CN112280832B - Extraction-free nucleic acid detection method and kit - Google Patents
Extraction-free nucleic acid detection method and kit Download PDFInfo
- Publication number
- CN112280832B CN112280832B CN202011236028.7A CN202011236028A CN112280832B CN 112280832 B CN112280832 B CN 112280832B CN 202011236028 A CN202011236028 A CN 202011236028A CN 112280832 B CN112280832 B CN 112280832B
- Authority
- CN
- China
- Prior art keywords
- detection
- nucleic acid
- detected
- buffer solution
- thermostable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an extraction-free nucleic acid detection method and a kit. The detection method comprises the following steps: (1) the biological sample containing the nucleic acid to be detected is put into a multifunctional buffer solution for cracking, and the nucleic acid to be detected is released; (2) adding the released multifunctional buffer solution containing the nucleic acid to be detected into a detection reagent to perform replication reaction of the nucleic acid to be detected; (3) and judging whether the sample contains the nucleic acid to be detected according to the detection result after the reaction is finished. The multifunctional buffer solution has the functions of cracking and inactivating biological samples, promoting the release of nucleic acid to be detected and serving as the buffer solution required by the replication and detection processes of the nucleic acid to be detected; the detection reagent comprises various enzymes, primers and auxiliary factors required by the nucleic acid replication amplification to be detected and the detection of the nucleic acid replication amplification product. The method can realize rapid, simple, high-specificity and high-sensitivity detection of whether specific nucleic acid sequences exist in original samples such as viruses, bacteria, cells, biological tissues and the like.
Description
Technical Field
The invention belongs to the technical field of nucleic acid extraction and detection, and particularly relates to an extraction-free nucleic acid detection method and a kit.
Background
The amplification and detection methods for biological nucleic acids in the existing biotechnology mainly include PCR (polymerase chain amplification), LAMP (loop-mediated isothermal amplification), RPA (recombinase polymerase amplification), HDA (helicase DNA amplification), RCA (rolling circle amplification), CPA (cross-primer isothermal amplification), and the like. The PCR method adopts exponential amplification and has the advantage of high sensitivity, but depends on a larger temperature control instrument, so that a sample is often required to be extracted into nucleic acid with higher purity and is required to be carried out in a professional laboratory. The LAMP loop-mediated isothermal amplification technology does not need a complex temperature control instrument, but has limited detection sensitivity and complex required primers. The RPA recombinase polymerase amplification technology has high sensitivity, does not need a complex temperature control instrument, but has low detection specificity. Several other techniques require complex temperature-controlled instruments, some are unsatisfactory in detection sensitivity or specificity, and most require processing of the sample to extract nucleic acids. The invention provides a high-sensitivity high-specificity extraction-free nucleic acid replication amplification and detection method and a kit, which do not need a complex temperature control instrument for temperature rise and temperature reduction.
Disclosure of Invention
The invention aims at providing an extraction-free nucleic acid detection method. The method can realize rapid, simple, high-specificity and high-sensitivity detection of the existence of specific nucleic acid sequences in original samples such as viruses, bacteria, cells, biological tissues and the like.
The extraction-free nucleic acid detection method specifically comprises the following steps:
(1) the biological sample containing the nucleic acid to be detected is put into a multifunctional buffer solution for cracking, and the nucleic acid to be detected is released;
(2) adding the multifunctional buffer solution containing the released nucleic acid to be detected into a detection reagent to carry out the replication reaction of the nucleic acid to be detected;
(3) and judging whether the sample contains the nucleic acid to be detected according to the detection result after the reaction is finished.
The biological sample containing the nucleic acid to be detected comprises: one or more of a virus, a bacterium, a cell, a biological tissue;
the multifunctional buffer solution has the functions of cracking and inactivating biological samples, promoting the release of nucleic acid to be detected and serving as the buffer solution required by the replication and detection processes of the nucleic acid to be detected;
the detection reagent comprises various enzymes, primers and auxiliary factors required by the replication and amplification of nucleic acid to be detected; or also contains various accessory factors required for detecting the nucleic acid replication amplification product to be detected.
In the detection method, each 100 mu L of detection system contains the following multifunctional buffer solution: 1uM-500mM Tris-HCl pH8.0, 0.1-15% Triton X-100, 0.1-20% Tween20, 1mM-1M betaine, 1ng/mL-10mg/mL BSA, 0.01-10% SDS, 0.01-10% ethanol, 1uM-5M sodium chloride, 1uM-5M potassium chloride, 1uM-1M sodium hydroxide, 7pM-350mM sedentarines.
Preferably comprising: 100uM-100mM Tris-HCl pH8.0, 1% -10% triton X-100, 1% -10% Tween20, 10mM-500mM betaine, 10ng/mL-1mg/mL BSA, 0.05% -5% SDS, 0.05% -5% ethanol, 10uM-1M sodium chloride, 10uM-1M potassium chloride, 10uM-100mM sodium hydroxide, 20pM-100mM sedentarines;
further preferably comprises: 500uM-50mM Tris-HCl pH8.0, 2% -8% triton X-100, 2% -8% Tween20, 80mM-300mM betaine, 30ng/mL-600ug/mL BSA, 0.1% -1% SDS,0.1% -1% ethanol, 80uM-800mM sodium chloride, 500uM-100mM potassium chloride, 300uM-50mM sodium hydroxide, 600pM-1mM cypersantine.
Most preferably: 18mM-22mM Tris-HCl pH8.0, 2% -4% triton X-100, 2% -4% Tween20, 100mM-140mM betaine, 80ug/mL-120ug/mL BSA, 0.1% -0.7% SDS,0.1% -0.5% ethanol, 130mM-170mM sodium chloride, 30mM-70mM potassium chloride, 22mM-28mM sodium hydroxide, 280nM-320nM sanskatortine.
