WO2023112717A1

WO2023112717A1 - Pad1 production-promoting drug and novel drug evaluation method

Info

Publication number: WO2023112717A1
Application number: PCT/JP2022/044524
Authority: WO
Inventors: 大知村田; 雅史宮井
Original assignee: 株式会社資生堂
Priority date: 2021-12-17
Filing date: 2022-12-02
Publication date: 2023-06-22

Abstract

The present disclosure addresses the problem of providing a novel PAD1 production promoter. More particularly, the present disclosure provides a PAD1 production promoter that contains, as an active ingredient, at least one substance selected from the group consisting of a Scutellaria baicalensis extract, Sapindus mukorossi extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene(14)-polyoxypropylene(7) dimethyl ether, and Angelica keiskei extract. The PAD1 production promoter according to the present disclosure can promote the production of natural moisturizing factor (NMF) and can prevent reductions in skin moisturization caused by an occlusion effect that impedes water evaporation.

Description

PAD1 production-promoting drug and new drug evaluation method

The present invention relates to a PAD1 production promoter.

Keratin fibers in the granular layer of the epidermis bind to a protein called filaggrin during keratinization and aggregate to create a specific morphology called a "keratin pattern". Keratohyalin granules in granule cells contain a large amount of filaggrin precursor profilaggrin (10 to 12 filaggrin units arranged vertically). Aggregates keratin fibers by phosphorylation. After that, it is deiminated by the action of an enzyme called peptidylarginine deiminase (PAD), released from keratin, and then decomposed into amino acids in the upper stratum corneum. These amino acids are called natural moisturizing factors (NMF), play an important role in retaining moisture in the stratum corneum, and are known to have UV absorption (Blank I.H. J.I. Dermatol., 18, 433 (1952); Blank I.H. J.I. Dermatol., 21, 259 (1953)).

PAD acts on the arginine residue of filaggrin to deiminate it and convert it to a citrulline residue. Deimination of filaggrin in this way weakens the affinity between filaggrin and keratin fibers, liberates keratin fibers, and as a result, filaggrin becomes susceptible to the action of proteases, and is finally decomposed into NMF. It is considered to be a thing. Calpain-1 and caspase-14 have been identified as enzymes that degrade filaggrin deiminated by PAD. It has been shown to be decomposed into Japanese Unexamined Patent Application Publication No. 2012-193136 discloses a bleomycin hydrolase production-promoting agent containing, as an active ingredient, one or more selected from the group consisting of rose rose extract, angelica extract, Phellodendron bark extract, dead nettle extract, rosemary extract, benzenesulfonyl GABA and erythritol. agents, natural moisturizing factor production promoters, and dry skin improving agents.

JP 2012-193136

Some consumers feel that the continuous use of cosmetics is damaging the skin's natural power. Therefore, there is a demand for elucidation of the mechanism by which the skin's natural power is impaired by continued use of cosmetics, and for the development of drugs/cosmetics that do not impair the skin's natural power even when cosmetics are used continuously.

The present disclosure provides novel PAD1 production promoting agents. The inventors have clarified that PAD1, an NMF-producing enzyme, decreases due to the "occlusion effect" caused by the act of applying cosmetics. As a result of intensive research on the PAD1 production-promoting effect of various ingredients as agents that prevent the reduction of the skin's natural moisturizing power due to cosmetics, the inventors found out that Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, We have found that polyoxyethylene (14) polyoxypropylene (7) dimethyl ether and Angelica keiskei extract have particularly high effects as agents for promoting PAD1 production, and have completed the following invention:

[Aspect 1] A substance selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract as an active ingredient A PAD1 production-promoting agent, including
[Aspect 2] The PAD1 production-promoting agent according to Aspect 1, for promoting the production of natural moisturizing factor (NMF).
[Aspect 3] The PAD1 production-promoting agent according to

Aspect

1 or 2, for preventing a decrease in skin moisturizing power caused by an occlusion effect that hinders water evaporation.
[Aspect 4] An external preparation for skin containing the PAD1 production-promoting drug according to any one of aspects 1 to 3.
[Aspect 5] A cosmetic method comprising the step of applying the PAD1 production-promoting agent according to any one of aspects 1 to 3 or the external preparation for skin according to aspect 4 to the skin of a subject.
[Aspect 6] A method of screening for a substance that prevents a decrease in skin moisturizing power caused by an occlusion effect that hinders water evaporation, using the expression of PAD1 as an index.

