Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
  • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
  • C12N5/10—Cells modified by introduction of foreign genetic material
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/88—Lyases (4.)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P13/00—Preparation of nitrogen-containing organic compounds
  • C12P13/04—Alpha- or beta- amino acids
  • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine

Definitions

• the present invention relates to a method for producing dihydroxyphenylalanine.
• L-DOPA 3,4-Dihydroxy-L-phenylalanine
• L-tyrosine which is a non-essential amino acid
• L-DOPA is hydroxylated by tyrosine hydroxylase and converted to L-DOPA, and further converted to dopamine, a neurotransmitter, by L-DOPA decarboxylase.
• L-DOPA is a precursor of dopamine.
• L-DOPA is also used as a therapeutic agent for Parkinson's disease because it can pass through the blood-brain barrier.
• shikimate pathway is an important metabolic pathway for the biosynthesis of aromatic compounds by plants and microorganisms.
• the formation of a 6-carbon ring is followed by the formation of a double bond, and protocatechuic acid derived from 3-dehydroshikimic acid produces aromatic compounds such as gallic acid and catechol. It is known that
• Patent Document 1 Patent No. 3116102
• the present invention relates to the following 1) to 3).
• 1) A step of contact-reacting protocatechuic acid, pyruvic acid, and an ammonium salt with cultured cells of a microorganism producing protocatechuate decarboxylase and tyrosine phenol lyase, a crushed product thereof, or a cell extract of the microorganism.
• 2) A vector or DNA fragment containing a polynucleotide encoding protocatechuate decarboxylase and tyrosine phenol lyase.
• 3) A transformed cell containing the vector or DNA fragment of 2) above.
• the present invention relates to providing a method for efficiently producing 3,4-dihydroxyphenylalanine from protocatechuic acid using cultured cells of microorganisms.
• the present inventors have found a tyrosine phenol lyase that is less susceptible to inhibition by protocatechuic acid, and efficiently produce 3,4-dihydroxyphenylalanine from protocatechuic acid by using protocatechuic acid decarboxylase and a microorganism that produces the tyrosine phenol lyase. I found what I could do.
• the present invention it becomes possible to efficiently produce 3,4-dihydroxyphenylalanine from protocatechuic acid. Since protocatechuic acid is produced via the shikimate pathway, the present invention enables the production of 3,4-dihydroxyphenylalanine using biomass sugar as a raw material.
• the identity of amino acid sequences or nucleotide sequences is calculated by the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, genetic information processing software GENETYX Ver. 12 homology analysis (Search homology) program is used, unit size to compare (ktup) is set to 2, and analysis is performed.
• GENETYX Ver. 12 homology analysis (Search homology) program is used, unit size to compare (ktup) is set to 2, and analysis is performed.
• amino acid sequences and nucleotide sequences means 90% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more. % or more, preferably 99% or more identity.
• an amino acid sequence in which one or several amino acids are deleted, substituted, added, or inserted means 1 or more and 20 or less, preferably 1 or more and 15 or less, more preferably 1 It refers to an amino acid sequence in which 10 or less, more preferably 1 or more and 5 or less, still more preferably 1 or more and 3 or less amino acids are deleted, substituted, added, or inserted.
• nucleotide sequence in which one or several nucleotides are deleted, substituted, added, or inserted means 1 or more and 30 or less, preferably 1 or more and 24 or less, more preferably 1 or more and 15 It refers to a nucleotide sequence in which no more than 1, more preferably from 1 to 9 nucleotides have been deleted, substituted, added or inserted.
• additional of amino acids or nucleotides includes addition of amino acids or nucleotides to one and both termini of a sequence. Mutations such as deletions, substitutions, insertions and additions can be introduced by introducing mutations into the base sequence of interest by, for example, site-directed mutagenesis.
• upstream and downstream with respect to a gene refer to upstream and downstream in the transcription direction of the gene.
• a gene located downstream of a promoter means that the gene is present on the 3' side of the promoter in the DNA sense strand
• upstream of the gene means that the gene is located 5' of the gene in the DNA sense strand. means the area on the side.
• control region such as a promoter and a gene
• control region means that the gene and the control region are linked so that the gene can be expressed under the control of the control region.