In the detection method, the detection reagent comprises various enzymes, primers and auxiliary factors required by the replication amplification of the nucleic acid to be detected, and the various enzymes, primers and auxiliary factors required by the replication amplification of the nucleic acid to be detected comprise heat-resistant recombinase capable of combining with oligonucleotide primers, specific primers (25bp-35bp of primer sequences, the GC content is between 35% and 55%, and secondary structures of more than 7bp are not contained in the primers), heat-resistant strand displacement DNA polymerase and heat-resistant single-stranded DNA binding protein.
Preferably: each 100 mu L of detection system contains the following detection reagents: 1uM to 1mM of a thermostable recombinase capable of binding to the oligonucleotide primer, 100nM to 20uM specific primer, 0.5U to 50U of a thermostable strand displacement DNA polymerase, 1nM to 1mM of a thermostable single-stranded DNA binding protein.
Further preferably comprises a thermostable Tth RecA protein, specific primers, Bst2.0WarmStart DNA polymerase and ET SSB.
Furthermore, each 100 mu L of the detection system contains the following detection reagents: 1uM-1mM thermostable Tth RecA protein, 100nM-20uM specific primers, 0.5U-50U Bst2.0WarmStart DNA polymerase, 1nM-1mM ET SSB.
Preferably, each 100 mu L of the detection system contains the following detection reagents: 30uM-800uM thermostable Tth RecA protein, 300nM-10uM specific primer, 1U-35U Bst2.0WarmStart DNA polymerase, 100nM-500uM ET SSB.
Further preferably: each 100 mu L of detection system contains the following detection reagents: 30uM-600uM thermostable Tth RecA protein, 500nM-5uM specific amplification primers, 5U-20U Bst2.0WarmStart DNA polymerase, 150nM-50uM ET SSB.
Most preferably: each 100 mu L of detection system contains the following detection reagents: 35uM-45uM thermostable Tth RecA protein, 0.5-3uM specific amplification primers, 8U-12U Bst2.0WarmStart DNA polymerase, 8uM-12uM ET SSB.
In the above detection method, the detection reagent further comprises: ATP-gamma-S, magnesium acetate and dNTP; if the target nucleic acid to be detected is RNA, it should also contain reverse transcriptase, RNases inhibitor.
Furthermore, each 100 mu L of detection system also contains the following detection reagents: 10nM to 600mM ATP- γ -S, 1mM to 5M magnesium acetate, 0.1mM to 500mM dNTP; if the target nucleic acid is RNA, it should also contain 0.1U-5U reverse transcriptase, 0.1U-200U RNases inhibitor.
Preferably: 200nM to 10mM ATP-gamma-S, 10mM to 1M magnesium acetate, 10mM to 300mM dNTP; if the target nucleic acid to be detected is RNA, it should also contain 0.5-5U, preferably 0.5U-3U, of reverse transcriptase, and 5-80U, preferably 50U-80U, of RNase inhibitor.
Further preferably: 10uM-8mM ATP-gamma-S, 10mM-600mM magnesium acetate, 2mM-200mM dNTP; if the target nucleic acid is RNA, it should also contain 1.5U-2.5U reverse transcriptase, 10U-30U RNases inhibitor.
Most preferably 5mM-7mM ATP- γ -S, 20mM-30mM magnesium acetate, 2mM-6mM dNTP.
In the detection method, the various accessory factors required for detecting the nucleic acid replication amplification product to be detected are CRISPR-Cas12b detection report systems.
The CRISPR-Cas12b detection reporting system comprises: aap Cas12b, Aap Cas12b sgRNA, and single-stranded reporter DNA.
Furthermore, each 100 mu L of detection system also comprises a CRISPR-Cas12b detection report system with the following components: 1nM-500M Aap Cas12b, 10nM-500mM Aap Cas12b sgRNA, 1nM-50mM single-stranded reporter DNA.
Preferably: 500nM-30M Aap Cas12b, 500nM-50mM Aap Cas12b sgRNA, 350nM-5mM single-stranded reporter DNA.
Further preferably: 1uM-750mM Aap Cas12b, 500nM-9mM Aap Cas12b sgRNA, 1uM-1mM single-stranded reporter DNA.
Most preferably: 1uM-3uM Aap Cas12b, 550nM-650nM Aap Cas12b sgRNA, 1uM-3uM single-stranded reporter DNA.
In the detection method, the detection reagent is preferably prepared into freeze-dried powder before use.
The detection method comprises the following steps: putting the biological sample in a multifunctional buffer solution, and heating for 2-30 min at 42-72 ℃; can crack the biological sample to release the nucleic acid to be detected;
adding a detection reagent into the multifunctional buffer solution containing the released nucleic acid to be detected, reacting at 42-72 ℃ for 2-30 min, and judging whether the sample contains the nucleic acid to be detected.
The reaction is preferably carried out at 50 ℃ to 70 ℃, more preferably at 65 ℃, preferably for 5min to 25min, and more preferably for 15 min.
The invention can finally judge whether the sample contains the nucleic acid to be detected in a fluorescence detection or test strip detection mode.
And (3) fluorescence detection process: the Aap Cas12b protein and the Aap Cas12b sgRNA are combined to form a compound to search a nucleic acid replication product and carry out enzyme digestion, the activity of hydrolyzed single-stranded DNA of the Aap Cas12b protein is activated after enzyme digestion, ssDNA reporters with a fluorescence signal and a quenching signal are hydrolyzed and then release the fluorescence signal, and the fluorescence signal can be detected through an instrument or related light.
