JP2021113172A - Peptidyl arginine deiminase 1 expression promoter - Google Patents

Abstract

To provide peptidyl arginine deiminase 1 (PAD1) expression promoters, moisturizers, hair growth agents, and hair restorers, characterized by containing guava leaves.SOLUTION: Since guava leaves exhibit a PAD1 expression promoting action, they can be used as foods, quasi-drugs, or pharmaceuticals having an excellent PAD1 expression promoting action, moisturizing action, as well as hair growth and hair restoration action. Furthermore, since the combined use of guava leaves, pineapple fruit, and papaya fruit exhibits an extremely excellent PAD1 expression promoting action, moisturizing action, as well as hair growth and hair restoration action, it can also be used as a food, quasi-drug, or pharmaceutical having an extremely excellent PAD1 expression promoting action, moisturizing action, as well as hair growth and hair restoration action.SELECTED DRAWING: None

Description

The present invention relates to a peptidyl arginine deiminase 1 expression promoter, a moisturizer, a hair growth agent and a hair growth agent, which are characterized by containing guava leaves. More specifically, the present invention relates to a peptidyl arginine deiminase 1 expression promoter, a moisturizer, a hair growth agent and a hair growth agent, which are characterized by containing guava leaves, pineapple fruits and papaya fruits.

Peptidylarginine deiminase (PAD) is a post-translational modification enzyme that converts arginine residues, which are basic amino acids in peptides, into citrulline residues. PAD1, which is one of the PAD isoforms, is an important factor for the differentiation of human epidermis and hair follicles (Non-Patent Document 1).

The stratum corneum is responsible for the moisturizing function of the skin. In order for the stratum corneum to keep the moisture inside the skin constant without escaping, it is important that there is a sufficient amount of natural moisturizing factors (NMF, natural moisturizing factor). In the process of keratinization of the epidermis, NMF is produced by modifying filaggrin released from profilaggrin with PAD1. As described above, PAD1 is an essential factor for NMF production and plays an important role in maintaining and enhancing the moisturizing function of the skin.

Hair follicles are organs that produce hair formed by hair, root sheaths, hair matrix cells, hair papilla cells, and the like. Hair grows and loses hair repeatedly in a cycle consisting of a growth phase, a catagen phase, a resting phase, and a hair loss phase. The growth period is a period in which hair follicles differentiate and grow, and hair grows by frequently dividing hair roots and adding them to the hair shaft. PAD1 related to the differentiation of hair follicles plays an important role in hair development and elongation.

There is a PAD1 production promoter (Patent Document 1) containing an enzymatically decomposed product of a water-insoluble protein contained in pearls and / or shells as an active ingredient, but the form is an external preparation for skin. In addition, although there are moisturizing cosmetics containing guava leaves, pineapple fruits, or papaya fruits, there is no knowledge about the moisturizing effect, hair growth, and hair growth effect of these three types in combination, and there is no invention related thereto.

Japanese Unexamined Patent Publication No. 2013-23438

J. Steroid. biochem. Mol. Biol, 144: 237-241 (2014)

The present invention relates to a PAD1 expression promoter, a moisturizer, a hair growth agent and a hair growth agent, which are characterized by containing guava leaves. More specifically, the present invention relates to a PAD1 expression promoter, a moisturizer, a hair growth agent and a hair growth agent, which are characterized by containing guava leaves, pineapple fruits and papaya fruits.

As a result of diligent research, the present inventors have found that guava leaves have a PAD1 expression promoting action, a moisturizing action, a hair growth and a hair growth action. Furthermore, it was found that the combined use of guava leaves, pineapple fruits, and papaya fruits significantly increases the PAD1 expression promoting action, moisturizing action, hair growth and hair growth action.

As the guava leaf of the present invention, a leaf of guava (Psidium guava) belonging to the genus Guava (Psidium) of the Myrtaceae family can be used.

As the pineapple fruit of the present invention, a fruit of the pineapple (Ananas comosos) belonging to the genus Bromeliad (Bromeliad) Bromeliad can be used.

As the papaya fruit of the present invention, a fruit of papaya (Calica papaya) belonging to the genus Papaya (Caricaceae) of the family Caricaceae can be used.

As the guava leaf, pineapple fruit, papaya fruit used in the present invention, the state as it is, a crushed product, a pressed product, a dried product, or the like can be appropriately selected as needed. Further, it may be treated by atomization treatment, roll press treatment, grinding treatment, ultra-high pressure microsteam treatment, or other mechanical method usually used industrially.

