WO2023090947A1 - 코로나바이러스 감염 질환의 예방 또는 치료용 약제학적 조성물 - Google Patents
코로나바이러스 감염 질환의 예방 또는 치료용 약제학적 조성물 Download PDFInfo
- Publication number
- WO2023090947A1 WO2023090947A1 PCT/KR2022/018334 KR2022018334W WO2023090947A1 WO 2023090947 A1 WO2023090947 A1 WO 2023090947A1 KR 2022018334 W KR2022018334 W KR 2022018334W WO 2023090947 A1 WO2023090947 A1 WO 2023090947A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- peg
- pharmaceutical composition
- art
- formula
- integer
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/357—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having two or more oxygen atoms in the same ring, e.g. crown ethers, guanadrel
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/74—Synthetic polymeric materials
- A61K31/765—Polymers containing oxygen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
Definitions
- the present invention relates to a pharmaceutical composition for preventing or treating a coronavirus infectious disease, and more particularly, to a SARS-CoV-2 virus that causes coronavirus infection-19, including a polyethylene glycol-artemisinin compound. It relates to a pharmaceutical composition capable of preventing or treating coronavirus infection diseases without side effects while having excellent antiviral activity and low toxicity.
- SARS-CoV-2 is the causative virus that causes coronavirus infection-19 (COVID-19). Its main propagation route is spread after contact with a medium through saliva (droplet) of an infected person, surface contact, air, etc. The incubation period is 1-14 days, and it is analyzed and judged by gene (PCR) detection and virus isolation regardless of clinical symptoms. The main symptoms are fever (37.5°C or higher), shortness of breath, chills, muscle pain, chest pain, etc., and the signs are also difficult to predict. In addition, there are various variants such as alpha, beta, gamma, and delta.
- the body's immune system plays a key role in this defense against COVID-19. It can prevent the spread of pathogens in the body by increasing the immune response following viral infection. However, some strains not only proliferate in the body by avoiding the immune system attack, but also induce an inflammatory response in the lungs, which can cause pneumonia. It can also trigger a massive inflammatory response known as a cytokine storm in some people, which can lead to severe pathological consequences.
- symptomatic treatment such as antipyretic administration, fluid supply, antitussive administration, and extracorporeal membrane oxygen supply are provided. It is to the extent that the aggravation of infection symptoms is improved with the help of side-type antiviral drugs.
- various vaccines have recently been developed and used worldwide, but these are also accompanied by breakthrough infections and side effects.
- Korean Patent Registration No. 10-2145197 discloses 2'-fluoro-5-methyl- ⁇ -L-arabinofuranosyluridine or a pharmaceutically acceptable salt thereof containing coronavirus infection-19 ( A drug for the treatment of coronavirus disease 2019, COVID-19 is disclosed.
- An object of the present invention is to provide a pharmaceutical composition capable of preventing or treating coronavirus infectious diseases without side effects, having excellent antiviral activity against the SARS-CoV-2 virus and low toxicity.
- One embodiment of the present invention relates to a pharmaceutical composition for preventing or treating a coronavirus infectious disease, comprising at least one of the following polyethylene glycol (PEG)-artemisinin compounds of Formulas 1 and 2.
- PEG polyethylene glycol
- n is an integer from 0 to 2000;
- R is a hydrogen atom or a C 1 -C 18 alkyl group
- n is an integer from 0 to 1000;
- the C 1 -C 18 alkyl group refers to a straight-chain or branched hydrocarbon having 1 to 18 carbon atoms, and examples thereof include methyl, ethyl, n-propyl, i-propyl, n-butyl, i- butyl, s-butyl, t-butyl, n-pentyl, n-hexyl, and the like, but are not limited thereto.
- n is an integer from 0 to 1000;
- R is a hydrogen atom or a C 1 -C 6 alkyl group
- m may be an integer from 0 to 500.
- n is an integer from 1 to 500;
- R is a hydrogen atom or a C 1 -C 3 alkyl group
- n may be an integer from 1 to 250.
- the polyethylene glycol (PEG)-artemisinin compound of Chemical Formula 1 according to the present invention may be prepared according to the method shown in Scheme 1 below.
- the method described in the reaction scheme below is merely an example of the method typically used in the present invention, and the order of unit operations, reaction reagents, reaction conditions, etc. may be changed as needed.
- n is as defined in Formula 1.
- the polyethylene glycol (PEG)-artemisinin compound of Formula 1 is prepared by combining polyethylene glycol (PEG) of Formula 3a and succinic anhydride of Formula 4, such as dimethylaminopyridine (DMAP). Reacting in the presence of a catalyst and a base such as triethylamine (TEA) to obtain a compound of Formula 5, reacting the compound of Formula 5 with hydrochloric acid to obtain a compound of Formula 6, and then reacting the compound of Formula 6 and Formula 8 It can be prepared by reacting dihydroartemisinin in the presence of a coupling agent such as dicyclohexylcarbodiimide (DCC) and a catalyst such as DMAP.
- a coupling agent such as dicyclohexylcarbodiimide (DCC) and a catalyst such as DMAP.
- the polyethylene glycol (PEG)-artemisinin compound of Chemical Formula 2 according to the present invention may be prepared according to the method shown in Scheme 2 below.
- the method described in the reaction scheme below is merely an example of the method typically used in the present invention, and the order of unit operations, reaction reagents, reaction conditions, etc. may be changed as needed.
- R and m are as defined in Formula 2.
- the polyethylene glycol (PEG)-artemisinin compound of Formula 2 is reduced by reducing artemisinin of Formula 7 using a reducing agent such as diisobutylaluminum hydride (DIBAL-H).
- DIBAL-H diisobutylaluminum hydride
- dihydroartemisinin of Formula 8 and polyethylene glycol (PEG) compound of Formula 3b were mixed with boron trifluoride-ether [BF 3 (OEt) 2 ] It can be prepared by reacting in the presence of a catalyst such as
- Polyethylene glycol (PEG)-artemisinin compounds of Formulas 1 and 2 according to the present invention have low cytotoxicity and exhibit excellent antiviral activity against the SARS-CoV-2 virus that causes coronavirus infection-19. In addition, it exhibits excellent anti-inflammatory activity in the lung and can be present in plasma for a longer period of time compared to artesunate (Experimental Examples 1 to 3).
- the polyethylene glycol (PEG)-artemisinin compounds of Chemical Formulas 1 and 2 according to the present invention can inhibit or inhibit RdRp (RNA-dependent RNA polymerase) activity (Experimental Example 2).
- RdRp RNA-dependent RNA polymerase
- the RdRp is an enzyme responsible for RNA genome replication and transcription in most RNA viruses including SARS-CoV-2.
- polyethylene glycol (PEG)-artemisinin compounds of Chemical Formulas 1 and 2 according to the present invention have excellent solubility in water and organic solvents.
- composition containing the compound can be effectively used for preventing or treating a coronavirus infection disease caused by the SARS-CoV-2 virus, that is, coronavirus disease 2019 (COVID-19).
- the SARS-CoV-2 virus may include its mutants.
- the variant may be a mutation in the spike protein of the SARS-CoV-2 virus.
- composition according to the present invention can be effectively used for the prevention or treatment of diseases caused by coronavirus infection, such as pneumonia, acute respiratory infection, hypoxic respiratory failure, acute respiratory syndrome, sepsis or severe acute respiratory syndrome. .
