WO2023274330A1

WO2023274330A1 - Method for isothermal amplification of nucleic acid target sequences

Info

Publication number: WO2023274330A1
Application number: PCT/CN2022/102545
Authority: WO
Inventors: 李春燕; 朱兆奎; 昃白尘
Original assignee: 上海伯杰医疗科技股份有限公司北京分公司; 上海伯杰医疗科技股份有限公司
Priority date: 2021-06-30
Filing date: 2022-06-29
Publication date: 2023-01-05
Also published as: CN113481283A; AU2022301095A1; BR112023027256A2; CN115074419A

Abstract

The present invention provides a method for isothermal amplification of nucleic acid target sequences. The method is suitable for double-stranded DNA, single-stranded DNA, and single-stranded RNA, and comprises a combined reaction of nickase and strand displacement enzyme. In double-stranded DNA and single-stranded DNA detection, three primers and one probe are used, and in single-stranded RNA detection, three primers and one probe may be used, or two primers and one probe may be used. The probe is a molecular beacon, which does not degrade during an amplification process and is only used for specifically binding to a target fragment to provide a fluorescent signal to ensure the specificity of the reaction. In the present invention, the beacon probe that does not overlap with the primers in a binding region on a target sequence is used to determine the result in real time; the beacon probe has high specificity in binding to the target sequence; and it is unnecessary to open a tube after the reaction to further prevent generation of false positives. The reaction is carried out at a constant temperature and consumes short time, and the detection can be completed within 8 minutes, which is more in line with POCT detection requirements.

Description

Method for isothermal amplification of nucleic acid target sequences

technical field

The invention belongs to the technical field of nucleic acid detection, in particular to a method for isothermally amplifying a nucleic acid target sequence.

Background technique

Polymerase chain reaction (Polymerase chain reaction, PCR) is currently the most widely used nucleic acid amplification detection technology (Nucleic Acid Amplification Test, NAAT). The classic reaction of this technology includes three steps of denaturation, renaturation, and extension. It is a process that requires rapid temperature cycling. It requires a specific thermal cycler for high-precision temperature control and consumes a lot of power. At the same time, the reaction time is long, which cannot meet the requirements of point-of-care detection (POCT). Although there are products that complete the reaction in 15-30 minutes in recent years, these products rely on extremely complicated industrial designs, and the cost is too high.

In order to solve many problems caused by PCR technology, a series of isothermal amplification technologies have emerged. The more common techniques are recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), nick and extension amplification (NEAR), and transcription amplification. mediation technology (TMA), etc.

RPA technology relies on three enzymes: recombinases that bind single-stranded nucleic acids, single-stranded DNA-binding proteins, and strand-displacing DNA polymerases. The complementary sequence of single-stranded nucleic acid is recognized by recombinase, and they are combined, and the binding region is stabilized by single-strand binding protein, and the strand displaces DNA polymerase for extension. The reaction is generally carried out at 37-42°C for 15-30 minutes, and special probes can be added to judge the result. RPA involves many components, and the cost of reagents is too high.

LAMP uses strand displacement enzymes to complete the reaction. By designing 4 or 6 primers and forming stem-loop products, under the action of strand displacement enzymes, the reaction is continuously initiated at the stem-loop. This technique takes 30-45 minutes to complete, and dyes are generally used for the judgment of the end point. LAMP reagents are cheap, but the results of using dyes are low, false positives are prone to occur, and primer design is difficult.

SDA uses specially modified nucleotides, endonucleases, and strand-displacing DNA polymerases, and requires 4 primers. Use the melting primer and the amplification primer to react with the template to generate a product with enzyme cleavage sites at both ends, because the end with modified nucleotides cannot be cut by the endonuclease, the product, under the action of the endonuclease, A nick is generated, and displacement extension is performed under strand-displacing DNA polymerase to form an exponential amplification. In the double-stranded DNA template, it is necessary to perform high-temperature melting and primer annealing first, and then add enzymes for the reaction. The reaction time is generally 30-60min.

NEAR is similar to SDA in that it uses nickase and strand displacement and requires only 2 primers. The distance between the two primers (3' ends) is 1-5 bases, through the effect of primer invasion, a product with nickase sites at both ends is formed, and the product is in the nickase and strand displacement DNA polymerase Under the effect of exponential amplification. Products can be analyzed by probes and dyes. Many products of this technology have been launched on the market. In the detection of new coronavirus nucleic acid, there have been reports of low sensitivity. Because the distance between the primers is too short, when the probe is used for real-time detection, false positives are prone to occur due to the homologous position between the primer and the probe. The reaction time is about 12 minutes.

Transcription amplification-mediated technology (TMA) reacts through reverse transcriptase and RNA polymerase, and the main product is RNA. The reaction time is 15-60min.