PAD1 production can be promoted by administration of the PAD1 production-promoting drug according to the present disclosure. According to the present invention, a composition containing a PAD1 production promoting agent can be provided. By promoting PAD1 production, it is possible to promote the production of natural moisturizing factor (NMF) and prevent the decrease in skin moisturizing power caused by the occlusion effect that hinders water evaporation.

FIG. 1 is a graph showing changes in the expression level of PAD1 in an experimental system that mimics the occlusion effect of cosmetic application in vitro. FIG. 2A is a graph showing the result of comparing the PAD1 production-promoting effect of the Scutellaria root extract with the control to which no test substance was added. It is shown as a relative expression level with the PAD1 gene expression level in the control being set to 1. FIG. 2B is a graph showing the result of comparison of the PAD1 production-promoting effect of the soapberry extract with the control to which no test substance was added. It is shown as a relative expression level with the PAD1 gene expression level of the control being set to 1. FIG. 2C is a graph showing the result of comparing the PAD1 production-promoting effect of the neem leaf extract with the control to which no test substance was added. It is shown as a relative expression level with the PAD1 gene expression level in the control being set to 1. FIG. 2D is a graph showing the results of comparison of the PAD1 production-promoting effect of the horse chestnut extract with the control to which no test substance was added. It is shown as a relative expression level with the PAD1 gene expression level in the control being set to 1. FIG. 2E is a graph showing the result of comparing the PAD1 production-promoting effect of Chinese quince extract with that of a control to which no test substance was added. It is shown as a relative expression level with the PAD1 gene expression level of the control being set to 1. FIG. 2F is a graph showing the results of comparing the effect of polyoxyethylene (14) polyoxypropylene (7) dimethyl ether on promoting PAD1 production with a control to which no test substance was added. It is shown as a relative expression level with the PAD1 gene expression level of the control being set to 1. FIG. 2G is a graph showing the result of comparing the PAD1 production-promoting effect of the Angelica keiskei extract with the control to which no test substance was added. It is shown as a relative expression level with the PAD1 gene expression level of the control being set to 1.

The present disclosure contains at least one substance selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract. Provided is a PAD1 production promoter containing as an active ingredient.

Scutellaria Root Extract is an extract extracted from Scutellaria root, the root of Scutellaria baicalensis, a member of the Labiatae family. Antioxidant, antiallergic, whitening, moisturizing, and barrier function improvement are known as expected effects of this extract. However, it has not been reported that Scutellaria root extract has a PAD1 production-promoting effect, which is a very surprising discovery. As the Scutellaria root extract, for example, Scutellaria root extract BG available from Maruzen Pharmaceutical Co., Ltd. can be used.

Sapindus Mukorossi Peel Extract is an extract obtained by extracting from the pericarp of Sapindus Mukorossi. Sapindactyl has long been used as a natural surfactant (cleansing component) for shampooing and washing hair. However, it has not been reported that the soapberry extract has a PAD1 production-promoting effect, which is a very surprising discovery. As the soapberry extract, for example, a soapberry extract powder available from Maruzen Pharmaceutical Co., Ltd. can be used.

Neem leaf extract (Melia Azadirachta Leaf Extract) is an extract obtained by extracting neem leaves. This extract is known to have an anti-inflammatory action and an action to suppress the production of melanin as expected actions. However, it has not been reported that neem leaf extract has a PAD1 production-promoting effect, which is a very surprising discovery. For the neem leaf extract, for example, neem leaf extract BG available from Ichimaru Farcos Co., Ltd. can be used.

Horse Chestnut Extract is an extract extracted from horse chestnut (horse chestnut) seeds. Anti-inflammatory, moisturizing, and whitening properties are known as expected effects of this extract. However, it has not been reported that a horse chestnut extract has a PAD1 production-promoting effect, which is a very surprising discovery. The horse chestnut extract can use the horse chestnut extract which can be purchased from Koei Kogyo Co., Ltd., for example.

Chinese quince extract (Chaenomeles Sinensis Extract) is an extract obtained by extracting from the fruit of the rose family Chinese quince. This extract is known to have a moisturizing effect by softening the skin surface and an anti-inflammatory effect by inhibiting lipase. However, it has not been reported that quince extract has a PAD1 production-promoting effect, which is a very surprising discovery. Chinese quince extract can be purchased, for example, from Ichimaru Farcos Co., Ltd.