- the pharmaceutical composition according to the present invention is easy to use as an oral therapeutic agent, has no side effects, and has excellent durability and bioavailability during in vivo administration.
- the pharmaceutical composition according to the present invention may further include at least one other antiviral agent in addition to the polyethylene glycol (PEG)-artemisinin compounds of Formulas 1 and 2 above.
- PEG polyethylene glycol
- viral replication inhibitors for example, viral replication inhibitors, helicase inhibitors, viral protease inhibitors, virus cell entry inhibitors, etc. may be used, and specifically, ribavirin, interferon, niclosamide ( niclosamide), etc. can be used.
- the pharmaceutical composition according to the present invention may be administered orally (eg, ingestion or inhalation) or parenterally (eg, injection, percutaneous absorption, rectal administration), and injection is, for example, intravenous injection , subcutaneous injection, intramuscular injection or intraperitoneal injection.
- the pharmaceutical composition according to the present invention may be formulated into tablets, capsules, granules, fine subtilae, powders, sublingual tablets, suppositories, ointments, injections, emulsions, suspensions, syrups, sprays, etc. can be formulated.
- the pharmaceutical composition may be in tablet form.
- compositions according to the present invention can be prepared by known techniques using pharmaceutically acceptable carriers commonly used in each formulation.
- pharmaceutically acceptable carriers are excipients, binders, disintegrating agents, lubricants, preservatives, antioxidants, isotonic agents, buffers, coating agents, sweetening agents, solubilizing agents, bases, dispersing agents, wetting agents. , suspending agents, stabilizers, colorants and the like.
- the pharmaceutical composition according to the present invention includes about 0.001 to 95% by weight of at least one of the polyethylene glycol (PEG)-artemisinin compounds of Chemical Formulas 1 and 2, depending on the type of drug.
- PEG polyethylene glycol
- the specific dosage of the pharmaceutical composition of the present invention may vary depending on the type, weight, sex, degree of disease, judgment of a doctor, etc. of mammals including humans to be treated.
- a doctor, etc. of mammals including humans to be treated.
- 0.01 to 50 mg of the active ingredient per 1 kg of body weight is administered per day
- 0.01 to 10 mg of the active ingredient per 1 kg of body weight is administered per day.
- the total daily dose may be administered at one time or divided into several times depending on the severity of the disease, the doctor's judgment, and the like.
- the polyethylene glycol-artemisinin compound according to the present invention has low cytotoxicity, exhibits excellent antiviral activity against the SARS-CoV-2 virus that causes coronavirus infection-19, and exhibits excellent anti-inflammatory activity in the lungs. It exhibits activity and can exist in plasma for a longer period of time compared to artesunate, so it can be effectively used in a pharmaceutical composition for preventing or treating coronavirus infection caused by SARS-CoV-2 virus.
- FIG. 1a to 1c show artesunate (Art), PEG-400-artemisinin compound (Art-PEG400) obtained in Example 2, and PEG-1500-artemisinin compound (Art-PEG1500) obtained in Example 1.
- the cytotoxicity evaluation results for Vero cells are shown.
- FIG. 3a to 3b show Paxlovid, Artesunate (Art), PEG-1500-artemisinin compound (Art-PEG1500) obtained in Example 1 in lung tissues of SARS-CoV-2 infected hamsters. and the result of confirming the virus proliferation inhibition result of the normal control group (Mock) through RT-PCR.
- FIGS. 4a to 4c show Paxlovid, artesunate (Art), PEG-1500-artemisinin compound (Art-PEG1500) obtained in Example 1 in lung tissues of SARS-CoV-2 infected hamsters. , This is the result of confirming the inflammation inhibition results of the normal control group (Mock) and the vehicle control group through RT-PCR.
- PEG-3400-disuccinic acid (570mg, 0.16mmol) obtained in Preparation Example 3, dihydroartemisinin (107mg, 0.38mmol) and dimethylaminopyridine (DMAP, 30mg, 0.25mmol) obtained in Synthesis Example 1 were mixed To a dry dichloromethane (20 ml) solution, dicyclohexylcarbodiimide (DCC, 102 mg, 0.50 mmol) was added. The reaction mixture was stirred at room temperature for 24 hours, the residue was filtered off, and the resulting solution was dried and precipitated with diethyl ether. The reaction mixture was purified by crystallization from tetrahydrofuran/diethyl ether to obtain 405 mg of PEG-3400-artemisinin compound as a waxy solid (yield: 62%).
- DCC dicyclohexylcarbodiimide
- PEG-8000-disuccinic acid 400mg, 0.05mmol obtained in Preparation Example 4, dihydroartemisinin (33mg, 0.12mmol), DCC (31mg, 0.15mmol) and dimethylaminopyridine (DMAP) obtained in Synthesis Example 1 , 6mg, 0.05mmol) and crystallized from tetrahydrofuran/diethyl ether to obtain 320mg of PEG-8000-artemisinin compound as a white waxy solid in the same manner as in Example 3, except for purification. (Yield: 72%).
- Vero cells were cultured in DMEM medium containing 10% FBS at 37°C and 5% CO 2 conditions. Subculture was performed every 2 days. To confirm cytotoxicity, 1x10 4 cells per well were placed in a 96-well plate and cultured for 24 hours before use.
- each concentration of artesunate (Art), PEG-400-artemisinin compound (Art-PEG400) obtained in Example 2 and PEG-1500-artemisinin compound obtained in Example 1 (Art-PEG1500) was cultured for 48 hours after treatment with 100ul per well. After removing the medium, 100ul of a medium containing 0.5 mg/ml of MTT was added and incubated for 1 hour. The formed MTT formazan was sufficiently dissolved in 200 ul of DMSO, and absorbance was measured at 540 nm.
- the CC 50 of Art, Art-PEG400, and Art-PEG1500 in Vero cells were 6.818, 14.47, and 22.17 ug/ml, respectively. From this, it can be seen that Art-PEG400 and Art-PEG1500 obtained through pegylation exhibit lower toxicity to Vero cells than Art.
- Calu-3 cells were cultured in EMEM medium containing 10% FBS at 37°C and 5% CO 2 conditions. Subculture was performed every 2 days. To confirm cytotoxicity, 1x10 4 cells per well were placed in a 96-well plate and cultured for 24 hours before use.
- each concentration of artesunate (Art), PEG-400-artemisinin compound (Art-PEG400) obtained in Example 2 and PEG-1500-artemisinin compound obtained in Example 1 (Art-PEG1500) was cultured for 48 hours after treatment with 100ul per well. After removing the medium, 100ul of a medium containing 0.5 mg/ml of MTT was added and incubated for 1 hour. After sufficiently dissolving the formed MTT formazan with 200 ul of DMSO, absorbance was measured at 540 nm.
- a 9-week-old male Syrian hamster was supplied from the central laboratory animal (Seoul, Korea), and was allowed to freely consume water and feed. Temperature (23 ⁇ 3 ° C), humidity (55 ⁇ 15%) The light/dark cycle (12 hours, 08:00 ⁇ 20:00) was automatically adjusted.
- the SARS-CoV-2 virus was purchased from the National Culture Collection for Pathogens (NCCP).
- An animal model for infection was prepared by inoculating 100 ⁇ l of the SARS-CoV-2 virus (1 ⁇ 10 6 PFU/100 ⁇ l) into the nasal cavity of the hamster.
- a normal control group not inoculated with the virus and a vehicle control group administered only with the solvent at the same time were used.