CN104726549A discloses a new method for detection of double-strand isothermal amplification based on nickase. The method uses three primers, one of which can be designed as a beacon probe, and the product is obtained by dye method, fluorescence method, electrochemical method, etc. method, colorimetric method, and chemical reflection method for analysis, and the detection time is 30-60min. Using methods other than the fluorescent method can easily lead to false positives, and the patent labels the primers so that the reaction cannot be carried out correctly. At the same time, the non-specific reaction of the labeled primers will bring false positive results. Due to factors such as too long reaction time and unreasonable product analysis, there is currently no product on the market.

Contents of the invention

The purpose of the invention is to solve the existing technical problems of long detection time and poor specificity.

In order to achieve the above object, in a first aspect, the present invention provides a method for isothermally amplifying a nucleic acid target sequence, comprising the steps of:

1, initial product formation comprises the following steps:

A1. When the single-stranded target is single-stranded DNA, the amplification primer P1 and the displacement primer are complementary combined with the single-stranded target, and the amplification primer P1 is extended along the single-stranded target under the action of DNA polymerase replacing the amplification product of the amplification primer P1 with the replacement primer; using the product formed by the extension of the replaced amplification primer P1 as a single-stranded template;

A2. When the single-stranded target is a single-stranded RNA, the single-stranded template can be obtained by reacting in two ways:

(1) If the DNA polymerase has both polymerase function, strand displacement function and reverse transcription function, the amplification primer P1, displacement primer and DNA polymerase are contacted with single-stranded RNA, and the single-stranded RNA is Reverse transcribe into cDNA under the action of enzymatic reverse transcription activity, and be replaced by a displacement primer to obtain a single-stranded template;

(2) If the DNA polymerase does not have the reverse transcription function, it is necessary to add a reverse transcriptase with RNase H activity, and contact the amplification primer P1 and the reverse transcriptase with the single-stranded RNA, and the single-stranded RNA Under the action of reverse transcriptase, it is reverse-transcribed into cDNA to form a cDNA-RNA composite double-stranded product, and the RNA strand in the composite double-stranded product is hydrolyzed by the RNase H activity of reverse transcriptase to obtain a single-stranded template.

B. The amplification primer P2 is complementary to the single-stranded template formed in step A, and the amplification primer P2 is extended along the single-stranded template under the action of DNA polymerase, and then the nicking enzyme acts on the extension product to extend at the nick and replacement to form a double-stranded initial product with one enzyme cleavage site at each end;

II, the exponential amplification signal collection comprises the following steps:

C. Contacting a nicking enzyme and a DNA polymerase with a double-stranded template, the double-stranded template generates a double-stranded nicking site under the action of the nicking enzyme, and the DNA polymerase amplifies and displaces from the nicking site to obtain a Increase the single strand complementary to primer P1 or P2;

D. Complementary binding of amplification primer P1 or P2 to the single strand formed in step C, and extension under the action of DNA polymerase to form two double strand products each with one restriction site;

E. Contacting the nicking enzyme and the DNA polymerase with the two double-stranded products produced in step D, the two double-stranded products form nicks respectively under the action of the nicking enzyme, and the DNA polymerase amplifies from the nicking site and Replacement to obtain two single strands that can be complementary to the amplification primer P1 or P2 respectively; the single strand is then contacted with the amplification primer P1 or P2, and extended under the action of DNA polymerase to form a double-stranded product;

F. Repeat step E to obtain the amplification product exponentially;

Wherein, the above steps are carried out under isothermal conditions, and there is no need to denature the target sequence before amplification;

Steps C to F also include complementary binding of the amplification system to molecular beacon probes to provide fluorescent signals;

The amplification primers P1 and P2, along the 5'-3' direction, sequentially include a stable region, a nickase recognition site region and a base region complementary to the target sequence; wherein the length of the stable region is 6-20bp ;

The displacement primer is fully complementary to the target sequence;

The molecular beacon probe is complementary to the target sequence or hybridizable to the target sequence, and the molecular beacon probe does not overlap with the binding regions of the amplification primers P1 and P2 on the target sequence;

When the single-stranded target is single-stranded DNA, the single-stranded target can be single-stranded DNA and the double-stranded DNA is contacted with the double-stranded DNA through a nickase and a DNA polymerase, and a nick is generated under the action of the nickase, and the DNA polymerizes The enzyme amplifies and displaces the resulting single-stranded product from the nick;

The DNA polymerase has a strand displacement function;

The methods are for non-disease diagnosis purposes.

Preferably, the positions of the base regions complementary to the target sequence on the amplification primers P1 and P2 are modified, and the modification methods include locked nucleic acid modification and methylation modification;

The distance between the 3' terminal bases of the amplification primers P1 and P2 on the target sequence is not less than 10 bp.

Molecular beacons may contain conventional synthetic modifications similar to the primers described above.