The guava leaves, pineapple fruits, and papaya fruits used in the present invention can be subjected to an extraction operation as needed. As extraction solvent, water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.) ), Ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, petroleum ether, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.), etc. Can be used. These solvents may be used alone or in admixture of two or more. Further, examples of the extraction method include continuous extraction, immersion extraction and the like, and if necessary, treatments such as concentration, dilution, filtration, decolorization by activated carbon treatment and the like, and deodorization may be performed. Further, the extracted solution may be subjected to treatments such as concentrated drying, spray drying, freeze drying and the like, and used as a dried product.

Any processed product or extract may be used for the guava leaf, pineapple fruit, and papaya fruit of the present invention. Further, it is preferable to use a hydrous ethanol extract for guava leaves, an ethanol extract for pineapple fruits, and a dry and crushed powder for papaya fruits.

The intake of guava leaves, pineapple fruits, and papaya fruits used in the present invention varies depending on the dosage form, purpose of use, age, body weight, and the like. The guava leaf hydrous ethanol extract can be orally administered once to several times a day in the range of 0.1 to 100 mg / day, preferably 0.5 to 20 mg / day, more preferably 1 to 10 mg / day. The pineapple fruit ethanol extract can be orally administered once to several times a day in the range of 1 to 1000 mg / day, preferably 10 to 100 mg / day, more preferably 20 to 50 mg / day. As papaya fruit powder, it can be orally administered once to several times a day in the range of 0.1 to 100 mg / day, preferably 0.5 to 20 mg / day, more preferably 1 to 10 mg / day. In some cases, an amount smaller than the above-mentioned administration range may be sufficient, and in other cases, it may be necessary to administer beyond the above-mentioned administration range. Further, the method of adding the medicinal ingredient in the formulation may be added in advance or may be added during the production, and may be appropriately selected in consideration of workability.

The PAD1 expression promoter of the present invention can be used for any of foods, quasi-drugs or pharmaceuticals. The dosage form is preferably taken internally, and can be used in dosage forms such as powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids and emulsions. It can also be used as an external preparation for skin, an injection, a suppository, and the like.

The PAD1 expression-promoting agent of the present invention is an excipient, a stabilizer, a preservative, a binder, a disintegrant, which is used for ordinary foods, non-pharmaceutical products or pharmaceuticals, as necessary, as long as the effect is not impaired. It can also contain components such as hydrocarbons, fatty acids, vitamins, alcohols, esters, pH regulators, preservatives and fragrances. It preferably contains vitamins, and more preferably β-carotene (vitamin A), vitamin C, and vitamin E, especially β-carotene (1-2 mg), vitamin C (1000-2000 mg), and vitamin E (10). It is preferably contained in an amount of ~ 20 mg.

The moisturizer in the present invention is an agent that increases the amount of water in the skin and suppresses the amount of water evaporation from the skin, and is used for dry skin, xeroderma, sebum deficiency, wrinkles, atopic dermatitis, rough skin, and keratinization. Abnormalities can be prevented and ameliorated.

The hair growth agent and hair growth agent in the present invention are agents that promote the growth and elongation of hair such as hair, and can prevent and improve hair thickening, thinning hair, and hair loss.

The PAD1 expression-promoting agent characterized by containing the guava leaf of the present invention has a PAD1 expression-promoting action, a moisturizing action, a hair growth and a hair growth action. Furthermore, the PAD1 expression-promoting agent, which is characterized by containing guava leaves, pineapple fruits and papaya fruits, has an excellent PAD1 expression-promoting action, a moisturizing action, a hair growth and a hair-growth action.

The following examples are provided for illustration purposes only, and the scope of claims of the present invention is not limited to these examples. In addition,% of the content shown in an Example shows weight%.

Production Example 1 Guava leaf hot water extract Add 2 L of purified water to 100 g of guava leaf, extract at 95-100 ° C. for 2 hours, concentrate the filtrate, freeze-dry, and add 9.3 g of guava leaf hot water extract. Obtained.

Production Example 2 Guava leaf 30% ethanol extract Add 1.4 L of purified water and 0.6 L of ethanol to 100 g of guava leaf, extract at room temperature for 5 days, then concentrate and dry the filtrate to extract 30% ethanol of guava leaf. 5.7 g of the product was obtained.

Production Example 3 Guava leaf 70% ethanol extract Add 0.6 L of purified water and 1.4 L of ethanol to 100 g of guava leaf, extract at room temperature for 5 days, concentrate and dry the filtrate, and extract 70% ethanol of guava leaf. 3.2 g of the product was obtained.

Production Example 4 Pineapple Hot Water Extract Add 2 L of purified water to 100 g of pineapple fruit, extract at 95-100 ° C for 2 hours, concentrate the filtrate and freeze-dry to obtain 7.4 g of pineapple fruit hot water extract. rice field.

Production Example 5 Pineapple fruit 30% ethanol extract Add 1.4 L of purified water and 0.6 L of ethanol to 100 g of pineapple fruit, extract at room temperature for 5 days, then concentrate and dry the filtrate to extract 30% ethanol of pineapple fruit. 4.0 g of the product was obtained.

Production Example 6 Pineapple Fruit Ethanol Extract To 100 g of pineapple fruit, 1 L of ethanol was added, and the mixture was extracted at room temperature for 5 days, and then the filtrate was concentrated to dryness to obtain 4.1 g of pineapple fruit ethanol extract.

Production Example 7 Papaya fruit powder 100 g of papaya fruit was dried, pulverized and sorted by sieving to obtain 80 g of papaya fruit powder.

Production Example 8 Papaya Fruit Hot Water Extract Add 2 L of purified water to 100 g of papaya fruit, extract at 95-100 ° C for 2 hours, concentrate the filtrate, freeze-dry, and add 8.7 g of papaya fruit hot water extract. Obtained.

Production Example 9 Papaya Fruit 30% Ethanol Extract To 100 g of papaya fruit, 1.4 L of purified water and 0.6 L of ethanol were added, extracted at room temperature for 5 days, and then the filtrate was concentrated to dryness to extract papaya fruit with 30% ethanol. 4.7 g of the product was obtained.

Prescription example 1 Granules <Prescription>
Ingredient content (%)
1. 1. Guava leaf 30% ethanol extract (Production Example 2) 0.16
2. Lactose 91.84
3. 3. Cellulose 8.00
<Manufacturing method>
Ingredients 1 to 3 are granulated by a dry method to obtain granules.
<Usage>
Take 3.2g per day.

Prescription example 2 Granules <Prescription>
Ingredient content (%)
1. 1. Guava leaf 30% ethanol extract (Production Example 2) 0.16
2. Pineapple Fruit Ethanol Extract (Production Example 6) 1.25
3. 3. Papaya fruit powder (Production Example 7) 0.16
4. Lactose 90.43
5. Cellulose 8.00
<Manufacturing method>
Ingredients 1 to 5 are granulated by a dry method to obtain granules.
<Usage>
Take 3.2g per day.

Prescription example 3 Granules <Prescription>
Ingredient content (%)
1. 1. Guava leaf 30% ethanol extract (Production Example 2) 0.16
2. Pineapple Fruit Ethanol Extract (Production Example 6) 1.25
3. 3. Papaya fruit powder (Production Example 7) 0.16
4. β-carotene 0.05
5. Vitamin C 50.00
6. Vitamin E 0.50
7. Lactose 39.88
8. Cellulose 8.00
<Manufacturing method>
Ingredients 1 to 8 are granulated by a dry method to obtain granules.
<Usage>
Take 3.2g per day.

Prescription example 4 Soft capsule <Prescription>
Ingredient content (%)
1. 1. Guava leaf hot water extract (Production Example 1) 0.090
2. Pineapple fruit hot water extract (Production Example 4) 1.800
3. 3. Papaya fruit hot water extract (Production Example 8) 0.006
4. Rice germ oil 78.104
5. Beeswax 12,000
6. Vitamin E 8,000
<Manufacturing method>
Ingredients 1 to 6 are mixed, 350 mg is filled in a film composed of gelatin, glycerin, and caramel color, and after drying, a soft capsule is obtained.
<Usage>
Take 3 tablets per day.

Prescription example 5 Beverage <Prescription>
Ingredient content (%)
1. 1. Guava leaf 70% ethanol extract (Production Example 3) 0.10
2. Pineapple fruit 30% ethanol extract (Production Example 5) 1.80
3. 3. Papaya fruit 30% ethanol extract (Production Example 9) 0.01
4. Citric acid 6.00
5. Sucrose 11.00
6. Fragrance 1.00
7. Water 80.09
<Manufacturing method>
Ingredients 1 to 6 are stirred and dissolved in a part of water of ingredient 7. Next, the remaining water of component 7 is added and mixed, and the sterilized product is used as a beverage.
<Usage>
Take 50 mL per day.

Prescription example 6 Toner <Prescription>
Ingredient content (%)
1. 1. Guava leaf 30% ethanol extract (Production Example 2) 5.0
2. Pineapple fruit ethanol extract (Production Example 6) 5.0
3. 3. Papaya fruit powder (Production Example 7) 5.0
4. Glycerin 5.0
5. Polyoxyethylene sorbitan monolaurate 1.5
6. Ethanol 5.0
7. Preservative 0.5
8. Water 73.0
<Manufacturing method>
Ingredients 1 to 7 are stirred and dissolved in the water of ingredient 8.
<Usage>
Apply 2 mL per day to the skin.

Comparative Example 1 Conventional Granules The granules of Formulation Example 1 in which the guava leaf 30% ethanol extract (Production Example 2) was replaced with lactose were used as the conventional granules.

Test Example 1 PAD1 expression promoting action, SMPD1 expression promoting action and ASAH1 expression suppressing action by Guava leaves To human keratinocyte HaCaT cultured to confluence in DMEM medium, Guava leaf 30% ethanol extract (Production Example 2) was added for 24 hours. , PAD1 gene expression analysis was performed by the real-time PCR method, and the expression level under the non-addition condition was set to 1 for comparison. In addition, gene expression analysis of sphingomyelin phosphodiesterase 1 (SMPD1, sphingomyelin phosphodiesterase 1) and N-acetylsphingosine amide hydrolase 1 (ASAH1, N-acetylsphingosine amidohydrose1) was performed.

Primer set for PAD1 GGGCCCCACTTAGAATTGCT (SEQ ID NO: 1)
GTGCAGATGCAAAGTCATTACCTT (SEQ ID NO: 2)
Primer set for SMPD1 GAAAGGGTGAAAAAAGCCCAAAT (SEQ ID NO: 3)
GGTTCTTTCACCGGATGATCTT (SEQ ID NO: 4)
Primer set for ASAH1 GAATCCAGCAGCGTGTGTGA (SEQ ID NO: 5)
AGGTAGAAGTGAAAAAACTGAAGAATAGTG (SEQ ID NO: 6)

The results of Test Example 1 are shown in Table 1. The guava leaf 30% ethanol extract (Production Example 2) promoted the expression of PAD1. From this, the PAD1 expression promoting action of the guava leaf was shown. In addition, the guava leaf 30% ethanol extract of Production Example 2 promoted the expression of SMPD1 and suppressed the expression of ASAH1.

Since the guava leaf 30% ethanol extract (Production Example 2) promoted the expression of PAD1, which is important in moisturizing, the guava leaf has a moisturizing effect.

Since the guava leaf 30% ethanol extract (Production Example 2) promoted the expression of PAD1, which is important for hair development and elongation, the guava leaf has a hair growth and hair growth effect.

Test Example 2 PAD1 expression promoting action by guava leaves, pineapple fruits, and papaya fruits To human keratinocytes HaCaT cultured to confluence in DMEM medium, guava leaves 30% ethanol extract (Production Example 2), pineapple fruit ethanol extract (Production Example 6) ), Pineapple fruit powder (Production Example 7) was added for 24 hours, and gene expression analysis was performed by the real-time PCR method. The same primer as in Test Example 1 was used, and the expression level under the condition of no addition was set to 1 for comparison.

The results of Test Example 2 are shown in Table 2. Compared with the case where 30% ethanol extract of guaba leaf (Production Example 2), pineapple fruit ethanol extract (Production Example 6), and papaya fruit powder (Production Example 7) were added, Production Examples 2, 6 and 7 were added. The combination showed a significant increase in PAD1 expression level. From this, the combined use of guava leaf, pineapple fruit, and papaya fruit shows a particularly remarkable PAD1 expression promoting effect, and has an excellent moisturizing effect, hair growth, and hair growth effect.

Test Example 3 Moisturizing effect by human drinking 104 males and females (20s to 50s) were divided into 4 groups of 26 each, and contained guava leaf-containing granules (prescription example 1), guava leaves, pineapple fruit, and papaya fruit. Granules (formulation example 2), guava leaves, pineapple fruit, papaya fruit, β-carotene, vitamin C, vitamin E-containing granules (formulation example 3), conventional granules (comparative example 1), 1 1.6 g of the dose was drunk twice a day for 3 months. To evaluate the moisturizing effect, the keratin water content was measured using a corneometer and the water evaporation amount was measured using a tevameter. Compared.

The results of Test Example 3 are shown in Table 3. Drinking of granules containing guava leaves (Prescription Example 1) showed an increase in keratin water content and a decrease in water evaporation amount. Therefore, the moisturizing effect of guava leaves was shown.

Drinking of the granule (Prescription Example 2) containing guava leaves, pineapple fruit, and papaya fruit showed a remarkable increase in keratin water content and a decrease in water evaporation amount as compared with the drinking of Formulation Example 1. Therefore, the combined use of guava leaves, pineapple fruits, and papaya fruits showed an excellent moisturizing effect.

In addition, drinking of Formulation Example 1, Formulation Example 2 and Formulation Example 3 showed not only an increase in keratin water content and a decrease in water evaporation amount, but also an improvement in dryness and dryness of the body such as heels, ankles, shins and elbows.

Test Example 4 Hair growth and hair growth effect by human drinking 104 males and females (20s to 50s) were divided into 4 groups of 26 each, and granules containing guava leaves (prescription example 1), guava leaves, pineapple fruits, papaya Fruit-containing granules (prescription example 2), guava leaves, pineapple fruits, papaya fruits, β-carotene, vitamin C, vitamin E-containing granules (formulation example 3), conventional granules (comparative example 1) 1.6 g of guava was drunk twice a day for 6 months. To evaluate the hair growth and hair growth effect, hair was cut (1 cm x 1 cm, the hair on the temporal region was cut with scissors from the root) before drinking, and a photograph was taken, and the number of hairs was counted from the image of the photograph. .. After the end of drinking, the hair was cut (1 cm × 1 cm, the hair on the temporal region was cut from the root with scissors), a photograph was taken, and the number of hairs and the length of the hairs were measured from the image of the photograph. Two days later, a photograph was taken and the length of the hair was measured. The hair elongation rate was calculated as a percentage of the length of the hair elongated in 2 days after the end of drinking, when the length of the hair elongated by drinking the granule of Comparative Example 1 was set to 100. The rate of increase in the number of hairs was shown as a ratio of the number of hairs after drinking of each granule as compared with that before drinking, when the number of hairs before drinking was 100 for each granule.

The results of Test Example 4 are shown in Table 4. Drinking of granules containing guava leaves (Prescription Example 1) improved the rate of hair elongation and the rate of increase in the number of hairs. Therefore, the hair growth and hair growth effects of guava leaves were shown.

Drinking of granules containing guava leaves, pineapple fruits, and papaya fruits (Prescription Example 2) showed a remarkable rate of hair elongation and a rate of increase in the number of hairs as compared with the drinking of Formulation Example 1. Therefore, the combined use of guava leaves, pineapple fruits, and papaya fruits showed excellent hair growth and hair growth effects.

From the above results, the PAD1 expression promoting action, the moisturizing action, the hair growth and the hair growth action of the guava leaf were shown. In addition, the combined use of guava leaves, pineapple fruits, and papaya fruits showed excellent PAD1 expression promoting action, moisturizing action, hair growth and hair growth action.

The PAD1 expression-promoting agent of the present invention exhibited excellent PAD1 expression-promoting action, moisturizing action, hair growth and hair growth action. Therefore, it is useful for use as a food, quasi-drug, or pharmaceutical product having an excellent PAD1 expression promoting effect, moisturizing effect, hair growth and hair growth effect. It can also be used as an external preparation for the skin.

Claims (5)

A peptidyl arginine deiminase 1 (PAD1) expression promoter containing guava leaves. The PAD1 expression promoter according to claim 1, which contains a pineapple fruit and a papaya fruit. A moisturizer containing the PAD1 expression-promoting agent according to claim 1 or 2. A hair growth agent and a hair growth agent containing the PAD1 expression promoter according to claim 1 or 2. A food composition for promoting PAD1 expression, moisturizing or hair growth, and hair growth, containing the PAD1 expression promoting agent according to claim 1 or 2.