Polyoxyethylene (14) polyoxypropylene (7) dimethyl ether (PEG/PPG-14/7 Dimethyl Ether) is a general term for polyoxyethylene polyoxypropylene random copolymer dimethyl ether. Polyoxyethylene (14) polyoxypropylene (7) dimethyl ether is used as a surfactant, skin conditioning agent. However, it has not been reported that polyoxyethylene (14) polyoxypropylene (7) dimethyl ether has a PAD1 production-promoting effect, which is a very surprising discovery. Polyoxyethylene (14) polyoxypropylene (7) dimethyl ether (polyoxyethylene (14) polyoxypropylene (7) dimethyl ether can be used, for example, Macbiobride E-1060 available from NOF Corporation) can.

Angelica Keiskei Extract is an extract extracted from Angelica keiskei leaves. Expected actions of this extract are moisturizing, promotion of hyaluronic acid production, promotion of collagen production, and antioxidant. However, Angelica keiskei extract has not been reported to have a PAD1 production promoting effect, which is a very surprising discovery. As the Angelica keiskei extract, for example, Angelica keiskei extract BG available from Ichimaru Farcos Co., Ltd. can be used.

The plant extracts such as "Scutellaria root extract" and "Sapindactyl extract" used in the present invention can be extracted from plant raw materials by methods known to those skilled in the art. Such plant extracts can be obtained using any method known to those skilled in the art, such as, for example, extraction methods using solvents, methods involving grinding or pressing steps.

If necessary, the part of the plant to be extracted is washed with water in advance to remove foreign matter, then it is left as it is or dried, then cut into small pieces or pulverized as necessary, and then brought into contact with the extraction solvent for extraction. Extraction can be carried out by contacting with an extraction solvent according to a conventional method such as immersion, but supercritical extraction or steam distillation may also be used.

When performing extraction, the plant body can be used as it is, but it is better to crush it into granules or powder before subjecting it to extraction, as it is possible to extract active ingredients with high extraction efficiency in a short period of time under mild conditions. It can be carried out. The extraction temperature is not particularly limited, and may be appropriately set according to the particle size of the pulverized material, the type of solvent, and the like. Usually, it is set within the range from room temperature to the boiling point of the solvent. The extraction time is also not particularly limited, and may be appropriately set according to the particle size of the pulverized material, the type of solvent, the extraction temperature, and the like. Furthermore, at the time of extraction, stirring may be performed, the liquid may be allowed to stand without stirring, or ultrasonic waves may be applied.

Examples of extraction solvents include water; lower alcohols such as methanol, ethanol and propanol; higher alcohols such as oleyl alcohol, stearyl alcohol and octyldodecanol; ethylene glycol, 1,3-propanediol, 1,3-butylene glycol, polyhydric alcohols such as glycerin; esters such as ethyl acetate, butyl acetate, methyl propionate and glyceryl trioctanoate; ketones such as acetone and methyl ethyl ketone; ethers such as ethyl ether, isopropyl and ether; n-hexane and toluene , chloroform and other hydrocarbon solvents, and the like, which can be used alone or in combination of two or more. Preferable solvents are polar solvents such as water, lower alcohols and liquid polyhydric alcohols, more preferably water or lower alcohols such as methanol, ethanol or 1,3-butylene glycol. The lower alcohol may be, for example, a hydrous lower alcohol, in which case the water content is, for example, 0-10 v/v%, 10-40 v/v%, 20-30 v/v%, 30-50 v/v%. , 50 to 80 v/v%, 80 to 99.5 v/v%, and the like. The lower alcohol may be, for example, a C1-C5 lower alcohol. These solvents may be used singly or in combination of two or more. Moreover, you may add an enzyme to a solvent and may perform an extraction process.

When using a mixed solvent, the mixing ratio is, for example, a mixed solvent of water and ethyl alcohol in the range of 1:1 to 25:1 by volume (same below); a mixed solvent of water and glycerin In the range of 1:1 to 15:1; or in the case of a mixed solvent of water and 1,3-propanediol or 1,3-butylene glycol, the range is preferably in the range of 1:1 to 15:1.

When preparing an extract, the pH is not particularly limited, but it is generally preferred to be in the range of pH 3-9. If necessary, the extraction solvent is blended with an alkalinity adjuster such as sodium hydroxide, sodium carbonate, potassium hydroxide, or an acidity adjuster such as citric acid, hydrochloric acid, phosphoric acid, sulfuric acid, etc. to achieve the desired pH. can be adjusted as follows.