- the caudal lobe was selected for virus-specific gene detection and homogenized using a trizol solution. Thereafter, the supernatant containing the RNA in the lung tissue was taken through centrifugation after mixing in chloroform, and the RNA pellet was obtained by mixing in the same amount of isopropanol and centrifuging. RNA samples were prepared by washing the RNA pellets with 70% ethanol, drying them at room temperature, and dissolving them in sterile distilled water. cDNA was synthesized using the extracted RNA as a template and random hexamer and oligo dT as primers.
- the Art-PEG1500 administration group showed better antiviral efficacy than the Art administration group.
- RNA samples were prepared by washing the RNA pellets with 70% ethanol, drying them at room temperature, and dissolving them in sterile distilled water.
- cDNA was synthesized using the extracted RNA as a template and random hexamer and oligo dT as primers.
- the Art-PEG1500-administered group showed better anti-inflammatory efficacy in the lungs than the vehicle control group and the Art-administered group.
- mice were intravenously injected with each drug at 5 mg/kg.
- Venous blood was collected for a predetermined time interval after administration, and plasma was collected by centrifugation immediately after the blood collection.
- 580 ⁇ l of acetonitrile (including internal standard) was added to 20 ⁇ l of plasma, mixed, and centrifuged at 4° C. at 15,000 rpm for 5 minutes.
- terfenadine was used as an internal standard.
- the supernatant obtained after centrifugation was quantitatively analyzed using liquid chromatography-mass spectrometry (LC-MS/MS).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Chemical & Material Sciences (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Virology (AREA)
- Epidemiology (AREA)
- Communicable Diseases (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Molecular Biology (AREA)
- Heterocyclic Carbon Compounds Containing A Hetero Ring Having Oxygen Or Sulfur (AREA)
Abstract
폴리에틸렌 글라이콜-아르테미시닌 화합물을 포함하는 코로나바이러스 감염 질환의 예방 또는 치료용 약제학적 조성물이 개시되어 있다. 상기 약제학적 조성물은 코로나바이러스 감염증-19의 원인이 되는 SARS-CoV-2 바이러스에 대한 항바이러스 활성이 우수하면서 독성이 낮아 부작용 없이 코로나바이러스 감염 질환을 예방 또는 치료하기 위해 유리하게 사용될 수 있다.
Description
본 발명은 코로나바이러스 감염 질환의 예방 또는 치료용 약제학적 조성물에 관한 것으로, 더욱 상세하게는 폴리에틸렌 글라이콜-아르테미시닌 화합물을 포함하여 코로나바이러스 감염증-19의 원인이 되는 SARS-CoV-2 바이러스에 대한 항바이러스 활성이 우수하면서 독성이 낮아 부작용 없이 코로나바이러스 감염 질환을 예방 또는 치료할 수 있는 약제학적 조성물에 관한 것이다.
사스-코로나바이러스-2(SARS-CoV-2)는 코로나바이러스감염증-19 (COVID-19)를 유발하는 원인 바이러스이다. 이의 주된 전파경로로는 감염자의 침방울(비말), 표면접촉, 공기 등으로 매개체에 접촉 후 전파된다. 잠복기는 1-14일로, 임상 양상에 관계없이 유전자(PCR) 검출 및 바이러스 분리에 의해 분석, 판단된다. 주요 증상은 발열(37.5℃ 이상), 호흡곤란, 오한, 근육통, 흉통 등으로, 징후 또한 예측이 어렵다. 또한, 알파, 베타, 감마, 델타 등 다양한 변이 종이 존재한다.
체내 면역체계는 이러한 COVID-19에 대한 방어에 핵심적인 역할을 한다. 바이러스 감염에 따른 면역 반응을 증가시켜 체내 병원균의 확산을 막을 수 있다. 그러나 일부 변종은 면역계 공격을 회피해 체내에서 증식할 뿐만 아니라 폐에 염증 반응을 유도하여 폐렴을 유발할 수 있다. 또한, 일부에게서는 사이토카인 폭풍 (cytokine storm)이라고 알려진 대규모 염증반응을 유발하여 심각한 병리학적 결과를 초래할 수 있다.
현재까지 특이 치료제는 없으며, 그 증상에 따라 해열제 투약, 수액 공급, 진해제 투약 등 대증 치료요법과 체외막 산소공급을 해주며, 병행하여 긴급 사용 승인된 렘데시비르 또는 몰루나피비르 등의 뉴클레오사이드계 항바이러스제의 도움을 받아 감염 증세의 악화를 개선하는 정도이다. 예방제로는, 최근에 전세계적으로 다양한 백신을 개발하여 사용 중이나, 이 역시 돌파 감염 및 부작용을 동반하고 있는 실정이다.
예를 들어, 대한민국 등록특허 제10-2145197호에는 2'-플루오로-5-메틸-β-L-아라비노푸라노실우리딘 또는 이의 약제학적으로 허용되는 염을 포함하는 코로나바이러스감염증-19 (coronavirus disease 2019, COVID-19) 치료용 약제가 개시되어 있다.
그러나, 여전히 독성이 낮아 부작용이 적으면서도 코로나바이러스 활성 억제효과가 우수한 새로운 치료제의 개발이 절실히 요구되고 있다.
본 발명의 목적은 SARS-CoV-2 바이러스에 대한 항바이러스 활성이 우수하면서 독성이 낮아 부작용 없이 코로나바이러스 감염 질환을 예방 또는 치료할 수 있는 약제학적 조성물을 제공하는 것이다.
본 발명의 일 실시형태는 하기 화학식 1 및 2의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물 중 하나 이상을 포함하는 코로나바이러스 감염 질환의 예방 또는 치료용 약제학적 조성물에 관한 것이다.
[화학식 1]
[화학식 2]
상기 식에서,
n은 0 내지 2000의 정수이고,
R은 수소 원자 또는 C1-C18의 알킬기이며,
m은 0 내지 1000의 정수이다.
본 명세서에서 사용되는 C1-C18의 알킬기는 탄소수 1 내지 18개로 구성된 직쇄형 또는 분지형 탄화수소를 의미하며, 예를 들어 메틸, 에틸, n-프로필, i-프로필, n-부틸, i-부틸, s-부틸, t-부틸, n-펜틸, n-헥실 등이 포함되나 이에 한정되는 것은 아니다.
본 발명의 일 실시형태에서,
n은 0 내지 1000의 정수이고,
R은 수소 원자 또는 C1-C6의 알킬기이며,
m은 0 내지 500의 정수일 수 있다.
본 발명의 일 실시형태에서,
n은 1 내지 500의 정수이고,
R은 수소 원자 또는 C1-C3의 알킬기이며,
m은 1 내지 250의 정수일 수 있다.
본 발명에 따른 상기 화학식 1의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물은 하기 반응식 1에 나타낸 방법에 따라 제조될 수 있다. 하기 반응식에 기재된 방법은 본 발명에서 대표적으로 사용된 방법을 예시한 것일 뿐 단위조작의 순서, 반응시약, 반응조건 등은 경우에 따라 얼마든지 변경될 수 있다.
[반응식 1]
상기 식에서,
n은 화학식 1에서 정의한 바와 같다.
