of SEQ ID NO: 22 via the nucleotide sequence of SEQ ID NO: 335.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 445 or SEQ ID NO: 447.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 445 or SEQ ID NO: 447.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 444 or SEQ ID NO: 446.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 444 or SEQ ID NO: 446.
  • the first anti-PD-1 fusion peptide further comprises a second anti- PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the second anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2.
  • the first anti-PD-1 antibody or fragment thereof and the second anti-PD-1 antibody or fragment thereof are same.
  • the first anti-PD-1 antibody or fragment thereof and the second anti-PD-1 antibody or fragment thereof are different.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to the first anti-PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the second anti-PD-1 antibody or fragment thereof.
  • the first anti- PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to the first anti-PD-1 antibody or fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof operatively linked to the second anti-PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the first anti-PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the second anti-PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the first anti-PD-1 antibody or fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof operatively linked to the second anti-PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, an amino acid sequence with at least 50%,
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305, and an amino acid sequence with at least 50%, 55%,
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, and an amino acid sequence with at least 50%, 55%, 60%, 65%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305, and an amino acid sequence with at least 50%, 55%, 60%, 65%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 303, the amino acid sequence of SEQ ID NO: 324, the amino acid sequence of SEQ ID NO: 328, the amino acid sequence of SEQ ID NO: 305, and the amino acid sequence of SEQ ID NO: 6. In some embodiments, the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 324, the amino acid sequence of SEQ ID NO: 328, the amino acid sequence of SEQ ID NO: 305, and the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 303, the amino acid sequence of SEQ ID NO: 324, the amino acid sequence of SEQ ID NO: 328, and the amino acid sequence of SEQ ID NO: 305. In some embodiments, the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 324, the amino acid sequence of SEQ ID NO: 328, and the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 324, the amino acid sequence of SEQ ID NO: 328, the amino acid sequence of SEQ ID NO: 305, and the amino acid sequence of SEQ ID NO: 6. In some embodiments, the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 328, the amino acid sequence of SEQ ID NO: 305, and the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 324.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 324.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 324.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 324.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the amino acid sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence of SEQ ID NO: 328 via the amino acid sequence of SEQ ID NO: 326.
  • the amino acid sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence of SEQ ID NO: 305 via the amino acid sequence of SEQ ID NO: 326.
  • the amino acid sequence of SEQ ID NO: 6 is operatively linked to the amino acid sequence of SEQ ID NO: 328 via the amino acid sequence of SEQ ID NO: 326.
  • the amino acid sequence of SEQ ID NO: 6 is operatively linked to the amino acid sequence of SEQ ID NO: 305 via the amino acid sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 327 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 327 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 327 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 327 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.5%, 99.5%, 99.
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 327 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 323.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 323.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 323.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 323.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the nucleotide sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence of SEQ ID NO: 327 via the nucleotide sequence of SEQ ID NO: 325.
  • the nucleotide sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence of SEQ ID NO: 304 via the nucleotide sequence of SEQ ID NO: 325.
  • the nucleotide sequence of SEQ ID NO: 22 is operatively linked to the nucleotide sequence of SEQ ID NO: 327 via the nucleotide sequence of SEQ ID NO: 325.
  • the nucleotide sequence of SEQ ID NO: 22 is operatively linked to the nucleotide sequence of SEQ ID NO: 304 via the nucleotide sequence of SEQ ID NO: 325.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 437 or SEQ ID NO: 439.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 437 or SEQ ID NO: 439.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 436 or SEQ ID NO: 438.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 436 or SEQ ID NO: 438.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the p35 subunit polypeptide or functional fragment thereof via a first linker.
  • the p35 subunit polypeptide or functional fragment thereof is operatively linked to the p40 subunit polypeptide or functional fragment thereof via a first linker.
  • the first linker comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 401.
  • the first linker comprises the sequence of SEQ ID NO: 401. In some embodiments, the first linker comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 329. In some embodiments, the first linker comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 329.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the anti-PD-1 fusion peptide sequences listed in Table 14.
  • the first anti-PD-1 fusion peptide comprises any one of the anti-PD-1 fusion peptide sequences listed in Table 14.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the anti-PD-1 fusion peptide-encoding nucleotide sequences listed in Table 14.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by any one of the anti-PD-1 fusion peptide-encoding nucleotide sequences listed in Table 14.
  • the recombinant nucleic acid as described herein further comprises a second nucleic acid sequence encoding a second anti-PD-1 fusion peptide comprising a third anti-PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the third anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2.
  • the first anti-PD-1 antibody or fragment thereof and the third anti-PD-1 antibody or fragment thereof are same.
  • the first anti-PD-1 antibody or fragment thereof and the third anti-PD-1 antibody or fragment thereof are different.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the p40 subunit polypeptide or functional fragment thereof operatively linked to the first anti-PD-1 antibody or fragment thereof
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to a third anti-PD-1 antibody or fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the p40 subunit polypeptide or functional fragment thereof operatively linked to the first anti-PD-1 antibody or fragment thereof.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, a leader sequence operatively linked to a third anti-PD-1 antibody or fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof. In some embodiments, the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, a third anti-PD-1 antibody or fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the p40 subunit polypeptide or functional fragment thereof operatively linked to the first anti-PD-1 antibody or fragment thereof
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a third anti-PD-1 antibody or fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the first anti-PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, a leader sequence operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to a third anti-PD-1 antibody or fragment thereof operatively linked to. In some embodiments, the second anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the p35 subunit polypeptide or functional fragment thereof operatively linked to a third anti-PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the first anti- PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof
  • the second anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, a leader sequence operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to a third anti-PD-1 antibody or fragment thereof operatively linked to.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the first anti-PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the p35 subunit polypeptide or functional fragment thereof operatively linked to a third anti-PD-1 antibody or fragment thereof.
  • the p35 subunit polypeptide or functional fragment thereof further comprises a transmembrane domain of a CD3 epsilon TCR subunit or functional fragments thereof.