In the test strip detection, ssDNA reporter is designed to have one end as a fluorescent group and the other end as a quenching group of Biotin, and a colloidal gold test strip is adopted for antibody color development.
The second purpose of the invention is to provide an extraction-free nucleic acid detection kit. The kit is a detection kit matched with the detection method. The method can also detect whether the original samples such as viruses, bacteria, cells, biological tissues and the like have specific nucleic acid sequences quickly, simply, conveniently, with high specificity and high sensitivity, and has low cost as a product.
The extraction-free nucleic acid detection kit comprises: a multifunctional buffer solution and a detection reagent;
the multifunctional buffer solution has the functions of cracking and inactivating biological samples, promoting the release of nucleic acid to be detected and serving as the buffer solution required by the replication and detection processes of the nucleic acid to be detected; the detection reagent comprises various enzymes, primers and auxiliary factors required by the replication and amplification of nucleic acid to be detected; or also contains the accessory factors required for the detection of the nucleic acid replication amplification product to be detected.
When the kit is used, each 100 mu L of detection system contains the following multifunctional buffer solution: 1uM-500mM Tris-HCl pH8.0, 0.1-15% Triton X-100, 0.1-20% Tween20, 1mM-1M betaine, 1ng/mL-10mg/mL BSA, 0.01-10% SDS, 0.01-10% ethanol, 1uM-5M sodium chloride, 1uM-5M potassium chloride, 1uM-1M sodium hydroxide, 7pM-350mM sedentarines.
Preferably comprising: 100uM-100mM Tris-HCl pH8.0, 1% -10% triton X-100, 1% -10% Tween20, 10mM-500mM betaine, 10ng/mL-1mg/mL BSA, 0.05% -5% SDS, 0.05% -5% ethanol, 10uM-1M sodium chloride, 10uM-1M potassium chloride, 10uM-100mM sodium hydroxide, 20pM-100mM sedentarines;
further preferably comprises: 500uM-50mM Tris-HCl pH8.0, 2% -8% triton X-100, 2% -8% Tween20, 80mM-300mM betaine, 30ng/mL-600ug/mL BSA, 0.1% -1% SDS,0.1% -1% ethanol, 80uM-800mM sodium chloride, 500uM-100mM potassium chloride, 300uM-50mM sodium hydroxide, 600pM-1mM cypersantine.
Most preferably: 18mM-22mM Tris-HCl pH8.0, 2% -4% triton X-100, 2% -4% Tween20, 100mM-140mM betaine, 80ug/mL-120ug/mL BSA, 0.1% -0.7% SDS,0.1% -0.5% ethanol, 130mM-170mM sodium chloride, 30mM-70mM potassium chloride, 22mM-28mM sodium hydroxide, 280nM-320nM sanskatortine.
The detection reagent comprises a heat-resistant recombinase capable of combining with an oligonucleotide primer, a specific primer, a heat-resistant strand displacement DNA polymerase and a heat-resistant single-stranded DNA binding protein.
When the kit is used,
preferably: each 100 mu L of detection system contains the following detection reagents: 1uM to 1mM of a thermostable recombinase capable of binding to the oligonucleotide primer, 100nM to 20uM specific primer, 0.5U to 50U of a thermostable strand displacement DNA polymerase, 1nM to 1mM of a thermostable single-stranded DNA binding protein.
Further preferably comprises a thermostable Tth RecA protein, specific primers, Bst2.0WarmStart DNA polymerase and ET SSB.
Furthermore, each 100 mu L of the detection system contains the following detection reagents: 1uM-1mM thermostable Tth RecA protein, 100nM-20uM specific primers, 0.5U-50U Bst2.0WarmStart DNA polymerase, 1nM-1mM ET SSB.
Preferably, each 100 mu L of the detection system contains the following detection reagents: 30uM-800uM thermostable Tth RecA protein, 300nM-10uM specific primer, 1U-35U Bst2.0WarmStart DNA polymerase, 100nM-500uM ET SSB.
Further preferably: each 100 mu L of detection system contains the following detection reagents: 30uM-600uM thermostable Tth RecA protein, 500nM-5uM specific amplification primers, 5U-20U Bst2.0WarmStart DNA polymerase, 150nM-50uM ET SSB.
Most preferably: each 100 mu L of detection system contains the following detection reagents: 35uM-45uM thermostable Tth RecA protein, 0.5-3uM specific amplification primers, 8U-12U Bst2.0WarmStart DNA polymerase, 8uM-12uM ET SSB.
In the above detection kit, the detection reagent further comprises: ATP-gamma-S, magnesium acetate and dNTP; if the target nucleic acid to be detected is RNA, it should also contain reverse transcriptase, RNases inhibitor.
When the kit is used,
each 100 mu L of detection system also contains the following detection reagents: 10nM to 600mM ATP- γ -S, 1mM to 5M magnesium acetate, 0.1mM to 500mM dNTP; if the target nucleic acid is RNA, it should also contain 0.1U-5U reverse transcriptase, 0.1U-200U RNases inhibitor.
Preferably: 200nM to 10mM ATP- γ -S, 10mM to 1M magnesium acetate, 10mM to 300mM dNTP; if the target nucleic acid to be detected is RNA, it should also contain 0.5-5U, preferably 0.5U-3U, of reverse transcriptase, and 5-80U, preferably 50U-80U, of RNase inhibitor.
Further preferably: 10uM-8mM ATP-gamma-S, 10mM-600mM magnesium acetate, 2mM-200mM dNTP; if the target nucleic acid is RNA, it should also contain 1.5U-2.5U reverse transcriptase, 10U-30U RNases inhibitor.
Most preferably 5mM-7mM ATP- γ -S, 20mM-30mM magnesium acetate, 2mM-6mM dNTP.