Extraction conditions such as extraction temperature and extraction time vary depending on the type and pH of the solvent used, and are not limited. For example, water or 1,3-butylene glycol, or a mixture of water and 1,3-butylene glycol When used as a solvent, the extraction temperature may be in the range of 0°C to 90°C, and the extraction time may be in the range of 0.5 hours to 7 days.

Through such an extraction operation, the active ingredients are extracted and dissolved in the solvent. The solvent containing the extract may be used as it is, or may be used after being subjected to conventional purification treatments such as sterilization, washing, filtration, decolorization and deodorization. Moreover, you may use, after concentrating or diluting if necessary. Further, the solvent may be entirely volatilized to form a solid (dried product) before use, or the dried product may be redissolved in an arbitrary solvent before use.

Prior to the extraction process or in parallel with the extraction process, the extraction site may be subjected to hydrolysis treatment as necessary. As a result, there is a possibility that the extract can be used more effectively by improving the skin irritation, efficacy, storage stability, or the like of the extract.

In addition, the pressed liquid obtained by pressing the raw material plant also contains the same active ingredients as the extract, so the pressed liquid can be used instead of the extract.

PAD1 refers to Peptidylarginine Deiminase 1. This gene encodes an enzyme belonging to the peptidylarginine deiminase family and catalyzes the post-translational deimination of proteins by converting arginine residues to citrulline in the presence of calcium ions. Although proteins belonging to this family have different substrate specificities and tissue-specific expression patterns, the PAD1 enzyme is involved in the later stages of epidermal differentiation and maintains stratum corneum hydration to preserve skin barrier function. Deiminates filaggrin and keratin K1.

　Natural moisturizing factor (NMF) is one of the moisturizing ingredients present in the stratum corneum and plays an important role in retaining moisture in the stratum corneum. Amino acids, the main components of NMF, are produced by degradation of filaggrin protein derived from keratohyalin granules. Filaggrin is a protein consisting of 317 amino acids. PAD acts on the arginine residue of filaggrin to deiminate it and convert it to a citrulline residue. Deimination of filaggrin in this way weakens the affinity between filaggrin and keratin fibers, liberates keratin fibers, and as a result, filaggrin becomes susceptible to the action of proteases, and is finally decomposed into NMF. It is considered to be a thing. The PAD1 production promoting agent according to the present disclosure can promote the production of natural moisturizing factor (NMF) by promoting the production of PAD1.

The "occlusion effect" refers to the effect of suppressing water evaporation from the inside of the body by applying (obstructing) an oil-based base material with low water permeability such as petroleum jelly to the skin, resulting in an increase in the barrier function. The PAD1 production-promoting agent according to the present disclosure can prevent a decrease in skin moisturizing power caused by the occlusion effect caused by the application of cosmetics by promoting the production of PAD1.

Promotion of PAD1 production means, for example, when the PAD1 production promoter is applied compared to the state (control) where the PAD1 production promoter is not applied, the expression level of the PAD1 gene is, for example, a significant level of 5%. It can mean that it is enhanced with a statistically significant difference (eg, Student's t-test). Alternatively, the promotion of PAD1 production means that, for example, when the PAD1 production promoter is applied, the expression level of the PAD1 gene is, for example, 10% or more, 20 % or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 100% or more, 200% or more, 300% or more, 400% or more, or 500% It can mean that it is enhanced more than The expression level of the PAD1 gene can be determined by any known technique, for example, the method described in Non-Patent Document 6.

Accordingly, the present disclosure effectively uses a substance selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract. Provided is a PAD1 production-promoting drug containing as a component. The PAD1 production-promoting agent according to the present disclosure can promote PAD1 production, and thus the production of natural moisturizing factor (NMF). Thus, in one aspect, the present disclosure provides Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract. It also relates to a natural moisturizing factor (NMF) production-promoting agent containing the substance as an active ingredient. In addition, the PAD1 production-promoting agent according to the present disclosure can prevent a decrease in skin moisturizing power caused by the occlusion effect caused by the application of cosmetics by promoting PAD1 production. Thus, in one aspect, the present disclosure provides Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract. It also relates to an agent for preventing a decrease in skin moisturizing power caused by an occlusion effect due to the application of cosmetics, which contains the substance as an active ingredient. PAD1 production enhancement and natural moisturizing factor (NMF) production enhancement may be in a tissue or organ such as skin. In addition, the present disclosure provides at least one extract selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract A composition containing a PAD1 production promoter or a natural moisturizing factor (NMF) production promoter containing the substance as an active ingredient is also provided. A composition according to the present disclosure may be a cosmetic composition or a food composition. In addition, the composition according to the present disclosure promotes the production of natural moisturizing factor (NMF) through the promotion of PAD1 production, thereby preventing a decrease in skin moisturizing power caused by the occlusion effect of applying cosmetics. may