• Procedures for "operably linking" genes and regulatory regions are well known to those of skill in the art.
• a "foreign gene” is an exogenous gene introduced into a cell from the outside.
• a foreign gene may be derived from the same organism as the cell into which it is introduced, or from a different organism (ie, a heterologous gene).
• 3,4-dihydroxyphenylalanine is a mixture of cultured cells of a microorganism that produces protocatechuate decarboxylase and tyrosine phenol lyase, a lysate thereof, or a cell extract of the microorganism, and protocatechuic acid ( PCA), pyruvic acid and an ammonium salt.
• protocatechuic acid is converted to catechol by protocatechuic acid decarboxylase, and then the catechol, pyruvic acid and ammonium salt react with tyrosine phenol lyase (TPL) to form 3,4- It is a reaction that produces dihydroxyphenylalanine.
• 3,4-dihydroxyphenylalanine includes 3,4-dihydroxy-L-phenylalanine (L-DOPA) and 3,4-dihydroxy-D-phenylalanine (D-DOPA), but 3,4-dihydroxy -L-phenylalanine (L-DOPA) is preferred.
• DOPA may be in the form of zwitterions or salts
• salts include sodium salts, potassium salts, calcium salts, hydrochlorides, and sulfates.
• hydrochlorides and sulfates are more preferable.
• the microorganism of the present invention has the ability to produce protocatechuate decarboxylase and tyrosine phenol lyase, and specifically includes a microorganism having genes encoding protocatechuate decarboxylase and tyrosine phenol lyase.
• Protocatechuic acid decarboxylase refers to an enzyme that catalyzes the reaction of decarboxylating protocatechuic acid to produce catechol.
• Enzymes having protocatechuate decarboxylase activity include protocatechuate decarboxylase (EC 4.1.1.63), gallic acid decarboxylase (EC 4.1.1.59), 4- Hydroxybenzoate decarboxylase (4-hydroxybenzoate decarboxylase, EC 4.1.1.61) and the like, and protocatechuate decarboxylase (EC 4.1.1.63) is preferred.
• Protocatechuate decarboxylase includes, for example, the following proteins (A1) or (A2).
• a protein consisting of the amino acid sequence shown in SEQ ID NO: 18 A protein consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 18 and having protocatechuic acid decarboxylase activity
• SEQ ID NO: 18 is protocatechuate decarboxylase (EcAroY) derived from Enterobacter cloacae.
• the identity with the amino acid sequence of SEQ ID NO: 18 is preferably 95% or more, more preferably 97% or more, from the viewpoint of protocatechuate decarboxylase activity, and 98% or more is More preferably, 99% or more is even more preferable.
• the amino acid sequence of the protein (A2) includes, for example, an amino acid sequence in which one or several amino acids are deleted, substituted, inserted or added to the amino acid sequence of SEQ ID NO:18.
• whether the protein has protocatechuic acid decarboxylase activity can be confirmed, for example, by incubating the protein with a substrate (that is, protocatechuic acid) and measuring the protein- and substrate-dependent catechol production. .
• the protocatechuate decarboxylase gene includes, for example, the gene encoding the protein (A1) or (A2). Specific examples include the following (a1) or (a2) polynucleotides.
• (a1) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 17
• (a2) comprising a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 17 and encoding a polypeptide having protocatechuate decarboxylase activity
• polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 17 represents a gene encoding protocatechuate decarboxylase (EcAroY) derived from Enterobacter cloacae.
• the identity of the nucleotide of (a2) with the nucleotide sequence of SEQ ID NO: 17 is preferably 95% or more, more preferably 97% or more, in terms of protocatechuate decarboxylase activity, and 98% or more is More preferably, 99% or more is even more preferable.
• the nucleotide sequence of the polynucleotide of (a2) includes, for example, a nucleotide sequence in which one or several nucleotides are deleted, substituted, added, or inserted with respect to the nucleotide sequence shown in SEQ ID NO:17.
• tyrosine phenol-lyase (EC 4.1.99.2) is an enzyme that catalyzes the reaction of degrading L-tyrosine into phenol, pyruvic acid and ammonia or the reverse reaction thereof.
• Tyrosine phenol lyase can also catalyze the decomposition of 3,4-dihydroxyphenylalanine into catechol, pyruvate and ammonia, or the reverse reaction.
• the activity of tyrosine phenol lyase is thought to be inhibited by catechol or its precursor, protocatechuic acid.
• the tyrosine phenol lyase used in the present invention preferably exhibits a low rate of activity inhibition by protocatechuic acid.
• the inhibition rate calculated by the formula is 91% or less, preferably 90% or less, preferably 75% or less, more preferably 50% or less, more preferably 40% or less, and still more preferably 36% or less. .