The detection kit comprises various accessory factors required by detection of the nucleic acid replication amplification product to be detected, namely a CRISPR-Cas12b detection report system.
The detection kit comprises a CRISPR-Cas12b detection report system and a detection kit, wherein the CRISPR-Cas12b detection report system comprises: aap Cas12b, Aap Cas12b sgRNA, and single-stranded reporter DNA.
When the kit is used,
each 100 mu L of detection system also comprises a CRISPR-Cas12b detection report system with the following components: 1nM-500M Aap Cas12b, 10nM-500mM Aap Cas12b sgRNA, 1nM-50mM single-stranded reporter DNA.
Preferably: 500nM-30M Aap Cas12b, 500nM-50mM Aap Cas12b sgRNA, 350nM-5mM single-stranded reporter DNA.
Further preferably: 1uM-750mM Aap Cas12b, 500nM-9mM Aap Cas12b sgRNA, 1uM-1mM single-stranded reporter DNA.
Most preferably: 1uM-3uM Aap Cas12b, 550nM-650nM Aap Cas12b sgRNA, 1uM-3uM single-stranded reporter DNA.
The detection reagent of the detection kit is freeze-dried powder.
The multifunctional buffer solution used by the invention has the function of cracking and inactivating viruses, bacteria, cells, biological tissues and the like, and can be used as the buffer solution of a nucleic acid replication module and a nucleic acid replication product detection module. The original samples of virus, bacteria, cells and the like are put in the multifunctional buffer solution, and the virus, the bacteria or the cells can be cracked by heating at 42-72 ℃ to release the nucleic acid to be detected. Adding a detection reagent into the multifunctional buffer solution containing the substance to be detected, and dissolving the detection reagent. The detection reagent is preferably prepared into lyophilized powder, and is more convenient to use, transport and store.
The freeze-dried powder contains a specific region replication module (comprising various enzymes, primers and various required auxiliary factors required by the replication amplification of the target nucleic acid) for the replication amplification of the target nucleic acid. The freeze-dried powder can also contain a detection module (comprising various enzymes, primers and various required auxiliary factors required by the detection of the target nucleic acid replication amplification product) for detecting whether the nucleic acid is replicated and amplified. Because the nucleic acid specific region replication module and the nucleic acid specific region replication product detection module are both carried out at the heating temperature of 42-72 ℃, the invention only needs to dissolve the multifunctional buffer solution containing the original samples such as viruses, bacteria, cells and the like to be detected into the freeze-dried powder, and react for 20 minutes at the temperature of 42-72 ℃, so that whether the samples contain the nucleic acid to be detected can be judged by a fluorescence detection or test strip detection mode.
The specific region replication module of the invention:
in order to realize sample extraction-free detection, the invention combines the advantages of LAMP detection and RPA detection methods to develop a DNA replication and amplification method under high temperature. The method uses a heat-resistant Tth RecA protein, a specific amplification primer, Bst2.0WarmStart DNA polymerase, ET SSB and the like to perform replication amplification on a target nucleic acid region at the temperature of 42-72 ℃. The specific principle is shown in figure 1. The method can effectively amplify target nucleic acid molecules with as low as one copy in the whole buffer solution.
The invention has a specific region replication product detection module:
in order to improve the specificity of the detection method, the invention introduces a CRISPR-Cas12b detection report system based on efficient reaction at high temperature. Cas12b specifically cleaves the replicated amplification product under the guide of the guide RNA. After cleavage, its nonspecific single-stranded DNA degradation activity is activated. The fluorescence detection of the system can be realized by cutting the single-stranded DNA fluorescent reporter group in the system. The specific flow and principle are shown in figure 2.
The present invention excludes detection for diagnostic purposes.
Compared with the prior art, the invention has the following advantages or beneficial effects:
(1) because the biological sample is completely free from extraction, the extraction efficiency does not need to be considered, even if a few virus, bacteria or cell samples are obtained, the biological sample can be detected very sensitively, and the sensitivity of the whole detection is improved. Meanwhile, the detection flow is shortened, and the detection time is reduced. The invention can detect the specific nucleic acid sequence of the organism to be detected with high specificity and high sensitivity within 20 minutes by taking viruses, bacteria, cells and the like as original samples.
(2) Only one liquid, namely the multifunctional buffer solution (the preservation temperature range is minus 20 ℃ to 40 ℃) and one detection freeze-dried powder (the preservation temperature range is minus 20 ℃ to 25 ℃) are used for detection from sample collection, so that convenience is brought to normal-temperature storage and transportation of the sample.
(3) The whole detection process can be completed only by one high-temperature reaction without a complex thermal cycler.
(4) The detection sensitivity reaches 1 copy of nucleic acid molecule/100 uL.
(5) The whole detection process can be finished by one tube, so that the risks of cross contamination and cross infection are reduced.
(6) The result reading is more convenient, and a complex fluorescence detector is not needed.
Drawings
FIG. 1 is a schematic diagram of a DNA replication amplification method according to the present invention combining LAMP detection and RPA detection;
fig. 2 is a flow chart and a schematic diagram of a CRISPR-Cas12b detection reporting system introduced by the present invention;
FIG. 3 is a graph showing the results of screening for a thermostable polymerase in amplification according to the present invention;
FIG. 4 is a diagram showing the results of screening for a recombinase capable of binding to an oligonucleotide primer that is thermostable in amplification according to the present invention;
FIG. 5 is a diagram showing the results of screening for thermostable single-stranded DNA binding proteins upon amplification according to the present invention;
FIG. 6 is a diagram showing the results of the detection of the COVID-19S gene pseudovirus of the present invention diluted to 100 copies, 10 copies, 1 copy;
FIG. 7 is a diagram showing the results of the detection of the COVID-19N protein gene pseudovirus diluted to 100 copies, 10 copies, and 1 copy.