상기 반응식 1에 도시된 바와 같이, 화학식 1의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물은 화학식 3a의 폴리에틸렌 글라이콜(PEG)과 화학식 4의 숙신산 무수물을 디메틸아미노피리딘(DMAP)과 같은 촉매와 트리에틸아민(TEA)과 같은 염기의 존재 하에 반응시켜 화학식 5의 화합물을 수득하고, 화학식 5의 화합물을 염산과 반응시켜 화학식 6의 화합물을 수득한 후, 화학식 6의 화합물과 화학식 8의 디하이드로아르테미시닌을 디사이클로헥실카보디이미드(DCC)와 같은 커플링제와 DMAP와 같은 촉매의 존재 하에 반응시켜 제조할 수 있다.
본 발명에 따른 상기 화학식 2의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물은 하기 반응식 2에 나타낸 방법에 따라 제조될 수 있다. 하기 반응식에 기재된 방법은 본 발명에서 대표적으로 사용된 방법을 예시한 것일 뿐 단위조작의 순서, 반응시약, 반응조건 등은 경우에 따라 얼마든지 변경될 수 있다.
[반응식 2]
상기 식에서,
R 및 m은 화학식 2에서 정의한 바와 같다.
상기 반응식 2에 도시된 바와 같이, 화학식 2의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물은 화학식 7의 아르테미시닌을 디아이소부틸알루미늄하이드라이드(DIBAL-H)와 같은 환원제를 사용하여 환원 반응시켜 화학식 8의 디하이드로아르테미시닌을 수득한 후, 화학식 8의 디하이드로아르테미시닌과 화학식 3b의 폴리에틸렌 글라이콜(PEG) 화합물을 보론트리플로라이드-에테르[BF3(OEt)2]와 같은 촉매의 존재 하에 반응시켜 제조할 수 있다.
본 발명에 따른 화학식 1 및 2의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물은 세포 독성이 낮으며, 코로나바이러스 감염증-19의 원인이 되는 SARS-CoV-2 바이러스에 대한 우수한 항바이러스 활성을 나타낼 뿐만 아니라 폐에서 우수한 항염증 활성을 나타내고 아르테수네이트 대비 더욱 오랫동안 혈장 내에 존재할 수 있다(실험예 1 내지 3).
특히, 본 발명에 따른 화학식 1 및 2의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물은 RdRp (RNA-dependent RNA polymerase) 활성을 저해 또는 억제시킬 수 있다(실험예 2). 상기 RdRp는 SARS-CoV-2 포함 대부분의 RNA 바이러스에서 RNA 게놈의 복제와 전사를 담당하는 효소이다.
또한, 본 발명에 따른 화학식 1 및 2의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물은 물 및 유기용매에 대한 용해도가 우수하다.
따라서, 상기 화합물을 포함하는 조성물은 SARS-CoV-2 바이러스에 의한 코로나바이러스 감염 질환, 즉 코로나바이러스 감염증-19 (coronavirus disease 2019, COVID-19)의 예방 또는 치료를 위해 효과적으로 사용될 수 있다.
상기 SARS-CoV-2 바이러스는 그 변이체를 포함할 수 있다.
상기 변이체는 SARS-CoV-2 바이러스의 스파이크 단백질 (spike protein)에 변이가 발생한 것일 수 있다.
또한, 본 발명에 따른 조성물은 코로나바이러스 감염 질환으로 인한 질병, 예를 들어 폐렴, 급성 호흡기 감염, 저산소 호흡기 부전, 급성 호흡기 장애증후군, 패혈증 또는 중증 급성 호흡기 증후군 등의 예방 또는 치료에 효과적으로 사용될 수 있다.
특히, 본 발명에 따른 약제학적 조성물은 경구용 치료제로서 사용이 간편하며, 부작용이 없고, 생체 투여시 지속성이 우수하며 생체 이용률이 뛰어나다.
본 발명에 따른 약제학적 조성물은 상기 화학식 1 및 2의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물 이외에, 적어도 하나의 다른 항바이러스제를 추가로 포함할 수 있다.
상기 다른 항바이러스제로는 예를 들면, 바이러스 복제 억제제, 헬리카아제 억제제, 바이러스 프로테아제 억제제, 바이러스 세포 진입 억제제 등을 사용할 수 있으며, 구체적으로는 리바비린(ribavirin), 인터페론(interferon), 니클로사미드(niclosamide) 등을 사용할 수 있다.
본 발명에 따른 약제학적 조성물은 경구적으로(예를 들면, 복용 또는 흡입) 또는 비경구적으로(예를 들면, 주사, 경피흡수, 직장투여) 투여될 수 있으며, 주사는 예를 들면, 정맥주사, 피하주사, 근육내 주사 또는 복강내 주사일 수 있다. 본 발명에 따른 약제학적 조성물은 투여 경로에 따라, 정제, 캡슐제, 과립제, 파인 서브틸래(fine subtilae), 분제, 설하 정제, 좌약, 연고, 주사제, 유탁액제, 현탁액제, 시럽제, 분무제 등으로 제형화될 수 있다. 바람직하기로, 상기 약제학적 조성물은 정제 형태일 수 있다. 상기 여러 가지 형태의 본 발명에 따른 약제학적 조성물은 각 제형에 통상적으로 사용되는 약제학적으로 허용되는 담체(carrier)를 사용하여 공지기술에 의해 제조될 수 있다. 약제학적으로 허용되는 담체의 예는 부형제, 결합제, 붕해제(disintegrating agent), 윤활제, 방부제, 항산화제, 등장제(isotonic agent), 완충제, 피막제, 감미제, 용해제, 기제(base), 분산제, 습윤제, 현탁화제, 안정제, 착색제 등을 포함한다.
본 발명에 따른 약제학적 조성물은 약제의 형태에 따라 다르지만, 상기 화학식 1 및 2의 폴리에틸렌 글라이콜(PEG)-아르테미시닌 화합물 중 하나 이상을 약 0.001 내지 95 중량%로 포함한다.
본 발명의 약제학적 조성물의 구체적인 투여량은 치료되는 사람을 포함한 포유동물의 종류, 체중, 성별, 질환의 정도, 의사의 판단 등에 따라 다를 수 있다. 바람직하게는, 경구 투여의 경우에는 하루에 체중 1kg당 활성성분 0.01 내지 50 mg이 투여되고, 비경구투여의 경우에는 하루에 체중 1kg당 활성성분 0.01 내지 10 mg이 투여된다. 상기 총 일일 투여량은 질환의 정도, 의사의 판단 등에 따라 한번에 또는 수회로 나누어 투여될 수 있다.
본 발명에 따른 폴리에틸렌 글라이콜-아르테미시닌 화합물은 세포 독성이 낮으며, 코로나바이러스 감염증-19의 원인이 되는 SARS-CoV-2 바이러스에 대한 우수한 항바이러스 활성을 나타낼 뿐만 아니라 폐에서 우수한 항염증 활성을 나타내고 아르테수네이트 대비 더욱 오랫동안 혈장 내에 존재할 수 있어 SARS-CoV-2 바이러스에 의한 코로나바이러스 감염 질환의 예방 또는 치료용 약제학적 조성물에 효과적으로 사용될 수 있다.
도 1a 내지 도 1c는 아르테수네이트(Art), 실시예 2에서 얻은 PEG-400-아르테미시닌 화합물(Art-PEG400) 및 실시예 1에서 얻은 PEG-1500-아르테미시닌 화합물(Art-PEG1500)의 Vero 세포에 대한 세포 독성 평가 결과를 나타낸다.