  • the sequence encoding the first anti-PD-1 fusion peptide and the second nucleic acid sequence are present on different nucleic acid molecules. [0831] In some embodiments, the sequence encoding the first anti-PD-1 fusion peptide and the second nucleic acid sequence are expressed in the same operon. In some embodiments, wherein the sequence encoding the first anti-PD-1 fusion peptide and the second nucleic acid sequence are operatively linked by a sequence encoding a second linker. In some embodiments, the second linker comprises a protease cleavage site. In some embodiments, the protease cleavage site is a 2A cleavage site.
  • the 2A cleavage site is a T2A cleavage site or a P2A cleavage site.
  • the 2A cleavage site comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 362.
  • the 2A cleavage site comprises the amino acid sequence of SEQ ID NO: 362.
  • the 2A cleavage site comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 322.
  • the 2A cleavage site comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 322.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO:
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6,
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%,
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%,
  • the first anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%,
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311.
  • the second anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%,
  • the first anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C- terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%,
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%,
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%,
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311.
  • the second anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%,
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 311, and the amino acid sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 303, the amino acid sequence of SEQ ID NO: 6, and the amino acid sequence of SEQ ID NO: 305. In some embodiments, the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 311, and the amino acid sequence of SEQ ID NO: 6.
  • the second anti- PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 303, the amino acid sequence of SEQ ID NO: 6, and the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 311, and the amino acid sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 6, and the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 311 and the amino acid sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 6 and the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 311, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 311.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 311, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 311.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 305.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6, and the second anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 311, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 311.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 311, and the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 6 operatively linked to the amino acid sequence of SEQ ID NO: 311.
  • the second anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO:
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 7
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310.
  • the second anti- PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 7
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 7
  • the first anti- PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 7
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 310
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 310.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 310
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 310.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22, and the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 310
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 310.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 310
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 22 operatively linked to the nucleotide sequence of SEQ ID NO: 310.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 309 or SEQ ID NO: 435
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 301 or SEQ ID NO
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 309 or SEQ ID NO: 435.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 301 or SEQ ID NO: 433.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 309 or SEQ ID NO: 435
  • the second anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 301 or SEQ ID NO: 433.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 309 or SEQ ID NO: 435.
  • the second anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 301 or SEQ ID NO: 433.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 308 or SEQ ID NO: 434
  • the second anti- PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 300 or SEQ ID NO: 432.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 308 or SEQ ID NO: 434.
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 300 or SEQ ID NO: 432.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 308 or SEQ ID NO: 434
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 300 or SEQ ID NO: 432
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 308 or SEQ ID NO: 434
  • the second anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 300 or SEQ ID NO: 432.
  • the recombinant nucleic acid further comprises a sequence encoding a His tag, a HA tag, a cMyc tag or a combination thereof. In some embodiments, the recombinant nucleic acid further comprises a sequence encoding the cMyc tag followed by the His tag. In some embodiments, the recombinant nucleic acid further comprises a sequence encoding the HA tag followed by the His tag.
  • the cMyc tag comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 307.
  • the cMyc tag comprises the amino acid sequence of SEQ ID NO: 307.
  • the cMyc tag comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 306.
  • the cMyc tag comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 306.
  • the HA tag comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 313. In some embodiments, the HA tag comprises the amino acid sequence of SEQ ID NO: 313.
  • the HA tag comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 312.
  • the HA tag comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 312.
  • the His tag comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 407. In some embodiments, the His tag comprises the amino acid sequence of SEQ ID NO: 407.
  • the His tag comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 314.
  • the His tag comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 314.
  • nucleic acid molecules comprising a first nucleic acid sequence encoding an anti-PD-1 fusion peptide comprising an anti-PD-1 antibody or fragment thereof and an enhancing domain operatively linked to the anti-PD-1 antibody or fragment thereof as descried herein, and a second nucleic acid sequence encoding a T cell receptor (TCR) fusion protein (TFP) as described herein.
  • TCR T cell receptor
  • the enhancing domain can comprise an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof, an interleukin-15 (IL-15) polypeptide or fragment thereof, or an IL-12 polypeptide or functional fragment thereof.
  • the anti-PD-1 fusion peptide can comprise an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof.
  • the anti-PD-1 antibody fusion peptide can further comprise an interleukin-15 (IL-15) polypeptide or fragment thereof.
  • the anti-PD-1 fusion peptide can comprise an IL-12 polypeptide or functional fragment thereof.
  • recombinant nucleic acid molecules comprising a first nucleic acid sequence encoding an enhancing domain such as a membrane bound IL15 or IL15-IL-15R fusion, and a second nucleic acid sequence encoding a T cell receptor (TCR) fusion protein (TFP) as described herein.
  • the first nucleic acid sequence and the second nucleic acid sequence described herein can be on the same nucleic acid molecule or different nucleic acid molecules.
  • recombinant nucleic acid molecules described herein further comprise a leader sequence.
  • the recombinant nucleic acid molecule is selected from the group consisting of a DNA and an RNA.
  • the recombinant nucleic acid molecule is an mRNA. In some embodiments, the recombinant nucleic acid molecule is a circRNA. In some embodiments, the recombinant nucleic acid molecule comprises a nucleic acid analog. In some embodiments, the nucleic acid analog is not in an encoding sequence of the recombinant nucleic acid.
  • the nucleic analog is selected from the group consisting of 2’-O-methyl, 2’-O-methoxyethyl (2’-O-MOE), 2’-O- aminopropyl, 2’-deoxy, T-deoxy-2’-fluoro, 2’-O-aminopropyl (2’-O-AP), 2'-O- dimethylaminoethyl (2’-O-DMAOE), 2’-O-dimethylaminopropyl (2’-O-DMAP), T-O- dimethylaminoethyloxyethyl (2’-O-DMAEOE), 2’-O-N-methylacetamido (2’-O-NMA) modified, a locked nucleic acid (LNA), an ethylene nucleic acid (ENA), a peptide nucleic acid (PNA), a 1’,5’- anhydrohexitol nucleic acid (HNA), a morpholino, a methyl, 2’-
  • the recombinant nucleic acid molecule further comprises a leader sequence. In some embodiments, the recombinant nucleic acid molecule further comprises a promoter sequence. In some embodiments, the recombinant nucleic acid molecule further comprises a sequence encoding a poly(A) tail. In some embodiments, the recombinant nucleic acid molecule further comprises a 3’UTR sequence. In some embodiments, the recombinant nucleic acid molecule is an isolated nucleic acid or a non-naturally occurring nucleic acid. In some embodiments, the nucleic acid is an in vitro transcribed nucleic acid.