Detailed Description
The following examples are intended to further illustrate the invention without limiting it.
Example 1 (screening of thermostable amplification enzyme)
The polymerase required by the present invention needs to have the following characteristics:
1. has DNA-dependent DNA polymerization activity at 42-72 deg.c;
2. has strand displacement activity.
As the conditions, there are Bst2.0 DNA Polymerase (NEB M0537L), Bst3.0 DNA Polymerase (NEB M0374L), Bst2.0WarmStart DNA Polymerase (NEB M0538L), Vent DNA Polymerase (NEB M0254L), Vent (exo-) DNA Polymerase (NEB M0257L), DeepVent DNA Polymerase (NEB M0258L), Deep Vent (exo-) DNA Polymerase (NEB M0259L) and the like.
Selecting a section of sequence of the COVID-19 virus S protein gene as a target amplification region.
ACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTAC, shown in SEQ ID NO. 1.
The oligonucleotide sequence:
19-F:
ACCTTTCTTTTCCAATGTTACTTGGTTCCA, shown in SEQ ID NO. 2.
19-R:
GTAGTACCAAAAATCCAGCCTCTTATTATG, shown in SEQ ID NO. 3.
TABLE 1
| Reaction system | Content of System |
| Tth RecA | 40uM |
| ATP-γ-S | 6mM |
| 19-F | 1uM |
| 19-R | 1uM |
| ET SSB | 10uM |
| Polymerase enzyme | 10U |
| MgAc | 25mM |
| dNTPs | 4mM |
| Multifunctional buffer solution | 1X |
| COVID-19S gene plasmid (Shanghai shenghua) | 100 copies |
| Total | 100uL |
The concentrations of the components of the multifunctional buffer solution of this example are shown in Table 2 below
TABLE 2
100uL of the multifunctional buffer solution prepared according to the table 2 is taken, and other components are added into the multifunctional buffer solution according to the reaction system in the table 1.
Mixing and then centrifuging instantly. The reaction is carried out for 15 minutes at 65 ℃ in a water bath or a PCR thermal cycler. After the reaction, 5uL of the mixture was run on 2% agarose gel for electrophoresis. The results are shown in FIG. 3.
Polymerases added in each lane were as follows:
s0 negative control without template
S1 Positive product control amplified by conventional PCR method
S2:Deep Vent(exo-)DNA Polymerase(NEB M0259L)
S3:DeepVent DNA Polymerase(NEB M0258L)
S4:Vent(exo-)DNA Polymerase(NEB M0257L)
S5:Bst2.0 WarmStart DNA Polymerase(NEB M0538L)
S6:Vent DNA Polymerase(NEB M0254L)
S7:Bst2.0 DNA Polymerase(NEB M0537L)
S8:Bst3.0 DNA Polymerase(NEB M0374L)
The results in FIG. 3 show that S5(Bst2.0 WarmStart DNA Polymerase) can amplify the desired product efficiently in the example system of the present invention.
Example 2 screening of recombinant proteins
The present invention requires that the selected enzyme be active at higher temperatures. The recombinant proteins screened in this example were RecA (NEB M0249L), Recaf (NEB M0355L), Tth RecA (NEB M2402S), T4 UvsX DNA recombination (Intact Genomics).
Selecting a sequence of the COVID-19 virus S protein gene as a target amplification region and an oligonucleotide sequence: 19-F and 19-R and the reaction conditions were the same as in example 1.
TABLE 3
The concentrations of the components of the multifunctional buffer solution of this example are shown in Table 4 below
TABLE 4
| Tris-HCl(pH8.0) | |
| Triton X-100 | |
| 2 | |
| Tween20 | |
| 2％ | |
| Betaine | 100mM |
| BSA | 80ug/mL |
| SDS | 0.1％ |
| Ethanol | 0.1％ |
| Sodium chloride | 130mM |
| Potassium chloride | 30mM |
| Sodium hydroxide (NaOH) | 22mM |
| Saftanting | 280nM |
The experimental results are shown in FIG. 4, and the results show that the Tth RecA (NEB M2402S) selected by the invention has good amplification effect.
Example 3 screening of Single chain binding proteins
The single-chain binding proteins screened were T4 Gene 32Protein (NEB M0300L), ET SSB (NEB M2401S), T4 gp32 Protein (intact genomics).
Selecting a sequence of the COVID-19 virus S protein gene as a target amplification region and an oligonucleotide sequence: 19-F and 19-R and multifunctional buffer, and reaction conditions were the same as in example 1.
TABLE 5
| Reaction system | System content |
| Tth RecA | 40uM |
| ATP-γ-S | 6mM |
| 19-F | 1uM |
| 19-R | 1uM |
| Single chain binding proteins | 10uM |
| Bst2.0 WarmStart DNA Polymerase | 10U |
| MgAc | 25mM |
| dNTPs | 4mM |
| Multifunctional buffer solution | 1X |
| COVID-19S gene plasmid | 100 copies |
| Total | 100uL |
The concentrations of the components of the multifunctional buffer solution of this example are shown in Table 6 below
TABLE 6
| Tris-HCl(pH8.0) | 22mM |
| Triton X-100 | 4％ |
| Tween20 | 4％ |
| Betaine | 140mM |
| BSA | 120ug/mL |
| SDS | 0.7％ |
| Ethanol | 0.5％ |
| Sodium chloride | 170mM |
| Potassium chloride | 70mM |
| Sodium hydroxide | 28mM |
| Saftanting | 320nM |
The experimental results are shown in FIG. 5, which illustrates that ET SSB (NEB M2401S) selected by the invention has good amplification effect.