도 2a 내지 도 2c는 아르테수네이트(Art), 실시예 2에서 얻은 PEG-400-아르테미시닌 화합물(Art-PEG400) 및 실시예 1에서 얻은 PEG-1500-아르테미시닌 화합물(Art-PEG1500)의 Calu-3 세포에 대한 세포 독성 평가 결과를 나타낸다.
도 3a 내지 도 3b는 SARS-CoV-2 감염 햄스터의 폐 조직에서, 팍스로비드(Paxlovid), 아르테수네이트(Art), 실시예 1에서 얻은 PEG-1500-아르테미시닌 화합물(Art-PEG1500) 및 정상 대조군(Mock)의 바이러스 증식 억제 결과를 RT-PCR을 통해 확인한 결과이다.
도 4a 내지 도 4c는 SARS-CoV-2 감염 햄스터의 폐 조직에서, 팍스로비드(Paxlovid), 아르테수네이트(Art), 실시예 1에서 얻은 PEG-1500-아르테미시닌 화합물(Art-PEG1500), 정상 대조군(Mock) 및 vehicle 대조군의 염증 억제 결과를 RT-PCR을 통해 확인한 결과이다.
이하, 실시예에 의해 본 발명을 보다 구체적으로 설명하고자 한다. 이들 실시예는 오직 본 발명을 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업자에게 있어서 자명하다.
합성예 1: 디하이드로아르테미시닌(DQHS)의 제조
건조된 테트라하이드로퓨란(THF, 20ml)에 용해된 아르테미시닌(1g, 3.54mmol) 용액에, 디아이소부틸알루미늄하이드라이드(DIBAL, 5.4ml, 5.2mmol), 톨루엔 1.0 M 용액을 -78℃에서 적가하였다. 반응 혼합물을 상온에서 1시간 동안 교반한 후, 반응 용액을 빙초산으로 중화하였다. 반응 혼합물을 50℃ 이하에서 진공 농축하여 용매를 제거한 후, 잔여물을 실리카겔 플래시 컬럼 크로마토그래피(헥산/에틸아세테이트=6/1)로 정제하여 디하이드로아르테미시닌 0.29g을 흰색 고체로서 수득하였다(수율: 92%).
MP: 150-152℃
1H NMR(CDCl3): 5.61 (lH, s, H-5α), 5.40(lH, s, H-5β), 5.30(lH, d, J=3.1Hz, H12β), 4.78(1H, d, J=9.3Hz, H-12α).
제조예 1: PEG-1500-디숙신산의 제조
건조 PEG-1500(6.2g, 4.13mmol, Tm=45℃), 숙신산 무수물(1.03g, 10.3mmol), DMAP(1.1g, 9mmol) 및 트리에틸아민(1.15ml, 9mmol)을 건조된 디옥산(50ml)에 용해시키고, 상온에서 24시간 동안 교반하였다. 감압 하에서 디옥산을 제거한 후, 잔류물을 사염화탄소(40ml)에 녹이고 여과한 다음 건조하고, 에테르(200ml)로 침전시켰다. 얻어진 혼합물 고체를 디클로로메탄-에테르로부터 결정화하여 왁스 같은 고체로서 PEG-1500-디숙신산의 디메틸아미노피리디늄 염 6.4g을 얻었다(수율: 87%).
1H NMR(CDC13): 8.28(2H, d, 방향족-H), 6.64(2H, d, 방향족-H), 4.24(4H, m, COOCH2CH2), 3.64(131H, s, OCH2CH2), 2.62(8H, m, COCH2CH2).
상기 얻어진 염을 디클로로메탄(50ml)에 녹인 다음 1N HCl 용액으로 산성화한 후. 생성된 유기층을 물로 세척하고 MgSO4로 건조한 다음, 감압 농축한 후, 잔류물을 플래시 컬럼으로 정제하였다. 실리카겔 크로마토그래피(디클로메탄/메탄올=8:1)로 PEG-1500-디숙신산 5.5g을 왁스 같은 고체로서 얻었다(수율: 78%).
제조예 2: PEG-400-디숙신산의 제조
PEG-400(2.8g, 7mmol, Tm= -6℃), 숙신산 무수물(1.77g, 17mmol), DMAP(1.7g, 13.9mmol) 및 트리에틸아민(1.96ml, 13.9mmol)을 사용하는 것을 제외하고는, 제조예 1과 동일한 방법으로 PEG-400-디숙신산을 얻었다.
1H NMR(CDCl3): 4.25(4H, m, COOCH2CH2), 3.63(31H, s, OCH2CH2), 2.62(8H, s, COCH2CH2).
제조예 3: PEG-3400-디숙신산의 제조
PEG-3400(3.4g, 1mmol, Tm= 55℃), 숙신산 무수물(250mg, 2.5mmol), DMAP(244mg, 2mmol) 및 트리에틸아민(280mml, 2mmol)을 사용하는 것을 제외하고는, 제조예 1과 동일한 방법으로 PEG-3400-디숙신산을 얻었다.
1H NMR(CDCl3): 4.25(4H, m, COOCH2CH2), 3.63(303H, s, OCH2CH2), 2.62(8H, m, COCH2CH2).
제조예 4: PEG-8000-디숙신산의 제조
PEG-8000(6,54g. 0.82mmol, Tm= 62℃), 숙신산 무수물(204mg, 2.05mmol), DMAP(200mg, 1.64mmol) 및 트리에틸아민(230mml, 1,65mmol)을 사용하는 것을 제외하고는, 제조예 1과 동일한 방법으로 PEG-8000-디숙신산을 얻었다.
1H NMR(CDC13): 4.25(4H, m, COOCH2CH2), 3.63(722H, s, OCH2CH2), 2.62(8H, m, COCH2CH2).
실시예 1: 화학식 1의 PEG-1500-아르테미시닌 화합물의 제조
상기 제조예 1에서 얻은 PEG-1500-디숙신산(440mg, 0.26mmol), 상기 합성예 1에서 얻은 디하이드로아르테미시닌(176mg, 0.62mmol)과 디메틸아미노피리딘(DMAP, 31mg, 0.25 mmol)이 혼합된 건조 디클로로메탄(20ml) 용액에, 디사이클로헥실카보디이미드(DCC, 150mg, 0.73mmol)를 첨가하였다. 반응 혼합물을 실온에서 20시간 동안 교반하였다. 잔류용액을 디사이클로헥실우레아(DCU) 잔류물로부터 여과하고 감압 하에 농축시켰다. 잔류물을 플래시 컬럼 크로마토그래피(실리카겔, 디클로로메탄/메탄올= 19:1)로 정제하여 PEG-1500-아르테미시닌 화합물 430mg을 왁스 같은 고체로서 얻었다(수율: 72%).
1H NMR(CDCl3): 5.80(2H, d, H-12), 5.40(2H, s, H-5), 4.20(4H, m, COOCH2CH2), 3.60(131H, s, OCH2CH2), 2.68(8H, m, COCH2CH2), 1.40(6H, s, 2 x Me), 0.91, 0.81(12H, 모두 s, 4 x Me).
실시예 2: 화학식 1의 PEG-400-아르테미시닌 화합물의 제조
상기 제조예 2에서 얻은 PEG-400-디숙신산(100mg, 0.17mmol), 상기 합성예 1에서 얻은 디하이드로아르테미시닌(104mg, 0.37mmol), 디사이클로헥실카보디이미드(DCC, 38mg, 0.47mmol) 및 디메틸아미노피리딘(DMAP, 25mg, 0.09mmol)을 사용하고 플래시 컬럼 크로마토그래피(아세톤/클로로포름= 9:1)로 정제하는 것을 제외하고는, 실시예 1과 동일한 방법으로 PEG-400-아르테미시닌 화합물 118mg을 담황색 젤상의 액체로서 얻었다(수율: 60%).