The PAD1 production promoter, the natural moisturizing factor (NMF) production promoter, the agent for preventing the decrease in moisturizing power of the skin caused by the occlusion effect due to the application of cosmetics, or the composition according to the present disclosure includes Scutellaria root extract, soapberry extract, and neem as active ingredients. At least one substance selected from the group consisting of leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract, for example, 10% by mass or more, 20% by mass 30% by mass or more, 40% by mass or more, 50% by mass or more, 60% by mass or more, 70% by mass or more, 80% by mass or more, 90% by mass or more, 95% by mass or more, or 99% by mass or more There is The PAD1 production promoter, the natural moisturizing factor (NMF) production promoter, the agent for preventing the decrease in skin moisturizing power caused by the occlusion effect caused by the application of cosmetics, or the composition according to the present disclosure includes Scutellaria root extract, soapberry extract, neem leaf extract, It may contain two or all three substances selected from the group consisting of horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract. In one embodiment, the PAD1 production promoter, the natural moisturizing factor (NMF) production promoter, or the agent for preventing the decrease in skin moisturizing power caused by the occlusion effect caused by the application of cosmetics, according to the present disclosure, is Scutellaria root extract, soapberry extract, and neem leaf. Extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract. At least one substance selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract used in the present invention can be obtained by any method, and is not limited by the method of production, source of supply, or the like.

The PAD1 production promoter, the natural moisturizing factor (NMF) production promoter, the agent for preventing the decrease in skin moisturizing power caused by the occlusion effect caused by the application of cosmetics, or the composition according to the present disclosure can be administered externally or orally. The form of external administration can be arbitrarily selected, for example, cream, milky lotion, liquid, sheet, spray, gel, and the like. Oral administration forms can be arbitrarily selected, for example, tablets, supplements, beverages, powders, and the like. Thus, the present disclosure provides a skin external preparation containing a PAD1 production promoting agent, a skin external preparation containing a natural moisturizing factor (NMF) production promoting agent, and an agent for preventing a decrease in skin moisturizing power caused by the occlusion effect caused by the application of cosmetics. Also provided is a topical skin preparation comprising:

The cosmetic composition according to the present disclosure may be various cosmetics such as milky lotions, creams, serums, lotions, packs, facial cleansers, soaps, body soaps and shampoos, and may be liquid, milky, creamy, solid, It may be in various forms such as sheet, spray, gel, foam and powder. In addition, the food composition according to the present disclosure may be powder, beverage, or tablet, and may be in various forms such as powder, liquid, solid, granules, granules, paste, and gel.

The PAD1 production promoter, the natural moisturizing factor (NMF) production promoter, the agent for preventing the decrease in skin moisturizing power caused by the occlusion effect caused by the application of cosmetics, or the composition according to the present disclosure includes Scutellaria root extract, soapberry extract, neem leaf extract, At least one substance selected from the group consisting of horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract in an amount such that the effect of promoting PAD1 production is sufficiently exhibited It is preferable to contain.

PAD1 production promoter according to the present disclosure, natural moisturizing factor (NMF) production promoter, preventive agent for reducing skin moisturizing power caused by occlusion effect due to application of cosmetics, or Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut in the composition The amount of at least one substance selected from the group consisting of extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract is determined according to their types, purposes, forms, usage methods, etc. can be determined as appropriate.

For the dosage of at least one substance selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract , When externally administered, for example, at least selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract The blending amount of one substance is the PAD1 production promoter according to the present disclosure, the natural moisturizing factor (NMF) production promoter, the agent for preventing the decrease in skin moisturizing power caused by the occlusion effect due to the application of cosmetics, or the total weight of the composition 0.001-50% by weight, 0.01-5% by weight, 0.01-1% by weight, 0.01-0.1% by weight, 0.02-0.05% by weight, etc., but not limited to these.