• the tyrosine phenol lyase of the present invention preferably includes, for example, proteins selected from the group consisting of (B1), (B2), (C1), (C2), (D1) and (D2) below. .
• B1 a protein consisting of the amino acid sequence shown in SEQ ID NO: 2
• B2 consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2
• C1 sequence Protein (C2) consisting of the amino acid sequence shown in SEQ ID NO: 4.
• Protein (D1) consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4 and having tyrosine phenol lyase activity (D1) shown in SEQ ID NO: 6.
• Protein consisting of an amino acid sequence (D2) A protein consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 6 and having tyrosine phenol lyase activity
• the protein consisting of the amino acid sequence of SEQ ID NO: 2 is a tyrosine phenol lyase (FnTPL) derived from Fusobacterium nucleatum.
• the protein consisting of the amino acid sequence of SEQ ID NO: 4 is Citrobacter freundii-derived tyrosine phenol lyase (CfTPL).
• the protein consisting of the amino acid sequence of SEQ ID NO: 6 is Erwinia herbicola-derived tyrosine phenol lyase (EwTPL).
• the protein (B2), (C2) or (D2) has 95% or more identity with the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6, respectively, in terms of tyrosine phenol lyase activity. is preferably 97% or more, more preferably 98% or more, and even more preferably 99% or more.
• the amino acid sequence of the protein (B2), (C2) or (D2) includes, for example, deletion, substitution, insertion of one or several amino acids in the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6, or added amino acid sequences are included.
• the protein also has tyrosine phenol lyase activity, for example, by incubating the protein with a substrate (ie, phenol or catechol, pyruvic acid and ammonium salts), the protein and substrate-dependent tyrosine or 3,4-dihydroxyphenylalanine can be confirmed by measuring the generation of a substrate (ie, phenol or catechol, pyruvic acid and ammonium salts), the protein and substrate-dependent tyrosine or 3,4-dihydroxyphenylalanine can be confirmed by measuring the generation of a substrate (ie, phenol or catechol, pyruvic acid and ammonium salts), the protein and substrate-dependent tyrosine or 3,4-dihydroxyphenylalanine can be confirmed by measuring the generation of a substrate (ie, phenol or catechol, pyruvic acid and ammonium salts), the protein and substrate-dependent tyrosine or 3,4-dihydroxyphenylalanine can be confirmed by measuring the generation of a
• the tyrosine phenol lyase gene of the present invention includes genes encoding the above proteins (B1), (B2), (C1), (C2), (D1) and (D2). Specific examples include polynucleotides selected from the group consisting of (b1), (b2), (c1), (c2), (d1) and (d2) below.
• (b1) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1; (b2) consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a polypeptide having tyrosine phenol lyase activity
• Polynucleotide (c1) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3
• (c2) a polypeptide consisting of a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in SEQ ID NO: 3 and having tyrosine phenol lyase activity
• Polynucleotide encoding (d1) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5
• the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 1 represents a gene encoding tyrosine phenol lyase (FnTPL) derived from Fusobacterium nucleatum.
• the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3 represents a gene encoding tyrosine phenol lyase (CfTPL) derived from Citrobacter freundii.
• the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5 represents a gene encoding tyrosine phenol lyase (EwTPL) derived from Erwinia herbicola.
• the nucleotides (b2), (c2), and (d2) have 95% or more identity with the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5 in terms of tyrosine phenol lyase activity. is preferably 97% or more, more preferably 98% or more, even more preferably 99% or more.
• the nucleotide sequence of the polynucleotide (b2), (c2) or (d2) for example, one or more nucleotides are deleted from the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 5 , substituted, added, or inserted nucleotide sequences.
• the Fusobacterium nucleatum-derived tyrosine phenol lyase (FnTPL) gene is particularly resistant to activity inhibition by protocatechuic acid and has excellent production efficiency of 3,4-dihydroxyphenylalanine.
• FnTPL Fusobacterium nucleatum-derived tyrosine phenol lyase
• a gene encoding the protein shown in (B1) or (B2) above, more specifically a polynucleotide consisting of the nucleotide sequence shown in (b1) or (b2) above is preferred.
• the microorganism of the present invention preferably has the ability to produce flavin mononucleotide prenyltransferase, ie, a gene encoding flavin mononucleotide prenyltransferase.