Preferably, the length of the molecular beacon is 13-80bp, and the binding position of the molecular beacon to the target sequence is not less than 12bp near the 5' end and 3'.

Preferably, the length of the amplification primer is between 17-40bp, the replacement primer is between 10-30bp, the GC% content is between 20-80%, the probe length is between 20-40bp, and the GC% content is 10% Between -80%.

The method for isothermally amplifying nucleic acid target sequences provided by the present invention is closed-tube real-time fluorescence detection. After the sample nucleic acid is loaded, the reaction is carried out on the machine, and there is no tube opening process in the middle, which avoids the possibility of product contamination caused by opening the cap.

Preferably, the single-stranded target is 30-100 bases in length;

The amplification is implemented between 37°C-70°C;

The entire reaction time is 1-10 minutes. Preferably, the reaction time of the method is no more than 8 minutes. Positive and negative results can be obtained within 8 minutes. When there is a high concentration of positive target sequences in the sample, a positive result can be obtained within 1-2 minutes.

Preferably, the nickase is selected from Nt.AlwI, Nb.BbvCI, Nt.BbvCI, Nb.BsrDI, Nb.BsmI, Nt.BsmAI, Nt.BspQI, Nt.BstNBI, Nb.BtsI, Nt.CviPII at least one.

Preferably, the DNA polymerase is selected from one of Bst DNA polymerase, Bsu DNA polymerase, phi29 DNA polymerase.

Preferably, the DNA polymerase is Bst 2.0 or Bst3.0.

Preferably, one end of the molecular beacon probe is a fluorescent group, the other end is a fluorescent quenching group, and the 5' end and 3' end of the probe are partially complementary in sequence, forming a stem-loop structure.

Preferably, the amplification reaction system includes Tris HCl buffer, BSA, NaCl, KCl, dNTP, Mg2+, (NH4)2SO4 and additives.

Preferably, the additive includes at least one of trehalose, betaine, dimethyl sulfoxide, gelatin, Tween 20, Triton-x100, and NP-40.

In the second aspect, the present invention provides a kit for realizing the method, which at least includes the amplification primers P1 and P2, displacement primers, molecular beacon probes and amplification reaction system in the above-mentioned method.

Compared with the prior art, the method for isothermally amplifying a nucleic acid target sequence provided by the invention has the following beneficial effects:

1. The novel method for rapid isothermal amplification and nucleic acid detection provided by the present invention. This method is applicable to double-stranded DNA, single-stranded DNA, and single-stranded RNA, including the joint reaction of nickase and strand displacement enzyme. When detecting double-stranded DNA and single-stranded DNA, three primers and one probe are used, while When performing single-stranded RNA detection, it can be 3 primers and 1 probe, or 2 primers and 1 probe. The probe is a molecular beacon, which does not degrade during the amplification process and is only used to specifically bind the target fragment to provide a fluorescent signal and ensure the specificity of the reaction.

2. The entire reaction process of the present invention is carried out under isothermal conditions, and there is no need to denature the target sequence before amplification, which is easier to operate than variable temperature nucleic acid amplification detection technology.

3. Both the upstream and downstream amplification primers of the present invention introduce the nucleic acid sequence of the nicking enzyme recognition site, and the 5' and 3' ends of the double-stranded initial product that can be obtained have a nicking enzyme cleavage recognition site, which can effectively improve The reaction efficiency of the subsequent exponential amplification stage can complete the reaction in a shorter time; and the present invention uses locked nucleic acid to modify the primer, so that the efficiency and stability of primer and template binding are better than conventional primers; at the same time, the reaction system increases the reaction efficiency The additives and the upgraded version of DNA polymerase with strand displacement activity further improve the reaction efficiency of the reaction system, making the reaction time shorter, and the reaction is completed within 8 minutes, while the general isothermal amplification reaction takes more than 30-60 minutes. The present invention is more in line with the POCT detection requirement.

4. The present invention uses a beacon probe that does not overlap with the primer binding region on the target sequence to judge the result in real time. The beacon probe has strong specificity in binding to the target sequence, and avoids the use of dye method or electrochemical method False positives caused by other protocols; at the same time, the tube is not opened after the reaction to further avoid false positives caused by product contamination.

Description of drawings

Fig. 1 is a schematic diagram of detecting double-stranded DNA in a preferred embodiment of the present invention.

Fig. 2 is a schematic diagram of initial template formation when detecting single-stranded DNA and single-stranded RNA in a preferred embodiment of the present invention.

Fig. 3 is a schematic diagram of initial template formation when detecting single-stranded RNA in a preferred embodiment of the present invention.

Fig. 4 is a diagram showing the amplification effect of a plasmid carrying human gene PSMB2 in a preferred embodiment of the present invention.

Fig. 5 is a diagram showing the effect of amplification of samples for detecting Mycoplasma pneumoniae in a preferred embodiment of the present invention.