When administered orally, at least one substance selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract is the PAD1 production promoter according to the present disclosure, the natural moisturizing factor (NMF) production promoter, the agent for preventing the decrease in skin moisturizing power caused by the occlusion effect due to the application of cosmetics, or the total weight of the composition 0.001 to 50 % by weight, 0.01-5% by weight, 0.01-1% by weight, 0.01-0.1% by weight, 0.02-0.05% by weight, etc., but not limited thereto.

The frequency of administration was once every 4 weeks, once every 2 weeks, once a week, once every 3 days, once every 2 days, once a day, twice a day, and 3 times a day. , 4 times a day, 5 times a day, administration as needed, etc. can be arbitrarily selected, but are not limited to these.

The PAD1 production promoter, the natural moisturizing factor (NMF) production promoter, the agent for preventing the decrease in moisturizing power of the skin caused by the occlusion effect due to the application of cosmetics, or the composition according to the present disclosure, the additive is arbitrarily selected as necessary. can be used together. Excipients and the like can be included as additives.

As the excipient, any excipients that are usually used for the desired dosage form may be used, and examples thereof include wheat starch, rice starch, corn starch, potato starch, dextrin, starches such as cyclodextrin, and crystalline celluloses. , lactose, glucose, sugar, reduced maltose, starch syrup, fructooligosaccharide, emulsified oligosaccharide, and sugar alcohols such as sorbitol, erythritol, xylitol, lactitol, and mannitol. These excipients can be used alone or in combination of two or more.

Other additives include colorants, preservatives, thickeners, binders, disintegrants, dispersants, stabilizers, gelling agents, antioxidants, surfactants, preservatives, pH adjusters, oils, Known substances such as water, alcohols, chelating agents, silicones, ultraviolet absorbers, moisturizing agents, fragrances, various medicinal ingredients, preservatives, neutralizers, etc. can be appropriately selected and used.

The present disclosure contains at least one substance selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract. Also provided are methods for promoting PAD1 production by administering. In addition, the present disclosure provides at least one extract selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract Also provided is a method for promoting production of natural moisturizing factor (NMF) through promotion of PAD1 production by administering a substance. Furthermore, the present disclosure provides at least one selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract. We also provide a method for preventing the decrease in skin moisturizing power caused by the occlusion effect caused by the application of cosmetics through the promotion of PAD1 production by administering a substance. The method according to the present disclosure is a cosmetic method and may not be a treatment by a doctor or a medical practitioner. Thus, the present disclosure is directed to the PAD1 production promoting agent according to the present disclosure, the natural moisturizing factor (NMF) production promoting agent, the agent for preventing the decrease in skin moisturizing power caused by the occlusion effect caused by the application of cosmetics, or the external skin preparation. A cosmetic method is also provided, comprising the step of applying to the skin. In addition, the present disclosure provides a PAD1 production promoting agent according to the present disclosure, a natural moisturizing factor (NMF) production promoting agent, a preventive agent for reducing the moisturizing power of the skin caused by an occlusion effect that prevents water evaporation, or A method for promoting the production of PAD1, a method for promoting the production of natural moisturizing factor (NMF), or a method for preventing a decrease in skin moisturizing power caused by an occlusion effect due to the application of cosmetics, comprising the step of administering a composition. also provide.

In one aspect, the present disclosure relates to a screening method for a substance that prevents a decrease in skin moisturizing power caused by an occlusion effect that hinders water evaporation, using the expression of PAD1 as an index.

Expression of PAD1 can be determined using mRNA or protein expression as an indicator. Measurement of mRNA or protein can be performed by any method known to those skilled in the art.

More specifically, the screening method according to the present disclosure comprises the steps of 1) preparing a sample containing a test agent, 2) contacting the sample with cells, and 3) evaluating the presence or absence of an increase in the expression level of PAD1 in cells. may include the step of Based on the results obtained in step 3, if the expression level of PAD1 is increased, the test agent is a PAD1 production promoter, promotes the production of natural moisturizing factor, and causes the occlusion effect due to the application of cosmetics. It can be determined that it is a substance that prevents a decrease in skin moisturizing power.

A drug to be tested can be, for example, any substance such as low-molecular-weight compounds, high-molecular polymers, proteins, peptides, antibodies, enzymes, nucleic acids, sugar chains, lipids, etc., and compositions containing them. Examples of drugs to be tested include, for example, vitamin C, vitamin E, β-carotene, astaxanthin, etc., derivatives thereof, and plant extract compositions. Examples of drugs to be tested include cosmetics, base materials, pharmaceuticals, and sunscreens.