• Flavin mononucleotide prenyltransferase (EC 2.5.1.129) attaches a dimethylallyl structure from dimethylallyl monophosphate (DMAP) to the flavin backbone of flavin mononucleotide (FMN) to form prenylated-FMN.
• Flavin mononucleotide prenyltransferases of the present invention include, for example, proteins (E1) or (E2) below.
• E1 A protein consisting of the amino acid sequence shown in SEQ ID NO: 24
• E2 A protein consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 24 and having flavin mononucleotide prenyltransferase activity
• the protein consisting of a 24 amino acid sequence is Escherichia coli-derived flavin mononucleotide prenyltransferase (EcUbiX).
• the identity with the amino acid sequence of SEQ ID NO: 24 is preferably 95% or more, more preferably 97% or more, and 98% or more in terms of flavin mononucleotide prenyltransferase activity. is more preferred, and 99% or more is even more preferred.
• the amino acid sequence of the protein (E2) includes, for example, an amino acid sequence in which one or several amino acids are deleted, substituted, inserted or added to the amino acid sequence of SEQ ID NO:24.
• the protein has flavin mononucleotide prenyltransferase activity, for example, see Nature, 2015, 522: 502-506, etc.
• the protein is flavin mononucleotide (FMN) and dimethylallyl monophosphate (DMAP) It can be confirmed by incubating in the presence and tracking the absorption spectrum change due to the production of prenylated-FMN.
• the flavin mononucleotide prenyltransferase gene of the present invention includes a gene encoding the protein (E1) or (E2). Specific examples include the following (e1) or (e2) polynucleotides.
• (e1) a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:23; Encoding Polynucleotide
• the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 23 represents a gene encoding Escherichia coli-derived flavin mononucleotide prenyltransferase (EcUbiX).
• the identity of the nucleotide (e2) with the nucleotide sequence of SEQ ID NO: 23 is preferably 95% or more, more preferably 97% or more, and 98% or more in terms of flavin mononucleotide prenyltransferase activity. is more preferred, and 99% or more is even more preferred.
• the nucleotide sequence of the polynucleotide (e2) includes, for example, a nucleotide sequence in which one or several nucleotides are deleted, substituted, added, or inserted with respect to the nucleotide sequence shown in SEQ ID NO:23.
• the microorganism of the present invention may have genes encoding protocatechuate decarboxylase and tyrosine phenol lyase, and optionally further flavin mononucleotide prenyltransferase (these are also referred to as "genes of the present invention"), but at least one It is preferably a gene exogenous to the host microorganism (foreign gene).
• a foreign gene-introduced microorganism can be produced by preparing an expression vector or a gene expression cassette capable of expressing the gene in host cells, and then introducing it into host cells to transform the host cells.
• Microorganisms as hosts for transformants may be either prokaryotes or eukaryotes, and prokaryotes such as microorganisms belonging to the genus Escherichia, microorganisms belonging to the genus Bacillus, actinomycetes, and coryneform bacteria.
• Organisms or eukaryotic microorganisms such as yeast and filamentous fungi can be used.
• Escherichia coli which is a microorganism belonging to the genus Escherichia
• Erwinia herbicola which is a microorganism belonging to the genus Erwinia
• Bacillus subtilis which is a microorganism belonging to the genus Bacillus
• the genus Corynebacterium Corynebacterium glutamicum which is a microorganism belonging to the genus Pseudomonas, Pseudomonas putida, which is a microorganism belonging to the genus Pseudomonas
• Rhodococcus jostii which is a microorganism belonging to the genus Rhodococcus.
• Li Um glutamicum is more preferred.
• any vector can be used as long as the gene of the present invention can be introduced into a host and the gene can be expressed in the host cell.
• the vector comprises the gene of the invention and a control region operably linked thereto.
• the vector may be a vector capable of autonomous replication and replication outside the chromosome, such as a plasmid, or a vector that is integrated into the chromosome.
• Specific vectors include, for example, pBluescript II SK (-) (Agilent Technologies), pUC-based vectors such as pUC18/19 and pUC118/119 (Takara Bio Inc.), pET-based vectors (Merck), and pGEX-based vectors.
• the gene of the present invention may be constructed as a DNA fragment containing it.
• the DNA fragments include, for example, PCR-amplified DNA fragments and restriction enzyme-cleaved DNA fragments.
• the DNA fragment may be an expression cassette comprising the gene of the invention and a control region operably linked thereto.
• the control region contained in the above vector or DNA fragment is a sequence for expressing the gene of the present invention in a host cell into which the vector or DNA fragment has been introduced. points, etc.