Fig. 6 is a diagram showing the amplification effect of detecting influenza B samples in a preferred embodiment of the present invention.

Fig. 7 is a diagram showing the amplification effect of detecting parvovirus in a preferred embodiment of the present invention.

Fig. 8 is a schematic diagram of the strand displacement amplification of the sample itself in a preferred embodiment of the present invention.

Fig. 9 is a graph showing the amplification effect of the sample self-strand displacement amplification reaction in a preferred embodiment of the present invention.

detailed description

In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the accompanying drawings, in which several embodiments of the present invention are shown, however, the present invention can be realized in many different forms and is not limited herein The described embodiments are, on the contrary, provided so that the disclosure of the invention will be thorough.

The invention provided by the invention provides a new method for rapid isothermal amplification and detection of double-stranded DNA, single-stranded DNA and single-stranded RNA. Including the following steps:

The reaction includes an initial product generation stage (double-stranded initial product formation stage) and an exponential amplification signal acquisition stage.

1. In the initial product generation stage, there are slight differences depending on the template and the enzyme system used:

a) When the template is double-stranded DNA, the nickase acts on the nickase cut site on the double-stranded DNA template to form a nick, and the strand displacement enzyme (DNA polymerase with strand displacement function) proceeds from the nick to extend and Strand displacement, forming a single-stranded product, the primer with a single-strand enzyme cleavage site (F/R, that is, the amplification primer P1) and the displacement primer (B) are combined on the single-stranded product, and through extension and strand displacement, an enzyme-containing The single-stranded product of the cleavage site, another primer (R/F, amplification primer P2) with a single-stranded restriction site binds to and extends the single-stranded product, and then undergoes restriction digestion and strand displacement to form an initial The product is a double-stranded initial product with two restriction sites at both ends (Figure 1).

b) When the template is single-stranded DNA, the primer (F/R) and the displacement primer (B) with a single-stranded restriction site bind to the single-stranded product, and the initial product is formed through the same process as above (Figure 2) .

c) When the template is single-stranded RNA, there are 2 different ways to form the initial template. In the first type, when using a reverse transcriptase with RNase H activity, the primer (B) does not need to be replaced, as shown in Figure 3, through reverse transcription and RNase H, a single strand with an enzyme cleavage site is formed, and the subsequent The reaction is the same as above; the second one uses reverse transcriptase (such as Bst 3.0) to generate a single strand with a restriction site through reverse transcription and strand displacement, and the process is similar to a single-stranded DNA template.

2. During the signal acquisition stage of exponential amplification, the nicking enzyme creates nicks on the initial product to form two double-stranded DNAs with enzyme cleavage sites on one side, as shown in the "exponential amplification" area of Figure 4, the first product Under the action of nickase and amplification enzyme, a single-stranded product can be generated, and the product can be further combined with the amplification primer and extended to form the second product; conversely, the second product can also generate the first product, and the two form exponential expansion. Molecular beacon probes can be combined with one of the single-stranded products, and a suitable fluorescent detection system can collect the amplification signal.

This method uses 2 amplification primers, 1 displacement primer and 1 molecular beacon probe when detecting double-stranded DNA, single-stranded DNA and single-stranded RNA; it can also be 2 amplification primers when detecting single-stranded RNA Primers and 1 molecular beacon probe.

The length of the molecular beacon is 13-80bp, and the binding position of the molecular beacon and the target sequence is not less than 12bp near the 5' end and 3'.

The amplification enzyme used in the present invention has the function of synthesizing DNA with DNA as a template, and at the same time has the function of strand displacement, and some types of amplification enzymes also have the function of reverse transcription into DNA with RNA as a template.

The length of the specific region of the initial product (not counting sequences such as restriction sites introduced by primer amplification) is between 30-100 bp.

When the molecular signal probe binds to the single-stranded product, it does not overlap with the binding region of the amplification primer on the single-stranded product. The distance between the 3' terminal bases of the amplification primers P1 and P2 on the target sequence is not less than 10 bp. When designing primers and probes, ensure sufficient specific positions for the probe to bind to the target sequence, and there is no base overlap between the probe and the amplification primer on the target sequence.

The temperature is constant during the reaction, and the reaction can be completed within 8 minutes.

The present invention uses 3 primers and 1 beacon probe (when detecting single-stranded RNA, it can be 2 primers and 1 probe), nickase and strand displacement DNA polymerase, and can complete nucleic acid amplification within 8 minutes and real-time fluorescence detection of the product.

The method is isothermal amplification, the temperature in the reaction is constant, and the reaction temperature is between 37-70°C.

The reaction time of the method does not exceed 8 minutes, positive and negative results are obtained within 8 minutes, and positive results can be obtained within 1-2 minutes when there is a high concentration of positive target sequences in the sample. The method is closed-tube real-time fluorescence detection. After adding the sample nucleic acid, the reaction is carried out on the machine, and there is no process of opening the tube in the middle.