1H NMR(CDC13): 5.79(2H, d, H-12), 5.41(2H, s, H-S), 4.22(4H, m, COOCH2CH2), 3.61(31H, s, OCH2CH2), 2.69(8H, m, COCH2CH2), 1.40(6H, s, 2 x Me), 0.91, 0.82(12H, 모두 s, 4 x Me).
실시예 3: 화학식 1의 PEG-3400-아르테미시닌 화합물의 제조
상기 제조예 3에서 얻은 PEG-3400-디숙신산(570mg, 0.16mmol), 상기 합성예 1에서 얻은 디하이드로아르테미시닌(107mg, 0.38mmol) 및 디메틸아미노피리딘(DMAP, 30mg, 0.25mmol)이 혼합된 건조 디클로로메탄(20ml) 용액에, 디사이클로헥실카보디이미드(DCC, 102mg, 0.50mmol)를 첨가하였다. 반응 혼합물을 실온에서 24시간 동안 교반하고, 잔여물을 여과 제거한 후, 생성된 용액을 건조한 다음, 디에틸에테르로 침전시켰다. 반응 혼합물을 테트라히드로퓨란/디에틸에테르로부터 결정화에 의해 정제하여 PEG-3400-아르테미시닌 화합물 405mg을 왁스 같은 고체로서 얻었다(수율: 62%).
1H NMR(CDC13): 5.79(2H, d, H-12), 5.41(2H, s, H-5), 4.21(2H, s, H-5), 3.61(303H, s, OCH2CH2), 2.68(8H, m, COCH2CH2), 1.40(6H, s, 2 x Me), 0.92, 0.81(12H, m, 4 x Me).
실시예 4: 화학식 1의 PEG-8000-아르테미시닌 화합물의 제조
상기 제조예 4에서 얻은 PEG-8000-디숙신산(400mg, 0.05mmol), 상기 합성예 1에서 얻은 디하이드로아르테미시닌(33mg, 0.12mmol), DCC(31mg, 0.15mmol) 및 디메틸아미노피리딘(DMAP, 6mg, 0.05mmol)을 사용하고 테트라히드로퓨란/디에틸에테르로부터 결정화하여 정제하는 것을 제외하고는, 실시예 3과 동일한 방법으로 PEG-8000-아르테미시닌 화합물 320mg을 백색의 왁스 같은 고체로서 얻었다(수율: 72%).
1H NMR(CDCl3): 5.80(2H, d, H-12), 5.42(2H, s, H-5), 4.24(4H, m, COOCH2CH2), 3.65(722H, OCH2CH2), 2.70(8H, m, COCH2CH2), 1.42(6H, s, 2 x Me), 0.96, 0.84(12H, d, 4 x Me).
실시예 5: 화학식 2의 MPEG-550-아르테미시닌 화합물의 제조
상기 합성예 1에서 얻은 디하이드로아르테미시닌(120 mg, 0.42 mmol) 및 건조 MPEG-550(polyethylene glycol monomethyl ether 550)(230mg, 0.42mmol)의 건조 벤젠(15ml) 용액에, 보론트리플로라이드-에테르[BF3(OEt)2] 3방울(테트라히드로퓨란 1.0M 용액)을 0-5℃ 미만에서 적가하였다. 반응 혼합물을 10시간 동안 교반 후, 용매를 제거하고, 잔류물을 플래시 컬럼 크로마토그래피(아세톤/클로로포름= 5:3)로 정제하여 MPEG-550-아르테미시닌 화합물 127mg을 얻었다(수율: 38%).
1H NMR(CDCl3): 5.41(1H, s, H-5), 4.73(1H, d, H-12), 3.65(47H, s, OCH2CH2), 3.90(3H, OCH3), 1.43(3H, s, Me), 0.93(6H, m, 2 x Me).
실험예 1: 세포 독성 평가
실험예 1-1: Vero 세포에 대한 세포 독성 평가
1) Vero 세포 배양
Vero 세포는 10% FBS가 포함된 DMEM 배지를 사용하여 37℃, 5% CO2 조건에서 배양하였다. 매 2일마다 계대 배양을 진행하였다. 세포 독성 확인을 위해 96웰 플레이트에 웰 당 1x104 개의 세포를 넣고 24시간 배양 후 사용하였다.
2) 세포 독성 분석
세포의 배지를 제거한 후, 각 농도별로 각각 아르테수네이트(Art), 실시예 2에서 얻은 PEG-400-아르테미시닌 화합물(Art-PEG400) 및 실시예 1에서 얻은 PEG-1500-아르테미시닌 화합물(Art-PEG1500)이 포함된 배지를 웰 당 100ul씩 처리 후 48시간 동안 배양하였다. 배지를 제거한 후 0.5 mg/ml 농도의 MTT가 포함된 배지를 100ul 넣은 후 1시간 동안 배양하였다. 형성된 MTT 포마잔(formazan)을 200ul의 DMSO로 충분히 녹여낸 후 540nm에서 흡광도를 측정하였다.
그 결과, 도 1a 내지 도 1c에 나타낸 바와 같이, Vero 세포에서 Art, Art-PEG400, Art-PEG1500의 CC50는 각각 6.818, 14.47, 22.17 ug/ml로 나타났다. 이를 통해 페길화(pegylation)를 통해 얻은 Art-PEG400과 Art-PEG1500이 Art에 비해 Vero 세포에 대해 낮은 독성을 나타냄을 알 수 있다.
실험예 1-2: Calu-3 세포에 대한 세포 독성 평가
1) Calu-3 세포 배양
Calu-3 세포는 10% FBS가 포함된 EMEM 배지를 사용하여 37℃, 5% CO2 조건에서 배양하였다. 매 2일마다 계대 배양을 진행하였다. 세포 독성 확인을 위해 96웰 플레이트에 웰 당 1x104 개의 세포를 넣고 24시간 배양 후 사용하였다.
2) 세포 독성 분석
세포의 배지를 제거한 후, 각 농도별로 각각 아르테수네이트(Art), 실시예 2에서 얻은 PEG-400-아르테미시닌 화합물(Art-PEG400) 및 실시예 1에서 얻은 PEG-1500-아르테미시닌 화합물(Art-PEG1500)이 포함된 배지를 웰 당 100ul씩 처리 후 48시간 동안 배양하였다. 배지를 제거한 후 0.5 mg/ml 농도의 MTT가 포함된 배지를 100ul 넣은 후 1시간 동안 배양하였다. 형성된 MTT 포마잔을 200ul의 DMSO로 충분히 녹여낸 후 540nm에서 흡광도를 측정하였다.
그 결과, 도 2a 내지 도 2c에 나타낸 바와 같이, Calu-3 세포에서 Art, Art-PEG400, Art-PEG1500의 CC50는 각각 21.1, 47.77, 96.26 ug/ml로 나타났다. 이를 통해 페길화를 통해 얻은 Art-PEG400과 Art-PEG1500이 Art에 비해 Calu-3 세포에 대해 낮은 독성을 나타냄을 알 수 있다.