• the type of control region can be appropriately selected according to the type of host microorganism into which the vector or DNA fragment is introduced. If necessary, the vector or DNA fragment further has a selection marker such as an antibiotic resistance gene, an amino acid synthesis-related gene (e.g., drug resistance genes such as ampicillin, neomycin, kanamycin, chloramphenicol, etc.).
• the gene of the present invention can be ligated with the regulatory region or marker gene sequence by a method such as a seamless cloning method. Procedures for introducing gene sequences into vectors are well known in the art.
• the types of control regions such as promoter regions, terminators, and secretory signal regions are not particularly limited, and commonly used promoters and secretory signal sequences can be appropriately selected and used according to the host into which the gene is introduced.
• control region include strong control regions capable of enhancing expression compared to the wild type, such as known high-expression promoters such as T7 promoter, lac promoter, tac promoter, trp promoter, gap promoter, tuf promoter, etc. are exemplified, but are not particularly limited to these.
• Transformed cells can be obtained by introducing a vector containing the gene of the present invention into a host or by introducing a DNA fragment containing the gene of the present invention into the genome of the host.
• Methods for introducing vectors or DNA fragments into hosts include, for example, the heat shock method, electroporation method, transformation method, transfection method, conjugation method, protoplast method, particle gun method, Agrobacterium method, and the like. be able to.
• the method for introducing the gene of the present invention into the genome of the host is not particularly limited, but examples include a double crossover method using a DNA fragment containing the gene.
• the DNA fragment may be introduced downstream of the promoter sequence of a gene highly expressed in the host cell described above, or a fragment previously prepared by operably linking the DNA fragment with the control region described above,
• the ligated fragment may be introduced into the genome of the host.
• the DNA fragment may be ligated in advance with a marker (drug resistance gene, auxotrophic complementary gene, etc.) for selecting cells into which the gene of the present invention has been appropriately introduced.
• Transformed cells into which the vector or DNA fragment of interest has been introduced can be selected using a selection marker.
• a selection marker is an antibiotic resistance gene
• transformed cells into which the desired vector or DNA fragment has been introduced can be selected by culturing in the antibiotic-supplemented medium.
• the selectable marker is an amino acid synthesis-related gene
• transformed cells into which the target vector or DNA fragment has been introduced using the presence or absence of the amino acid auxotrophy as an indicator, after gene introduction into the host microorganism having the amino acid auxotrophy.
• introduction of the desired vector or DNA fragment can be confirmed by examining the DNA sequence of transformed cells by PCR or the like.
• the cultured cells of the microorganism thus obtained, the crushed product thereof, or the cell extract of the microorganism, protocatechuic acid, pyruvic acid, and an ammonium salt are brought into contact reaction.
• the cultured cells of microorganisms used here are microbial culture solutions during and after culturing, cells isolated from microbial cultures, and powders by freeze-drying or spray-drying the cultured cells. powdered fungus bodies obtained by immobilizing the cultured fungus bodies on a carrier.
• the disrupted bacterial cells include a disrupted bacterial cell solution containing protocatechuate decarboxylase and tyrosine phenol lyase of the present invention, a microsomal fraction, and the like.
• the cell extract of the microorganism the cell of the microorganism is lysed by a bacteriophage, an agent such as an organic solvent or a surfactant, an enzyme, a mechanical force, a temperature shock, an osmotic shock, or the like. extracts of protocatechuate decarboxylase and tyrosine phenol lyase.
• Microorganisms can be cultured using media (natural media, synthetic media) containing carbon sources, nitrogen sources, inorganic salts, and other nutrients.
• Carbon sources include monosaccharides such as glucose, fructose, mannose, arabinose, xylose and galactose; disaccharides such as cellobiose, sucrose (sucrose), lactose, maltose, trehalose, cellobiose and xylobiose; dextrin or soluble starch.
• sugar alcohols such as mannitol, sorbitol, xylitol and glycerin
• organic acids such as acetic acid, citric acid, lactic acid, fumaric acid, maleic acid and gluconic acid
