KR102158723B1 - SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene - Google Patents

SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene Download PDF

Info

Publication number
KR102158723B1
KR102158723B1 KR1020190039250A KR20190039250A KR102158723B1 KR 102158723 B1 KR102158723 B1 KR 102158723B1 KR 1020190039250 A KR1020190039250 A KR 1020190039250A KR 20190039250 A KR20190039250 A KR 20190039250A KR 102158723 B1 KR102158723 B1 KR 102158723B1
Authority
KR
South Korea
Prior art keywords
snp
gene
allele
cerebral aneurysm
diagnosing
Prior art date
Application number
KR1020190039250A
Other languages
Korean (ko)
Inventor
전진평
Original Assignee
한림대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한림대학교 산학협력단 filed Critical 한림대학교 산학협력단
Priority to KR1020190039250A priority Critical patent/KR102158723B1/en
Application granted granted Critical
Publication of KR102158723B1 publication Critical patent/KR102158723B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Abstract

The present invention relates to a single nucleotide polymorphism (SNP) marker composition for diagnosing an intracranial aneurysm, comprising an SNP of the SPCS3 gene; a composition for diagnosing an intracranial aneurysm comprising an agent capable of detecting or amplifying the SNP marker; a kit for diagnosing an intracranial aneurysm comprising the composition; and a method of providing information for diagnosing an intracranial aneurysm using the composition and the kit. According to the SNP marker composition for diagnosing an intracranial aneurysm, the composition for diagnosing an intracranial aneurysm, the kit for diagnosing an intracranial aneurysm, and the method for providing information for diagnosing an intracranial aneurysm of the present invention, an SNP on the SPCS3 gene can be used as a marker for predicting or diagnosing the risk of developing an intracranial aneurysm in a Korean or Asian population.

Description

SPCS3 유전자의 단일염기다형성을 포함하는 뇌동맥류 진단용 SNP 마커 {SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene}SNP marker for diagnosis of cerebral aneurysm including single nucleotide polymorphism of SPCS3 gene {SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene}
본 발명은 SPCS3 유전자의 SNP를 포함하는, 뇌동맥류 진단용 SNP 마커 조성물, 상기 SNP 마커를 검출 또는 증폭할 수 있는 제제를 포함하는 뇌동맥류 진단용 조성물, 상기 조성물을 포함하는 뇌동맥류 진단용 키트, 및 상기 조성물 및 키트를 이용한 뇌동맥류 진단을 위한 정보 제공 방법에 관한 것이다.The present invention includes a SNP marker composition for cerebral aneurysm diagnosis, comprising the SNP of the SPCS3 gene, a composition for diagnosis of a cerebral aneurysm comprising an agent capable of detecting or amplifying the SNP marker, a kit for diagnosing a cerebral aneurysm comprising the composition, and the composition And a method of providing information for diagnosing a cerebral aneurysm using a kit.
단일염기 다형성(single nucleotide polymorphism, SNP)이란 염색체의 단일부위에서 여러 가지 DNA 염기들 중의 하나에 나타나는 일반적인 돌연변이로 인간의 게놈(genome)에는 약 3백만 개의 SNP가 존재한다. SNP는 그 빈도가 높고 안정하며 유전체 전체에 분포되어 있고 이에 의하여 개인의 유전적 다양성이 발생한다. 이러한 SNP 차이는 서로 다른 질병에 대한 감수성의 차이를 만들어 낸다. 따라서 최근에는 SNP 정보를 바탕으로, 인간의 질병에 관여하는 적절한 유전자(질환 후보 유전자)들을 선정하고 이들의 변이형을 발굴하고 질환과의 연관성을 통계적으로 확인하는 과정을 포함하는 “질병 예측 유전자 검사 기술”이 개발되고 있다. 따라서, 단일염기다형성을 분석함으로써 사람의 경우 특정 질환에 대한 개인의 감수성을 파악하여 염기서열의 차이로 인해 발생하는 선천성 질병에 대한 예방 또는 발병한 질환의 치료에 도움이 될 수 있다.Single nucleotide polymorphism (SNP) is a common mutation that appears in one of several DNA bases in a single region of a chromosome. About 3 million SNPs exist in the human genome. SNPs are highly frequent and stable, and are distributed throughout the genome, thereby generating individual genetic diversity. These SNP differences create differences in susceptibility to different diseases. Therefore, in recent years, based on SNP information, the “Disease Prediction Gene Test, which includes the process of selecting appropriate genes (disease candidate genes) involved in human diseases, discovering their variants, and statistically confirming the association with the disease. Technology” is being developed. Therefore, by analyzing a single nucleotide polymorphism, in the case of humans, it can be helpful in preventing or treating congenital diseases caused by differences in base sequences by grasping an individual's susceptibility to specific diseases.