Example 4:
selecting a sequence of the COVID-19 virus S protein gene as a target nucleic acid region as follows:
ACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTAC, shown in SEQ ID NO. 4.
The sequence of the oligonucleotide:
19-F:
ACCTTTCTTTTCCAATGTTACTTGGTTCCA, shown in SEQ ID NO. 5.
19-R:
GTAGTACCAAAAATCCAGCCTCTTATTATG, shown in SEQ ID NO. 6.
19s-Cas12b sgRNA sequence:
5'-GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACUCAGUGGAAGCAAAAUAAAC-3', shown in SEQ ID NO. 7.
Single-stranded reporter DNA:
56-FAM/TTATT/3BHQ1/, shown in SEQ ID NO. 8.
The concentrations of the components of the multifunctional buffer of this example are shown in Table 7
TABLE 7
| Tris-HCl(pH8.0) | |
| Triton X-100 | |
| 2 | |
| Tween20 | |
| 2％ | |
| Betaine | 120mM |
| BSA | 100ug/mL |
| SDS | 0.5％ |
| Ethanol | 0.3％ |
| Sodium chloride | 150mM |
| Potassium chloride | 50mM |
| Sodium hydroxide | 25mM |
| Saftanting | 300nM |
The COVID-19S gene pseudovirus is diluted to 100 copies, 10 copies and 1 copy for detection.
The reaction system is prepared as shown in Table 8:
TABLE 8
In Table 8, except for the multifunctional buffer, the remaining components were first frozen into dry powder,
the COVID-19S gene pseudovirus (Biotech, 2019-Ncov-S pseudovirus) was added to 100uL of a multifunctional buffer (prepared according to Table 7) at 0 copy (negative control), 1 copy, 10 copies, and 100 copies, and mixed well. The mixture was left at room temperature for 5 minutes.
The freeze-dried powder of other components in the reaction system of table 8 was dissolved with a multifunctional buffer containing pseudoviruses so that the concentrations of the components in the total reaction system are shown in table 8. Fully dissolving and mixing the components, and reacting the mixture in a water bath or a metal bath at 65 ℃ for 15 minutes. And detecting the fluorescence in the tube by using LED blue light or UV ultraviolet after the reaction is finished.
The results of the experiment are shown in FIG. 6, in which S0 was used as a negative control and no fluorescence development occurred. Fluorescence coloration appeared in S1, S2 and S3. The invention can be matched with multifunctional buffer solution to carry out extraction-free high-sensitivity detection on microorganisms such as viruses and the like or other cells.
Example 5:
selecting a sequence of the COVID-19 virus N protein gene as a target nucleic acid region as follows: ACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGT, shown in SEQ ID NO. 9.
The sequence of the oligonucleotide:
19-N-F:
TGAAAGATCTCAGTCCAAGATGGTATTTCT, shown in SEQ ID NO. 10.
19-N-R:
GGTGCCAATGTGATCTTTTGGTGTATTCA, shown in SEQ ID NO. 11.
19N-Cas12b sgRNA sequence:
5'-GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCACAAGUCCAGCUUCUGGCCCAG-3', see SEQ ID NO. 12.
Single-stranded reporter DNA:
(iii)/56-FAM/TTATT/3 BHQ1/, shown in SEQ ID NO. 13.
The concentrations of the components of the multifunctional buffer of this example are shown in Table 9
TABLE 9
The COVID-19N gene pseudovirus is diluted to 100 copies, 10 copies and 1 copy for detection.
The reaction system is shown in Table 10
Watch 10
In Table 10, except for the multifunctional buffer, the other components were first frozen into dry powder,
the COVID-19N gene pseudovirus (Biotech, 2019-Ncov-N pseudovirus) was added to 100uL of a multifunctional buffer (prepared in accordance with Table 9) at 0 copy (negative control), 1 copy, 10 copies, and 100 copies, and mixed well. The mixture was left at room temperature for 5 minutes.
The freeze-dried powders of other components in the reaction system of table 10 were dissolved with a multifunctional buffer containing pseudoviruses so that the concentrations of the components in the total reaction system are shown in table 10. Fully dissolving and mixing the components, and reacting the mixture in a water bath or a metal bath at 65 ℃ for 15 minutes. And detecting fluorescence in the tube by using LED blue light or UV after the reaction is finished.
The results of the experiment are shown in FIG. 7, in which S0 was used as a negative control and no fluorescence development occurred. Fluorescence coloration appeared in S1, S2 and S3. The invention can be matched with multifunctional buffer solution to carry out extraction-free high-sensitivity detection on microorganisms such as viruses and the like or other cells.
The multifunctional buffer solution and the detection reagent prepared within the content range of each component described in the claims or the specification of the invention and the reaction conditions can achieve better nucleic acid detection effect, and are not limited to the situations described in the examples.