All publications, applications, standards, and patents referred to in this specification are incorporated by reference in their entirety, and in the event of conflicting terms, this specification shall prevail. The invention should not be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

Next, the present invention will be described in more detail by way of examples. In addition, this invention is not limited by this.

Example 1: Changes in PAD1 expression level in an experimental system mimicking the occlusion effect of cosmetic application A system was constructed in which a three-dimensional skin model was cultured in a state in which contact with the external environment was blocked only by the occlusion effect of petroleum jelly and paper, covered with a paper coated with . As a control, a three-dimensional skin model covered with paper not coated with petroleum jelly was used. Under such an experimental system, epidermal keratinocytes were cultured at 45% relative humidity (RH) for 24 hours, and then PAD1 expression in a three-dimensional skin model was examined by quantitative PCR.

The results are shown in Figure 1 (Student's t-test, Bonferroni-corrected p-value, *p < 0.025, ***p < 0.0025 (n=4)). The results show that blocking contact with the external environment with petroleum jelly-coated paper reduces the expression level of PAD1 (gene name: PADI1) in cells. Furthermore, it was found that culturing the cells in the presence of polyoxyethylene (14) polyoxypropylene (7) dimethyl ether could restore the decreased expression of PAD1.

Example 2: Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract PAD1 gene expression enhancement effect (sample preparation)
Commercially available Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract are filter-sterilized and filtered to obtain a concentration of 1M of Scutellaria root extract, soapberry extract, Neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract samples were prepared. The Scutellaria root extract used was Scutellaria root extract BG purchased from Maruzen Pharmaceutical Co., Ltd. The scutellaria root extract used was soap extract powder purchased from Maruzen Pharmaceutical Co., Ltd. The neem leaf extract was purchased from Ichimaru Farcos Co., Ltd. Neem leaf extract BG is used, horse chestnut extract purchased from Koei Kogyo Co., Ltd. is used, quince extract is purchased from Ichimaru Farcos Co., Ltd. Polyoxyethylene (14) Polyoxypropylene (7) dimethyl ether used was Macbio Bride E-1060 purchased from NOF Corporation, and Angelica keiskei extract BG purchased from Ichimaru Falcos Co., Ltd. was used as Angelica keiskei extract.

(Culture of epidermal keratinocytes)
Commercially available keratinocytes derived from normal adult skin (Kurabo) were inoculated into T75 flasks at 5 × 10 ⁵ cells/flask, and incubated in a keratinocyte medium (Humedia-KG2, Kurabo) at 37°C and 5% CO The cells were cultured under _two atmospheres until reaching semi-confluence and used as seed cells. The keratinocytes were collected by trypsinization, inoculated into a 12-well plate at 5×10 ⁴ cells/well, and placed in a keratinocyte medium (Humedia-KG2, Kurabo Industries) at 37° C., 5% CO _{2 .} It was cultured under atmosphere until confluency was reached.

(Addition of sample)
Scutellaria root extract (0.1%; % concentration relative to medium volume; same below), soapberry extract (0.001%), neem leaf extract (0.05%), horse chestnut extract (0.05%), quince extract to confluent epidermal keratinocytes (0.05%), polyoxyethylene (14) polyoxypropylene (7) dimethyl ether (0.05%), and Angelica keiskei extract (0.01%) samples were added at appropriate dilutions _and continued culturing in As a control, culturing was carried out using only the medium to which no sample was added.

(Extraction of RNA from cells)
Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract were added 48 hours later, the medium was removed, and commercially available RNA was extracted. Cell lysis and RNA extraction were performed using an extraction reagent (RNeasy Mini Kit, Qiagen).

(Evaluation of PAD1 production amount by quantitative PCR method)
Using the extracted RNA as a template, quantitative PCR was performed using a commercially available quantitative PCR reagent (LightCycler (registered trademark) 480 SYBR Green I Master, Roche Applied Science) and a quantitative PCR device (LightCycler (registered trademark) 480 System, Roche Applied Science). was performed to measure the expression level of the PAD1 gene. As an internal standard, the expression level of the GAPDH gene whose expression level is almost constant was also measured at the same time. The following PCR primers specific to each gene were used as PCR primers.
Forward primer for GAPDH: GAGTCAACGGATTTGGTCGT (SEQ ID NO: 1)
Reverse primer for GAPDH: TTGATTTTGGAGGGATCTCG (SEQ ID NO: 2)
Forward primer for PAD1: AGAGTGACATCGTGGACATTC (SEQ ID NO: 3)
Reverse primer for PAD1: GCTCGTGGTAGGACAAGTAGTC (SEQ ID NO: 4)

The results are shown in Figures 2A to 2G. The PAD1 gene expression level when each sample was added is shown as a comparison with the PAD1 gene expression level of the control being set to 1.