뇌동맥류, 구체적으로 두개내 동맥류는 모든 지주막하 출혈(지주막하 출혈)의 약 85%를 차지하며, 이는 50%까지의 높은 사망률을 가진다. 뇌동맥류는 일반적으로 지주막하출혈이 발생하게 되어 이를 먼저 뇌CT 촬영으로 확인할 수 있으며, 지주막하출혈이 의심되나 CT에서 안보일 경우에는 요추부 천자를 통해서 피가 섞인 뇌척수액을 확인함으로써 진단할 수도 있다. 또한, 실제로 파열된 뇌동맥류의 치료계획을 세우기 위해서는 파열된 부위를 찾아내어 위치, 크기, 모양, 갯수등을 정확히 파악해야 하는데 이를 위해서는 '뇌혈관 조영술' 이라는 검사를 해야 하며, 그 외의 방법으로는 CT 혈관촬영술이나 MRI 혈관촬영술등이 있다. 다만, 상기와 같은 방법은 번거로울 뿐만 아니라, 뇌동맥류가 발병하기 전이나 또는 예후를 예측하기에는 어렵다는 문제점이 있다.Cerebral aneurysms, specifically intracranial aneurysms, account for about 85% of all subarachnoid hemorrhages (subarachnoid hemorrhage), which has a high mortality rate of up to 50%. Cerebral aneurysms are generally caused by subarachnoid hemorrhage, which can be first confirmed by cerebral CT scan. If subarachnoid hemorrhage is suspected but not visible on CT, it can also be diagnosed by checking the blood-infused cerebrospinal fluid through a lumbar puncture. In addition, in order to establish a treatment plan for an actually ruptured cerebral aneurysm, the ruptured area must be identified and the location, size, shape, and number of the ruptured cerebral aneurysms must be accurately identified. These include CT angiography and MRI angiography. However, the above method is not only cumbersome, but also has a problem that it is difficult to predict the prognosis or before the onset of a cerebral aneurysm.
이에 본 발명자들은 뇌동맥류 발병 진단, 발병 위험 예측 및 예후 예측을 효율적이고 손쉽게 할 수 있는 방법을 개발하고자 노력한 결과, 특정 유전자 상의 SNP 대립형질로부터 뇌동맥류를 진단 또는 예측할 수 있는 진단용 조성물을 개발하여 본 발명을 완성하였다.Accordingly, the present inventors have endeavored to develop a method for efficiently and easily diagnosing the onset of cerebral aneurysms, predicting the risk of onset, and predicting the prognosis. The invention was completed.
대한민국 공개특허 제10-2017-0134203호Republic of Korea Patent Publication No. 10-2017-0134203
본원의 제 1 측면은, SPCS3(Signal Peptidase Complex Subunit 3) 유전자의 단일염기다형성(single nucleotide polymorphism, SNP)인 rs17688188을 포함하는, 뇌동맥류 진단용 SNP 마커 조성물을 제공하는 것이다.The first aspect of the present application is to provide a SNP marker composition for diagnosing a cerebral aneurysm, including rs17688188, which is a single nucleotide polymorphism (SNP) of the SPCS3 (Signal Peptidase Complex Subunit 3) gene.