Sequence listing
<110> same-year-old-Earth Biotechnology Co., Ltd, Hunan
<120> extraction-free nucleic acid detection method and kit
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 159
<212> DNA
<213> coronavirus (coronavirus)
<400> 1
acctttcttt tccaatgtta cttggttcca tgctatacat gtctctggga ccaatggtac 60
taagaggttt gataaccctg tcctaccatt taatgatggt gtttattttg cttccactga 120
gaagtctaac ataataagag gctggatttt tggtactac 159
<210> 2
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acctttcttt tccaatgtta cttggttcca 30
<210> 3
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gtagtaccaa aaatccagcc tcttattatg 30
<210> 4
<211> 159
<212> DNA
<213> coronavirus (coronavirus)
<400> 4
acctttcttt tccaatgtta cttggttcca tgctatacat gtctctggga ccaatggtac 60
taagaggttt gataaccctg tcctaccatt taatgatggt gtttattttg cttccactga 120
gaagtctaac ataataagag gctggatttt tggtactac 159
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
acctttcttt tccaatgtta cttggttcca 30
<210> 6
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gtagtaccaa aaatccagcc tcttattatg 30
<210> 7
<211> 111
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gucuagagga cagaauuuuu caacgggugu gccaauggcc acuuuccagg uggcaaagcc 60
cguugagcuu cucaaaucug agaaguggca cucaguggaa gcaaaauaaa c 111
<210> 8
<211> 5
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ttatt 5
<210> 9
<211> 356
<212> DNA
<213> coronavirus (coronavirus)
<400> 9
acaccaatag cagtccagat gaccaaattg gctactaccg aagagctacc agacgaattc 60
gtggtggtga cggtaaaatg aaagatctca gtccaagatg gtatttctac tacctaggaa 120
ctgggccaga agctggactt ccctatggtg ctaacaaaga cggcatcata tgggttgcaa 180
ctgagggagc cttgaataca ccaaaagatc acattggcac ccgcaatcct gctaacaatg 240
ctgcaatcgt gctacaactt cctcaaggaa caacattgcc aaaaggcttc tacgcagaag 300
ggagcagagg cggcagtcaa gcctcttctc gttcctcatc acgtagtcgc aacagt 356
<210> 10
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tgaaagatct cagtccaaga tggtatttct 30
<210> 11
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ggtgccaatg tgatcttttg gtgtattca 29
<210> 12
<211> 111
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gucuagagga cagaauuuuu caacgggugu gccaauggcc acuuuccagg uggcaaagcc 60
cguugagcuu cucaaaucug agaaguggca caaguccagc uucuggccca g 111
<210> 13
<211> 5
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ttatt 5
Claims (15)
1. An extraction-free nucleic acid detection method is characterized by comprising the following steps:
(1) the biological sample containing the nucleic acid to be detected is put into a multifunctional buffer solution for cracking, and the nucleic acid to be detected is released;
(2) adding the released multifunctional buffer solution containing the nucleic acid to be detected into a detection reagent to perform replication reaction of the nucleic acid to be detected;
(3) judging whether the sample contains nucleic acid to be detected according to the detection result after the reaction is finished;
the biological sample containing the nucleic acid to be detected is a virus;
the multifunctional buffer solution has the functions of cracking and inactivating biological samples, promoting the release of nucleic acid to be detected and serving as the buffer solution required by the replication and detection processes of the nucleic acid to be detected;
the detection reagent comprises various enzymes, primers and auxiliary factors required by the replication and amplification of nucleic acid to be detected; or also contains various accessory factors required by the detection of the nucleic acid replication amplification product to be detected;
each 100 mu L detection system contains the following multifunctional buffer solution: Tris-HCl 18mM-22mM pH8.0, triton X-100 2% -4%, Tween20 2% -4%, betaine 100mM-140mM, BSA 80ug/mL-120ug/mL, SDS 0.1% -0.7%, ethanol 0.1% -0.5%, sodium chloride 130mM-170mM, potassium chloride 30mM-70mM, sodium hydroxide 22mM-28mM, sanctine 280nM-320 nM.
2. The detection method according to claim 1, wherein the detection reagent comprises a thermostable recombinase capable of binding to an oligonucleotide primer, a specific primer, a thermostable strand-displacement DNA polymerase, and a thermostable single-stranded DNA binding protein.
3. The detection method according to claim 2, characterized in that the detection reagent contains the following components in each 100 μ L detection system: 1uM to 1mM of a thermostable recombinase capable of binding to the oligonucleotide primer, 100nM to 20uM specific primer, 0.5U to 50U of a thermostable strand displacement DNA polymerase, 1nM to 1mM of a thermostable single-stranded DNA binding protein.
4. The detection method according to claim 2, wherein the detection reagent further comprises: ATP-gamma-S, magnesium acetate and dNTP; if the target nucleic acid to be detected is RNA, reverse transcriptase and RNases inhibitor are also contained.
5. The detection method according to claim 1, wherein the various cofactors required for detection of the nucleic acid amplification product to be detected is CRISPR-Cas12b detection reporter system.
6. The detection method according to claim 5, wherein the CRISPR-Cas12b detection reporter system comprises: aap Cas12b, Aap Cas12b sgRNA, and single-stranded reporter DNA.
7. The assay of any one of claims 1-6, wherein the assay reagent is formulated as a lyophilized powder prior to use.
8. The detection method according to claim 7,
putting the biological sample in a multifunctional buffer solution, and heating for 2-30 min at 42-72 ℃; can crack the biological sample to release the nucleic acid to be detected;
adding the released multifunctional buffer solution containing the nucleic acid to be detected into the detection reagent, reacting for 2-30 min at 42-72 ℃, and judging whether the sample contains the nucleic acid to be detected.
9. An extraction-free nucleic acid detection kit, comprising: a multifunctional buffer solution and a detection reagent;
the multifunctional buffer solution has the functions of cracking and inactivating biological samples, promoting the release of nucleic acid to be detected and serving as the buffer solution required by the replication and detection processes of the nucleic acid to be detected; the detection reagent comprises various enzymes, primers and auxiliary factors required by the replication and amplification of nucleic acid to be detected; or also contains accessory factors required by the detection of the nucleic acid replication amplification product to be detected;
each 100 mu L detection system contains the following multifunctional buffer solution: 18mM-22mM Tris-HCl pH8.0, 2% -4% triton X-100, 2% -4% Tween20, 100mM-140mM betaine, 80ug/mL-120ug/mL BSA, 0.1% -0.7% SDS,0.1% -0.5% ethanol, 130mM-170mM sodium chloride, 30mM-70mM potassium chloride, 22mM-28mM sodium hydroxide, 280nM-320nM sanskatortine.