• alcohols such as ethanol and propanol
• Hydrocarbons such as paraffins and the like
• Nitrogen sources include, for example, peptone, meat extract, yeast extract, casein hydrolyzate, soybean meal alkaline extract, corn steep liquor, alkylamines such as methylamine, nitrogen-containing organic compounds such as amino acids, ammonia or salts thereof.
• inorganic or organic ammonium compounds such as ammonium chloride, ammonium sulfate, ammonium nitrate and ammonium acetate
• urea aqueous ammonia, sodium nitrate, potassium nitrate and the like
• inorganic salts include monopotassium phosphate, dipotassium phosphate, magnesium sulfate, sodium chloride, ferrous nitrate, manganese sulfate, zinc sulfate, cobalt sulfate, and calcium carbonate.
• Other nutritional substances include soybean protein hydrolysates, amino acids and the like. Tyrosine or tyrosine substitutes, vitamin B6s, catechol, 3,4-dihydroxyphenylalanine, protocatechuic acid, antifoaming agents and the like can be added to the medium.
• a culture temperature of 15°C to 45°C is appropriate.
• the culture pH and culture time are not particularly limited, but, for example, a method of continuing culture for 6 to 72 hours while controlling the pH to 6.0 to 8.0 can be employed.
• antibiotics such as ampicillin and kanamycin may be added to the medium during the culture, if necessary.
• the contact reaction between the cultured cells of the microorganism or the crushed product thereof or the cell extract of the microorganism and protocatechuic acid, pyruvic acid and ammonium salt is carried out by mixing these and usually at 20 ° C. to 50 ° C. for a predetermined time ( For example, 30 minutes to 60 hours, preferably 1 hour to 24 hours), with stirring or shaking as necessary.
• the origin of protocatechuic acid used as a raw material is not particularly limited, and it may be produced by any of an organic synthesis method and a method using microorganisms or enzymes. is preferably produced from saccharides such as glucose.
• the concentration of protocatechuic acid is preferably 0.5-100 g/L, more preferably 5-15 g/L.
• the concentration of pyruvic acid is preferably 0.5-100 g/L, more preferably 5-15 g/L.
• the concentration of the ammonium salt is preferably 5-150 g/L, more preferably 50-80 g/L.
• the concentration of the cultured cells, the crushed product thereof, or the cell extract of the microorganism is suitably in the range of 2 to 400 g/L, preferably 50 to 200 g/L. 3,4-dihydroxyphenylalanine can be accumulated by intermittently adding protocatechuic acid, pyruvic acid, and an ammonium salt to the reaction solution.
• reducing agents such as sodium sulfite, sodium ascorbate and cysteine, chelating agents such as EDTA and citric acid, vitamin B6 compounds such as pyridoxal phosphate, and buffers such as Tris/HCl are added to the reaction system.
• concentration of the reducing agent is preferably 0.5-20 g/L, more preferably 2-5 g/L.
• the concentration of the chelating agent is preferably 0.5-20 g/L, more preferably 2-5 g/L.
• concentration of pyridoxal phosphate is preferably 0.05-5 mM, more preferably 0.5-2 mM.
• the buffer concentration is preferably 5-200 mM, more preferably 50-100 mM.
• the reaction temperature is preferably 5 to 60°C, more preferably 15 to 30°C.
• the reaction pH is suitably in the range of 5.0-10.0, preferably 6.5-8.5.
• the reaction time is appropriately determined depending on the amount of activity of protocatechuate decarboxylase and tyrosine phenol lyase used and the substrate concentration, and is usually 0.5 to 72 hours, preferably 6 to 24 hours.
• the 3,4-dihydroxyphenylalanine produced in the reaction solution is separated and recovered by centrifugation, filtration, etc., and then combined with conventional methods such as ion-exchange resin treatment and crystallization as appropriate. can be further purified by
• ⁇ 1> including a step of contact-reacting protocatechuic acid, pyruvic acid and ammonium salt with cultured cells of a microorganism that produces protocatechuate decarboxylase and tyrosine phenol lyase, a crushed product thereof, or a cell extract of the microorganism; A method for producing 4-dihydroxyphenylalanine.
• ⁇ 2> The method of ⁇ 1>, wherein the microorganism has genes encoding protocatechuate decarboxylase and tyrosine phenol lyase.
• ⁇ 3> The method of ⁇ 2>, wherein the microorganism further has a gene encoding flavin mononucleotide prenyltransferase.
• ⁇ 4> The method of ⁇ 2> or ⁇ 3>, wherein at least one of the genes is a foreign gene.
• the tyrosine phenol lyase has an activity inhibition rate by protocatechuic acid of 91% or less, preferably 75% or less, more preferably 50% or less, more preferably 40% or less, still more preferably 36% or less. , ⁇ 1> to ⁇ 4>.
• the tyrosine phenol lyase is a protein selected from the group consisting of the following (B1), (B2), (C1), (C2), (D1) and (D2), ⁇ 1> to ⁇ 5 > either method.