본원의 제 2 측면은, SPCS3 유전자의 SNP인 rs17688188를 검출 또는 증폭할 수 있는 제제를 포함하는, 뇌동맥류 진단용 조성물을 제공하는 것이다.A second aspect of the present application is to provide a composition for diagnosing a cerebral aneurysm, including an agent capable of detecting or amplifying rs17688188, which is the SNP of the SPCS3 gene.
본원의 제 3 측면은, 뇌동맥류 진단용 조성물을 포함하는, 뇌동맥류 진단용 키트를 제공하는 것이다.A third aspect of the present application is to provide a kit for diagnosing a cerebral aneurysm, including a composition for diagnosing a cerebral aneurysm.
본원의 제 4 측면은, 개체로부터 분리된 생물학적 시료로부터, SPCS3 유전자의 SNP인 rs17688188의 대립형질을 결정하는 단계를 포함하는, 뇌동맥류 진단을 위한 정보 제공 방법을 제공하는 것이다.A fourth aspect of the present application is to provide a method of providing information for diagnosing a cerebral aneurysm, comprising determining an allele of rs17688188, a SNP of the SPCS3 gene, from a biological sample isolated from an individual.
이를 구체적으로 설명하면 다음과 같다. 한편, 본원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.This will be described in detail as follows. Meanwhile, each description and embodiment disclosed herein may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in this application belong to the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the specific description described below.
본원의 제 1 측면은, SPCS3(Signal Peptidase Complex Subunit 3) 유전자의 단일염기다형성 (single nucleotide polymorphism, SNP)인 rs17688188을 포함하는, 뇌동맥류 진단용 SNP 마커 조성물을 제공한다.The first aspect of the present application provides a SNP marker composition for diagnosing a cerebral aneurysm, comprising rs17688188, which is a single nucleotide polymorphism (SNP) of the SPCS3 (Signal Peptidase Complex Subunit 3) gene.
본원 명세서 전체에서 사용되는 용어, "SNP(single nucleotide polymorphism)”는 단일염기다형성을 의미하며, 염색체의 단일부위에서 여러 가지 DNA 염기들 중의 하나에 나타나는 일반적인 돌연변이로 SNP는 그 빈도가 높고 안정하며 유전체 전체에 분포되어 있고 이에 의하여 개인의 유전적 다양성이 발생한다. 본원에서, 상기 “SNP 마커”는 “SNP”와 혼용되어 명명될 수 있다.The term "SNP (single nucleotide polymorphism)" as used throughout this specification refers to single nucleotide polymorphism. SNP is a common mutation that appears in one of several DNA bases in a single site of a chromosome. It is distributed throughout, thereby causing genetic diversity of individuals In the present application, the “SNP marker” may be named interchangeably with “SNP”.
본원 명세서 전체에서 사용되는 용어, "마커(marker)"는 바이오마커를 의미하며 생명체의 변화를 탐지할 수 있어 생명체의 정상 또는 병리적인 상태, 약물에 대한 반응 정도 등을 객관적으로 측정할 수 있다.The term "marker" used throughout the specification of the present application means a biomarker and can detect changes in a living organism, thereby objectively measuring the normal or pathological state of the living organism, and the degree of reaction to a drug.
