WO2023085036A1 - Determination method using genetic polymorphism - Google Patents

Abstract

The present invention provides a method for predicting reocclusion of an intracranial cerebral blood vessel, the method comprising: detecting whether or not a subject has a RNF213 p.R4810K polymorphism by using a sample collected from the subject; and determining that, when the subject has the RNF213 p.R4810K polymorphism and after an endovascular therapy is performed on occlusion of the intracranial cerebral blood vessel, there is a high probability of reocclusion occurring in the blood vessel that has undergone the endovascular therapy.

Description

Determination method using genetic polymorphism

The present invention relates to a determination method using genetic polymorphism.

　In Japan, 110,000 people die from stroke annually, and cerebral infarction, which accounts for 70 to 80% of them, is a major cause of hemiplegia and dementia. Cerebral infarction is a disease in which blood vessels that supply blood to brain cells are blocked and brain cells die. Cerebral infarction is caused by atherothrombotic cerebral infarction, which is mainly caused by arteriosclerosis of relatively large blood vessels in the brain, lacunar infarction, which is caused by blockage of small blood vessels in the brain, and atrial fibrillation. It is classified as cardiogenic cerebral embolism, which blocks the large blood vessels of the brain.

Japanese Patent Application Laid-Open No. 2020-092660 (Patent Document 1) discloses that RNF213 p. A method for predicting the risk of developing cerebral infarction in a subject based on the presence or absence of the R4810K gene polymorphism and gender information of the subject is disclosed. International Publication No. 2020/121489 (Patent Document 2) discloses that RNF213p. It is disclosed that when a subject has the R4810K gene polymorphism, the time of onset of cerebral infarction in the subject is judged to be earlier than usual.

Japanese Patent Application Laid-Open No. 2020-092660 WO2020/121489

For patients who have developed cerebral infarction, MRI (Magnetic Resonance Imaging) examination or CT (Computed Tomography) examination is performed to identify the type of cerebral infarction and the site where cerebrovascular abnormalities occur. As a treatment for cerebral infarction, thrombolytic therapy / tPA (tissue plasminogen activator) that dissolves blood clots clogged in blood vessels with drugs, a thin tube called a catheter is inserted from the base of the foot into the blood vessel to remove blood clots in the lesions of the brain. Endovascular treatment is mainly performed to directly remove the

Patients who have undergone endovascular treatment for cerebral infarction may experience reocclusion of the treated vessel. For this reason, doctors need to periodically monitor for the presence or absence of reocclusion for several months after the operation, which imposes a heavy burden on the patient, such as visiting the patient. An object of the present invention is to provide a method for facilitating the prediction of vascular reocclusion risk after endovascular treatment.

One embodiment of the present invention is
Using a sample collected from a subject, the subject was tested for RNF213p. detecting whether it has the R4810K polymorphism;
said subject is said RNF213p. Determining that, when having the R4810K polymorphism, after endovascular treatment for occlusion of an intracranial cerebral vessel, there is a high possibility of reocclusion of the vessel that has undergone endovascular treatment;
to a method for predicting intracranial cerebral vessel reocclusion, comprising:

One embodiment of the present invention is
RNF213p. A kit for determining, based on the presence or absence of the R4810K polymorphism, whether or not there is a high possibility of reocclusion of a blood vessel that has undergone endovascular treatment after endovascular treatment for intracranial cerebral vessel occlusion,
Said RNF213p. A PCR primer pair that amplifies a nucleotide sequence containing a genetic mutation corresponding to the R4810K polymorphism;
Said RNF213p. A first probe that binds to the wild-type base sequence of the R4810K polymorphism and a second probe that binds to the mutant base sequence,
The first probe and the second probe relate to kits labeled with fluorescent dyes different from each other.

One embodiment of the present invention is
RNF213p. The present invention relates to a genetic marker consisting of the R4810K polymorphism for determining whether, after endovascular treatment for occlusion of intracranial cerebral vessels, there is a high likelihood of reocclusion of the vessels that have received said endovascular treatment.

According to the present invention, the risk of reocclusion of blood vessels after endovascular treatment can be predicted.

1 is a flow chart of a case study in an example; FIG. 2 is a graph showing the incidence of immediate and early reocclusion in polymorphism carriers and non-carriers in patients with major brain artery occlusion. FIG. 2 is a graph showing the incidence of immediate and early reocclusion in polymorphism carriers and non-carriers in patients with intracranial atherosclerosis-associated major brain artery occlusion. RNF213p. who developed sudden left hemiplegia. An example of a 59-year-old male with the R4810K polymorphism (case 3 in Table 3) is shown. (A) Diffusion-weighted magnetic resonance (MR) imaging shows several acute ischemic lesions within the cortical perfusion region of the right middle cerebral artery (MCA). (B) MR angiography shows right MCAM1 occlusion. (C) Right internal carotid artery angiography shows right proximal MCAM1 occlusion. (D) Right internal carotid artery angiography shows effective recanalization but remained severe stenosis with delayed peripheral perfusion after mechanical thrombectomy. (E) Final vascular imaging after angioplasty and intracranial stent. (F) Premature reocclusion 7 days after surgery and sudden onset of left hemiparesis.

[Method for predicting reocclusion of intracranial cerebral vessels]
A method for predicting intracranial cerebral vessel reocclusion according to an embodiment of the present invention comprises:
Using a sample collected from a subject, the subject was tested for RNF213p. detecting whether it has the R4810K polymorphism;
said subject is said RNF213p. and determining, after endovascular treatment for intracranial cerebral vessel occlusion, that the endovascularly treated vessel is likely to re-occlude when carrying the R4810K polymorphism.

According to the method for predicting reocclusion of intracranial cerebral blood vessels according to the present invention, it is possible to easily predict whether the risk of reocclusion of blood vessels after endovascular treatment is high. The method for predicting reocclusion of intracranial cerebral vessels according to the present invention allows identification of patients at high risk of reocclusion after endovascular treatment. This allows patients at high risk of reocclusion to be prioritized or more frequently treated and/or monitored to prevent the development of reocclusion. This method can also be said to be a method for assisting in predicting the risk of reocclusion of blood vessels. This method does not include a judgment step by a doctor and does not correspond to a method for diagnosing humans.

Ring finger protein 213 gene (RNF213) p. The R4810K polymorphism (c.14576G>A) is the founder polymorphism of Moyamoya disease (Circle of Willis occlusion) ¹⁾ in East Asia ^1-4) . RNF213p. The R4810K polymorphism is a single nucleotide polymorphism (SNP) of 73097 G>A in the nucleic acid sequence represented by SEQ ID NO:2. This RNF213 SNP is found in 2.5% of healthy Japanese, 2.7% of healthy Koreans, and 0.9% of Chinese, but not in Caucasian (European) ^3,5,6) . A recent study of 46,958 Japanese subjects (17,752 with cerebral infarction and 29,206 controls) found that this polymorphism was present in 5.2% of non-cardiogenic stroke patients and 2.1% of healthy controls. and RNF213 p. It has been shown that the R4810K polymorphism is a risk factor for ischemic stroke (cerebral infarction) in Japanese ⁷⁾ .

SEQ ID NO: 2 contains the RNF213 gene (also known as mysterin gene: moyamoya steno-occlusive disease-associated AAA+ and RING finger protein) and its peripheral region genes [FLJ3520, NPTX1, CARD14 and Raptor (KIAA1303)] Chromosome 17 Partial nucleotide sequence of DNA corresponding to nucleotides 43560001 to 43795000 of Contig #NT010783.15 registered with NCBI. In the notation of "G>A", the base of the major allele (G in this case) precedes the symbol ">" and the base of the minor allele (A in this case) follows.

The RNF213 gene encodes a protein containing dual AAA+ATPase and E3 ligase domains and plays an important role in regulating vascular remodeling and angiogenesis ^3,8) . In recent studies, RNF213p. Overexpression of R4810K was shown to suppress the angiogenic activity and proliferation of human endothelial cells, whereas overexpression of wild-type RNF213 did not ^8,9) . Furthermore, accumulation of filamin A, a substrate of RNF213, has been shown to promote vascular remodeling by migration and proliferation of vascular smooth muscle cells from the media to the intima ^10,11) . Such cell changes in the vasculature lead to RNF213p. It has been suggested that the R4810K polymorphism-associated negative remodeling of blood vessels that is characteristic of major intracranial artery stenosis may occur ^12-14) .

(Step of detecting whether the subject has the RNF213p.R4810K polymorphism using a sample collected from the subject)
RNF213p. The presence or absence of the R4810K polymorphism can be detected from genomic DNA, RNA or protein. Detected RNF213p. The R4810K polymorphism may be homozygous for the mutant or heterozygous for the mutant and wild type (GA type).

When using a nucleic acid to detect a polymorphism, an SNP in which the 14576th base of the RNF213 gene is guanine (G) in the wild type, but adenine (A) in the mutant type should be detected. SNPs may be detected using methods well known in the art, such as PCR-RFLP (restriction fragment length polymorphism) method, PCR-SSCP (single strand conformation polymorphism) method, secondary structural polymorphism analysis) method, PCR-SSO (specific sequence oligonucleotide) method, ASO (Allele Specific Oligonucleotide) hybridization method, sequencing method, next-generation sequencing method, ARMS (Amplification Refracting Mutation System) em) method , Deterted concentration gradient gel Electrical Volunteer Swimming Movement (DENATURING GEL ELECTROPHORESIS, RNASEA Cutting, DOL (DYE -LABELED OLIGONUCLEOTITIDE LIGATION), TAQMANN PCR method, real -time PCR method, SNAP SHOT method, mass spectrometry method, Primer EXTENSION method, Invader method, DNA chip method or DNA microarray method, single nucleotide extension method, Southern blot hybridization method, dot hybridization method, Pyrosequencing method, Exonuclease Cycling Assay method and the like can be used. SNPs may be detected using the kits described below.

　RNF213 p. When detecting the presence or absence of the R4810K polymorphism using a protein, a mutation in which arginine (R) at position 4810 in the protein (SEQ ID NO: 1) encoded by the RNF213 gene is changed to lysine (K) may be detected. Amino acid mutations can be detected using, for example, steric structure analysis, mass spectrometry, antigen-antibody reaction, ultracentrifugation, electrophoresis, absorbance measurement, or a combination thereof.

The sample may be derived from any tissue, cell, or bodily fluid from which genomic DNA or protein, etc. can be collected. Examples of samples include hair, nails, skin, mucous membranes, blood, saliva, tears, urine, feces, sweat, lymph, breast milk, amniotic fluid, body cavity fluid (including ascites, pleural fluid, and cerebrospinal fluid). The blood may be whole blood, plasma or serum. The sample is preferably blood or saliva from the viewpoint of minimal invasiveness in obtaining. Samples may be diluted in saline, buffers, etc., and may be tissue or cell extracts or lysates. Samples may be stored frozen. Sample collection may be performed by a known method depending on the type of sample.

The subject may be a human, a person who has not yet developed a cerebral infarction, or a person who has developed a cerebral infarction. Human race is not particularly limited, but is preferably East Asian (East Asian/Mongoloid). East Asians refer to people of Japanese, Korean, Chinese, Taiwanese and Mongolian origin. East Asians may be Japanese, Korean or Chinese. A race is a distinct subgroup within the Homo sapiens species. The world's major races can be classified into five groups based on genetic information, for example, African (Negroid), Caucasian (Caucasian), Oceanian (Australoid), East Asian (Mongoloid) and Native American.

(Determining that, after endovascular treatment for intracranial cerebral vessel occlusion, there is a high likelihood of reocclusion of the endovascularly treated vessel when the subject has the RNF213p.R4810K polymorphism)
In the present invention, the patient has RNF213p. Having the R4810K polymorphism is determined to be prone to reocclusion after endovascular treatment. As a factor of reocclusion after endovascular treatment, vascular endothelial cells may be damaged during endovascular treatment. Based on the damage caused at this time, the mechanism of thrombus formation is promoted, and thrombus may cause reocclusion. Conceivable. Occlusion of intracranial cerebral vessels before reocclusion (occlusion that led to endovascular treatment) includes cardiogenic cerebral infarction and atherosclerotic cerebral infarction. Atherosclerosis is a condition in which cholesterol, fat, inflammatory cells, etc. accumulate in the lumen of cerebral blood vessels, forming plaque and narrowing the lumen of the blood vessel. A rupture can result in a stroke. When intracranial cerebral vessel occlusion before reocclusion is caused by atherosclerosis, reocclusion is thought to occur more easily because the vessel is more susceptible to injury during endovascular treatment. If the patient has RNF213p. With the R4810K polymorphism and when the cause of the stroke is atherosclerosis, the risk of vessel reocclusion after endovascular treatment is expected to be higher. Also, if the patient has RNF213p. Having the R4810K polymorphism predicts a susceptibility to restenosis after endovascular treatment. The present invention may be a method for predicting restenosis of intracranial cerebral vessels.

Endovascular treatment includes a method of retrieving the thrombus by entangling it with a stent (metal net) attached to the tip of the catheter, a method of retrieving the thrombus while aspirating it with a suction pump connected to the catheter, and a method of dilating the blood vessel with a balloon. method, a method of placing a stent in a blood vessel, and the like. For endovascular therapy, an appropriate therapeutic method or a combination thereof is selected depending on the type of cerebral infarction that has developed, the size and location of the thrombus. Endovascular therapy can also be performed for stenosis of cerebral vessels.

The method for predicting intracranial cerebral vessel reocclusion may further include selecting an instrument for endovascular treatment based on the likelihood of vessel reocclusion. As described above, there is a possibility that reocclusion of the blood vessel may occur easily due to the strain on the blood vessel. It is expected that the method of retrieving a thrombus by suction or the method of retrieving a thrombus by a stent will place a small burden on the blood vessel, while the method of dilating the blood vessel with a balloon or the method of placing a stent will place a large burden on the blood vessel. If it is determined that reocclusion is likely to occur, the risk of reocclusion may be reduced by selecting less vascular-intrusive treatment methods and instruments. The device of choice may be a drug eluting stent (DES).

Based on the possibility of reocclusion of blood vessels, the dosage, administration method, administration period, administration timing, etc. of the administered drug may be adjusted. Drugs include antiplatelet agents, antithrombin agents, anticoagulants, dextran, and the like. The drug may be an orally or injected drug.

The step of determining that the blood vessel is likely to re-occlude may include determining that the treated vessel is likely to re-occlude earlier than usual after the endovascular treatment. The earlier-than-usual period after endovascular treatment may be from the time recanalization is observed by endovascular treatment to the time during endovascular treatment (immediate reocclusion), or after recanalization is observed by endovascular treatment. May be within 2 weeks (early reocclusion).

The intracranial cerebral artery in which endovascular treatment is performed may be the main cerebral artery, and the main cerebral artery includes the intracranial internal carotid artery, the middle cerebral artery, the anterior cerebral artery, the vertebral artery, and the basilar artery. The risk of reocclusion after endovascular treatment tends to be particularly high in the intracranial internal carotid artery and middle cerebral artery.

[kit]
A kit according to an embodiment of the present invention comprises
RNF213p. A kit for determining, based on the presence or absence of the R4810K polymorphism, whether or not there is a high possibility of reocclusion of a blood vessel that has undergone endovascular treatment after endovascular treatment for intracranial cerebral vessel occlusion,
Said RNF213p. A PCR primer pair that amplifies a nucleotide sequence containing a genetic mutation corresponding to the R4810K polymorphism;
Said RNF213p. A first probe that binds to the wild-type base sequence of the R4810K polymorphism and a second probe that binds to the mutant base sequence,
The first probe and the second probe are labeled with fluorescent dyes different from each other.
The kit may be a kit for determining whether a blood vessel that has undergone endovascular treatment has a high probability of restenosis.

By using a kit having the primer pair and the set of the first probe and the second probe, RNF213p. The R4810K polymorphism can be detected. If the subject is RNF213p. Based on whether or not a person has the R4810K polymorphism, it can be predicted whether there is an increased risk of reocclusion or restenosis of the vessel after endovascular treatment. The kit can provide information for predicting the risk of vessel reocclusion or restenosis after endovascular treatment. The kit contains a nucleic acid in a sample taken from a subject, preferably a p.o. The R4810K polymorphism (c.14576G>A) can be discriminated. Detected RNF213p. The R4810K polymorphism may be homozygous for the mutant or heterozygous for the mutant and wild type.

A PCR primer pair uses the genomic DNA in the specimen collected from the subject as a template, and the RNF213p. A nucleic acid fragment containing the SNP site of the R4810K polymorphism can be amplified. The amplification site for detecting the wild type and the amplification site for detecting the mutant are identical. As the length of the nucleic acid fragment to be amplified, RNF213p. 80-100 bases including the SNP site of the R4810K polymorphism are preferred. As such a PCR primer pair, oligonucleotides (forward primer and reverse primer) that hybridize under stringent conditions to the region consisting of the base sequence shown in SEQ ID NO:7 are preferred. Here, the stringent conditions refer to conditions under which the binding between the template DNA and the primers is specific in the annealing in PCR, which is the step of binding the primers to the template DNA. The T _m of the primers may be designed to be, for example, 58-60°C. The base length of the PCR primer is preferably 15-25 bases. From the viewpoint of specificity, the kit according to the present invention preferably comprises a PCR primer pair comprising a primer having the nucleotide sequence shown in SEQ ID NO:3 and a primer having the nucleotide sequence shown in SEQ ID NO:4.
5′-TTCCAGAACGTCCAGCAAGT-3′ (forward; SEQ ID NO: 3)
5′-ACAGTCCTGGTCCTGTCAGA-3′ (Reverse; SEQ ID NO: 4)

The sequences below represent RNF213p. It is the nucleotide sequence of the region containing the SNP of the R4810K polymorphism. Any base sequence of the following sequences can be amplified as long as it contains a SNP site.
5′-CCCAATAACATTTTTTAGGTAAAAAAATTGTTACTGGGTGGTCTTCCCTTCTCCAGGAAGCAGCAGAGCTGAGGCTGGTAAAGTTCCTGCCTGAGATTTTGGCCTTGCAAAGGGATCTAGTGTAAGCAGTTCCAGAACGTCCAGCAAGTTGAATACAGCTCCAT CAGAGGCTTCCTCAGCAAGCACAGCTCAGGTGTGGCTCTGCTCTGACAGGACCAGGGACTGTCCCGCATTTGGCGGGTTCGAAAAGGATCACTGCATAGGGGGAACAGGGTGGGGGCGGAGGGGAGGAGGCGCGCTGATGGGTGCTCTATAGCCTAAGCCCTTACCATGCGGTGAA GGGTGCTTGAACCCCCAAAA-3' (SEQ ID NO: 7)

The probes are used for real-time PCR using the FRET principle, the probe sequences are designed, and the reporter fluorescent dye and quencher are selected so as to be compatible with the method. The first probe binds to a nucleic acid fragment in which the 14576th SNP of the RNF213 gene is a wild-type base (G). The second probe binds to a mutant nucleic acid fragment in which the 14576th SNP of the RNF213 gene is replaced with G>A. The first probe preferably hybridizes under stringent conditions to a nucleic acid fragment having a wild-type nucleotide sequence amplified by PCR using the wild-type RNF213 gene as a template. It does not hybridize under stringent conditions to a nucleic acid fragment containing the SNP site of the R4810K polymorphism. On the other hand, the second probe was RNF213p. It hybridizes under stringent conditions to a nucleic acid fragment containing the SNP site of the R4810K polymorphism, but under stringent conditions to a nucleic acid fragment having a wild-type nucleotide sequence amplified by PCR using the wild-type RNF213 gene as a template. Do not hybridize with Stringent conditions refer to conditions under which specific hybrids are formed during annealing between nucleic acid fragments amplified by PCR and probes, but non-specific hybrids are not formed. It is preferred to design the probe sequences to target approximately the middle of the PCR product amplified by the primer pair.

The base length of the probe is preferably 10-25 bases, more preferably 15-20 bases. The _Tm of the probe may be designed to be, for example, 68-70°C. From the viewpoint of specificity, the kit according to the present invention preferably contains a set of the first probe having the base sequence shown in SEQ ID NO:5 and the second probe having the base sequence shown in SEQ ID NO:6.
First probe: 5'-CTCCATCAGAGGCTTCCT-3' (SEQ ID NO: 5)
Second probe: 5'-CTCCATCAAAGGCTTCCT-3' (SEQ ID NO: 6)

The above sequence is an example, and part of the base sequence may be modified to the extent that specific hybridization can be performed without hindrance. Here, "partially modified" means deletion, substitution, insertion and/or addition of part of the bases. The number of bases to be modified is, for example, 1 to 3, 1 to 2, or 1.

Probes include, but are not limited to, hydrolysis probes, Molecular Beacons, cycling probes, and the like. An example of a hydrolysis probe is an oligonucleotide modified with a fluorescent dye at the 5' end and a quencher substance at the 3' end. The hydrolysis probe specifically hybridizes to the template DNA during PCR annealing, but the presence of the quencher on the probe suppresses the generation of fluorescence even when irradiated with excitation light. In the elongation reaction step of PCR, when the hydrolysis probe hybridized to the template DNA is decomposed by the 5'→3' exonuclease activity of Taq DNA polymerase, the fluorescent dye is released from the probe, and the fluorescence is emitted by the quencher. The suppression is released and fluorescence is emitted. By measuring this fluorescence intensity, the production amount of the amplification product can be measured. Fluorescent dyes include FAM (6-carboxyfluorescein), ROX (6-carboxy-X-rhodamine), Cy3 and Cy5 (cyanine dyes), HEX (4,7,2′,4′,5′,7′- hexachloro-6-carboxyfluorescein), VIC, TET (tetrachlorofluorescein), NED, CAL Fluor Orange 560 (CFO), CAL Fluor Gold 540, CAL Fluor Red 590, CAL Fluor Red 610, CAL Fluor Red 635, Quasar 570, Quasar 670, Quasar 705, T (JOE), etc., but not limited to these. Examples of quenchers include TAMRA (tetramethylrhodamine; registered trademark), BHQ (Black Hole Quencher; registered trademark)-1, BHQ-2, BHQ-3, Pulsar 650, Spacer C3, MGB-Eclipse (registered trademark), DABCYL, and the like. include, but are not limited to.

The first probe and the second probe are labeled with fluorescent dyes different from each other. Combinations of different fluorescent dyes are not particularly limited as long as they have different fluorescent properties and do not interfere with each other in fluorescence measurement. As a combination of the fluorescent dye of the first probe and the fluorescent dye of the second probe, FAM and HEX (which may be the fluorescent dye of the first probe. The same applies to the following combinations), FAM and CFO, Examples include FAM and VIC, FAM and TET, HEX and Joe, HEX and TET, and the like.

A kit according to the present invention may further comprise a PCR buffer containing a surfactant and proteinase K. Surfactants can dissolve cells, biological tissues, and the like. As surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants or nonionic surfactants can be selected. The surfactant is preferably an anionic surfactant, more preferably sodium dodecyl sulfate. When the surfactant is sodium dodecyl sulfate, its concentration is preferably 0.1-0.5% (w/v) when mixed with the sample. Proteinase K acts to inactivate DNA and RNA degrading enzymes. The proteinase K concentration is preferably 100-300 μg/mL when mixed with the sample. The PCR buffer may further comprise KCl, MgCl ₂ and dNTP mix (deoxyribonucleotide 5′-triphosphate; mixture consisting of dATP, dGTP, dCTP and dTTP). The PCR buffer is not particularly limited, but is preferably Tris buffer. Appropriate concentrations of dNTPs, MgCl ₂ , KCl and buffers can be set by those skilled in the art, for example, MgCl ₂ concentration is 1.5 mM, KCl concentration is 35 mM, dNTP concentration is 200 μM each, Tris The buffer concentration is 10 mM. The PCR buffer is a negatively charged biological substance (such as certain sugars and dyes) that adsorbs to DNA polymerase and a positively charged biological substance (such as certain proteins) that adsorbs to DNA. It may contain a substance that binds to a substance that inhibits PCR and neutralizes the PCR inhibitory action of said negatively charged substance and positively charged substance. As such a PCR buffer, gene amplification reagents Ampdirect or Ampdirect Plus (both registered trademarks; Shimadzu Corporation) can be used.

The kit according to the present invention can be used in a rapid genotyping system for simple and rapid genetic testing in clinical settings. Examples of rapid genotype determination systems include "GTS-7000" manufactured by Shimadzu Corporation.

One embodiment of the present invention is
RNF213p. Based on the presence or absence of the R4810K polymorphism, after endovascular treatment for intracranial cerebral vessel occlusion, the above kit for determining whether there is a high possibility of reocclusion or restenosis of the blood vessel that has undergone endovascular treatment. in manufacturing,
Said RNF213p. A PCR primer pair that amplifies a nucleotide sequence containing a genetic mutation corresponding to the R4810K polymorphism;
Said RNF213p. Use with a first probe that binds to the wild-type sequence and a second probe that binds to the mutant sequence of the R4810K polymorphism.

Using this kit, RNF213p. A method for detecting the R4810K polymorphism is described. RNF213p. An example of a method for detecting the R4810K polymorphism is
(1) mixing a sample taken from a subject with a PCR buffer containing detergent and proteinase K;
(2) The mixture obtained in step (1) was treated with a DNA polymerase, RNF213p. (3) detecting a PCR product;

The sample collected from the subject may be the sample described in [Method for predicting reocclusion of intracranial cerebral blood vessels]. The sample preferably contains the subject's genomic DNA. The amount of the sample depends on the amount of genomic DNA contained, but if the sample is saliva or peripheral blood, it may be about 0.1 μL to 10 μL, or 0.5 μL to 2 μL.

(1) By mixing a sample collected from a subject with a PCR buffer containing a surfactant and proteinase K, the sample is dissolved and nucleic acids are released.

(2) The mixture of sample and PCR buffer contains DNA polymerase and RNF213p. PCR can be initiated by mixing with a PCR primer pair that amplifies a nucleotide sequence containing the genetic mutation corresponding to the R4810K polymorphism. Although the DNA polymerase is not particularly limited, it may be a thermostable DNA polymerase derived from thermophilic bacteria, and Taq, Tth, KOD, Pfu and mutants thereof can be used. A hot start DNA polymerase may be used to avoid non-specific amplification. Hot-start DNA polymerases include BIOTAQ® hot-start DNA polymerase. Examples of hot-start DNA polymerases include DNA polymerases to which an anti-DNA polymerase antibody is bound, DNA polymerases to which the enzyme active site is chemically modified with heat sensitivity, and the like. PCR conditions (temperature, time and number of cycles) can be easily set by those skilled in the art. In the method using this kit, PCR products can be detected by real-time measurement (real-time PCR).

(3) In real-time measurement of PCR products, monitor the amplification curve of PCR products using a fluorescence filter corresponding to the fluorescent dye used. If the fluorescence intensity increases with the number of PCR cycles, the presence of the DNA of interest in the sample is determined to be positive, while if the fluorescence intensity does not increase in the PCR, the presence of the control DNA is determined. determined to be negative. In a method for detecting a PCR product, by comparing the increase in fluorescence intensity derived from the first probe and the fluorescence intensity derived from the second probe, RNF213p. The R4810K polymorphism can be detected. RNF213p. When the R4810K polymorphism is homozygous, an increase in fluorescence intensity from the second probe is observed, but no increase in fluorescence intensity from the first probe is observed. RNF213p. When the R4810K polymorphism is heterozygous between mutant and wild type, an increase in fluorescence intensity from both the first and second probes is observed. In the wild-type RNF213 gene (homozygous), only an increase in fluorescence intensity derived from the first probe is observed. If an increase in fluorescence intensity from the second probe is observed, RNF213p. It is determined that the R4810K polymorphism was detected.

As another detection method, based on the number of PCR cycles (Cq value) at which the amplification curve of the PCR product crosses a certain threshold line, The presence of the R4810K polymorphism can be determined. Generally, a small Cq value indicates a large amount of template DNA, and a large Cq value indicates a small amount of template DNA. Given a given Cq value for the use of the second probe, RNF213p. It is determined that the R4810K polymorphism was detected. RNF213p. When the R4810K polymorphism is heterozygous for mutant and wild type, a constant Cq value is given for the use of both fluorescently labeled probes, although they do not necessarily show the same value. The wild-type RNF213 gene (homozygous) gives a constant Cq value only for the use of the first probe. If the amplification curve of the PCR product does not cross a certain threshold line for the fluorescently labeled probe used, i.e. if no Cq value is given, it indicates that there is no base sequence to which the probe binds.

[marker]
One embodiment of the present invention is
RNF213p. A genetic marker consisting of the R4810K polymorphism for determining whether reocclusion or restenosis is likely to occur after endovascular treatment for intracranial cerebral vessel occlusion.
If this gene marker is used, the subject will be able to detect RNF213p. With the R4810K polymorphism, it can be determined that, after endovascular treatment for intracranial cerebral vessel occlusion, there is a high likelihood of reocclusion or restenosis of the endovascularly treated vessel. This genetic marker can provide information for predicting the risk of vascular reocclusion after endovascular treatment.

　One embodiment of the present invention is a RNF213 p. Use of the R4810K polymorphism.

[Prediction method]
One embodiment of the present invention is
Using a sample collected from a subject, the subject was tested for RNF213p. A method of predicting intracranial cerebral vessel reocclusion or restenosis comprising detecting whether or not the patient has the R4810K polymorphism.
If the subject is RNF213p. With the R4810K polymorphism, it can be predicted that after endovascular treatment for intracranial cerebral vessel occlusion, the endovascularly treated vessel is likely to reocclude or restenosis. If the subject is RNF213p. As a method for detecting whether or not a subject has the R4810K polymorphism, the method described in the above [Method for predicting reocclusion of intracranial cerebral blood vessels] may be used.

The present invention will be described in more detail below with reference to Examples, but the present invention is not limited to these.

Mechanical thrombectomy (MT) is used to treat acute ischemic stroke (AIS) due to occlusion of the M1 segment of the internal carotid artery (ICA) and middle cerebral artery (MCA). ¹⁵⁾ . In East Asians, intracranial atherosclerotic disease (ICAD) has been reported to be the cause of approximately 15-25% of large vessel occlusions (LVO) in which MT was performed. ^16,17) . Recent studies suggest that reocclusion may occur after endovascular therapy (EVT) in intracranial atherosclerosis-related major cerebral artery occlusion (ICAD-related LVO) ^[18-20]. . This is thought to be because unstable plaques, which are prone to rupture, are present at the stenotic site, and thrombus removal promotes vascular endothelium damage and platelet aggregation ^{21, 22)} . RNF213p. The R4810K polymorphism may be associated with ICAD-associated LVO in Asian patients undergoing MT. RNF213p. Negative remodeling in ICAD patients with the R4810K polymorphism may have different frequencies of reocclusion after EVT, including balloon angioplasty, compared to conventional ICAD-associated LVO. Among patients with anterior circulation intracranial LVO, RNF213p. It has not been examined whether EVT outcomes differ between carriers and non-carriers of the R4810K polymorphism. Here, RNF213p. Verify the effect of the R4810K polymorphism.

[Method]
The identified data supporting the findings of this study are available from the inventors upon reasonable request and after obtaining approval from the relevant ethics committee.

(test population)
All AIS patients admitted to the National Cerebral and Cardiovascular Center (NCVC) within 7 days of symptom onset or last known date are enrolled in the NCVC Stroke Registry ^23-25 . In this study, patients enrolled in the registry from January 2011 to March 2021, (1) had intracranial internal carotid artery or middle cerebral artery M1 occlusion, (2) underwent EVT, and (3) this study. studies and RNF213p. A retrospective study was conducted in patients who gave written informed consent for the R4810K polymorphism genotyping study. Clinical and radiological data were obtained prospectively from the database and extracted for retrospective analysis. This study was conducted in accordance with the Declaration of Helsinki and was approved by the Ethics Committee of the NCVC. The NCVC Stroke Registry is registered at ClinicalTrials.gov (NCT02251665).

(RNF213 genotyping test)
RNF213p. Genotyping of the R4810K polymorphism was performed after EVT by a fully automated genetic analysis system (GTS-7000; Shimadzu Corporation or LightCycler 96; Roche). These systems allow direct detection of SNPs from 1 μL of whole blood by real-time PCR ²⁶⁾ . The primer sequences used were
5′-TTCCAGAACGTCCAGCAAGT-3′ (forward; SEQ ID NO: 3)
5′-ACAGTCCTGGTCCTGTCAGA-3′ (reverse; SEQ ID NO: 4)
Met. The probe set is
5′-CTCCATCAGAGGCTTCCT-3′ (SEQ ID NO:5) and 5′-CTCCATCAAAGGCTTCCT-3′ (SEQ ID NO:6)
Met.
In 22 of the patients, the results of genotyping by real-time PCR were confirmed by DNA sequencing. RNF213p. As a result of R4810K polymorphism analysis, p. The R4810K GA polymorphism was considered a polymorphism carrier and the wild-type homozygous GG genotype was considered a polymorphism non-carrier.

(EVT)
All endovascular surgeries were performed according to the American Heart Association/American Stroke Association guidelines ¹⁵⁾ or Japanese guidelines for neuroendovascular mechanical thrombectomy ²⁷⁾ . All patients underwent EVT under local anesthesia and received conscious sedation as needed. In this study, a balloon guide catheter was used and guided as far as possible to the extracranial internal carotid artery. EVT procedures include stent retriever thrombectomy, contact aspiration, intracranial balloon angioplasty, intracranial stents, or combinations thereof. Modified Thrombolysis In Cerebral Infarction: mTICI was used to assess recanalization ²⁸⁾ . The antiplatelet agents aspirin and clopidogrel are co-administered perioperatively when diagnosed with ICAD-associated LVO as described below.

(Collection of clinical data)
The following clinical data were collected; age, sex, prestroke modified Rankin Scale (mRS) score, admission systolic blood pressure, baseline National Institutes of Health Stroke Scale (NIHSS) score, current smoking, atrial fibrillation, vascular risk. Factors (hypertension, diabetes and dyslipidemia) and past medical history (stroke or transient ischemic attack before index stroke). The degree of ischemic changes in the MCA region was measured based on diffusion-weighted magnetic resonance (MR) imaging or non-contrast computed tomography (CT), according to the Alberta Stroke Program Early Computed. Tomography Score (ASPECTS) ^29,30) . The occlusion was identified by digital subtraction angiography on admission. Intravenous thrombolysis was performed using alteplase 0.6 mg/kg (approved dose in Japan) ³¹⁾ . Time metrics included time from confirmation of onset to thrombolysis and time from confirmation of onset to groin puncture. Causes of acute LVO have been classified into three groups (ICAD-related, embolism and arterial dissection) by stroke society-certified neurologists. ICAD-associated LVO is defined as ≥50% residual stenosis in the target arterial lesion after EVT detected by postoperative angiography and follow-up angiography, with a clear proximal source of cerebral embolism. ^18,20,32,33) . Intracranial artery stenosis was measured according to standards ³⁴⁾ . The definition of LVO due to cerebral embolism was defined as acute intracranial artery occlusion with an identifiable proximal source of cerebral embolism, eg, atrial fibrillation or cerebral embolic stroke of unknown origin ⁽³⁵⁾ . Antithrombotic therapy at discharge includes antiplatelet agents (aspirin, clopidogrel and cilostazol) and anticoagulants (direct oral anticoagulants [dabigatran, rivaroxaban, avixaban and edoxaban] and warfarin).

(outcome)
Postoperative outcomes were immediate reocclusion, final mTICI≧2b recanalization, and early reocclusion. Immediate reocclusion was defined as reocclusion during surgery, and early reocclusion was defined as reocclusion detected by MR angiography within 2 weeks after confirmation of effective recanalization after surgery ^19,20) . Clinical outcomes were an mRS score of 0-2 after 90 days, subarachnoid hemorrhage, cerebral parenchymal hemorrhage and symptomatic intracranial hemorrhage (ICH). ICH was assessed by non-contrast CT or gradient-echo MR imaging within 36 hours of onset. Parenchymal hemorrhage was defined as hemorrhage at the site of cerebral infarction with an occupancy effect, as shown in the European Cooperative Acute Stroke Study ³⁶⁾ . Symptomatic ICH was defined as ICH with an increase in NIHSS score of ≥4 points from baseline ⁽³⁷⁾ .

(Statistical analysis)
Data were summarized as medians (interquartile range [IQR]) for continuous variables and as frequencies and percentages for categorical variables. Statistical differences between polymorphism carriers and polymorphism non-carriers were assessed by the Mann-Whitney U test or Fisher's two-tailed exact test. Postoperative outcomes were evaluated using age-adjusted multivariate logistic regression models to evaluate RNF213p. Association with the R4810K polymorphism was analyzed and non-polymorphism carriers were used as controls ³⁸⁾ . Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated. RNF213p. Because the R4810K polymorphism is associated with stenosis/occlusion of the intracranial internal carotid artery or middle cerebral artery M1 by ^ICAD8,38-40) , clinical data and outcomes were further limited to cases of ICAD-associated LVO and polymorphism-bearing A comparison was made between polymorphism non-carriers and polymorphism non-carriers (secondary analysis, Fig. 1). P-values less than 0.05 were considered statistically significant. All analyzes were performed using the Stata/IC statistical package, version 15.1 (Stata Corp LP).

[result]
(Patient characteristics)
Of 341 patients who underwent EVT for acute intracranial ICA/MCAM1 obstruction, 64 patients had RNF213p. Excluded due to lack of R4810K genotyping data (Fig. 1). RNF213p. Genotyped patients were younger (76 vs. 80 years, P=0.02) and had a higher frequency of dyslipidemia (45.7%) when compared with patients without R4810K genotyping data. vs. 31.2%, P=0.04). Of the 277 patients analyzed (128 female [46.2%]; median age 76 years [IQR, 69-82 years]; median NIHSS score 11 [IQR 8-17]), RNF213p . The R4810K polymorphism was found in 10 patients (3.6%). Polymorphism carriers were younger (67 vs. 76 years, P<0.01) and more likely to be current smokers (80.0% vs. 43.0%) compared to non-polymorphism carriers. 4%, P=0.05), were less likely to have atrial fibrillation (30.0% vs. 63.4%, P=0.05), and had higher baseline systolic blood pressure ( 172 mmHg vs. 151 mmHg, P=0.02) (Table 1). Polymorphism carriers were more likely to have ICAD-associated LVO and less likely to have cerebral embolism LVO compared to non-polymorphism carriers (both P<0.01). Antiplatelet agents were administered more frequently to polymorphism carriers than to non-polymorphism carriers at hospital discharge (P<0.01 for both aspirin and clopidogrel).

(RNF213p.R4810K polymorphism carriers and non-carriers)
Details and outcomes of EVT between polymorphism carriers and polymorphism non-carriers are shown in Table 2. Polymorphism carriers performed angioplasty more frequently than non-polymorphism carriers (40.0% vs. 12.0%, P<0.01), with a median angioplasty of doubled (4 vs. 2, P=0.27) and intracranial stent surgery was performed more frequently (20.0% vs. 2.2%, P=0.03). Polymorphism carriers had a longer time from groin puncture to end of surgery compared to non-polymorphism carriers (177 vs. 72 minutes, P=0.08). Polymorphism carriers had higher immediate reocclusion rates (40.0% vs. 5.6%, P<0.01; age-adjusted OR 9.83, 95% CI 2.47-39.22). (Table 2 and FIG. 2), the rate of final mTICI≧2b recanalization was 100.0% in carriers and 81.8% in non-carriers (P=0.22; age-adjusted OR 3.91, 95% CI 0.64-23.99). Polymorphism carriers had a higher frequency of early reocclusion compared with non-polymorphism carriers (60.0% vs. 0.4%, P<0.01; age-adjusted OR 346.4, 95 %CI 33.21-3612) (Table 2 and Figure 2). The median number of days from the end of surgery to early reocclusion (IQR) was 4 (2-9) days. Repeat EVT for early reocclusion was performed in 4 polymorphism carriers and 1 polymorphism non-carrier. The frequency of mRS scores 0-2 after 90 days was seen in 60.0% of polymorphism carriers and 51.7% of non-polymorphism carriers (P=0.75). The rates of subarachnoid hemorrhage, cerebral parenchymal hemorrhage and symptomatic ICH did not differ between polymorphism carriers and non-polymorphism carriers (Table 2). RNF213p. A summary of patients with the R4810K polymorphism is shown in Table 3, RNF213p. A representative patient with the R4810K polymorphism is shown in FIG.

(Intra-group analysis of ICAD-related LVO patients)
A similar analysis was performed limiting to patients diagnosed with ICAD-associated LVO (n=30) (secondary analysis, Figure 1). Polymorphism carriers (n=7) were younger compared to non-polymorphism carriers (n=23) (60 vs. 73 years, P=0.04). No significant differences were found between polymorphism carriers and non-polymorphism carriers in rates of angioplasty, total number of angioplasty procedures and intracranial stents. The time from groin puncture to end of surgery was longer in polymorphism carriers (190 min vs. 142 min, P=0.09). The immediate reocclusion rate was not significantly different between polymorphism carriers (57.1%) and polymorphism non-carriers (34.8%) (P=0.39; age-adjusted OR 2 .38, 95% CI 0.39-14.47) (Table 2 and Figure 3). The rate of final mTICI≧2b recanalization was similar between polymorphism carriers (100.0%) and polymorphism non-carriers (91.3%) (P=1.00). Polymorphism carriers had a higher frequency of early reocclusion compared with non-polymorphism carriers (71.4% vs. 4.3%, P<0.01 adjusted OR 47.6), 95% CI 3.53-674.0) (Table 2 and Figure 3). The median number of days from the end of surgery to early reocclusion (IQR) was 2 (2-6) days. No significant between-group differences were seen for clinical outcomes.

[Discussion]
By analyzing a cohort of patients with anterior circulation LVO who underwent EVT (n=277), RNF213p. Carriers of the R4810K polymorphism had a higher rate of immediate reocclusion during EVT (40.0% vs. 5.6%) and a higher rate of early reocclusion within 2 weeks after EVT compared to non-polymorphism carriers. (60.0% vs. 0.4%) was shown. RNF213p. In R4810K polymorphism carriers, ICAD caused 70.0% of acute LVO, compared to 8.6% in non-polymorphism carriers. Early reocclusion was seen more frequently in polymorphism carriers than in non-polymorphism carriers, and was more frequent in polymorphism carriers even when the study was limited to ICAD-associated LVO patients. Differences in the incidence of immediate and early reocclusion between polymorphism carriers and polymorphism non-carriers are particularly evident in RNF213p. It may result from the vascular pathology of ICAD due to the R4810K polymorphism ^12-14) .

EVT outcomes associated with specific polymorphisms have not been previously reported, and the RNF213 polymorphism is unique to East Asian populations. In our study, RNF213p. The frequency of the R4810K polymorphism was 3.6%, which approximated the frequencies of 4.2% to 5.2% reported in studies of ischemic stroke patients7,41 ⁾ . In contrast, when the sample population was restricted to ICAD-related LVO patients, RNF213p. The proportion of the R4810K polymorphism was clearly increased to 23.3%, suggesting the utility of investigating this polymorphism when ICAD-associated LVO is suspected. RNF213p. The R4810K polymorphism can be identified using specific primer and probe sets in as little as an hour after blood collection. The present invention suggests that immediate and early reocclusion is more likely in polymorphism carriers compared to non-polymorphism carriers, and rapid genotyping of genetic polymorphisms may help patients with EVT surgery and post-op. Can assist in choosing care. Furthermore, genotyping results can be used for risk assessment of EVT in patients with acute anterior circulation LVO stroke ⁴² .

[Reference]
1. Scott RM, Smith ER. Moyamoya disease and moyamoya syndrome. N Engl J Med. 2009;360:1226-1237. doi: 10.1056/NEJMra0804622.
2. Kamada F, Aoki Y, Narisawa A, et al. A genome-wide association study identifies RNF213 as the first moyamoya disease gene. J Hum Genet. 2011;56:34-40. doi: 10.1038/jhg.2010.132.
3. Liu W, Morito D, Takashima S, et al. Identification of RNF213 as a susceptibility gene for moyamoya disease and its possible role in vascular development. PLoS One. 2011;6:e22542. doi: 10.1371/journal.pone.0022542 .
4. Bang OY, Ryoo S, Kim SJ, et al. Adult moyamoya disease: a burden of intracranial stenosis in East Asians? PLoS One. 2015;30;10:e0130663. doi: 10.1371/journal.pone.0130663.
5. Liu W, Hitomi T, Kobayashi H, Harada KH, Koizumi A. Distribution of moyamoya disease susceptibility polymorphism p.R4810K in RNF213 in East and Southeast Asian populations. Neurol Med Chir (Tokyo). 2012;52:299-303. doi: 10.2176/nmc.52.299.
6. Cecchi AC, Guo D, Ren Z, et al. RNF213 rare variants in an ethnically diverse population with moyamoya disease. Stroke. 2014;45:3200-3207. doi: 10.1161/STROKEAHA.114.006244.
7. Okazaki S, Morimoto T, Kamatani Y, et al. Moyamoya disease susceptibility variant RNF213 p.R4810K increases the risk of ischemic stroke attributable to large artery atherosclerosis. Circulation. 2019;139:295-298. doi: 10.1161/CIRCULATIONAHA. 118.038439.
8. Koizumi A, Kobayashi H, Hitomi T, Harada KH, Habu T, Youssefian S. A new horizon of moyamoya disease and associated health risks explored through RNF213. Environ Health Prev Med. 2016;21:55-70. doi: 10.1007 /s12199-015-0498-7.
9. Hitomi T, Habu T, Kobayashi H, et al. Downregulation of Securin by the variant RNF213 R4810K (rs112735431, G>A) reduces angiogenic activity of induced pluripotent stem cell-derived vascular endothelial cells from moyamoya patients. Biochem Biophys Res Commun 2013;438:13-19. doi: 10.1016/j.bbrc.2013.07.004.
10. Zhu G, Chen H, Zhang W. Phenotype switch of vascular smooth muscle cells after siRNA silencing of filamin. Cell Biochem Biophys. 2011;61:47-52. doi: 10.1007/s12013-011-9159-7.
11. Stahlhut M, van Deurs B. Identification of filamin as a novel ligand for caveolin-1: evidence for the organization of caveolin-1-associated membrane domains by the actin cytoskeleton. Mol Biol Cell. 2000;11:325-337. doi: 10.1091/mbc.11.1.325.
12. Hongo H, Miyawaki S, Imai H, et al. Smaller outer diameter of atherosclerotic middle cerebral artery associated with RNF213 c.14576G>A variant (rs112735431). Surg Neurol Int. 2017;8:104. doi: 10.4103/sni .sni_59_17.
13. Chung JW, Kim DH, Oh MJ, et al. Cav-1 (caveolin-1) and arterial remodeling in adult moyamoya disease. Stroke. 2018;49:2597-2604. doi: 10.1161/STROKEAHA.118.021888.
14. Choi EH, Lee H, Chung JW, et al. Ring finger protein 213 variant and plaque characteristics, vascular remodeling, and hemodynamics in patients with intracranial atherosclerotic stroke: a high-resolution magnetic resonance imaging and hemodynamic study. J Am Heart Assoc 2019;8:e011996. doi: 10.1161/JAHA.119.011996.
15. Powers WJ, Rabinstein AA, Ackerson T, et al. Guidelines for the early management of patients with acute ischemic stroke: 2019 update to the 2018 guidelines for the early management of acute ischemic stroke: a guideline for healthcare professionals from the American Heart. Association/American Stroke Association. Stroke. 2019;50:e344-e418. doi: 10.1161/STR.0000000000000211.
16. Yoshimura S, Sakai N, Uchida K, et al. Endovascular therapy in ischemic stroke with acute large-vessel occlusion: recovery by endovascular salvage for cerebral ultra-acute embolism Japan registry 2. J Am Heart Assoc. 2018;7:e008796 doi: 10.1161/JAHA.118.008796.
17. Tong X, Wang Y, Fiehler J, et al. Thrombectomy versus combined thrombolysis and thrombectomy in patients with acute stroke: a matched-control study. Stroke. 2021;52:1589-1600. doi: 10.1161/STROKEAHA.120.031599.
18. Kim BJ, Kim JS. Ischemic stroke subtype classification: an Asian viewpoint. J Stroke. 2014;16:8-17. doi: 10.5853/jos.2014.16.1.8.
19. Hwang YH, Kim YW, Kang DH, Kim YS, Liebeskind DS. Impact of target arterial residual stenosis on outcome after endovascular revascularization. Stroke. 2016;47:1850-1857. doi:10.1161/STROKEAHA.
20. Baek BH, Yoon W, Lee YY, Kim SK, Kim JT, Park MS. Intravenous tirofiban infusion after angioplasty and stenting in intracranial atherosclerotic stenosis-related stroke. Stroke. 2021;52:1601-1608. doi: 10.1161/STROKEAHA .120.033551.
21. Kang DH, Yoon W. Current opinion on endovascular therapy for emergent large vessel occlusion due to underlying intracranial atherosclerotic stenosis. Korean J Radiol. 2019;20:739-748. doi: 10.3348/kjr.2018.0809.
22. Kim GE, Yoon W, Kim SK, et al. Incidence and clinical significance of acute reocclusion after emergent angioplasty or stenting for underlying intracranial stenosis in patients with acute stroke. AJNR Am J Neuroradiol. 2016;37:1690-1695. doi : 10.3174/ajnr.A4770.
23. Sato S, Uehara T, Ohara T, Suzuki R, Toyoda K, Minematsu K. Factors associated with unfavorable outcome in minor ischemic stroke. Neurology. 2014;83:174-181.
24. Fujita K, Tanaka K, Yamagami H, et al. Detrimental effect of chronic hypertension on leptomeningeal collateral flow in acute ischemic stroke. Stroke. 2019;50:1751-1757.
25. Yoshimoto T, Inoue M, Tanaka K, et al. Identifying large ischemic core volume ranges in acute stroke that can benefit from mechanical thrombectomy. J Neurointerv Surg. 2020;neurintsurg-2020-016934. 016934.
26. Saito S, Shinmyozu K, Kawakami D, et al. Conversion from cilostazol to OPC-13015 linked to mitigation of cognitive impairment. Alzheimers Dement (NY). 2021;27:e12182. doi: 10.1002/trc2.12182.
27. Yamagami H, Hayakawa M, Inoue M, et al. Guidelines for Mechanical Thrombectomy in Japan, the fourth edition, March 2020: a guideline from the Japan Stroke Society, the Japan Neurological Society, and the Japanese Society for Neuroendovascular Therapy. Med Chir (Tokyo). 2021;61:163-192. doi: 10.2176/nmc.nmc.st.2020-0357.
28. Zaidat OO, Yoo AJ, Khatri P, et al. Recommendations on angiographic revascularization grading standards for acute ischemic stroke: a consensus statement. Stroke. 2013;44:2650-2663. doi: 10.1161/STROKEAHA.113.001972.
29. Pexman JH, Barber PA, Hill MD, et al. Use of the Alberta stroke program early CT score (ASPECTS) for assessing CT scans in patients with acute stroke. AJNR Am J Neuroradiol. 2001;22:1534-1542.
30. Hirai T, Sasaki M, Maeda M, et al. Diffusion-weighted imaging in ischemic stroke: effect of display method on observers' diagnostic performance. Acad Radiol. 2009;16:305-312. doi: 10.1016/j.acra 2008.09.012.
31. Toyoda K, Koga M, Iguchi Y, et al. Guidelines for Intravenous Thrombolysis (Recombinant Tissue-Type Plasminogen Activator), the third edition, March 2019: A guideline from the Japan Stroke Society. Neurol Med Chir (Tokyo). 2019 ;59:449-491. doi: 10.2176/nmc.st.2019-0177.
32. Kang DH, Yoon W, Kim SK, et al. Endovascular treatment for emergent large vessel occlusion due to severe intracranial atherosclerotic stenosis. J Neurosurg. 2019;130:1949-1956. doi: 10.3171/2018.1.JNS172350.
33. Kang DH, Yoon W, Baek BH, et al. Front-line thrombectomy for acute large-vessel occlusion with underlying severe intracranial stenosis: stent retriever versus contact aspiration. J Neurosurg. 2020;132:1202-1208. doi: 10.3171 /2019.1.JNS182905.
34. Schumacher HC, Meyers PM, Higashida RT, et al. Reporting standards for angioplasty and stent-assisted angioplasty for intracranial atherosclerosis. Stroke. 2009;40:e348-e365.
35. Hart RG, Diener HC, Coutts SB, et al. Embolic strokes of undetermined source: the case for a new clinical construct. Lancet Neurol. 2014;13:429-438. -7.
36. Hacke W, Kaste M, Fieschi C, et al. Intravenous thrombolysis with recombinant tissue plasminogen activator for acute hemispheric stroke. The European Cooperative Acute Stroke Study (ECASS). JAMA. 1995;274:1017-1102.
37. Hacke W, Kaste M, Fieschi C, et al. Randomized double-blind placebo-controlled trial of thrombolytic therapy with intravenous alteplase in acute ischaemic stroke (ECASS II). Second European-Australasian Acute Stroke Study Investigators. Lancet. 1998; 352:1245-1251. doi: 10.1016/s0140-6736(98)08020-9.
38. Kamimura T, Okazaki S, Morimoto T, et al. Prevalence of RNF213 p.R4810K variant in early-onset stroke with intracranial arterial stenosis. Stroke. 2019;50:1561-1563.
39. Miyawaki S, Imai H, Takayanagi S, Mukasa A, Nakatomi H, Saito N. Identification of a genetic variant common to moyamoya disease and intracranial major artery stenosis/occlusion. Stroke. 2012;43:3371-3374. doi: 10.1161 /STROKEAHA.112.663864.
40. Kim HJ, Choi EH, Chung JW, et al. Role of the RNF213 variant in vascular outcomes in patients with intracranial atherosclerosis. J Am Heart Assoc. 2021;10:e017660. doi: 10.1161/JAHA.120.017660.
41. Park YS, Park HW, Park HS, et al. Association of genetic variants of RNF213 with ischemic stroke risk in Koreans. Genes Genomics. 2021;43:389-397.
42. Xiong Y, Wang H, Zhang M, et al. Risk stratification for endovascular treatment in acute anterior circulation occlusive stroke. J Stroke Cerebrovasc Dis. 2019;28:104442. doi: 10.1016/j.jstrokecerebrovasdis.2019.104442.

[Aspect]
It will be appreciated by those skilled in the art that the multiple exemplary embodiments and examples described above are specific examples of the following aspects. The terms used herein have meanings as commonly understood by those of ordinary skill in the fields of medicine, anatomy, pharmacology, molecular biology, organic chemistry, and the like, unless otherwise specified. In the event that terms defined herein do not have the same meaning as commonly understood, the statements made herein will control.

(Section 1)
According to one aspect, a method for predicting intracranial cerebral vessel reocclusion comprises:
Using a sample collected from a subject, the subject was tested for RNF213p. detecting whether it has the R4810K polymorphism;
said subject is said RNF213p. and determining, after endovascular treatment for intracranial cerebral vessel occlusion, that the endovascularly treated vessel is likely to re-occlude when having the R4810K polymorphism.

According to the method described in paragraph 1, it becomes easier to predict the risk of reocclusion of blood vessels after endovascular treatment.

(Section 2)
The method of claim 1, further comprising selecting an instrument for use in the endovascular treatment based on the likelihood of reocclusion of the intracranial cerebral vessel.

According to the method described in paragraph 2, the risk of reocclusion can be reduced.

(Section 3)
3. The method of claim 1 or 2, wherein the determining comprises determining that the treated blood vessel is likely to re-occlude earlier than usual after the endovascular treatment. include.

(Section 4)
In the method according to item 3, the period earlier than usual after the endovascular treatment is from when recanalization is recognized by the endovascular treatment to during the endovascular treatment.

(Section 5)
In the method according to item 3, the earlier-than-usual period after the endovascular treatment is within two weeks after recanalization is observed by the endovascular treatment.

According to the methods described in paragraphs 3 to 5, patients with a high risk of immediate or early reocclusion are determined.

(Section 6)
6. The method according to any one of items 1 to 5, wherein said RNF213p. The R4810K polymorphism is heterozygous for mutant and wild type.

(Section 7)
7. The method of any one of paragraphs 1-6, wherein the sample is blood or saliva.

According to the method described in paragraph 7, a sample can be obtained with minimal invasiveness.

(Section 8)
In the method according to any one of items 1 to 7, the intracranial cerebral blood vessel is the intracranial internal carotid artery or the middle cerebral artery.

(Section 9)
In the method according to any one of items 1 to 8, the intracranial cerebral vascular occlusion is vascular occlusion due to atherosclerosis.

When intracranial cerebral vessel occlusion is atherosclerosis, RNF213 p. Patients with the R4810K polymorphism can be judged to be at higher risk of vessel reocclusion.

(Section 10)
A kit according to one aspect comprises:
RNF213p. A kit for determining, based on the presence or absence of the R4810K polymorphism, whether or not there is a high possibility of reocclusion of a blood vessel that has undergone endovascular treatment after endovascular treatment for intracranial cerebral vessel occlusion,
Said RNF213p. A PCR primer pair that amplifies a nucleotide sequence containing a genetic mutation corresponding to the R4810K polymorphism;
Said RNF213p. A first probe that binds to the wild-type base sequence of the R4810K polymorphism and a second probe that binds to the mutant base sequence,
The first probe and the second probe are kits labeled with fluorescent dyes different from each other.

According to the kit described in paragraph 10, it is possible to predict whether a subject has a high risk of reocclusion of blood vessels after endovascular treatment.

(Section 11)
In the kit according to item 10, the PCR primer pair includes a primer having the nucleotide sequence shown by SEQ ID NO:3 and a primer having the nucleotide sequence shown by SEQ ID NO:4.

According to the kit described in item 11, PCR can be performed with less non-specific amplification.

(Section 12)
In the kit according to item 10 or 11, the first probe has the base sequence shown by SEQ ID NO:5 and the second probe has the base sequence shown by SEQ ID NO:6.

According to the kit described in paragraph 12, non-specific detection of PCR products can be reduced.

(Section 13)
The kit of paragraphs 10-12, further comprising a PCR buffer containing detergent and proteinase K.

According to the kit described in paragraph 13, PCR can be easily and rapidly performed using genomic DNA as a template.

(Section 14)
The invention according to one aspect provides RNF213p. A genetic marker consisting of the R4810K polymorphism for determining whether or not there is a high possibility of reocclusion of a vessel that has received intracranial cerebral vessel occlusion after endovascular treatment.

According to the invention described in paragraph 14, information for predicting the risk of reocclusion of blood vessels after endovascular treatment can be provided.

(Section 15)
According to one aspect, a method for predicting intracranial cerebrovascular restenosis comprises:
Using a sample collected from a subject, the subject was tested for RNF213p. detecting whether it has the R4810K polymorphism;
said subject is said RNF213p. after endovascular treatment for intracranial cerebral vessel occlusion when having the R4810K polymorphism, determining that the endovascularly treated vessel is likely to restenose.

If the patient has RNF213p. Having the R4810K polymorphism predicts a susceptibility to restenosis after endovascular treatment. It is believed that when the risk of restenosis is high, the risk of reocclusion is also high.

(Section 16)
A kit according to one aspect comprises:
RNF213p. A kit for determining, based on the presence or absence of the R4810K polymorphism, whether there is a high possibility of restenosis in a blood vessel that has undergone endovascular treatment after endovascular treatment for intracranial cerebral vessel occlusion,
Said RNF213p. A PCR primer pair that amplifies a nucleotide sequence containing a genetic mutation corresponding to the R4810K polymorphism;
Said RNF213p. A first probe that binds to the wild-type base sequence of the R4810K polymorphism and a second probe that binds to the mutant base sequence,
The first probe and the second probe are kits labeled with fluorescent dyes different from each other.

(Section 17)
The invention according to one aspect provides RNF213p. A genetic marker consisting of the R4810K polymorphism for determining whether or not there is a high possibility of restenosis in the blood vessels that have undergone endovascular treatment after endovascular treatment for intracranial cerebral vessel occlusion.

Claims (14)

1. Using a sample collected from a subject, the subject was tested for RNF213p. detecting whether it has the R4810K polymorphism;
   said subject is said RNF213p. Determining that, when having the R4810K polymorphism, after endovascular treatment for occlusion of an intracranial cerebral vessel, there is a high possibility of reocclusion of the vessel that has undergone endovascular treatment;
   A method for predicting intracranial cerebral vessel reocclusion, comprising:
2. The method of claim 1, further comprising selecting an instrument for use in said endovascular treatment based on the likelihood of reocclusion of said intracranial cerebral vessels.
3. 3. The method of claim 1 or 2, wherein said determining comprises determining that the treated vessel is likely to re-occlude earlier than normal after said endovascular treatment.
4. The method according to claim 3, wherein the period earlier than usual after the endovascular treatment is from when recanalization is recognized by the endovascular treatment to during the endovascular treatment.
5. The method according to claim 3, wherein the earlier-than-usual period after the endovascular treatment is within two weeks after recanalization is observed by the endovascular treatment.
6. The RNF213 p. 2. The method of claim 1, wherein the R4810K polymorphism is heterozygous for mutant and wild type.
7. The method according to claim 1, wherein the sample is blood or saliva.
8. The method according to claim 1, wherein the intracranial cerebral blood vessel is the intracranial internal carotid artery or the middle cerebral artery.
9. The method according to claim 1, wherein the intracranial cerebral vascular occlusion is vascular occlusion due to atherosclerosis.
10. RNF213p. A kit for determining, based on the presence or absence of the R4810K polymorphism, whether or not there is a high possibility of reocclusion of a blood vessel that has undergone endovascular treatment after endovascular treatment for intracranial cerebral vessel occlusion,
    Said RNF213p. A PCR primer pair that amplifies a nucleotide sequence containing a genetic mutation corresponding to the R4810K polymorphism;
    Said RNF213p. A first probe that binds to the wild-type base sequence of the R4810K polymorphism and a second probe that binds to the mutant base sequence,
    A kit in which the first probe and the second probe are labeled with fluorescent dyes different from each other.
11. The kit according to claim 10, wherein the PCR primer pair includes a primer having the nucleotide sequence shown by SEQ ID NO:3 and a primer having the nucleotide sequence shown by SEQ ID NO:4.
12. The kit according to claim 10 or 11, wherein the first probe has the base sequence shown by SEQ ID NO:5 and the second probe has the base sequence shown by SEQ ID NO:6.
13. The kit according to claim 10, further comprising a PCR buffer containing a surfactant and proteinase K.
14. 　RNF213 p. A genetic marker after endovascular treatment for intracranial cerebral vessel occlusion, which consists of the R4810K polymorphism, to determine whether the endovascularly treated vessels are likely to re-occlude.

Images