• B1 a protein consisting of the amino acid sequence shown in SEQ ID NO: 2
• B2 consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2
• C1 sequence Protein (C2) consisting of the amino acid sequence shown in SEQ ID NO: 4.
• Protein (D1) consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4 and having tyrosine phenol lyase activity (D1) shown in SEQ ID NO: 6.
• Protein consisting of an amino acid sequence (D2) A protein consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 6 and having tyrosine phenol lyase activity ⁇ 7>
• Tyrosine phenol lyase is the above (B1) Or the method of ⁇ 6>, which is the protein of (B2).
• ⁇ 8> The method according to any one of ⁇ 1> to ⁇ 7>, wherein the protocatechuate decarboxylase is the following protein (A1) or (A2).
• A1 A protein consisting of the amino acid sequence shown in SEQ ID NO: 18
• A2 A protein consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 18 and having protocatechuic acid decarboxylase activity
• E1 A protein consisting of the amino acid sequence shown in SEQ ID NO: 24
• E2 A protein consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 24 and having flavin mononucleotide prenyltransferase activity
• ⁇ 10 > The method according to any one of ⁇ 1> to ⁇ 9>, wherein the protocatechuic acid is produced from a saccharide as a starting material.
• ⁇ 11> The method according to any one of ⁇ 1> to ⁇ 10>, comprising the step of recovering 3,4-dihydroxyphenylalanine from the reaction solution.
• ⁇ 12> A vector or DNA fragment containing a polynucleotide encoding protocatechuate decarboxylase and tyrosine phenol lyase.
• Tyrosine phenol lyase is a protein selected from the group consisting of the following (B1), (B2), (C1), (C2), (D1) and (D2) ⁇ 12> or ⁇ 13 > vectors or DNA fragments.
• (B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (B2) consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2, and having tyrosine phenol lyase activity (C1) sequence Protein (C2) consisting of the amino acid sequence shown in SEQ ID NO: 4. Protein (D1) consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 4 and having tyrosine phenol lyase activity (D1) shown in SEQ ID NO: 6.
• Protocatechuate decarboxylase has the following ( The vector or DNA fragment of any one of ⁇ 12> to ⁇ 14>, which is the protein of A1) or (A2).
• A1 A protein consisting of the amino acid sequence shown in SEQ ID NO: 18
• A2 A protein consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 18 and having protocatechuic acid decarboxylase activity ⁇ 16>
• E1 A protein consisting of the amino acid sequence shown in SEQ ID NO: 24
• E2 A protein consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 24 and having flavin mononucleotide prenyltransferase activity
• ⁇ 17 > A transformed cell containing the vector or DNA fragment of any one of ⁇ 12> to ⁇ 16>.
• ⁇ 18> The method according to any one of ⁇ 1> to ⁇ 11>, wherein the microorganism is the transformed cell of ⁇ 17>.
• Example 1 Preparation of Plasmids Containing Various Genes
• PCR was performed using KOD One PCR Master Mix (Toyobo).
• plasmids pET_FnTPL, pET_CfTPL, pET_EwTPL
• FnTPL genes encoding tyrosine phenol lyase
• FnTPL Fusobacterium nucleatum
• SEQ ID NO: 3 A DNA fragment (SEQ ID NO: 3) of a gene encoding tyrosine phenol lyase (CfTPL) derived from Citrobacter freundii and a gene encoding tyrosine phenol lyase (EwTPL) derived from Erwinia herbicola
• SEQ ID NO: 5 was prepared by artificial gene synthesis (Eurfin Genomics), and using this
• Each plasmid (pET_FnTPL, pET_CfTPL, pET_EwTPL) was constructed by ligating the purified DNA fragments with an In-Fusion HD Cloning Kit (Takara Bio Inc.). Using the obtained plasmid solution, ECOS competent E. coli DH5 ⁇ (Nippon Gene), and spread the cell solution on LBAmp agar medium (Bacto Tryptone 1%, Yeast Extract 0.5%, NaCl 1%, ampicillin sodium 50 ⁇ g/mL, agar 1.5%).
• a DNA fragment for insert was obtained by PCR using primers EcoroYins F (SEQ ID NO: 19, GAAGGAGATATACATATGCAAAACCCGATAAATGAC) and EcoroYins R (SEQ ID NO: 20, GTGGTGGTGGTGGTGTTATTTCTTATCGCTAAATAACTC). Subsequently, a DNA fragment for a vector was obtained by PCR using primers pET vec F (SEQ ID NO: 13) and pET vec R (SEQ ID NO: 14) and pET21a plasmid as a template.
• each DNA fragment was purified by NucleoSpin Gel and PCR clean-up (Takara Bio Inc.).
• a plasmid (pET_EcAroY) was constructed by ligating the purified DNA fragment using In-Fusion HD Cloning Kit (Takara Bio Inc.).
• ECOS competent E. coli DH5 ⁇ (Nippon Gene)
• the cell solution was spread on an LBAmp agar medium, allowed to stand overnight at 37° C., and the resulting colonies were treated with the primer pET CPCR2 F (SEQ ID NO: 21, AGATCTCGATCCCGCGAAAT).
• pET CPCR2 R (SEQ ID NO: 22, TTTAGAGGCCCCAAGGGGTT) was performed to select a transformant in which introduction of the target DNA fragment was confirmed.
• the resulting transformants were inoculated into 2 mL of LBAmp liquid medium and cultured overnight at 37°C.
• a plasmid was purified from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.).
• a vector DNA fragment was obtained by PCR using primers EcAroY vec R (SEQ ID NO: 27, GATTCAAACCTCCTTTATTTCTTATCGCTAAATAACTCTG) and EcAroY vec F (SEQ ID NO: 28, CACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCC) for the plasmid (pET_EcAroY) prepared in (a). .
• EcAroY vec R SEQ ID NO: 27, GATTCAAACCTCCTTTATTTCTTATCGCTAAATAACTCTG
• EcAroY vec F SEQ ID NO: 28, CACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCC
• the target plasmid (pET_EcAroY-EcUbiX) was constructed by ligating the purified DNA fragments with In-Fusion HD Cloning Kit (Takara Bio Inc.). Using the obtained plasmid solution, ECOS competent E. E. coli DH5 ⁇ (Nippon Gene) was transformed, the cell solution was spread on LBAmp agar medium, allowed to stand overnight at 37° C., and the resulting colonies were treated with primers pET CPCR2 F (SEQ ID NO: 21) and pET. A PCR reaction was performed using CPCR2 R (SEQ ID NO: 22), and transformants in which introduction of the target DNA fragment was confirmed were selected. The resulting transformants were inoculated into 2 mL of LBAmp liquid medium and cultured overnight at 37°C. A plasmid was purified from this culture medium using NucleoSpin Plasmid EasyPure (Takara Bio Inc.).
• PCR was performed using primers EcAroY-EcUbiX vec F (SEQ ID NO: 35, AGGAGGTTTGATTCATGCAAAACCCGATAAATGAC) and EcAroY-EcUbiX vec R (SEQ ID NO: 36, ATGTATATCTCCTTCTTAAAGTTAA).
• a vector DNA fragment was obtained by After treating these PCR products with DpnI (Takara Bio Inc.), each DNA fragment was purified by NucleoSpin Gel and PCR clean-up (Takara Bio Inc.).
• the target plasmids (pET_FnTPL-EcAroY-EcUbiX, pET_CfTPL-EcAroY-EcUbiX, pET_EwTPL-EcAroY-EcUbiX) were constructed by ligating the purified DNA fragments using In-Fusion HD Cloning Kit (Takara Bio Inc.). Using the obtained plasmid solution, ECOS competent E. E. coli DH5 ⁇ (Nippon Gene) was transformed, the cell solution was spread on LBAmp agar medium, allowed to stand at 37° C.
• Example 2 Evaluation of inhibition rate of tyrosine phenol lyase by protocatechuic acid (1) Introduction of plasmid into host cell Each plasmid (pET_FnTPL, pET_CfTPL, pET_EwTPL) obtained in Example 1(1) was used to transform ECOS competent E. coli. coli BL21(DE3) (Nippon Gene) was transformed by the heat shock method. The resulting transformed cell suspension was plated on an LBAmp agar medium and allowed to stand at 37° C. for 16 hours, and the resulting colonies were used as transformants.
• ECOS competent E. coli. coli BL21(DE3) Nippon Gene
• Example 3 Production of 3,4-dihydroxyphenylalanine using protocatechuic acid as a substrate using a bacterial cell catalyst
• plasmid pET_FnTPL-EcAroY-EcUbiX, pET_CfTPL-EcAroY-EcUbiX, pET_EwTPL-EcAroY-EcUbiX
• ECOS competent E. coli. coli BL21(DE3) Nippon Gene
• the resulting transformed cell suspension was plated on an LBAmp agar medium and allowed to stand at 37° C. for 16 hours, and the resulting colonies were used as transformants.
• the concentration of 3,4-dihydroxyphenylalanine in the resulting reaction solution was determined according to the method of Reference Example 1, and the ability to produce 3,4-dihydroxyphenylalanine using protocatechuic acid as a substrate was calculated according to the following formula.
• Gradient elution was performed under the conditions of 70% methanol as the eluent B, a flow rate of 1.0 mL/min, and a column temperature of 40°C.
• a UV detector detection wavelength 280 nm was used to detect 3,4-dihydroxyphenylalanine.
• a concentration calibration curve was prepared using a standard sample [3,4-dihydroxy-L-phenylalanine (seller code A11311, Fujifilm Wako Pure Chemical Industries, Ltd.)], and based on the concentration calibration curve, 3,4-dihydroxyphenylalanine Quantification was performed.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biotechnology (AREA)
• Biomedical Technology (AREA)
• General Engineering & Computer Science (AREA)
• Microbiology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Molecular Biology (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Biophysics (AREA)
• Mycology (AREA)
• Medicinal Chemistry (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Cell Biology (AREA)
• Enzymes And Modification Thereof (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Priority Applications (1)

Applications Claiming Priority (2)

Publications (1)

Family

ID=86397131

Family Applications (1)

Country Status (3)

Families Citing this family (1)

Citations (5)

• 2022
  • 2022-11-16 JP JP2022183717A patent/JP2023074007A/ja active Pending
  • 2022-11-16 CN CN202280076375.9A patent/CN118302528A/zh active Pending
  • 2022-11-16 WO PCT/JP2022/042624 patent/WO2023090378A1/ja not_active Ceased

Patent Citations (5)

Also Published As

Similar Documents

Legal Events