본원 명세서 전체에서 사용되는 용어, "뇌동맥류(cerebral aneurysm 또는 brain aneurysm)"는 두개내 동맥류(Intracranial aneurysm. IA)로도 지칭되며, 뇌동맥 또는 뇌정맥의 벽의 약화가 혈관의 국소적 확장 또는 풍선확장(ballooning)을 유발하는 뇌혈관 질환이다. 뇌동맥류의 일반적인 위치는 윌리스환(Circle of Willis)이라고 알려진, 뇌의 기부에 있는 동맥이다. 뇌동맥류의 약 85%가 윌리스환의 앞부분에서 발생하고, 뇌의 앞부분과 중간부분에 혈액을 공급하는 내부 경동맥 및 그들의 주요 분지를 포함한다. 뇌동맥류는 크기와 형태에 의해 분류된다. 소 동맥류(small aneurysm)는 15 mm 미만의 직경을 갖는다. 더 큰 동맥류(larger aneurysm)는 대형(large)(15 내지 25mm), 특대형(giant)(25 내지 50mm), 및 초특대형(super giant)(50mm 초과)으로 분류되는 동맥류를 포함한다. 낭형 동맥류(saccular aneurysm)는 낭형 돌출(saccular outpouching)을 갖는 동맥류이고, 뇌동맥류의 가장 흔한 형태이다. 딸기형 동맥류는 딸기를 닮은 목 또는 줄기를 갖는 낭형 동맥류이다. 방추형 동맥류(fusiform aneurysm)는 줄기가 없는 동맥류이다.The term "cerebral aneurysm or brain aneurysm" as used throughout the present specification is also referred to as intracranial aneurysm. IA, and weakening of the wall of a cerebral artery or a cerebral vein is caused by local expansion of blood vessels or balloon expansion. It is a cerebrovascular disease that causes (ballooning). A common location for a cerebral aneurysm is an artery at the base of the brain, known as the Circle of Willis. About 85% of cerebral aneurysms occur in the anterior part of the Willis ring and include the internal carotid arteries and their major branches that supply blood to the anterior and middle parts of the brain. Cerebral aneurysms are classified by size and shape. Small aneurysm has a diameter of less than 15 mm. Larger   aneurysms include   aneurysms classified as large (15-25 mm), giant (25-50 mm), and super giant (> 50 mm). A saccular aneurysm is an aneurysm with saccular outpouching and is the most common form of cerebral aneurysm. Strawberry-like aneurysms are cystic aneurysms with a strawberry-like neck or stem. Fusiform aneurysm (fusiform aneurysm) is a stemless   aneurysm.
본원의 일 구현예에 따르면, 본원의 뇌동맥류 진단용 SNP 마커 조성물은 뇌동맥류 발병을 진단하거나, 뇌동맥류 발병 위험을 예측하거나 또는 뇌동맥류의 예후를 예측하는 것일 수 있으나, 이에 제한되는 것은 아니다.According to the exemplary embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm of the present application may diagnose the onset of a cerebral aneurysm, predict the risk of developing a cerebral aneurysm, or predict the prognosis of a cerebral aneurysm, but is not limited thereto.
본원 명세서 전체에서 사용되는 용어 "진단"은, 특정 개인에 대하여 뇌동맥류가 이미 발병하였는지 여부를 판별하는 것을 의미한다.The term "diagnosis", as used throughout the present specification, means determining whether a cerebral aneurysm has already occurred in a specific individual.
본원 명세서 전체에서 사용되는 용어 "예측"은, 특정 개인에 대하여 뇌동맥류가 발병할 가능성이 있는지, 발병할 가능성이 있다면 뇌동맥류가 발병할 가능성이 불특정 다수인에 비하여 상대적으로 높은지 여부를 판별하는 것을 의미한다.The term "prediction" as used throughout the present specification is to determine whether there is a possibility of developing a cerebral aneurysm in a specific individual, or whether the likelihood of developing a cerebral aneurysm is relatively high compared to a large number of unspecified individuals. it means.
본원의 일 구현예에 따르면, 상기 SPCS3 유전자의 SNP인 rs17688188는 서열번호 11의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs17688188의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs17688188의 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs17688188가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.73)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to one embodiment of the present application, rs17688188, which is the SNP of the SPCS3 gene, may include the 26th nucleotide of SEQ ID NO: 11, and the allele of the base of rs17688188 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs17688188 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an exemplary embodiment of the present application, it was confirmed that rs17688188 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.73) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원 명세서 전체에서 사용되는 용어 "대립형질" 또는 "대립유전자"는 상동염색체의 동일한 유전자 좌위에 존재하는 한 유전자의 여러 유형을 의미한다. 대립유전자는 다형성을 나타내는데 사용되기도 하며, 예컨대, SNP는 두 종류 이상, 예를 들어 두 종류의 대립형질을 갖는다.The term "allele" or "allele" as used throughout this specification refers to multiple types of a gene present at the same locus of a homologous chromosome. Alleles are sometimes used to represent   polymorphism, for example  SNP has two or more types, for example, two types of alleles.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물은 1) GBA(Glucocerebrosidase) 유전자의 SNP인 rs75822236, 2) TCF24(transcription factor 24) 유전자의 SNP인 rs112859779, 3) OLFML2A(Olfactomedin Like 2A) 유전자의 SNP인 rs79134766, 4) ARHGAP32(Rho GTPase Activating Protein 32) 유전자의 SNP인 rs371331393, 5) CD163L1(CD163 Molecule Like 1) 유전자의 SNP인 rs138525217, 6) CUL4A(cullin 4A) 유전자의 SNP인 rs74115822, 7) LOC102724084 유전자의 SNP인 rs75861150, 8) LRRC3(Leucine rich repeat containing 3) 유전자의 SNP인 rs116969723, 9) RNF144A 유전자의 SNP인 rs6741819, 10) FLJ45964 유전자의 SNP인 rs59626274, 11) LINGO2(Leucine Rich Repeat And Ig Domain Containing 2) 유전자의 SNP인 rs56942085, 및 12) MINK1(misshapen/Nck-interacting kinase(NIK)-related kinase 1) 유전자의 SNP인 rs72835045으로 이루어진 군에서 선택되는 하나 이상의 SNP를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.According to one embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm is 1) rs75822236, which is a SNP of the GBA (Glucocerebrosidase) gene, 2) rs112859779, which is a SNP of the TCF24 (transcription factor 24) gene, 3) OLFML2A (Olfactomedin Like 2A) The SNP of the gene rs79134766, 4) The SNP of the ARHGAP32 (Rho GTPase Activating Protein 32) gene rs371331393, 5) The SNP of the CD163L1 (CD163 Molecule Like 1) gene rs138525217, 6) The SNP of the CUL4A (cullin 4A) gene rs74115822, 7) rs75861150, a SNP of the LOC102724084 gene, 8) rs116969723, a SNP of the LRRC3 (Leucine rich repeat containing 3) gene, 9) rs6741819, a SNP of the RNF144A gene 10) rs59626274, 11) LINGO2 (Leucine Rich Repeat, a SNP of the FLJ45964 gene) And Ig Domain Containing 2) SNP of the gene rs56942085, and 12) MINK1 (misshapen/Nck-interacting kinase (NIK)-related kinase 1) SNP of the gene rs72835045 additionally comprising one or more SNPs selected from the group consisting of It may be, but is not limited thereto.
본원의 일 구현예에 따르면, 상기 GBA(Glucocerebrosidase) 유전자의 SNP인 rs75822236는 서열번호 1의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs75822236의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs75822236의 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs75822236가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 1.00)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to the exemplary embodiment of the present application, rs75822236, which is the SNP of the GBA (Glucocerebrosidase) gene, may include the 26th nucleotide of SEQ ID NO: 1, and the allele of the base of rs75822236 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs75822236 is C or the allele of its complementary base is G, it is possible to diagnose the occurrence of a cerebral aneurysm or to predict the risk of the onset at a high level. According to an embodiment of the present application, it was confirmed that rs75822236 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 TCF24 유전자의 SNP인 rs112859779는 서열번호 2의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs112859779의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs112859779의 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs112859779가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.94)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to one embodiment of the present application, rs112859779, which is the SNP of the TCF24 gene, may include the 26th nucleotide of SEQ ID NO: 2, and the allele of the base of rs112859779 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs112859779 is C or the allele of its complementary base is G, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs112859779 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.94) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 OLFML2A 유전자의 SNP인 rs79134766는 서열번호 3의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs79134766의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs79134766의 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs79134766가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.96)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to one embodiment of the present application, rs79134766, which is the SNP of the OLFML2A gene, may include the 26th nucleotide of SEQ ID NO: 3, and the allele of the base of rs79134766 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs79134766 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs79134766 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.96) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 ARHGAP32 유전자의 SNP인 rs371331393는 서열번호 4의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs371331393의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs371331393의 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs371331393가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 1.00)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to one embodiment of the present application, rs371331393, which is the SNP of the ARHGAP32 gene, may include the 26th nucleotide of SEQ ID NO: 4, and the allele of the base of rs371331393 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs371331393 is G or the allele of its complementary base is C, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level. According to an embodiment of the present application, it was confirmed that rs371331393 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 CD163L1 유전자의 SNP인 rs138525217는 서열번호 5의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs138525217의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs138525217의 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs138525217가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 1.00)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to one embodiment of the present application, rs138525217, which is the SNP of the CD163L1 gene, may include the 26th nucleotide of SEQ ID NO: 5, and the allele of the base of rs138525217 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs138525217 is C or the allele of its complementary base is G, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level. According to an embodiment of the present application, it was confirmed that rs138525217 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 CUL4A 유전자의 SNP인 rs74115822는 서열번호 6의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs74115822의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs74115822의 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs74115822가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.80)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to one embodiment of the present application, rs74115822, which is the SNP of the CUL4A gene, may include the 26th nucleotide of SEQ ID NO: 6, and the allele of the base of rs74115822 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs74115822 is G or the allele of its complementary base is C, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level. According to an embodiment of the present application, it was confirmed that rs74115822 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.80) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 LOC102724084 유전자의 SNP인 rs75861150는 서열번호 7의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs75861150의 염기의 대립형질은 T 또는 C일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs75861150의 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs75861150가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 1.00)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to the exemplary embodiment of the present application, rs75861150, which is the SNP of the LOC102724084 gene, may include the 26th nucleotide of SEQ ID NO: 7, and the allele of the base of rs75861150 may be T or C. According to an embodiment of the present invention, when the allele of the base of rs75861150 is C or the allele of its complementary base is G, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs75861150 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 1.00) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 LRRC3 유전자의 SNP인 rs116969723는 서열번호 8의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs116969723의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs116969723의 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs116969723가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.81)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to one embodiment of the present application, rs116969723, which is the SNP of the LRRC3 gene, may include the 26th nucleotide of SEQ ID NO: 8, and the allele of the base of rs116969723 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs116969723 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing it may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs116969723 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.81) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 RNF144A 유전자의 SNP인 rs6741819는 서열번호 9의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs6741819의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs6741819의 염기의 대립형질이 T이거나 그의 상보적인 염기의 대립형질이 A인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs6741819가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.72)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to one embodiment of the present application, rs6741819, which is the SNP of the RNF144A gene, may include the 26th nucleotide of SEQ ID NO: 9, and the allele of the base of rs6741819 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs6741819 is T or the allele of its complementary base is A, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs6741819 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.72) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm can do.