The primer is a single-stranded nucleotide polymer, and if necessary, the primer may contain conventional synthetic modifications such as locked nucleic acid (LNA) and methylation. Among the 3 primers, 1 is a strand displacement primer, and 2 are amplification primers. The strand displacement primer is completely complementary to the template, and the amplification primer contains 3 regions, which are the specific binding region, the enzyme cleavage site region and the stable region. .

The beacon probe refers to a single-stranded nucleotide polymer modified with a fluorescent group and a quencher group, and artificial sequences at the 5' and 3' ends are complementary to form a stem-loop structure. If necessary, routine synthetic modifications similar to those described above for the primers may be included, as well as spacer modifications at the 5' and 3' ends to increase their length. Beacon probes and primers have no overlapping parts on the target sequence, ensuring their specificity.

The nickase is a kind of special enzyme that recognizes the specific sequence of double-stranded DNA and forms a nick thereon, such as Nt.AlwI, Nb.BbvCI, Nt.BbvCI, Nb.BsrDI, Nb.BsmI, Nt.BsmAI, Nt. BspQI, Nt.BstNBI, Nb.BtsI, Nt.CviPII or other enzymes having the same function.

The strand-displacing DNA polymerase is a kind of polymerase that has the activity of polymerizing at the 3' terminal of nucleic acid and also has the function of displacing nucleic acid in the direction of polymerization. Such as Bst DNA polymerase (including Bst 2.0, Bst3.0 and other upgraded products), Bst DNA polymerase large fragment, Bsu DNA polymerase, Bsu DNA polymerase large fragment, phi29 DNA polymerase, etc.

In addition to the above-mentioned primers, probes, and enzymes, the method also includes various substances used in common nucleic acid amplification reactions, such as Tris HCl buffer, BSA, NaCl, KCl, dNTP, Mg2+, (NH4)2SO4 and other reactions Commonly used buffers and ionic components, as well as additives such as trehalose, betaine, dimethyl sulfoxide, gelatin, Tween 20, Triton-x100, NP-40, etc.

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. If not specified, the examples are all in accordance with conventional experimental conditions, such as Sambrook and other molecular cloning experiment manuals (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or in accordance with the conditions suggested by the manufacturer's instructions.

Example 1 The detection comparison of the plasmid carrying the human gene PSMB2

Experimental group (the present invention): using upgraded DNA polymerase, primers to introduce locked nucleic acid markers, reaction system adding reaction enhancer and control group: using low-level version of DNA polymerase, primers not locked nucleic acid markers, reaction system without adding reaction Enhancers were compared for reaction times.

The composition of the amplification reaction system of the present invention and the control group, additives and the modified situation of the primers used are as follows in Table 1:

Table 1

(1) The primer probe sequence of the present invention:

The primer probe sequence (5'-3') is as follows:

PSMB2-B (primer): CCCAGCACTTT

PSMB2-F (primer): TTCAGACTATTGAGTCTATTCTGACCA A CAT

PSMB2-R (primer): GTCAGACTATTGAGTCTTCTCCCAGCT A AT

PSMB2-P (probe): ATGGTAGTAGAGACGGGGTTTTTACCAT

Note: " A " is modified with LNA.

(2) Unmodified primer probes are as follows:

The primer probe sequence (5'-3') is as follows:

PSMB2-B (primer): CCCAGCACTTT

PSMB2-F (primer): TTCAGACTATTGAGTCTATTCTGACCAACAT

PSMB2-R (primer): GTCAGACTATTGAGTCTTCTCCCAGCTAAT

PSMB2-P (probe): ATGGTAGTAGAGACGGGGTTTTTACCAT

All reactions were carried out at 55°C, and the signal was collected every 10 s. The instrument was LightCycler480II. The samples of plasmids 1E5, 1E4, 1E3, 1E2, and 1E1 were detected, and the results of each group are shown in Table 1, and the graph of the detection results of the present invention is shown in FIG. 4 . Table 2 Comparison results of the detection of plasmids carrying the human gene PSMB2.

组别group	本发明this invention	对照组1Control group 1	对照组2Control group 2	对照组3Control group 3	对照组4Control group 4
检测时间detection time	2.5-4min2.5-4min	5-9min5-9min	5.5-9min5.5-9min	7-10min7-10min	9-12min9-12min

Table 2

It can be seen that the detection time of the present invention is significantly earlier than that of the control groups, indicating that the present invention has a better time advantage in the application of double-stranded DNA nucleic acid detection.

Example 2 Mycoplasma pneumoniae clinical sample detection comparison

Experimental group (the present invention): using upgraded DNA polymerase, primers for nucleic acid-locking labeling, reaction system adding reaction enhancer and control group: using low-level version of DNA polymerase, primers for nucleic acid-locking labeling, no reaction added to the reaction system Enhancers were compared for reaction times.

The composition of the amplification reaction system of the present invention and the control group, the additives and the modified conditions of the primers used are as follows in Table 3:

table 3

(1) The primer probe sequence of the present invention:

The primer probe sequence (5'-3') is as follows:

Mp-B (primer): CTCTCCACTAA

Mp-F (primer): CATAGACTTATGAGTCTTCT A TTCGCTTC

Mp-R (primer): GTTAGACTTTTGAGTCTTCTTGCTCTGGT

Mp-P (probe): CGCAGCTGGTTACGGGAATACTGCG

Note: " A " is modified with LNA.

(2) The sequence of the unlabeled primer probe is as follows:

The primer probe sequence (5'-3') is as follows:

Mp-B (primer): CTCTCCACTAA

Mp-F (primer): CATAGACTTATGAGTCTTCTATTCGCTTC

Mp-R (primer): GTTAGACTTTTGAGTCTTCTTGCTCTGGT

Mp-P (probe): CGCAGCTGGTTACGGGAATACTGCG

All reactions were carried out at 55°C, and the signal was collected every 10 s. The instrument was LightCycler480II. Detected 8 lung branch samples, and 8 other respiratory pathogens: influenza A virus, influenza B virus, Chlamydia pneumoniae, respiratory syncytial virus, human parvovirus B19, Staphylococcus aureus, human respiratory adenovirus, rhinovirus, The results of each group are shown in Table 4, and the graph of the detection results of the present invention is shown in Figure 5. The following table shows the comparison results of the detection of Mycoplasma pneumoniae.

组别group	本发明this invention	对照组1Control group 1	对照组2Control group 2	对照组3Control group 3	对照组4Control group 4
检测时间detection time	3-7min3-7min	10-15min10-15min	14-19min14-19min	15-19min15-19min	18-22min18-22min
检测非特异性Detection of non-specific	0/80/8	2/82/8	0/80/8	1/81/8	2/82/8

Table 4

It can be seen that the present invention has obvious advantages in the detection time and detection specificity of double-stranded DNA nucleic acid.

Example 3 Influenza B virus (single-stranded RNA virus) clinical sample detection comparison

Experimental group (the present invention): using upgraded DNA polymerase, primers to introduce locked nucleic acid markers, adding reaction enhancer to the reaction system and control group: using a low-level version of DNA polymerase, primers for locked nucleic acid markers, no reaction added to the reaction system Enhancers were compared for reaction times.

The composition of the amplification reaction system of the present invention and the control group, the additives and the modification of the primers used are as follows in Table 5:

table 5

(1) The primer probe sequence of the present invention:

The primer probe sequence (5'-3') is as follows:

FluB-B (primer): TGTTGCTAAACT

FluB-F (primer): CTACTGATGAGTCTTTTTAGTGGAGG A T

FluB-R (primer): CCTTCATTGAGTCTTTTGAAG A GTGA

FluB-P (probe): ACGGCCATCGGATCCTCAAGCCGT

Note: " A " is modified with LNA.

(1) The sequence of the unlabeled primer probe is as follows:

The primer probe sequence (5'-3') is as follows:

FluB-B (primer): TGTTGCTAAACT

FluB-F (primer): CTACTGATGAGTCTTTTTAGTGGAGGAT

FluB-R (primer): CCTTCATTGAGTCTTTTGAAGAGTGA

FluB-P (probe): ACGGCCATCGGATCCTCAAGCCGT

All reactions were carried out at 55°C, and the signal was collected every 10 s. The instrument was LightCycler 480II. Detected 8 clinical samples of influenza B virus, and 8 other respiratory pathogens: influenza A virus, Mycoplasma pneumoniae, Chlamydia pneumoniae, respiratory syncytial virus, human parvovirus B19, Staphylococcus aureus, human respiratory adenovirus, rhinovirus To verify the specificity of the reaction system, the results of each group are shown in Table 3, and the graph of the detection results of the present invention is shown in Figure 6.

It can be seen that the present invention has obvious advantages in detection time and detection specificity of single-stranded RNA nucleic acid. Table 6 is the detection and comparison results of influenza B virus.

组别group	本发明this invention	对照组1Control group 1	对照组2Control group 2	对照组3Control group 3	对照组4Control group 4
检测时间detection time	3-5min3-5min	7-10min7-10min	9-13min9-13min	11-15min11-15min	20-24min20-24min
检测非特异性Detection of non-specific	0/80/8	1/81/8	0/80/8	1/81/8	2/82/8

Table 6

Example 4 Parvovirus Detection Comparison

The composition of the amplification reaction system of the present invention and the control group, the additives and the modified conditions of the primers used are as follows in Table 7:

Table 7

(1) The primer probe sequence of the present invention:

CVP-F (primer): GAACTTTTGAGTCTTTTACTATAC A CATC

CVP-R (primer): GAACTTTTGAGTCTTTTTCCCAGTTTTC A T

CVP-B (primer): AGTCTTTGCAACCT

CVP-P (probe): CGCCAGGAAAAGTACCAGAATGGCG

Note: " A " is modified with LNA.

(2) The sequence of the unlabeled primer probe is as follows:

CVP-F (primer): GAACTTTTGAGTCTTTTACTATAC A CATC

CVP-R (primer): GAACTTTTGAGTCTTTTTCCCAGTTTTC A T

CVP-B (primer): AGTCTTTGCAACCT

CVP-P (probe): CGCCAGGAAAAGTACCAGAATGGCG

All reactions were carried out at 55°C, and the signal was collected every 10 s. The instrument was LightCycler480II. Detect 5 samples of parvovirus, and 8 other respiratory pathogens: Influenza A virus, Mycoplasma pneumoniae, Chlamydia pneumoniae, Respiratory syncytial virus, Human parvovirus B19, Staphylococcus aureus, Human respiratory adenovirus, Rhinovirus, each The group results are shown in Table 4, and the curve diagram of the detection results of the present invention is shown in Figure 7.

It can be seen that the present invention has obvious advantages in detection time and detection specificity of single-stranded DNA nucleic acid. The following table 8 is the detection and comparison results of canine parvovirus.

组别group	本发明this invention	对照组1Control group 1	对照组2Control group 2	对照组3Control group 3	对照组4Control group 4
检测时间detection time	3.5-5min3.5-5min	8-12min8-12min	9-15min9-15min	13-17min13-17min	15-22min15-22min
检测非特异性Detection of non-specific	0/80/8	2/82/8	0/80/8	2/82/8	3/83/8

Table 8

Example 5 Strand displacement amplification of the sample itself

When strand displacement enzymes and nickases are used for sample amplification, the sample itself will undergo strand displacement amplification due to the large number of enzyme cleavage points on the sample. This process is similar to multiple displacement amplification. The principle is shown in the figure 8. Just don't need the participation of primer probe. An example response is as follows:

Prepare the following reaction system:

Tris-HCl pH8.0, 50mM

(NH4)2SO4, 20mM

MgCl2, 8mM

NaCl, 30mM

KCl, 10mM

dNTPs, 1 mM

Evagreen 1×

Nt.BstNBI, 3U

Bst 3.0, 6U

The reaction was carried out at 55°C, and the signal was collected every 1 min for a total of 60 cycles. The instrument was LightCycler 480II. The samples were nucleic acid stock solution extracted from throat swabs, 10 times and 100 dilutions of the stock solution, and each was repeated twice. The results are shown in Figure 9, the nucleic acid sample extracted from the throat swab showed an amplification signal in about 12 minutes. When strand displacement enzyme and nickase are used for amplification, self-amplification of the sample is inevitable. When CN104726549A uses the dye method to judge the result, when the reaction is carried out for 30-60 minutes, the occurrence of this false positive phenomenon cannot be avoided. The above-described embodiment only expresses a certain implementation mode of the present invention, and its description is relatively specific and detailed, but it should not be interpreted as limiting the patent scope of the present invention; it should be pointed out that for those of ordinary skill in the art That is to say, without departing from the concept of the present invention, several modifications and improvements can be made, which all belong to the protection scope of the present invention; therefore, the protection scope of the patent for the present invention should be based on the appended claims.

Claims

A method for isothermally amplifying a nucleic acid target sequence, comprising the steps of:

1, initial product formation comprises the following steps:

A1. When the single-stranded target is single-stranded DNA, the amplification primer P1 and the displacement primer are complementary combined with the single-stranded target, and the amplification primer P1 is extended along the single-stranded target under the action of DNA polymerase replacing the amplification product of the amplification primer P1 with the replacement primer; using the product formed by the extension of the replaced amplification primer P1 as a single-stranded template;

A2. When the single-stranded target is a single-stranded RNA, the single-stranded template can be obtained by reacting in two ways:

(1) If the DNA polymerase has both polymerase function, strand displacement function and reverse transcription function, the amplification primer P1, displacement primer and DNA polymerase are contacted with single-stranded RNA, and the single-stranded RNA is Reverse transcribe into cDNA under the action of enzymatic reverse transcription activity, and be replaced by a displacement primer to obtain a single-stranded template;

(2) If the DNA polymerase does not have the reverse transcription function, it is necessary to add a reverse transcriptase with RNase H activity, and contact the amplification primer P1 and the reverse transcriptase with the single-stranded RNA, and the single-stranded RNA Under the action of reverse transcriptase, it is reverse transcribed into cDNA to form a cDNA-RNA composite double-stranded product, and the RNA strand in the composite double-stranded product is hydrolyzed by the RNase H activity of reverse transcriptase to obtain a single-stranded template;