  • the recombinant nucleic acid molecule as described herein comprises a sequence encoding an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the amino acid sequences listed in Table 14.
  • the recombinant nucleic acid molecule as described herein comprises a sequence encoding any one of the amino acid sequences listed in Table 14.
  • the recombinant nucleic acid molecule as described herein comprises a sequence encoding an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the amino acid sequences selected from SEQ ID NOs: 301, 433, 309, 435, 316, 437, 439, 331, 441, 443, 334, 445, 447, 337, 347, 351, 414, 423, 429, and 431.
  • the recombinant nucleic acid molecule as described herein comprises a sequence encoding any one of the amino acid sequences selected from SEQ ID NOs: 301, 433, 309, 435, 316, 437, 439, 331, 441, 443, 334, 445, 447, 337, 347, 351, 414, 423, 429, and 431.
  • the recombinant nucleic acid molecule as described herein comprises a sequence having at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the nucleic acid sequences listed in Table 14.
  • the recombinant nucleic acid molecule as described herein comprises any one of the nucleic acid sequences listed in Table 14.
  • the recombinant nucleic acid molecule as described herein comprises a sequence having at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the nucleic acid sequences selected from SEQ ID NOs: 300, 432, 308, 434, 315, 436, 438, 330, 440, 442, 333, 444, 446, 336, 346, 350, 413, 422, 428, and 430.
  • the recombinant nucleic acid molecule as described herein comprises any one of the nucleic acid sequences selected from SEQ ID NOs: 300, 432, 308, 434, 315, 436, 438, 330, 440, 442, 333, 444, 446, 336, 346, 350, 413, 422, 428, and 430.
  • the sequence of the recombinant nucleic acid molecule as described herein is a sequence having at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.7%, 99.9% or more sequence identity to any one of the nucleic acid sequences selected from SEQ ID NOs: 300, 432, 308, 434, 315, 436, 438, 330, 440, 442, 333, 444, 446, 336, 346, 350, 413, 422, 428, and 430.
  • the sequence of the recombinant nucleic acid molecule as described herein is the any one of the nucleic acid sequences selected from SEQ ID NOs: 300, 432, 308, 434, 315, 436, 438, 330, 440, 442, 333, 444, 446, 336, 346, 350, 413, 422, 428, and 430.
  • Vectors [0881]
  • the instant disclosure provides vectors comprising the recombinant nucleic acid(s) encoding the TFP and/or additional molecules of interest (e.g., a protein or proteins to be secreted by the TFP-T cell).
  • the vector can comprise a recombinant nucleic acid encoding an anti-PD-1 antibody or fragment thereof or a fusion protein comprising an anti-PD-1 antibody or fragment thereof and a cytokine or fragment thereof (e.g., IL-15, IL- 15R or IL12) operatively linked to the anti-PD-1 antibody or fragment thereof as descried herein.
  • a cytokine or fragment thereof e.g., IL-15, IL- 15R or IL12
  • the vector can comprise a recombinant nucleic acid comprising a first sequence encoding a TFP and a second sequence encoding an anti-PD-1 antibody or fragment thereof or a fusion protein comprising an anti-PD-1 antibody or fragment thereof and a transmembrane domain or an intracellular domain operatively linked to the anti-PD-1 antibody or fragment thereof as descried herein.
  • the vector is selected from the group consisting of a DNA, a RNA, a plasmid, a lentivirus vector, adenoviral vector, an adeno- associated viral vector (AAV), a Rous sarcoma viral (RSV) vector, or a retrovirus vector.
  • the vector is an AAV6 vector. In some instances, the vector further comprises a promoter. In some instances, the vector is an in vitro transcribed vector. [0882] The present disclosure further provides a vector comprising a nucleic acid molecule encoding a TFP as described herein, an anti-PD-1 antibody or fragment thereof or a fusion protein comprising an anti-PD-1 antibody or fragment thereof and a transmembrane domain or an intracellular domain operatively linked to the anti-PD-1 antibody or fragment thereof as descried herein, and a sequence encoding a switch polypeptide comprising a TGFBr2 extracellular domain or a functional fragment thereof as described herein, a PD-1 polypeptide or a fragment thereof as described herein, a CD28 polypeptide or a fragment thereof as described herein, an IL-15 polypeptide, or a fragment thereof described herein, an IL-15R ⁇ or a fragment thereof as described herein, or a combination thereof.
  • a vector encoding the nucleic acid molecules as described herein can be directly transduced into a cell, e.g., a T cell.
  • the vector is a cloning or expression vector, e.g., a vector including, but not limited to, one or more plasmids (e.g., expression plasmids, cloning vectors, minicircles, minivectors, double minute chromosomes), retroviral and lentiviral vector constructs.
  • the vector is capable of expressing the TFP construct, the anti-PD-1 antibody or fragment thereof or a fusion protein comprising an anti-PD-1 antibody or fragment thereof and a transmembrane domain or an intracellular domain operatively linked to the anti-PD-1 antibody or fragment thereof as descried herein construct, an IL-15 construct, and/or an IL-15R ⁇ construct in mammalian T cells.
  • the mammalian T cell is a human T cell.
  • the nucleic acid sequences coding for the desired molecules can be obtained using recombinant methods, such as, for example by screening libraries from cells expressing the gene, by deriving the gene from a vector known to include the same, or by isolating directly from cells and tissues containing the same, using standard techniques. Alternatively, the gene of interest can be produced synthetically, rather than cloned.
  • the present disclosure also provides vectors in which a DNA of the present disclosure is inserted. Vectors derived from retroviruses such as the lentivirus are suitable tools to achieve long-term gene transfer since they allow long-term, stable integration of a transgene and its propagation in daughter cells.
  • Lentiviral vectors have the added advantage over vectors derived from onco-retroviruses such as murine leukemia viruses in that they can transduce non- proliferating cells, such as hepatocytes. They also have the added advantage of low immunogenicity.
  • the vector comprising the nucleic acid encoding the desired TFP of the present disclosure is an adenoviral vector (A5/35).
  • the expression of nucleic acids encoding TFPs can be accomplished using of transposons such as sleeping beauty, crisper, CAS9, and zinc finger nucleases. See, e.g., June et al., 2009 Nature Reviews Immunology 9.10: 704-716, which is incorporated herein by reference.
  • the TFP of the present disclosure may be used in multicistronic vectors or vectors expressing several proteins in the same transcriptional unit.
  • Such vectors may use internal ribosomal entry sites (IRES). Since IRES are not functional in all hosts and do not allow for the stoichiometric expression of multiple protein, self-cleaving peptides may be used instead. For example, several viral peptides are cleaved during translation and allow for the expression of multiple proteins form a single transcriptional unit.
  • Such peptides include 2A-peptides, or 2A- like sequences, from members of the Picornaviridae virus family. See for example Szymczak et al., 2004, Nature Biotechnology; 22:589-594.
  • the recombinant nucleic acid described herein encodes the TFP in frame with the agent, with the two sequences separated by a self-cleaving peptide, such as a 2A sequence, or a T2A sequence.
  • the recombinant nucleic acid described herein can encode a TFP in frame with a secreted PD-1 antibody binding fragment, such as an scFv or sdAb, with the two sequences separated by a self- cleaving peptide, such as a 2A sequence, or a T2A sequence.
  • the expression constructs of the present disclosure may also be used for nucleic acid immunization and gene therapy, using standard gene delivery protocols.
  • the present disclosure provides a gene therapy vector.
  • the nucleic acid can be cloned into a number of types of vectors.
  • the nucleic acid can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid.
  • Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.
  • the expression vector may be provided to a cell in the form of a viral vector.
  • Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY), and in other virology and molecular biology manuals.
  • Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.
  • a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No.6,326,193).
  • selectable markers e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No.6,326,193
  • retroviruses provide a convenient platform for gene delivery systems.
  • a selected gene can be inserted into a vector and packaged in retroviral particles using techniques known in the art.
  • the recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo.
  • retroviral systems are known in the art.
  • adenovirus vectors are used.
  • a number of adenovirus vectors are known in the art.
  • lentivirus vectors are used.
  • Additional promoter elements e.g., enhancers, regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have been shown to contain functional elements downstream of the start site as well.
  • the spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline.
  • tk thymidine kinase
  • a promoter that is capable of expressing a TFP transgene in a mammalian T cell is the EF1a promoter.
  • the native EF1a promoter drives expression of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome.
  • the EF1a promoter has been extensively used in mammalian expression plasmids and has been shown to be effective in driving TFP expression from transgenes cloned into a lentiviral vector (see, e.g., Milone et al., Mol.
  • CMV immediate early cytomegalovirus
  • constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the elongation factor-1a promoter, the hemoglobin promoter, and the creatine kinase promoter. Further, the present disclosure should not be limited to the use of constitutive promoters.
  • inducible promoters are also contemplated as part of the present disclosure.
  • the use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired or turning off the expression when expression is not desired.
  • inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline-regulated promoter.
  • the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors.
  • the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, for example, antibiotic- resistance genes, such as neo and the like.
  • Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences.
  • a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.
  • Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82).
  • Suitable expression systems are well known and may be prepared using known techniques or obtained commercially.
  • the construct with the minimal 5’ flanking region showing the highest level of expression of reporter gene is identified as the promoter.
  • Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter-driven transcription.
  • Methods of introducing and expressing genes into a cell are known in the art.
  • the vector can be readily introduced into a host cell, e.g., mammalian, bacterial, yeast, or insect cell by any method in the art.
  • the expression vector can be transferred into a host cell by physical, chemical, or biological means.
  • Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well-known in the art. See, for example, Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY). A preferred method for the introduction of a polynucleotide into a host cell is calcium phosphate transfection.
  • Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors.
  • Viral vectors and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells.
  • Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like (see, e.g., U.S. Pat.
  • Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
  • Other methods of state-of-the-art targeted delivery of nucleic acids are available, such as delivery of polynucleotides with targeted nanoparticles or other suitable sub-micron sized delivery system.
  • an exemplary delivery vehicle is a liposome.
  • lipid formulations is contemplated for the introduction of the nucleic acids into a host cell (in vitro, ex vivo or in vivo).
  • the nucleic acid may be associated with a lipid.
  • the nucleic acid associated with a lipid may be encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing a lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained or complexed with a micelle, or otherwise associated with a lipid.
  • Lipid, lipid/DNA or lipid/expression vector associated compositions are not limited to any particular structure in solution.
  • Lipids are fatty substances which may be naturally occurring or synthetic lipids.
  • lipids include the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.
  • DMPC dimyristyl phosphatidylcholine
  • DCP dicetyl phosphate
  • Choi cholesterol
  • DMPG dimyristyl phosphatidylglycerol
  • Stock solutions of lipids in chloroform or chloroform/methanol can be stored at about -20 °C. Chloroform is used as the only solvent since it is more readily evaporated than methanol.
  • Liposome is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10).
  • compositions that have different structures in solution than the normal vesicular structure are also encompassed.
  • the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules.
  • lipofectamine- nucleic acid complexes are also contemplated.
  • the present disclosure further provides a vector comprising a TFP encoding nucleic acid molecule.
  • a TFP vector can be directly transduced into a cell, e.g., a T cell.
  • the vector is a cloning or expression vector, e.g., a vector including, but not limited to, one or more plasmids (e.g., expression plasmids, cloning vectors, minicircles, minivectors, double minute chromosomes), retroviral and lentiviral vector constructs.
  • the vector is capable of expressing the TFP construct in mammalian T cells.
  • the mammalian T cell is a human T cell.
  • Circular RNA [0903]
  • TFP-T cells are transduced with an RNA molecule.
  • the RNA is circular RNA.
  • the circular RNA is exogenous.
  • circular RNA is endogenous.
  • circular RNAs with an internal ribosomal entry site can be translated in vitro or in vivo or ex vivo.
  • Circular RNAs are a class of single-stranded RNAs with a contiguous structure that have enhanced stability and a lack of end motifs necessary for interaction with various cellular proteins. Circular RNAs are 3-5’ covalently closed RNA rings, and circular RNAs do not display Cap or poly(A) tails. Since circular RNAs lack the free ends necessary for exonuclease-mediated degradation, rendering them resistant to several mechanisms of RNA turnover and granting them extended lifespans as compared to their linear mRNA counterparts.
  • Circular RNAs are produced by the process of splicing, and circularization occurs using conventional splice sites mostly at annotated exon boundaries (Starke et al., 2015; Szabo et al., 2015).
  • splice sites are used in reverse: downstream splice donors are “backspliced” to upstream splice acceptors (see Jeck and Sharpless, 2014; Barrett and Salzman, 2016; Szabo and Salzman, 2016; Holdt et al., 2018 for review).
  • RNA circularization To generate circular RNAs that we could subsequently transfer into cells, in vitro production of circular RNAs with autocatalytic-splicing introns can be programmed.
  • IVTT in vitro transcription
  • Three general strategies have been reported so far for RNA circularization: chemical methods using cyanogen bromide or a similar condensing agent, enzymatic methods using RNA or DNA ligases, and ribozymatic methods using self-splicing introns.
  • precursor RNA was synthesized by run-off transcription and then heated in the presence of magnesium ions and GTP to promote circularization. RNA so produced can efficiently transfect different kinds of cells.
  • the template includes sequences for the TFP, CAR, and TCR, or combination thereof.
  • the group I intron of phage T4 thymidylate synthase (td) gene is well characterized to circularize while the exons linearly splice together (Chandry and Bel- fort, 1987; Ford and Ares, 1994; Perriman and Ares, 1998).
  • td intron order is permuted flanking any exon sequence, the exon is circularized via two autocatalytic transesterification reactions (Ford and Ares, 1994; Puttaraju and Been, 1995).
  • the group I intron of phage T4 thymidylate synthase (td) gene is used to generate exogenous circular RNA.
  • a ribozymatic method utilizing a permuted group I catalytic intron has been used since it is more applicable to long RNA circularization and requires only the addition of GTP and Mg 2+ as cofactors.
  • This permuted intron-exon (PIE) splicing strategy consists of fused partial exons flanked by half-intron sequences.
  • a full-length encephalomyocarditis virus such as EMCV
  • IRES full-length encephalomyocarditis virus
  • TFP thymidylate synthase
  • T4 thymidylate synthase
  • the mentioned sequence further comprises complementary ‘homology arms’ placed at the 5′ and 3′ ends of the precursor RNA with the aim of bringing the 5′ and 3′ splice sites into proximity of one another.
  • the splicing reaction can be treated with RNase R.
  • the anti-TAA TFP and/or the anti-PD-1 antibody is encoded by a circular RNA.
  • the circular RNA encoding the anti-TAA TFP and/or the anti-PD-1 antibody is introduced into a T cell for production of a TFP-T cell.
  • the in vitro transcribed RNA TFP and/or anti-PD-1 antibody can be introduced to a cell as a form of transient transfection.
  • linear precursor RNA is produced by in vitro transcription using a polymerase chain reaction (PCR)-generated template as is described herein.
  • PCR polymerase chain reaction
  • Modified T cells Disclosed herein are modified T cells comprising the sequence encoding the TFP disclosed herein or a TFP encoded by the sequence of the nucleic acid disclosed herein.
  • modified allogenic T cells comprising the sequence encoding the TFP disclosed herein or a TFP encoded by the sequence of the nucleic acid disclosed herein.
  • the TFP T cells disclosed herein further comprises an anti-PD-1 antibody or an anti-PD-1 fusion peptide or a nucleic acid sequence encoding an anti-PD-1 antibody or fragment thereof or the anti-PD-1 fusion peptide unless otherwise specified.
  • the nucleic acid sequence encoding an anti-PD-1 antibody or the anti-PD-1 fusion peptide and the nucleic acid sequence encoding the TFP can be on a same nucleic acid molecule.
  • the modified T cell may secrete the anti-PD-1 antibody or fragment thereof or the anti-PD-1 fusion peptide containing the anti-PD-1 antibody.
  • the anti-PD-1 antibody or fragment thereof can be an scFv or sdAb.
  • the anti-PD-1 fusion peptide of the modified cell can comprise an anti-PD-1 antibody fused to an enhancing domain.
  • the enhancing domain can be a cytokine or fragment thereof.
  • the enhancing domain can be a cytokine receptor or fragment thereof.
  • the enhancing domain can be an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof.
  • the enhancing domain can be an interleukin-15 (IL-15) polypeptide or fragment thereof.
  • the enhancing domain can be an IL-12 polypeptide or functional fragment thereof.
  • the anti-PD-1 fusion peptide can comprise a IgGk signal peptide, an anti-PD-1 antibody or fragment thereof, a first linker, an IL-15R ⁇ RD domain, a second linker, an IL-15 polypeptide, a HA tag and a His tag.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, a IgGk signal peptide, operatively linked to an anti-PD-1 antibody or fragment thereof, operatively linked to an IL-15R ⁇ RD domain via a first linker, operatively linked to an IL-15 polypeptide via a second linker, operatively linked to a HA tag, and operatively linked to a His tag.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 303, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 349, an amino acid sequence of SEQ ID NO: 341, an amino acid sequence of SEQ ID NO: 343, an amino acid sequence of SEQ ID NO: 345, an amino acid sequence of SEQ ID NO: 313, and an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence of SEQ ID NO: 349 operatively linked to an amino acid sequence of SEQ ID NO: 341 operatively linked to an amino acid sequence of SEQ ID NO: 343 operatively linked to an amino acid sequence of SEQ ID NO: 345 operatively linked to an amino acid sequence of SEQ ID NO: 313 operatively linked to an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 347.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 347.
  • the anti-PD-1 fusion peptide can comprise an IL15R ⁇ signal peptide, an IL-15R ⁇ RD domain, a first linker, an IL-15 polypeptide, a second linker, an anti-PD- 1 antibody or fragment thereof, a HA tag and a His tag.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an IL15R ⁇ signal peptide, operatively linked to an IL- 15R ⁇ RD domain operatively linked to an IL-15 polypeptide via a first linker operatively linked to an anti-PD-1 antibody or fragment thereof via a second linker, operatively linked to a HA tag, operatively linked to a His tag.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 339, an amino acid sequence of SEQ ID NO: 341, an amino acid sequence of SEQ ID NO: 355, an amino acid sequence of SEQ ID NO: 345, an amino acid sequence of SEQ ID NO: 349, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 313, and an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence of SEQ ID NO: 339 operatively linked to an amino acid sequence of SEQ ID NO: 341 operatively linked to an amino acid sequence of SEQ ID NO: 355 operatively linked to an amino acid sequence of SEQ ID NO: 345 operatively linked to an amino acid sequence of SEQ ID NO: 349 operatively linked to an amino acid sequence of SEQ ID NO: 6 operatively linked to an amino acid sequence of SEQ ID NO: 313 operatively linked to an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can further comprise a 4-1BBL ECD.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an IL15R ⁇ signal peptide, operatively linked to an IL-15R ⁇ RD domain operatively linked to an IL-15 polypeptide via a first linker operatively linked to an anti-PD-1 antibody or fragment thereof via a second linker, operatively linked to a 4-1BBL ECD via a third linker, operatively linked to a HA tag, operatively linked to a His tag.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 339, an amino acid sequence of SEQ ID NO: 341, an amino acid sequence of SEQ ID NO: 343, an amino acid sequence of SEQ ID NO: 345, an amino acid sequence of SEQ ID NO: 417, an amino acid sequence of SEQ ID NO: 6, an amino acid sequence of SEQ ID NO: 419, an amino acid sequence of SEQ ID NO: 421, an amino acid sequence of SEQ ID NO: 313, and an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence of SEQ ID NO: 339, operatively linked to an amino acid sequence of SEQ ID NO: 341, operatively linked to an amino acid sequence of SEQ ID NO: 343, operatively linked to an amino acid sequence of SEQ ID NO: 345, operatively linked to an amino acid sequence of SEQ ID NO: 417, operatively linked to an amino acid sequence of SEQ ID NO: 6, operatively linked to an amino acid sequence of SEQ ID NO: 419, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 313, operatively linked to an amino acid sequence of SEQ ID NO: 407.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 414.
  • the anti-PD-1 fusion peptide can comprise an amino acid sequence of SEQ ID NO: 414.
  • the anti-PD-1 fusion peptide can comprise three tandemly linked 4-1BBL ECDs.
  • the anti-PD-1 fusion peptide can comprise, from N-terminus to C-terminus, an amino acid sequence of SEQ ID NO: 339, operatively linked to an amino acid sequence of SEQ ID NO: 341, operatively linked to an amino acid sequence of SEQ ID NO: 343, operatively linked to an amino acid sequence of SEQ ID NO: 345, operatively linked to an amino acid sequence of SEQ ID NO: 417, operatively linked to an amino acid sequence of SEQ ID NO: 6, operatively linked to an amino acid sequence of SEQ ID NO: 419, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 400, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 400, operatively linked to an amino acid sequence of SEQ ID NO: 421, operatively linked to an amino acid sequence of SEQ ID NO: 400, operatively linked to an amino acid sequence of S
  • the anti-PD-1 fusion protein can comprise an amino acid sequence with at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO: 423.
  • the anti-PD-1 fusion protein can comprise an amino acid sequence of SEQ ID NO: 423.
  • the sequence encoding the TFP can be linked to any one of the sequences encoding the anti-PD-1 fusion peptide via a cleavable linker.
  • the cleavable linker can be a self-cleaving peptide, such as a 2A sequence, or a T2A sequence.
  • the modified T cells comprising the recombinant nucleic acid disclosed herein, or the vectors disclosed herein comprises a functional disruption of an endogenous TCR.
  • modified allogenic T cells comprising the sequence encoding the TFP disclosed herein or a TFP encoded by the sequence of the nucleic acid disclosed herein.
  • a T cell comprising (i) a first recombinant nucleic acid comprising a sequence encoding a T-cell receptor (TCR) fusion protein (TFP); and (ii) a sequence encoding an anti-PD-1 fusion peptide that specifically binds programmed cell death protein 1 (PD-1).
  • the TFP can comprise: (a) a TCR subunit comprising: (i) at least a portion of a TCR extracellular domain, (ii) a TCR transmembrane domain, and (iii) a TCR intracellular domain, and (b) a binding domain.
  • the anti-PD-1 fusion peptide can be secreted by the T cell.
  • the TCR subunit and the binding domain can be operatively linked.
  • the TFP can functionally interact with an endogenous TCR complex in the T cell.
  • the modified cell provided herein can comprise a recombinant nucleic acid comprising a sequence encoding an anti-PD-1 fusion peptide comprising (i) an anti-PD-1 antibody or fragment thereof that specifically binds PD-1, (ii) an interleukin-15 receptor (IL-15R) subunit polypeptide or a fragment thereof; and (iii) an interleukin-15 (IL-15) polypeptide or fragment thereof.
  • the modified cell provided herein can comprise the anti-PD-1 fusion peptide encoded by the recombinant nucleic acid.
  • the anti-PD-1 antibody or fragment thereof can inhibit an interaction of PD-1 with PD-L1 or PD-L2.
  • the anti-PD-1 antibody or fragment thereof, the IL-15R subunit polypeptide or a fragment thereof, and the IL-15 polypeptide or fragment thereof can be operatively linked.
  • the anti-PD-1 fusion peptide can be secreted.
  • the IL-15R subunit polypeptide or fragment thereof can be an IL-15R alpha (IL-15R ⁇ ) or fragment thereof.
  • the IL-15R subunit polypeptide or fragment thereof can comprise an IL-15R alpha fragment (IL-15R ⁇ RD domain).
  • the IL-15R subunit polypeptide or fragment thereof can comprise a sequence of SEQ ID NO: 341.
  • the IL-15 polypeptide or fragment thereof can be a human IL-15 polypeptide or fragment thereof.
  • the IL-15 polypeptide or fragment thereof can comprise a sequence of SEQ ID NO: 345.
  • the anti-PD-1 fusion peptide can comprise, from N- terminal to C-terminal, the anti-PD-1 antibody or fragment thereof operatively linked to the IL- 15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof.
  • the anti-PD-1 fusion peptide can comprise, from N-terminal to C-terminal, the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof.
  • the anti-PD- 1 antibody or fragment thereof can be operatively linked to the IL-15R subunit polypeptide or a fragment thereof via a first linker.
  • the first linker can comprise a sequence of SEQ ID NO: 349.
  • the IL-15R subunit polypeptide or a fragment thereof can be operatively linked to the IL-15 polypeptide or fragment thereof via a second linker.
  • the second linker can comprise a sequence of SEQ ID NO: 343 or SEQ ID NO: 355.
  • the IL-15 polypeptide or fragment thereof can be operatively linked to the anti-PD-1 antibody or fragment thereof via a third linker.
  • the third linker can comprise a sequence of SEQ ID NO: 349 or SEQ ID NO: 417.
  • the anti-PD-1 fusion peptide can further comprise a 4-1BB ligand ectodomain (4-1BBL ECD).
  • the anti-PD-1 fusion peptide can further comprise two or more 4-1BBL ECDs.
  • the anti- PD-1 fusion peptide further comprises three 4-1BBL ECDs.
  • the 4-1BBL ECD can comprise a sequence of SEQ ID NO: 421.
  • the anti-PD-1 fusion peptide can comprise, from N-terminal to C- terminal, the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof operatively linked to the 4-1BBL ECD.
  • the anti-PD-1 fusion peptide can comprise, from N- terminal to C-terminal, the IL-15R subunit polypeptide or a fragment thereof operatively linked to the IL-15 polypeptide or fragment thereof operatively linked to the anti-PD-1 antibody or fragment thereof operatively linked to three consecutively linked 4-1BBL ECDs.
  • the recombinant nucleic acid can further comprise a sequence encoding a His tag, a HA tag, a hFc tag or a combination thereof.
  • the recombinant nucleic acid can further comprise a sequence encoding a HA tag followed by a His tag.
  • the HA tag can comprise a sequence of SEQ ID NO: 313.
  • the His tag comprises a sequence of SEQ ID NO: 407.
  • the modified cell provided herein can comprise a recombinant nucleic acid comprising a sequence encoding a first anti-PD-1 fusion peptide comprising (i) a first anti- PD-1 antibody or fragment thereof that specifically binds PD-1, and (ii) an IL-12 polypeptide or functional fragment thereof.
  • the first anti-PD-1 antibody or fragment thereof can inhibit an interaction of PD-1 with PD-L1 or PD-L2.
  • the first anti-PD-1 antibody or fragment thereof and the IL-12 polypeptide or functional fragment thereof can be operatively linked.
  • the first anti-PD-1 fusion peptide is as described herein.
  • the first anti-PD-1 fusion peptide is secreted.
  • the IL-12 polypeptide or functional fragment thereof comprises a p40 subunit polypeptide or functional fragment thereof, a p35 subunit polypeptide or functional fragment thereof, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115
  • the IL-12 polypeptide or a fragment thereof comprises a sequence encoding IL-12 p35 subunit having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids at the N- or C-terminus or at both the N- and C-terminus or a sequence encoding IL- 12 p40 subunit having a truncation of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more amino acids at the N- or C-terminus or at both the N- and C-terminus.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the amino acid sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises the amino acid sequence of SEQ ID NO: 311, the amino acid sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises the amino acid sequence of SEQ ID NO: 328, the amino acid sequence of SEQ ID NO: 305, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310, an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310, an amino acid sequence
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 327, an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 327, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 332, an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 332, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 304, or a combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the IL-12 amino acid sequences listed in Table 14, or any combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises any one of the IL-12 amino acid sequences listed in Table 14, or any combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the IL-12-encoding nucleotide sequences listed in Table 14, or any combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises an amino acid sequence encoded by any one of the IL-12-encoding nucleotide sequences listed in Table 14, or any combination thereof.
  • the IL-12 polypeptide or functional fragment thereof comprises a p40 subunit polypeptide or functional fragment thereof operatively linked to a p35 subunit polypeptide or functional fragment thereof.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the p35 subunit polypeptide or functional fragment thereof via a first linker.
  • the first linker comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 401.
  • the first linker comprises the sequence of SEQ ID NO: 401.
  • the first linker comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 329.
  • the first linker comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 329.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to the first anti-PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof is operatively linked to the p35 subunit polypeptide or functional fragment thereof.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9%sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, and an amino acid sequence with
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the first anti-PD-1 fusion peptide comprises the sequence of SEQ ID NO: 303, the sequence of SEQ ID NO: 324, the sequence of SEQ ID NO: 328, and the sequence of SEQ ID NO: 305. In some embodiments, the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the sequence of SEQ ID NO: 303 operatively linked to the sequence of SEQ ID NO: 324 operatively linked to the sequence of SEQ ID NO: 328 operatively linked to the sequence of SEQ ID NO: 305.
  • the sequence of SEQ ID NO: 324 is operatively linked to the sequence of SEQ ID NO: 328 via the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 3
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 332 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 332 operatively linked to the nucleotide sequence of SEQ ID NO: 304.
  • the nucleotide sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence of SEQ ID NO: 332 via a nucleotide sequence of SEQ ID NO: 325.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 441 or SEQ ID NO: 443.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 441 or SEQ ID NO: 443.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 440 or SEQ ID NO: 442.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 440 or SEQ ID NO: 442.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the p40 subunit polypeptide or functional fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the first anti- PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 311 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 305 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9%sequence identity to the sequence of SEQ ID NO: 6 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 311, the amino acid sequence of SEQ ID NO: 305, and the amino acid sequence of SEQ ID NO: 6. In some embodiments, the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 311 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6. [0948] In some embodiments, the amino acid sequence of SEQ ID NO: 305 is operatively linked to the amino acid sequence of SEQ ID NO: 6 via an amino acid sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 310 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 304 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 22 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 310 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the nucleotide sequence of SEQ ID NO: 304 is operatively linked to the nucleotide sequence of SEQ ID NO: 22 via the nucleotide sequence of SEQ ID NO: 335.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 445 or SEQ ID NO: 447.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 445 or SEQ ID NO: 447.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 444 or SEQ ID NO: 446.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 444 or SEQ ID NO: 446.
  • the first anti-PD-1 fusion peptide further comprises a second anti- PD-1 antibody or fragment thereof that specifically binds PD-1, wherein the second anti-PD-1 antibody or fragment thereof inhibits an interaction of PD-1 with PD-L1 or PD-L2.
  • the first anti-PD-1 antibody or fragment thereof and the second anti-PD-1 antibody or fragment thereof are same.
  • the first anti-PD-1 antibody or fragment thereof and the second anti-PD-1 antibody or fragment thereof are different.
  • the second anti-PD-1 fusion peptide is as described herein.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, a leader sequence operatively linked to the first anti-PD-1 antibody or fragment thereof operatively linked to the p40 subunit polypeptide or functional fragment thereof operatively linked to the p35 subunit polypeptide or functional fragment thereof operatively linked to the second anti-PD-1 antibody or fragment thereof.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328, an amino acid sequence with at least 50%,
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 303 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 328 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 303, the amino acid sequence of SEQ ID NO: 324, the amino acid sequence of SEQ ID NO: 328, the amino acid sequence of SEQ ID NO: 305, and the amino acid sequence of SEQ ID NO: 6.
  • the first anti-PD-1 fusion peptide comprises, from the N-terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 303 operatively linked to the amino acid sequence of SEQ ID NO: 324 operatively linked to the amino acid sequence of SEQ ID NO: 328 operatively linked to the amino acid sequence of SEQ ID NO: 305 operatively linked to the amino acid sequence of SEQ ID NO: 6.
  • the amino acid sequence of SEQ ID NO: 324 is operatively linked to the amino acid sequence of SEQ ID NO: 328 via the amino acid sequence of SEQ ID NO: 326.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 302 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 operatively linked to a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%
  • the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 327 via a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.5%, 99.5%, 99.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 302 operatively linked to the nucleotide sequence of SEQ ID NO: 323 operatively linked to the nucleotide sequence of SEQ ID NO: 327 operatively linked to the nucleotide sequence of SEQ ID NO: 304 operatively linked to the nucleotide sequence of SEQ ID NO: 22.
  • the nucleotide sequence of SEQ ID NO: 323 is operatively linked to the nucleotide sequence of SEQ ID NO: 327 via the nucleotide sequence of SEQ ID NO: 325.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 437 or SEQ ID NO: 439.
  • the first anti-PD-1 fusion peptide comprises the amino acid sequence of SEQ ID NO: 437 or SEQ ID NO: 439.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 436 or SEQ ID NO: 438.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 436 or SEQ ID NO: 438.
  • the p40 subunit polypeptide or functional fragment thereof is operatively linked to the p35 subunit polypeptide or functional fragment thereof via a first linker.
  • the first linker comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 401.
  • the first linker comprises the sequence of SEQ ID NO: 401.
  • the first linker comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 329.
  • the first linker comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 329.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the anti-PD-1 fusion peptide sequences listed in Table 14.
  • the first anti-PD-1 fusion peptide comprises any one of the anti-PD-1 fusion peptide sequences listed in Table 14.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the anti-PD-1 fusion peptide-encoding nucleotide sequences listed in Table 14.
  • the first anti-PD-1 fusion peptide comprises an amino acid sequence encoded by any one of the anti-PD-1 fusion peptide-encoding nucleotide sequences listed in Table 14.
  • the recombinant nucleic acid further comprises a sequence encoding a His tag, a HA tag, a cMyc tag or a combination thereof. In some embodiments, the recombinant nucleic acid further comprises a sequence encoding the cMyc tag followed by the His tag. In some embodiments, the recombinant nucleic acid further comprises a sequence encoding the HA tag followed by the His tag.
  • the cMyc tag comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 307.
  • the cMyc tag comprises the amino acid sequence of SEQ ID NO: 307.
  • the cMyc tag comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 306.
  • the cMyc tag comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 306.
  • the HA tag comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 313.
  • the HA tag comprises the amino acid sequence of SEQ ID NO: 313.
  • the HA tag comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 312.
  • the HA tag comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 312.
  • the His tag comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 407. In some embodiments, the His tag comprises the amino acid sequence of SEQ ID NO: 407.
  • the His tag comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 314.
  • the His tag comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 314.
  • the recombinant nucleic acid can comprise a first sequence encoding the anti-PD-1 fusion peptide.
  • the recombinant nucleic acid can further comprise a second sequence encoding a TFP.
  • the sequence encoding the TFP and the sequence encoding the anti-PD-1 fusion peptide can be contained in a single operon.
  • a second recombinant nucleic acid can comprise the sequence encoding the TFP.
  • the first sequence encoding the anti-PD-1 fusion peptide and the second sequence encoding a TFP are encoded in frame and the first sequence and the second sequence are operatively linked by a linker sequence.
  • the linker sequence encodes a protease cleavage site.
  • the protease cleavage site is a 2A cleavage site.
  • the 2A cleavage site is a T2A cleavage site or a P2A cleavage site.
  • the 2A cleavage site comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 362.
  • the 2A cleavage site comprises the amino acid sequence of SEQ ID NO: 362.
  • the 2A cleavage site comprises an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 322.
  • the 2A cleavage site comprises an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 322.
  • the second sequence encoding the TFP comprises an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 359, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 69, and an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 383.
  • the second sequence encoding the TFP comprises, from the N-terminus to the C-terminus, an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 359 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 69 operatively linked to an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO:
  • the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 69 is operatively linked to the amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 383 via an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 118.
  • the second sequence encoding the TFP comprises the amino acid sequence of SEQ ID NO: 359, the amino acid sequence of SEQ ID NO: 69, and the amino acid sequence of SEQ ID NO: 383.
  • the second sequence encoding the TFP comprises, from the N- terminus to the C-terminus, the amino acid sequence of SEQ ID NO: 359 operatively linked to the amino acid sequence of SEQ ID NO: 69 operatively linked to the amino acid sequence of SEQ ID NO: 383.
  • the amino acid sequence of SEQ ID NO: 69 is operatively linked to the amino acid sequence of SEQ ID NO: 383 via the amino acid sequence of SEQ ID NO: 118.
  • the second sequence encoding the TFP comprises, from the N- terminus to the C-terminus, an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 317 operatively linked to an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 318 operatively linked to an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%,
  • the amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 318 is operatively linked to the amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to the sequence of SEQ ID NO: 320 via an amino acid sequence encoded by a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
  • the second sequence encoding the TFP comprises, from the N-terminus to the C- terminus, an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 317 operatively linked to an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 318 operatively linked to an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 320.
  • the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 318 is operatively linked to the amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 320 via an amino acid sequence encoded by the nucleotide sequence of SEQ ID NO: 319.
  • the recombinant nucleic acid encodes an amino acid sequence with at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the sequences selected from SEQ ID NOs: 331, 334, 316, 423, and 429. In some embodiments, the recombinant nucleic acid encodes any one of the amino acid sequences selected from SEQ ID NOs: 331, 334, 316, 423, and 429.
  • the recombinant nucleic acid comprises a nucleotide sequence with at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 96%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% sequence identity to any one of the sequences selected from SEQ ID NOs: 330, 333, 315, 428, and 430.
  • the recombinant nucleic acid comprises any one of the nucleotide sequences selected from SEQ ID NOs: 330, 333, 315, 428, and 430.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente divulgation concerne des protéines de fusion de lymphocytes T (récepteurs) (TFP) comprenant des domaines de liaison ciblant divers antigènes associés à une maladie ou des molécules d'acides nucléiques codant de telles TFP. La présente divulgation concerne des peptides de fusion anti-PD-1, ainsi que des molécules d'acides nucléiques codant les peptides de fusion anti-PD-1. La présente divulgation concerne en outre des lymphocytes T modifiés exprimant de telles TFP ou des peptides de fusion anti-PD-1, et des méthodes de régulation de lymphocytes T ou de traitement de patients faisant intervenir de telles constructions ou de tels lymphocytes T modifiés.
PCT/US2023/060117 2022-01-05 2023-01-04 Compositions et mé de reprogrammation de tcr à l'aide de protéines de fusion et de peptides de fusion anti-pd-1 WO2023133424A2 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263296656P 2022-01-05 2022-01-05
US63/296,656 2022-01-05
US202263354450P 2022-06-22 2022-06-22
US63/354,450 2022-06-22