실험예 2: 동물 모델에서 항바이러스 및 항염증 효능 평가
1) 감염 동물 모델 준비
9주령의 수컷 시리아 햄스터(Syrian Hamster)를 중앙실험동물(서울, 한국)로부터 공급받아 사용하였으며, 물과 사료는 자유롭게 섭취하도록 하였고, 온도 (23±3℃), 습도 (55±15%) 및 명암주기 (12시간, 08:00 ~ 20:00)는 자동으로 조절되도록 하였다.
SARS-CoV-2 바이러스는 국가병원체자원은행 (National Culture Collection for pathogens, NCCP)에서 분양받았다.
햄스터의 비강에 SARS-CoV-2 바이러스(1×106 PFU/100 ㎕) 100 ㎕를 접종하여 감염 동물 모델을 준비하였다.
2) 항바이러스 효능 분석
SARS-CoV-2 바이러스를 비강 접종하고 24시간 후부터 팍스로비드(250 mg/kg/day, 1일 2회 경구투여), 아르테수네이트(128 mg/kg, 1일 1회, 경구투여) 및 실시예 1에서 얻은 PEG-1500-아르테미시닌 화합물(Art-PEG1500)(128 mg/kg, 1일 1회, 경구투여)을 각각 4일간 투여하여 항 바이러스 효능을 평가하였다.
대조군으로는 바이러스를 접종하지 않은 정상 대조군(Mock)과 용매만을 동일 시간에 투여한 vehicle 대조군을 사용하였다.
바이러스 접종 후 5일째에 햄스터를 희생하여 폐의 좌엽과 우엽을 모두 채취하였다. 폐의 좌엽은 병리학적 분석을 위해 포르말린에 고정하고 우엽은 분자적 분석을 위해 냉동 보관하였다.
폐의 우엽 4개 중 바이러스 특이 유전자 검출을 위해 뒤쪽엽(caudal lobe)을 선택하고, 이를 트리졸(trizol) 용액을 사용하여 균질화하였다. 이후 클로로포름에 섞어 원심분리를 통해 폐 조직 내 RNA가 포함된 상층액을 취하고, 동량의 이소프로판올에 섞어 원심분리하여 RNA 펠렛을 확보하였다. 70% 에탄올을 사용하여 RNA 펠렛을 세척한 뒤, 상온에서 건조하고 멸균 증류수에 용해하여 RNA 샘플을 준비하였다. 추출한 RNA를 주형으로 하고 프라이머로 random hexamer와 oligo dT를 이용하여 cDNA를 합성하였다. 바이러스 역가 측정을 위하여 SARS-CoV-2 특이적인 RdRp, E gene에 대한 primer set을 이용하여 iQ SYBR green Supermix로 real-time qPCR을 수행하였으며, 해당 유전자의 발현을 바이러스 양으로 해석하여 이를 군 간 비교 분석하였다. Real-time RT-PCR에 사용된 프라이머 염기서열은 하기 표 1에 기재하였다. 통계적 유의성은 Artesunate 대조군과의 스튜던트 티 검정 (Student's t-test) 통계법을 사용하여 분석하였다 (*p<0.05, ****p<0.0001).
Gene name | Forward primer | Reverse primer |
RdRp | 5'- CATCTCACTTGCTGGTTCCT-3' | 5'- CCTTAATAGTCCTCACTTCTCTC -3' |
E gene | 5'- GGAAGAGACAGGTACGTTAA-3' | 5'- AAGGTTTTACAAGACTCACG-3' |
그 결과, 도 3a 내지 도 3b에 나타낸 바와 같이, Art-PEG1500 투여군이 Art 투여군에 비해 더욱 우수한 항바이러스 효능을 나타내었다.
3) 항염증 효과 분석
폐의 우엽 4개 중 항염증 유전자 검출을 위해 뒤쪽엽 (caudal lobe)과 앞쪽엽 (cranial lobe)을 선택하고, 이를 트리졸 용액을 사용하여 균질화하였다. 이후 클로로포름에 섞어 원심분리를 통해 폐 조직 내 RNA가 포함된 상층액을 취하고, 동량의 이소프로판올에 섞어 원심분리하여 RNA 펠렛을 확보하였다. 70% 에탄올을 사용하여 RNA 펠렛을 세척한 뒤, 상온에서 건조하고 멸균 증류수에 용해하여 RNA 샘플을 준비하였다. 추출한 RNA를 주형으로 하고 프라이머로 random hexamer와 oligo dT를 이용하여 cDNA를 합성하였다. 항염증 효과를 확인하기 위해 뒤쪽엽에서 IL-6, 앞쪽엽에서 IFN-γ 및 IL-10 유전자에 대한 primer set을 이용하여 iQ SYBR green Supermix로 real-time qPCR을 수행하였으며, 해당 유전자의 발현 값은 하우스키핑 유전자인 GAPDH 발현 값으로 나누어 보정하였다. Real-time RT-PCT에 사용된 프라이머 염기서열은 하기 표 2에 기재하였다. 통계적 유의성은 vehicle 대조군과 각 군, Art 투여군과 Art-PEG1500 투여군의 스튜던트 티 검정 (Student's t-test) 통계법을 사용하여 분석하였다(*p<0.05, **p<0.01, ***p<0.001).
Gene name | Forward primer | Reverse primer |
IL-6 | 5'-TGTCTTCTTGGGACTGCTGC-3' | 5'-CCAAACCTCCGACTTGTTGA-3' |
IFN-γ | 5'-TGCATCTTGGCTTTGTTGCTC-3' | 5'-TCCCCTCCATTCACGACATC-3' |
IL-10 | 5'-GGTTGCCAAACCTTATCAGAAATG-3' | 5'-TTCACCTGTTCCACAGCCTTG-3' |
GAPDH | 5'-CACCACCACCCCAGTTTCTAT-3' | 5'-TCCAATACGGCCAAATCCGT-3' |
그 결과, 도 4a 내지 도 4c에 나타낸 바와 같이, Art-PEG1500 투여군이 vehicle 대조군 및 Art 투여군에 비해 폐에서 더욱 우수한 항염증 효능을 나타내었다.
실험예 3: 마우스를 이용한 약물동태학적 평가
마우스를 이용하여 아르테수네이트(Art) 및 실시예 1에서 얻은 PEG-1500-아르테미시닌 화합물(Art-PEG1500)을 대상으로 약물동태학 시험을 하기와 같이 수행하였다.
구체적으로, 마우스에 각각의 약물을 5 mg/kg으로 정맥 주사하였다. 투약 후 정해진 시간 간격 동안 정맥혈을 채혈하고, 채혈 즉시 원심분리하여 혈장을 취하였다. 혈장 20㎕에 아세토니트릴 580㎕ (내부 표준물질 포함)를 첨가하여 혼합한 후, 4℃에서 15,000 rpm으로 5분간 원심분리하였다. 이때, 내부 표준물질로는 terfenadine을 사용하였다. 원심분리 후 얻은 상층액을 액체크로마토그래피-질량분석기(LC-MS/MS)를 이용하여 정량분석 하였다.
그 결과를 하기 표 3에 나타내었다.
시간 (hr) | 마우스 혈장 내 농도 (ng/ml) | |
Art | Art-PEG1500 | |
0.08 | 141.5 | 23.9 |
0.25 | 3.9 | 3.7 |
0.5 | - | 3.6 |
상기 표 3을 통해, Art-PEG1500가 Art에 비해 오랫동안 혈장 내에 존재하는 것을 확인할 수 있으며, 이를 통해 Art-PEG1500가 Art에 비해 장시간 약효를 발휘할 수 있음을 알 수 있다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 본 발명이 속한 기술분야에서 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아님은 명백하다. 본 발명이 속한 기술분야에서 통상의 지식을 가진 자라면 상기 내용을 바탕으로 본 발명의 범주 내에서 다양한 응용 및 변형을 행하는 것이 가능할 것이다.
따라서, 본 발명의 실질적인 범위는 첨부된 특허청구범위와 그의 등가물에 의하여 정의된다고 할 것이다.
Claims (6)
- 제1항에 있어서,n은 0 내지 1000의 정수이고,R은 수소 원자 또는 C1-C6의 알킬기이며,m은 0 내지 500의 정수인 약제학적 조성물.
- 제1항에 있어서,n은 1 내지 500의 정수이고,R은 수소 원자 또는 C1-C3의 알킬기이며,m은 1 내지 250의 정수인 약제학적 조성물.
- 제1항에 있어서, RdRp (RNA-dependent RNA polymerase) 활성을 저해 또는 억제시키는 약제학적 조성물.
- 제1항에 있어서, 상기 코로나바이러스 감염 질환은 코로나바이러스 감염증-19 (coronavirus disease 2019, COVID-19)인 약제학적 조성물.
- 제1항에 있어서, 적어도 하나의 다른 항바이러스제를 추가로 포함하는 약제학적 조성물.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR10-2021-0159564 | 2021-11-18 | ||
KR20210159564 | 2021-11-18 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2023090947A1 true WO2023090947A1 (ko) | 2023-05-25 |
Family
ID=86397482
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2022/018334 WO2023090947A1 (ko) | 2021-11-18 | 2022-11-18 | 코로나바이러스 감염 질환의 예방 또는 치료용 약제학적 조성물 |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR20230073136A (ko) |
WO (1) | WO2023090947A1 (ko) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004071506A1 (en) * | 2003-02-12 | 2004-08-26 | Georgetown University | Use of artemisinin for treating tumors induced by oncogenic viruses and for treating viral infections |
US20160250339A1 (en) * | 2012-05-30 | 2016-09-01 | Beijing Kaizheng Biotech Development Co. LTD | Pegylated Artesunate Derivative, Pharmaceutical Composition and Use Thereof |
CN110642868A (zh) * | 2019-09-26 | 2020-01-03 | 西南大学 | 二氢青蒿素嘧啶类衍生物及其应用 |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102145197B1 (ko) | 2020-03-10 | 2020-08-18 | 부광약품 주식회사 | 코로나바이러스를 치료하기 위한 l-뉴클레오사이드의 용도 |
-
2022
- 2022-11-18 KR KR1020220155606A patent/KR20230073136A/ko unknown
- 2022-11-18 WO PCT/KR2022/018334 patent/WO2023090947A1/ko unknown
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2004071506A1 (en) * | 2003-02-12 | 2004-08-26 | Georgetown University | Use of artemisinin for treating tumors induced by oncogenic viruses and for treating viral infections |
US20160250339A1 (en) * | 2012-05-30 | 2016-09-01 | Beijing Kaizheng Biotech Development Co. LTD | Pegylated Artesunate Derivative, Pharmaceutical Composition and Use Thereof |
CN110642868A (zh) * | 2019-09-26 | 2020-01-03 | 西南大学 | 二氢青蒿素嘧啶类衍生物及其应用 |
Non-Patent Citations (2)
Title |
---|
N'DA DAVID D., BREYTENBACH JACO C.: "Synthesis and antiplasmodial activity of EG-artemisinin ethers and artemisinin-quinoline hybrids", SOUTH AFRICAN JOURNAL OF CHEMISTRY, THE SOUTH AFRICAN CHEMICAL INSTITUTE, vol. 64, 1 January 2011 (2011-01-01), pages 163 - 172, XP093067931, ISSN: 1996-840X * |
UCKUN FATIH M., SAUND SARAN, WINDLASS HITESH, TRIEU VUONG: "Repurposing Anti-Malaria Phytomedicine Artemisinin as a COVID-19 Drug", FRONTIERS IN PHARMACOLOGY, vol. 12, pages 649532, XP093067937, DOI: 10.3389/fphar.2021.649532 * |
Also Published As
Publication number | Publication date |
---|---|
KR20230073136A (ko) | 2023-05-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP0329348B1 (en) | 2',3'-Dideoxy-2',2'-difluoronucleosides | |
JP3225045B2 (ja) | 治療用化合物 | |
FI93217C (fi) | Menetelmä terapeuttisesti aktiivisten nukleosidijohdannaisten estereiden ja amidien valmistamiseksi | |
US8404742B2 (en) | Diosmetin compounds, a process for their preparation and pharmaceutical compositions containing them | |
WO2021206309A1 (en) | Pharmaceutical composition for prevention or treatment of diseases caused by sars-cov-2 | |
JP2005511572A (ja) | Hcv阻害剤としてのアシルジヒドロピロール誘導体 | |
HU203561B (en) | Process for producing adenozine derivatives and pharmaceutical compositions containing them as active components | |
WO2023090947A1 (ko) | 코로나바이러스 감염 질환의 예방 또는 치료용 약제학적 조성물 | |
KR910009934B1 (ko) | 카르바모일-2-피롤리디논 화합물 | |
WO2010110622A2 (en) | Novel crystal forms of adefovir dipivoxil and processes for preparing the same | |
WO2018174320A1 (ko) | 신규한 피롤로피리딘 유도체, 이의 제조방법 및 용도 | |
WO2009119980A2 (ko) | 미세소관 형성 저해제로서 유용한 벤조페논 티아졸 유도체 및 이의 제조 방법 | |
WO2022239987A1 (ko) | 피롤리딘을 링커로 포함하는 화합물 및 이를 포함하는 약학 조성물 | |
WO2012008711A2 (en) | Erlotinib dichloroacetate and anti-cancer agent comprising the same | |
WO2021261663A1 (ko) | 신규한 벤지미다졸 유도체, 이의 제조 방법 및 이의 항암제 또는 항바이러스제로서의 용도 | |
WO2019231261A1 (ko) | 신규 바이페닐 유도체 화합물 및 이의 용도 | |
WO2018066947A1 (ko) | 지방산이 결합된 엔테카비어 유도체 화합물 및 이의 약학적 용도 | |
WO2022035048A1 (ko) | 도네페질 에테르 팔미테이트 또는 이의 약제학적으로 허용가능한 염 | |
CN115190762A (zh) | 新的取代的磺酰脲和磺酰亚胺脲衍生物 | |
WO2006100106A1 (en) | 3-carboxy pyrroles as anti-viral agents | |
WO2021020879A1 (en) | Dinucleotide compounds for treating cancers and medical uses thereof | |
WO2022211520A1 (ko) | 신규 화합물 및 이의 자가면역질환 치료 용도 | |
WO2020040343A1 (en) | Isoxazole derivatives and preparation process thereof | |
WO2010064817A2 (ko) | 신규 쿠마린계 화합물, 이의 제조방법 및 이를 유효성분으로 함유하는 다약제내성 억제용 약학적 조성물 | |
WO2023249228A1 (ko) | 신규 화합물 및 이의 자가면역질환 치료 용도 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22896144 Country of ref document: EP Kind code of ref document: A1 |