B. The amplification primer P2 is complementary to the single-stranded template formed in step A, and the amplification primer P2 is extended along the single-stranded template under the action of DNA polymerase, and then the nicking enzyme acts on the extension product to extend at the nick and replacement to form a double-stranded initial product with one enzyme cleavage site at each end;

II, the exponential amplification signal collection comprises the following steps:

C. Contacting a nicking enzyme and a DNA polymerase with a double-stranded template, the double-stranded template generates a double-stranded nicking site under the action of the nicking enzyme, and the DNA polymerase amplifies and displaces from the nicking site to obtain a Increase the single strand complementary to primer P1 or P2;

D. Complementary binding of amplification primer P1 or P2 to the single strand formed in step C, and extension under the action of DNA polymerase to form two double strand products each with one restriction site;

E. Contacting the nicking enzyme and the DNA polymerase with the two double-stranded products produced in step D, the two double-stranded products form nicks respectively under the action of the nicking enzyme, and the DNA polymerase amplifies from the nicking site and Replacement to obtain two single strands that can be complementary to the amplification primer P1 or P2 respectively; the single strand is then contacted with the amplification primer P1 or P2, and extended under the action of DNA polymerase to form a double-stranded product;

F. Repeat step E to obtain the amplification product exponentially;

Wherein, the above steps are carried out under isothermal conditions, and there is no need to denature the target sequence before amplification;

Steps C to F also include complementary binding of the amplification system to molecular beacon probes to provide fluorescent signals;

The amplification primers P1 and P2, along the 5'-3' direction, sequentially include a stable region, a nickase recognition site region and a base region complementary to the target sequence; wherein the length of the stable region is 6-20bp ;

The displacement primer is fully complementary to the target sequence;

The molecular beacon probe is complementary to the target sequence or hybridizable to the target sequence, and the molecular beacon probe does not overlap with the binding regions of the amplification primers P1 and P2 on the target sequence;

When the single-stranded target is single-stranded DNA, the single-stranded target can be single-stranded DNA and the double-stranded DNA is contacted with the double-stranded DNA through a nickase and a DNA polymerase, and a nick is generated under the action of the nickase, and the DNA polymerizes The enzyme amplifies and displaces the resulting single-stranded product from the nick;

The DNA polymerase has a strand displacement function;

The methods are for non-disease diagnostic purposes.
The method for isothermally amplifying a nucleic acid target sequence according to claim 1, characterized in that:

The position of the base region complementary to the target sequence on the amplification primers P1 and P2 is modified, and the modification method includes locked nucleic acid modification and methylation modification;

The distance between the 3' terminal bases of the amplification primers P1 and P2 on the target sequence is not less than 10 bp.
The method for isothermally amplifying a nucleic acid target sequence according to claim 1, characterized in that: the length of the molecular beacon is 13-80bp, and the binding position of the molecular beacon and the target sequence is close to the 5' end and 3' not less than 12bp position.
The method for isothermally amplifying a nucleic acid target sequence according to claim 1, characterized in that:

The length of the single-stranded target is 30-100 bases;

The amplification is implemented between 37°C-70°C;

The whole reaction time is 1-10min.
The method for isothermally amplifying a nucleic acid target sequence according to claim 1, wherein said nickase is selected from Nt.AlwI, Nb.BbvCI, Nt.BbvCI, Nb.BsrDI, Nb.BsmI, Nt.BsmAI, At least one of Nt.BspQI, Nt.BstNBI, Nb.BtsI, Nt.CviPII.
The method for isothermally amplifying a nucleic acid target sequence according to claim 1, wherein said DNA polymerase is selected from one of Bst DNA polymerase, Bsu DNA polymerase, and phi29 DNA polymerase.
The method for isothermally amplifying a nucleic acid target sequence according to claim 1, wherein said DNA polymerase is Bst 2.0 or Bst 3.0.
The method for isothermally amplifying a nucleic acid target sequence according to claim 1, wherein one end of the molecular beacon probe is a fluorescent group, the other end is a fluorescent quenching group, and the 5' end of the probe is Complementary to the partial sequence at the 3' end, a stem-loop structure can be formed.
The method for isothermally amplifying a nucleic acid target sequence according to claim 1, wherein the amplification reaction system includes Tris HCl buffer, BSA, NaCl, KCl, dNTP, Mg2+, (NH4)SO4 and additives.
The method for isothermally amplifying nucleic acid target sequences according to claim 1, wherein said additives include trehalose, betaine, dimethyl sulfoxide, gelatin, Tween 20, Triton-x100, NP-40 at least one of .
The method for isothermally amplifying a nucleic acid target sequence according to claim 1, wherein the kit includes the amplification primers P1, P2, replacement primers, Molecular beacon probe and amplification reaction system.