The graph in Figure 2A shows the results of comparing the PAD1 production-promoting effect of the Scutellaria root extract with the control to which no test substance was added (Student's t-test, *p<0.05, mean ± SD (n=6)). It was confirmed that the Scutellaria root extract has a very high PAD1 production-promoting effect compared to the case of culturing in a medium alone.

The graph in FIG. 2B shows the results of comparing the PAD1 production-promoting effect of the soapberry extract with that of a control containing no test substance (Student's t-test, ***p<0.005, mean±SD (n=4)). . Sapindactyl extract was confirmed to have a very high PAD1 production-promoting effect compared to the case of culturing in a medium alone.

The graph in Figure 2C shows the results of comparing the PAD1 production-promoting effect of neem leaf extract with the control without the test substance added (Student's t-test, *p<0.05, mean ± SD (n=6)). It was confirmed that the neem leaf extract has a very high PAD1 production-promoting effect compared to the case where the neem leaf extract is cultured only in the medium.

The graph in Fig. 2D shows the results of comparing the PAD1 production-promoting effect of the horse chestnut extract with the control to which no test substance was added (Student's t-test, *p < 0.05, mean ± SD (n = 6)). It was confirmed that the horse chestnut extract has a very high PAD1 production-promoting effect compared to the case of culturing in the medium alone.

The graph in Figure 2E shows the results of comparing the PAD1 production-promoting effect of quince extract with the control to which no test substance was added (Student's t-test, *p<0.05, mean ± SD (n=6)). It was confirmed that the Chinese quince extract has a very high PAD1 production-promoting effect compared to the case of culturing in the medium alone.

The graph in FIG. 2F shows the results of comparing the PAD1 production-promoting effect of polyoxyethylene (14) polyoxypropylene (7) dimethyl ether (Aquainpool 1407) with a control containing no test substance (Student's t-test , **p < 0.01, mean ± SD (control group: n = 5, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether group: n = 6)). It was confirmed that polyoxyethylene (14) polyoxypropylene (7) dimethyl ether has a very high PAD1 production-promoting effect compared to the case of culturing in the medium alone.

The graph in Figure 2G shows the results of comparing the PAD1 production-promoting effect of Angelica keiskei extract with the control to which no test substance was added (Student's t-test, *p<0.05, mean ± SD (n=6)). It was confirmed that Angelica keiskei extract has a very high PAD1 production-promoting effect compared to the case of culturing in a medium alone.

As described above, from Figures 2A to 2G, Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract were grown in medium alone. It was confirmed that there is a very high PAD1 production-promoting effect compared to the case of culturing.

At least one substance selected from the group consisting of Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and Angelica keiskei extract according to the present disclosure PAD1 gene expression can be promoted by administration of a PAD1 production promoter contained as an active ingredient. In addition, administration of a PAD1 production promoter can promote the production of natural moisturizing factor (NMF) through promoting PAD1 gene expression, and by promoting the production of natural moisturizing factor (NMF) , It can prevent the decrease in skin moisturizing power caused by the occlusion effect that hinders water evaporation.

Claims

Scutellaria root extract, soapberry extract, neem leaf extract, horse chestnut extract, Chinese quince extract, polyoxyethylene (14) polyoxypropylene (7) dimethyl ether, and PAD1-producing substance containing as an active ingredient a substance selected from the group consisting of Angelica keiskei extract Facilitator.
The PAD1 production promoting agent according to claim 1 for promoting the production of natural moisturizing factor (NMF).
The PAD1 production-promoting agent according to claim 1 or 2, for preventing a decrease in skin moisturizing power caused by an occlusion effect that hinders water evaporation.
A skin external preparation containing the PAD1 production-promoting agent according to any one of claims 1 to 3.
A cosmetic method comprising the step of applying the PAD1 production-promoting agent according to any one of claims 1 to 3 or the external preparation for skin according to claim 4 to the skin of a subject.
A screening method for a substance that prevents a decrease in skin moisturizing power caused by an occlusion effect that hinders water evaporation, using the expression of PAD1 as an index.