10. The detection kit of claim 9, wherein the detection reagent comprises a thermostable recombinase capable of binding to an oligonucleotide primer, a specific primer, a thermostable strand-displacement DNA polymerase, and a thermostable single-stranded DNA binding protein.
11. The detection kit according to claim 10, wherein when the kit is used, the detection reagent comprises the following components in each 100 μ L detection system: 1uM to 1mM of a thermostable recombinase capable of binding to the oligonucleotide primer, 100nM to 20uM specific primer, 0.5U to 50U of a thermostable strand displacement DNA polymerase, 1nM to 1mM of a thermostable single-stranded DNA binding protein.
12. The test kit of claim 10, wherein the test reagents further comprise: ATP-gamma-S, magnesium acetate and dNTP; if the target nucleic acid to be detected is RNA, reverse transcriptase and RNases inhibitor are also contained.
13. The detection kit according to claim 9, wherein the various accessory factors required for detection of the nucleic acid amplification product to be detected are CRISPR-Cas12b detection reporter system.
14. The detection kit according to claim 13, wherein the CRISPR-Cas12b detection reporter system comprises: aap Cas12b, Aap Cas12b sgRNA, and single-stranded reporter DNA.
15. The detection kit according to any one of claims 9 to 14, wherein the detection reagent is lyophilized powder.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011236028.7A CN112280832B (en) | 2020-11-09 | 2020-11-09 | Extraction-free nucleic acid detection method and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011236028.7A CN112280832B (en) | 2020-11-09 | 2020-11-09 | Extraction-free nucleic acid detection method and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112280832A CN112280832A (en) | 2021-01-29 |
| CN112280832B true CN112280832B (en) | 2022-06-24 |
Family
ID=74351746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011236028.7A Active CN112280832B (en) | 2020-11-09 | 2020-11-09 | Extraction-free nucleic acid detection method and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112280832B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005226A (en) * | 2021-02-07 | 2021-06-22 | 利多(香港)有限公司 | Oligonucleotide and kit for detecting SARS-CoV-2 |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100475976C (en) * | 2006-08-18 | 2009-04-08 | 上海科华生物工程股份有限公司 | Reagent kit for inspecting hepatitis and AIDS virus nucleic acid by synchronous amplification |
| EP3402880B1 (en) * | 2016-01-15 | 2024-01-03 | Thermo Fisher Scientific Baltics UAB | Thermophilic dna polymerase mutants |
| CN107354221A (en) * | 2017-08-28 | 2017-11-17 | 合肥千麦医学检验所有限公司 | The PCR detection kit of Ye Shi lung pityrosporion ovales |
| CN107475252B (en) * | 2017-10-09 | 2020-08-14 | 湖南大地同年生物科技有限公司 | Nucleic acid releasing agent, method for rapidly releasing nucleic acid and application thereof |
| CN110029102A (en) * | 2019-04-21 | 2019-07-19 | 湖南大地同年生物科技有限公司 | A kind of fecal cast-off cell and its nucleic acid preservation reagent and its preparation and application |
-
2020
- 2020-11-09 CN CN202011236028.7A patent/CN112280832B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112280832A (en) | 2021-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109055499B (en) | Isothermal nucleic acid detection method and kit based on CRISPR-Cas | |
| CN112094888B (en) | Multifunctional buffer solution and application thereof | |
| JP2023537096A (en) | NUCLEIC ACID DETECTION KIT, METHOD AND APPLICATION THEREOF | |
| WO2023246032A1 (en) | One-pot single-stranded dna cyclization and amplification and crispr/cas-mediated nucleic acid molecule detection method | |
| WO2023274330A1 (en) | Method for isothermal amplification of nucleic acid target sequences | |
| CN112322705A (en) | Isothermal amplification fluorescence RMA method for multiple nucleic acid detection | |
| CN102399866A (en) | Generic buffer for amplification | |
| CN112280832B (en) | Extraction-free nucleic acid detection method and kit | |
| WO2016106113A1 (en) | Methods and reagents for reverse-transcription polymerase chain reaction | |
| WO2016106111A1 (en) | Methods and reagents for reverse-transcription polymerase chain reaction | |
| US10822645B1 (en) | Methods and reagents for reverse-transcription polymerase chain reaction | |
| JP5470400B2 (en) | Method for specific detection of low-volume RNA species in biological samples | |
| CN111394518A (en) | Method and kit for in-vitro amplification detection of new coronavirus nucleic acid | |
| EP2625285B1 (en) | Method for cell lysis and pcr within the same reaction vessel | |
| CN116083575A (en) | Kit for detecting cervical cancer and application thereof | |
| Wang et al. | Application of CRISPR/Cas12a in the rapid detection of pathogens | |
| JP5798631B2 (en) | Method for cell lysis in RT-PCR reaction buffer | |
| JP6174999B2 (en) | Method for cell lysis in PCR reaction buffer | |
| CN111154836A (en) | Targeted nucleic acid capture and detection methods | |
| WO2023246033A1 (en) | One-pot rolling circle transcription and crispr/cas-mediated nucleic acid detection method and kit | |
| US20220195541A1 (en) | Detecting a target nucleic acid in a biological sample | |
| JP5077813B2 (en) | Nucleic acid amplification method | |
| CN112899377A (en) | Kit with chlamydia trachomatis infection diagnosis and/or prognosis evaluation function | |
| KR20230071480A (en) | Methods for detecting target nucleic acids | |
| CN115418390A (en) | Application of betaine in improving in vitro transcription efficiency of DNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |