WO2023115313A1

WO2023115313A1 - Method for enriching, isolating and purifying nucleic acids on basis of crispr-cas system

Info

Publication number: WO2023115313A1
Application number: PCT/CN2021/139993
Authority: WO
Inventors: 周文华; 喻学锋; 张琼珶; 高钟
Original assignee: 深圳先进技术研究院
Priority date: 2021-12-21
Filing date: 2021-12-21
Publication date: 2023-06-29

Abstract

Disclosed in the present invention is a method for enriching, isolating and purifying nucleic acids on the basis of a CRISPR-Cas system. The method comprises: preparing complex 1 of a Cas effector protein and sgRNA, crRNA or crRNA/tracrRNA1; forming complex 2 of complex 1 and a target nucleic acid from a nucleic acid sample to be treated and complex 1; capturing complex 2 with an avidin-coated magnetic bead to form complex 3 of the magnetic bead and complex 2 when complex 1 is labeled with biotin, or capturing complex 2 with a magnetic bead modified with an antibody corresponding to the Cas effector protein to form complex 3 of the magnetic bead and complex 2 when complex 1 is not labeled with biotin; and separating complex 3 by means of magnetic attraction.

Description

A method for nucleic acid enrichment, isolation and purification based on CRISPR-Cas system

technical field

The invention belongs to the field of separation of target nucleic acids in biological samples, in particular to a method for enriching, separating and purifying nucleic acids based on a CRISPR-Cas system.

Background technique

Nucleic acid is the basic genetic material and an important carrier of genetic information. Its research or detection is widely involved in scientific research, medical diagnosis, environmental microbial detection, border quarantine inspection and other fields. Generally, two prerequisites are required for the correct research or detection of nucleic acid. The first is the purity of nucleic acid. In the field of scientific research, molecular cloning technology is one of the research methods to study the function or characteristics of the target gene. If the template is contaminated and causes cloning failure, it will seriously affect the research results; in the process of medical diagnosis, nucleic acid contamination is also very likely to lead to diagnostic errors. . The second is the concentration of nucleic acid. At present, the detection methods of nucleic acid generally have the problem of low sensitivity, which limits its application field. Since the current actual detection substances are often seldom nucleic acid samples with high purity and high concentration, it is particularly important to extract and isolate nucleic acids that meet the requirements from actual samples. At present, for different biological samples, although the methods of extracting and separating DNA are different, the principles are basically similar. Treat samples with protein denaturants (sodium dodecylsulfonate, cetyltrimethylammonium bromide, sodium hydroxide solution, etc.) Protein and DNA are separated by means of saturated salting out, and finally the separated DNA is purified with a certain concentration of ethanol to make it meet the requirements of research or detection. However, the existing methods still have defects such as cumbersome extraction steps, long operation process, and the use of toxic reagents. Therefore, new simple, fast, and safe DNA extraction or extraction methods have important application value.

Enrichment and separation of nucleic acid by magnetic beads is a relatively common method. The nucleic acid can be bound to the surface of the magnetic bead by modifying the group of affinity nucleic acid on the surface of the magnetic bead, and then the nucleic acid on the surface of the magnetic bead will be separated from other interferences by an external magnetic field. The components are separated to achieve the purpose of separation and purification, such as silanol magnetic beads and nano magnetic beads. This method is fast, simple and efficient. However, its disadvantage is that it cannot perform directional enrichment and separation of targeted nucleic acid DNA.

The CRISPR-Cas system is an acquired immune system that exists in most bacteria or archaea to defend against foreign nucleic acid invasion. According to different effector proteins, the system can be divided into several types. The effector proteins in the system can target exogenous nucleic acid substances, or combine with other auxiliary elements and play the role of nucleases, cutting or degrading them to achieve defense purposes. At present, the research on the type II system is the most thorough. Cas9 is this type of effector protein, which can form a complex with the crRNA (CRISPR RNA) in the system and target the DNA (20nt) partially complementary to the crRNA to play the role of binding and cutting. . It specifically and precisely targets almost all genome sequences, and is widely used in fields such as gene editing and gene therapy. Cas12a (Cpf1) in the type V system is also used in the field of gene editing because of its similar characteristics. Cas13a (C2c2) in the type VI system has shown strong strength in the field of genetic testing. However, this feature has not been fully applied, and there are few reports in the field of enriching, separating and purifying target nucleic acid DNA from complex biological samples by combining it with the above-mentioned magnetic bead method.

Contents of the invention

In order to solve the deficiencies in the prior art, the object of the present invention is to propose a method for nucleic acid enrichment, separation and purification based on the CRISPR-Cas system. The present invention utilizes the property that the complex formed by the Cas effector protein or other components (such as sgRNA) in the CRISPR-Cas defense system can accurately target and bind nucleic acid, and combines the magnetic bead method to realize the target nucleic acid in the biological sample to be detected enrichment, separation and purification. The specific technical scheme is as follows:

The first aspect of the present invention provides a method for nucleic acid enrichment, separation and purification based on the CRISPR-Cas system, comprising the following steps:

(1) preparing a complex 1 of a nuclease-deficient Cas effector protein and sgRNA, crRNA or crRNA/tracrRNA, wherein the complex 1 is biotin-labeled or unlabeled;

(2) adding the nucleic acid sample to be treated to the above-mentioned complex 1 and incubating to form a complex 2 of the complex 1 and the target nucleic acid;

(3) When the complex 1 is labeled with biotin, the above-mentioned complex 2 is captured with the magnetic beads coated with avidin to form the complex 3 of the magnetic beads and the complex 2;

When complex 1 is not labeled with biotin, the above-mentioned complex 2 is captured with magnetic beads modified by an antibody corresponding to the Cas effector protein to form a complex 3 of magnetic beads and complex 2;

(4) The above complex 3 is separated by magnetic suction, and the magnetic beads are eluted with a buffer solution, that is, the enrichment, separation and purification of the target nucleic acid of the nucleic acid sample to be processed are realized.

Further, the sgRNA is formed by combining crRNA and tracrRNA;

The crRNA includes a complementary nucleotide sequence close to the 5' direction of NGG in the target nucleic acid and a tracRNA recognition binding sequence.

Further, the biotin label is on the Cas effector protein and/or on the sgRNA, crRNA or crRNA/tracrRNA;

Preferably, when biotin is labeled on the Cas effector protein, the molar ratio of biotin to Cas effector protein is 200:1; when biotin is labeled, it is incubated overnight at 4°C or room temperature, preferably overnight at 4°C.

Preferably, the avidin is streptavidin.

Further, the Cas effector protein is selected from Cas9 in the type II CRISPR-Cas system, Cas12a, C2c1, and C2c3 in the type V system, Cas13a in the type VI system, and one of the effector proteins in other types of systems;

Further, the Cas effector protein is derived from archaea or bacteria, and is selected from nuclease-deficient type;

Preferably, the Cas effector protein is derived from Streptococcus pyogenes (Streptococcus pyogenes), a nuclease-deficient Cas9 derivative protein having an amino acid sequence as shown in SEQ.ID.NO:1;

Preferably, the Cas effector protein is derived from Lachnospiraceae bacterium (Lachnospiraceae bacterium), a nuclease-deficient Cpf1 derivative protein having an amino acid sequence as shown in SEQ.ID.NO:2;

Preferably, the Cas effector protein is derived from Alicyclobacillus acidoterrestris, a nuclease-deficient C2c1 derivative protein having the amino acid sequence shown in SEQ.ID.NO:3.

Further, the nucleic acid in the nucleic acid sample to be processed is linear nucleic acid.

Further, the method also includes pre-processing the nucleic acid sample to be processed, the pre-processing includes crushing the nucleic acid sample to be processed;

Preferably, the pretreatment includes: successively performing ultrasonic treatment, high temperature treatment and centrifugation on the nucleic acid sample to be treated to destroy the cell wall and cell membrane to release the nucleic acid;

Preferably, the operation of the ultrasonic treatment is: ultrasonic 100-300W ultrasonic 5 seconds, stop for 5 seconds, the total length is 15-30 minutes, preferably 270W ultrasonic 5 seconds, stop for 5 seconds, the total length is 10 minutes;

Preferably, the high-temperature treatment operation is: 90-98°C for 5-10 minutes, preferably 95°C for 10 minutes.

Further, other methods can be used to crush the nucleic acid samples to be processed, such as filtration, ultrafiltration, repeated freezing and thawing, and hydrolysis with digestive enzymes to obtain relatively pure nucleic acid samples.

Further, the nuclease-deficient Cas effector protein and the complex 1 have a wide range of dosage ratios to the nucleic acid sample to be treated, preferably the amount of the complex 1 is at the nM level, and the amount of the target nucleic acid in the nucleic acid sample to be treated is The amount is 1/20～1/10 of compound 1;

The incubation temperature described in step (2) is determined according to the suitable working temperature of the effector protein, preferably the optimum temperature for the activity of the Cas effector protein, such as the working temperature of the Cas9 protein derived from Streptococcus pyogenes (Streptococcus pyogenes) is 25° C. to 42° C. °C, preferably 37 °C.

The amount of magnetic beads used in step (3) is determined according to the amount of biotin loaded on the magnetic beads coated with avidin, the amount of target nucleic acid and the amount of complex 1. For a small amount of target nucleic acid, the preferred amount of magnetic beads is 2ul.

Further, the method also includes identifying the target nucleic acid of the enriched, separated and purified complex 3;

The method of target nucleic acid identification is selected from but not limited to polymerase chain reaction, isothermal amplification technology, helicase-dependent amplification technology, rolling circle amplification technology, circle-mediated amplification technology or recombinase polymerase Isothermal amplification technology;

Preferably, the method for identifying the target nucleic acid is polymerase chain reaction.

During the identification operation, there is no need to elute the target nucleic acid from the magnetic beads, and it can be added together with the magnetic beads into the identification amplification reaction system, and the results will not be affected.

The second aspect of the present invention provides a nucleic acid enrichment, separation and purification kit based on the CRISPR-Cas system, including (1) a biotin-labeled Cas effector protein and magnetic beads coated with avidin, and/or ( 2) Cas effector proteins and magnetic beads modified by antibodies corresponding to the Cas effector proteins, and/or (3) Cas effector proteins, biotin and magnetic beads coated with avidin.

Further, the kit also includes a buffer;

The composition of the buffer solution is: Tris-HCl: 10mM, NaCl: 50mM, MgCl ₂ : 10mM, tween20: 0.1%, pH7.0-8.0;

The composition of the reaction solution is Tris-HCl: 10 mM, NaCl: 50 mM, MgCl ₂ : 10 mM, tween20: 0.1%, pH 7.0-8.0.

Further, the avidin is preferably streptavidin.

Further, the Cas effector protein is selected from Cas9 in the type II CRISPR-Cas system, Cas12a, C2c1, and C2c3 in the type V system, Cas13a in the type VI system, and one of effector proteins in other types of systems.

The beneficial effects of the present invention are:

1. Compared with the existing nucleic acid isolation technology, the method of the present invention is novel, unique, convenient and safe, and the complex formed by the Cas effector protein in the CRISPR-Cas system and sgRNA, crRNA or crRNA/tracrRNA can accurately target Target nucleic acid characteristics, and specific enrichment, separation and purification of target nucleic acids. The method is easy to operate, and no reagents that endanger human health or environmental safety are involved in the process. In addition, another feature of this technology is that it focuses on the enrichment and separation of linear target nucleic acids, rather than the extraction of large genome fragments. The size of fragmented DNA in sonicated biological samples is between 200 and 1000 bp, and this feature combined with the role of CRISPR-Cas is sufficient for the specific detection of various samples.

2. The application field of the present invention is extremely wide, and the target nucleic acid in samples from different sources can be enriched, separated, and further identified. The main reason is that when the CRISPR-Cas system recognizes the target nucleic acid, the Cas effector protein and the complex formed with sgRNA, crRNA or crRNA/tracrRNA can orient the target nucleic acid according to its own characteristics. For example, the complex formed by Cas9 and sgRNA in the type II system can recognize the "-NGG-" sequence (N represents any base) in the target nucleic acid from the 5' to 3' direction, thereby further matching with the 20 in the 5' direction. A nucleotide combination, together with the adjacent sequence, is specifically separated by the method of the present invention. Sequences such as "-NGG-" are widely distributed in human genomes, plant genomes, or microbial genomes, which means that this technology can meet different requirements and isolate the required target nucleic acid.

3. The technology of the present invention can efficiently and specifically separate and purify target nucleic acid DNA based on two points. The first point is that the Cas protein mentioned above and the effector complex formed with sgRNA, crRNA or crRNA/tracrRNA can orient the target nucleic acid according to its own characteristics. The second point is that streptavidin or antibodies on the surface of magnetic beads can specifically recognize biotin-labeled effector proteins or other components in effector protein complexes, such as sgRNA, and because of the extremely high binding constant, thus To achieve efficient separation effect.

Description of drawings

Figure 1 is a schematic diagram of the principle of enrichment, separation and purification of target DNA based on the CRISPR-Cas system (biotin is labeled on the Cas9 protein).

Figure 2 is the result of polymerase chain reaction verification after enrichment and isolation of a small amount of short-segment DNA containing excess interfering DNA based on CRISPR-Cas system enrichment, separation and purification.

Figure 3 is the result of polymerase chain reaction verification after enrichment and separation based on CRISPR-Cas system enrichment, separation and purification of trace amounts of short-segment DNA containing excess interfering DNA and cell culture medium.

Detailed ways

In order to understand the present invention more clearly, the present invention will now be further described with reference to the following examples and accompanying drawings. The examples are for illustration only and do not limit the invention in any way. In the examples, each original reagent material can be obtained commercially, and the experimental methods without specific conditions are conventional methods and conventional conditions well known in the art, or according to the conditions suggested by the instrument manufacturer.

In the embodiment, the effector protein Cas9 and sgRNA in the type II CRISPR-Cas system are used as a display. The schematic diagram of the principle of enrichment, separation and purification of target DNA based on the CRISPR-Cas system (biotin-labeled on the Cas9 protein) is shown in Figure 1. sgRNA is formed by combining crRNA and tracRNA.

Design a crRNA for a short segment of DNA. Search for "-NGG-" on the short DNA sequence, and the 20 nucleotides close to the 5' direction are part of the crRNA sequence, and the other part of the crRNA sequence is the tracRNA recognition and binding sequence. The sequences of crRNA and tracRNA are as follows:

crRNA: CUUGUAGCUACGCCUGUGAUGUUUUAGAGCUAUGCUGUUUUG (SEQ.ID.NO:4)

tracRNA: AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ.ID.NO:5)

Verify that the primer sequences for the target nucleic acid are as follows:

Verification-For: CTGATGTGGGCTGCCTAGAAAGG (SEQ.ID.NO:6)

Verification-Rev: CAAGGATTGACCCAGGCCAGG (SEQ.ID.NO:7)

Example 1: Enrichment, separation and purification of trace short fragment DNA containing excess interfering DNA based on CRISPR-Cas system

Based on the CRISPR-Cas system, the specific experimental operation of enriching, separating and purifying a small amount of short fragment DNA containing excess interfering DNA is as follows:

1. Biotin labeling of Cas9 protein: Cas9 is a protein with double nuclease domain deficiency, that is, dCas9. Biotin and dCas9 are incubated overnight at 4°C at a molar ratio of 200:1. After incubation, transfer to a desalting column and centrifuge to remove excess biotin. After the first centrifugation (5000rpm, 2min), add an appropriate amount of 1×PBS (PH 7.4), centrifuge under the same conditions, and repeat three times to ensure that unlabeled biotin is completely removed.

2. Preparation of sgRNA: Anneal the synthesized crRNA and tracRNA at a molar ratio of 1:2 to form a functional sgRNA. The annealing condition was 98°C for 5min, followed by a gradient cooling down by 2°C every 20s until 25°C (room temperature).

3. Formation of dCas9-sgRNA complex: In the reaction solution (Tris-HCl: 10mM, NaCl: 50mM, MgCl ₂ : 10mM, tween20: 0.1%, pH7-8.0), add biotin with a molar ratio of 1:2 Labeled dCas9 protein and sgRNA, wherein the concentration of dCas9 in a 30ul reaction system is 25nM-200nM, and the concentration of sgRNA is 50nM-400nM, and incubated at 37°C for 10-20min, preferably 15min in this example, to form a stable dCas9 -sgRNA complexes.

4. Formation of dCas9-sgRNA-DNA complex: use preservation solution (Tris-HCl: 10mM, NaCl: 50mM, MgCl ₂ : 10mM, tween20: 0.1%, 0.2mg/ml BSA, 250ng/ul EGFP plasmid, pH7～ 8.0) Dilute short DNA fragments to prepare low-concentration DNA with a concentration of 25nM to 2.5fM. Take 1ul of different concentrations, add the reaction solution described in step 2 to it, and add 0.5ul of preservation solution at the same time to increase the amount of interfering DNA. (8ng/ul), incubate at 37°C for 15-30min, preferably 20min in this embodiment, to form a stable dCas9-sgRNA-DNA complex.

5. Treatment of magnetic beads: take 5 ul magnetic beads, absorb them on the tube wall by the force of an external magnetic field, discard the supernatant, add 200 ul of the reaction solution prepared in step 3 to it, vortex and mix, magnetize the magnetic beads and discard Clear, repeat three times. Add the processed magnetic beads to the reaction system in step 4, and incubate at room temperature for 10-40 minutes, preferably 30 minutes in this example, and vortex every 5 minutes to avoid magnetic beads from depositing at the bottom of the tube.

6. Separation of target nucleic acid DNA: The DNA separated and enriched on the surface of the magnetic beads is adsorbed on the tube wall through the force between the magnet and the magnetic beads, and the supernatant is discarded; add 200ul of washing buffer (Tris-HCl: 10mM, NaCl: 50mM, MgCl ₂ : 10mM, tween20: 0.1%, pH 7-8.0) were fully resuspended, then placed on a magnet to absorb magnetic beads, let stand for 1min, removed the supernatant, and repeated three times to purify DNA.

7. Identification of target DNA: In the 50ul system of polymerase chain reaction, first add nuclease-free water, 10ul 5× amplification buffer, 1ul 10mM dNTP, 0.5ul polymerase, after mixing evenly, two 10mM Add 1.5ul of each verification primer, and then add the isolated and purified target DNA together with magnetic beads to the prepared reaction system. Amplify according to the program of 98°C, 10s, 55°C, 5s, 72°C, 18s, repeated 30 cycles.

8. Add gelgreen fluorescent dye to the amplified product at a volume ratio of 100:1, and add 36% glycerol aqueous solution at a volume ratio of 6:1. Gel run identification in 6% non-denaturing gel, the buffer solution is 1×TBE, and the gel running conditions are 150V, 20min.

The identification results are shown in Figure 2. The control group (not separated and purified by this technology) contained a high concentration of interfering DNA and the concentration of the target DNA was too low, resulting in a large number of non-specific bands in the amplified product. However, after the enrichment, separation and purification treatment of this embodiment, the experimental group can more sensitively amplify the target band, and the amplified target band can still be observed under low concentration conditions, indicating the feasibility and High sensitivity. In addition, it has a significant effect on reducing the amplification of non-specific bands.

Example 2: Enrichment, separation and purification of trace short DNA fragments containing excess interfering DNA and cell culture medium based on CRISPR-Cas system

The specific experimental steps are as described in Example 1, except that in step 3, in addition to adding interfering DNA, a cell culture medium containing serum at a final concentration of 10% is also added, and the concentration of DNA is 25fM-25aM.

The experimental results are shown in Figure 3: due to the complexity of the components in the cell culture medium, the target band was not amplified for the untreated sample, and the experimental group was enriched, separated and purified in this embodiment, although there were A small amount of non-specific bands, but the target band can be amplified at a lower concentration.

Example 3: A kit for nucleic acid enrichment, isolation and purification based on the CRISPR-Cas system

In a specific embodiment, the kit includes biotin-labeled Cas effector protein, magnetic beads coated with avidin, buffer and reaction solution, and the avidin is preferably streptavidin.

In a specific embodiment, the kit includes a Cas effector protein, magnetic beads modified by an antibody corresponding to the Cas effector protein, a buffer and a reaction solution.

In a specific embodiment, the kit includes Cas effector protein, biotin, magnetic beads coated with avidin, buffer and reaction solution, and the avidin is preferably streptavidin.

The buffer solution is used to elute the magnetic beads, and its components and concentrations are Tris-HCl: 10mM, NaCl: 50mM, MgCl ₂ : 10mM, tween20: 0.1%, pH 7-8.0.

The reaction solution is used for the reaction of Cas effector protein with sgRNA, crRNA or crRNA/tracrRNA complex 1, and its components and concentrations are Tris-HCl: 10mM, NaCl: 50mM, MgCl ₂ : 10mM, tween20: 0.1%, pH7～ 8.0.

In this embodiment, the Cas effector protein is selected from Cas9 in the type II CRISPR-Cas system, Cas12a, C2c1, and C2c3 in the type V system, Cas13a in the type VI system, and one of effector proteins in other types of systems.

Cas effector proteins are derived from archaea or bacteria and are selected from nuclease deficient ones.

As a preferred embodiment, the Cas effector protein is derived from Streptococcus pyogenes (Streptococcus pyogenes), a nuclease-deficient Cas9 derivative protein having an amino acid sequence as shown in SEQ.ID.NO:1;

As a preferred embodiment, the Cas effector protein is derived from Lachnospiraceae bacterium (Lachnospiraceae bacterium), a nuclease-deficient Cpf1 derivative protein having an amino acid sequence as shown in SEQ.ID.NO:2;

As a preferred embodiment, the Cas effector protein is derived from Alicyclobacillus acidoterrestris, a nuclease-deficient C2c1 derivative protein having the amino acid sequence shown in SEQ.ID.NO:3.

Apparently, the above-mentioned embodiments are only examples for clear description, rather than limiting the implementation. For those of ordinary skill in the art, other changes or changes in different forms can be made on the basis of the above description. It is not necessary and impossible to exhaustively list all the implementation manners here. And the obvious changes or changes derived therefrom are still within the scope of protection of the present invention.

Claims

A method for nucleic acid enrichment, separation and purification based on a CRISPR-Cas system, characterized in that it comprises the following steps:

(1) preparing a complex 1 of a nuclease-deficient Cas effector protein and sgRNA, crRNA or crRNA/tracrRNA, wherein the complex 1 is biotin-labeled or unlabeled;

(2) adding the nucleic acid sample to be treated to the above-mentioned complex 1 and incubating to form a complex 2 of the complex 1 and the target nucleic acid;

(3) When the complex 1 is labeled with biotin, the above-mentioned complex 2 is captured with the magnetic beads coated with avidin to form the complex 3 of the magnetic beads and the complex 2;

When complex 1 is not labeled with biotin, the above-mentioned complex 2 is captured with magnetic beads modified by an antibody corresponding to the Cas effector protein to form a complex 3 of magnetic beads and complex 2;

(4) The above complex 3 is separated by magnetic suction, and the magnetic beads are eluted with a buffer solution, that is, the enrichment, separation and purification of the target nucleic acid of the nucleic acid sample to be processed are realized.
The method according to claim 1, wherein the sgRNA is formed by combining crRNA and tracrRNA;

The crRNA includes a complementary nucleotide sequence close to the 5' direction of NGG in the target nucleic acid and a tracRNA recognition binding sequence.
The method according to claim 1, wherein the biotin is labeled on the Cas effector protein and/or labeled on sgRNA, crRNA or crRNA/tracrRNA;

Preferably, when biotin is labeled on the Cas effector protein, the molar ratio of biotin to Cas effector protein is 200:1;

Preferably, the avidin is streptavidin.
The method according to claim 1, wherein the Cas effector protein is selected from Cas9 in type II CRISPR-Cas system, Cas12a, C2c1, C2c3 in type V system, Cas13a in type VI system and other types One of the effector proteins of the system;

Preferably, the Cas effector protein is derived from archaea or bacteria, and is selected from nuclease-deficient types;

Preferably, the Cas effector protein is derived from Streptococcus pyogenes, a nuclease-deficient Cas9 derivative protein having an amino acid sequence as shown in SEQ.ID.NO:1;

Preferably, the Cas effector protein is derived from Lachnospiraceae, a nuclease-deficient Cpf1 derivative protein having an amino acid sequence as shown in SEQ.ID.NO:2;

Preferably, the Cas effector protein is derived from Cycloalilic acid soil, a nuclease-deficient C2c1 derivative protein having the amino acid sequence shown in SEQ.ID.NO:3.
The method according to claim 1, wherein the nucleic acid in the nucleic acid sample to be processed is a linear nucleic acid.
The method according to claim 1, characterized in that, the method further comprises pre-processing the nucleic acid sample to be processed, the pre-processing comprising crushing the nucleic acid sample to be processed;

Preferably, the pretreatment includes: successively performing ultrasonic treatment, high temperature treatment and centrifugation on the nucleic acid sample to be treated;

Preferably, the operation of the ultrasonic treatment is: ultrasonic power 100-300W, ultrasonic for 5 seconds, pause for 5 seconds, the total length is 15-30min, preferably 270W ultrasonic for 5 seconds, pause for 5 seconds, the total length is 10min;

Preferably, the high-temperature treatment operation is: 90-98°C for 5-10 minutes, preferably 95°C for 10 minutes.
The method according to claim 1, wherein the amount of the nuclease-deficient Cas effector protein or complex 1 is at the nM level, and the amount of the target nucleic acid in the nucleic acid sample to be treated is 1/1 of the complex 1 20～1/10;

Preferably, the incubation temperature described in step (2) is the optimal temperature for Cas effector protein activity;

Preferably, the amount of magnetic beads used in step (3) is determined according to the amount of biotin loaded on the magnetic beads coated with avidin, the amount of target nucleic acid and the amount of complex 1.
The method according to claim 1, characterized in that the method further comprises identifying the target nucleic acid of the enriched, separated and purified complex 3;

The method for identifying the target nucleic acid is selected from polymerase chain reaction, isothermal amplification technology, helicase-dependent amplification technology, rolling circle amplification technology, circle-mediated amplification technology or recombinase polymerase isothermal amplification technology ;

Preferably, the method for identifying the target nucleic acid is polymerase chain reaction.
A nucleic acid enrichment, separation and purification kit based on the CRISPR-Cas system, characterized in that it includes (1) biotin-labeled Cas effector proteins and magnetic beads coated with avidin, and/or (2) Cas effector protein and magnetic beads modified by Cas effector protein corresponding antibody, and/or (3) Cas effector protein, biotin and magnetic beads coated with avidin.
The kit according to claim 9, further comprising a buffer and a reaction solution;

The composition of the buffer solution is: Tris-HCl: 10mM, NaCl: 50mM, MgCl 2 : 10mM, tween20: 0.1%, pH7.0-8.0;

The composition of the reaction solution is Tris-HCl: 10 mM, NaCl: 50 mM, MgCl 2 : 10 mM, tween20: 0.1%, pH 7.0-8.0.
The kit according to claim 9, wherein the avidin is streptavidin.
The kit according to claim 9, wherein the Cas effector protein is selected from Cas9 in the type II CRISPR-Cas system, Cas12a, C2c1, C2c3 in the type V system, Cas13a in the type VI system and others One of the effector proteins of the type system.
The kit according to claim 9, wherein the Cas effector protein is derived from archaea or bacteria, and is selected from nuclease-deficient types;

Preferably, the Cas effector protein is derived from Streptococcus pyogenes, a nuclease-deficient Cas9 derivative protein having an amino acid sequence as shown in SEQ.ID.NO:1;

Preferably, the Cas effector protein is derived from Lachnospiraceae, a nuclease-deficient Cpf1 derivative protein having an amino acid sequence as shown in SEQ.ID.NO:2;

Preferably, the Cas effector protein is derived from Cycloalilic acid soil, a nuclease-deficient C2c1 derivative protein having the amino acid sequence shown in SEQ.ID.NO:3.