Publications (2)

Publication Number Publication Date
WO2023133424A2 true WO2023133424A2 (fr) 2023-07-13
WO2023133424A3 WO2023133424A3 (fr) 2023-09-07

Family

ID=87074264

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/060117 WO2023133424A2 (fr) 2022-01-05 2023-01-04 Compositions et mé de reprogrammation de tcr à l'aide de protéines de fusion et de peptides de fusion anti-pd-1

Country Status (1)

Country Link
WO (1) WO2023133424A2 (fr)

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004056875A1 (fr) * 2002-12-23 2004-07-08 Wyeth Anticorps anti pd-1 et utilisations
SG11201601844TA (en) * 2013-09-13 2016-04-28 Beigene Ltd Anti-pd1 antibodies and their use as therapeutics and diagnostics
CA3047999A1 (fr) * 2016-12-21 2018-06-28 TCR2 Therapeutics Inc. Lymphocytes t modifies pour le traitement du cancer
CN111867612A (zh) * 2018-03-26 2020-10-30 阿尔托生物科学有限责任公司 抗PDL1、IL-15和TGF-β受体组合分子
KR20210049816A (ko) * 2018-07-26 2021-05-06 티씨알2 테라퓨틱스 인크. 표적 특이적 융합 단백질을 사용하는 tcr 리프로그래밍을 위한 조성물 및 방법
US11377477B2 (en) * 2018-10-12 2022-07-05 Xencor, Inc. PD-1 targeted IL-15/IL-15RALPHA fc fusion proteins and uses in combination therapies thereof
EP3990476A1 (fr) * 2019-06-25 2022-05-04 Gilead Sciences, Inc. Protéines de fusion flt3l-fc et procédés d'utilisation
US11851466B2 (en) * 2019-10-03 2023-12-26 Xencor, Inc. Targeted IL-12 heterodimeric Fc-fusion proteins
KR20220114063A (ko) * 2019-12-13 2022-08-17 큐진 인크. 신규한 인터루킨-15 (ｉｌ-15) 융합 단백질 및 이의 용도
WO2021232200A1 (fr) * 2020-05-18 2021-11-25 Guangdong Tcrcure Biopharma Technology Co., Ltd. Thérapie par cellules immunitaires armées à il-12 et leurs utilisations

Also Published As

Publication number Publication date
WO2023133424A3 (fr) 2023-09-07

Similar Documents

Publication Publication Date Title
JP7262535B2 (ja) 融合タンパク質を用いたｔｃｒの再プログラミングのための組成物及び方法
TWI790213B (zh) 用於使用融合蛋白之tcr重編程的組合物及方法
US11242376B2 (en) Compositions and methods for TCR reprogramming using fusion proteins
US20210079057A1 (en) Compositions and methods for tcr reprogramming using fusion proteins
US20210315933A1 (en) Compositions and methods for tcr reprogramming using target specific fusion proteins
US20210187022A1 (en) Engineered t cells for the treatment of cancer
EP3765039A1 (fr) Compositions et procédés de reprogrammation de tcr faisant appel à des protéines de fusion
WO2022006451A2 (fr) Compositions et procédés de reprogrammation de tcr faisant intervenir des protéines de fusion et des anticorps anti-pd1
WO2022056321A1 (fr) Compositions et procédés pour la reprogrammation de tcr au moyen de protéines de fusion spécifiques gpc3
WO2021133959A2 (fr) Compositions et procédés de reprogrammation de tcr gamma delta à l'aide de protéines de fusion
CA3154287A1 (fr) Compositions et procedes de reprogrammation de tcr a l'aide de proteines de fusion
US20240117002A1 (en) Compositions and methods for tcr reprogramming using fusion proteins
WO2022232277A1 (fr) COMPOSITIONS PHARMACEUTIQUES ET PROCÉDÉS DE REPROGRAMMATION TCR À L'AIDE DE PROTÉINES DE FUSION ET DE COMMUTATION TGFβR
WO2022056304A1 (fr) Compositions et méthodes pour la reprogrammation de tcr au moyen de protéines de fusion spécifiques de la nectine-4
WO2021226289A2 (fr) Compositions et procédés pour la reprogrammation de tcr au moyen de protéines de fusion spécifiques cd70
WO2023034220A2 (fr) Compositions et procédés de reprogrammation de tcr à l'aide de protéines de fusion et de cxcr6
WO2023133424A2 (fr) Compositions et mé de reprogrammation de tcr à l'aide de protéines de fusion et de peptides de fusion anti-pd-1
WO2023172967A2 (fr) Compositions et méthodes pour la reprogrammation de tcr au moyen de protéines de fusion spécifiques de gpc3

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23737723

Country of ref document: EP

Kind code of ref document: A2