본원의 일 구현예에 따르면, 상기 FLJ45964 유전자의 SNP인 rs59626274는 서열번호 10의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs59626274의 염기의 대립형질은 C 또는 T일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs59626274의 염기의 대립형질이 T이거나 그의 상보적인 염기의 대립형질이 A인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs59626274가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.71)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to the exemplary embodiment of the present application, rs59626274, which is the SNP of the FLJ45964 gene, may include the 26th nucleotide of SEQ ID NO: 10, and the allele of the base of rs59626274 may be C or T. According to an embodiment of the present invention, when the allele of the base of rs59626274 is T or the allele of its complementary base is A, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs59626274 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.71) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 LINGO2 유전자의 SNP인 rs56942085는 서열번호 12의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs56942085의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs56942085의 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs56942085가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.78)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to the exemplary embodiment of the present application, rs56942085, which is the SNP of the LINGO2 gene, may include the 26th nucleotide of SEQ ID NO: 12, and the allele of the base of rs56942085 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs56942085 is G or the allele of its complementary base is C, the occurrence of a cerebral aneurysm can be diagnosed or the risk of developing a cerebral aneurysm can be predicted at a high level. According to an embodiment of the present application, it was confirmed that rs56942085 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance 0.78) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 MINK1 유전자의 SNP인 rs72835045는 서열번호 13의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs72835045의 염기의 대립형질은 G 또는 A일 수 있다. 본 발명의 일 실시예에 따르면, 상기 rs72835045의 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측할 수 있다. 본원의 일 실시예에 따르면, 전장유전체 연관 분석 결과 rs72835045가 뇌동맥류 진단에 있어서 높은 통계적 유의성을 갖는 것을 확인하였는 바(통계적 유의성 0.79)(표 2), 상기 SNP를 이용하면 효율적으로 뇌동맥류를 진단할 수 있다.According to one embodiment of the present application, rs72835045, which is the SNP of the MINK1 gene, may include the 26th nucleotide of SEQ ID NO: 13, and the allele of the base of rs72835045 may be G or A. According to an embodiment of the present invention, when the allele of the base of rs72835045 is A or the allele of its complementary base is T, it may be diagnosed as not developing a cerebral aneurysm, or the risk of developing a cerebral aneurysm may be predicted at a low level. According to an embodiment of the present application, it was confirmed that rs72835045 has a high statistical significance in diagnosing a cerebral aneurysm as a result of an overall genetic association analysis (statistical significance of 0.79) (Table 2), and the use of the SNP effectively diagnoses a cerebral aneurysm. can do.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물은 LOX(lysyl oxidase) 유전자 중의 서열번호 14의 서열의 205번째 염기(rs2303656)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 서열번호 15의 서열의 488번째 염기(rs3900446)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 서열번호 15의 서열의 678번째 염기(rs763497)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 및 이들의 조합을 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.According to one embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 205th base (rs2303656) of the sequence of SEQ ID NO: 14 in the LOX (lysyl oxidase) gene, or A complementary polynucleotide, a polynucleotide consisting of 10 or more consecutive bases including the 488th base (rs3900446) of the sequence of SEQ ID NO: 15, or a complementary polynucleotide thereof, the 678th base (rs763497) of the sequence of SEQ ID NO: 15 A polynucleotide composed of 10 or more consecutive bases, or a complementary polynucleotide thereof, and a combination thereof may be additionally included, but are not limited thereto.
본 발명의 일 실시예에 따르면, 상기 서열번호 14의 205번째 염기의 대립형질이 T이거나 그의 상보적인 염기의 대립형질이 A인 경우가 상기 서열번호 14의 205번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우보다 뇌동맥류의 발병 위험이 낮다고 예측할 수 있다.According to an embodiment of the present invention, when the allele of the 205th base of SEQ ID NO: 14 is T or the allele of its complementary base is A, the allele of the 205th base of SEQ ID NO: 14 is G or its It can be predicted that the risk of developing a cerebral aneurysm is lower than when the allele of the complementary base is C.
본 발명의 일 실시예에 따르면, 상기 서열번호 15의 488번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우가 상기 서열번호 15의 488번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우보다 뇌동맥류의 발병 위험이 높다고 예측하거나 뇌동맥류의 발병을 진단할 수 있다.According to an embodiment of the present invention, when the allele of the 488th base of SEQ ID NO: 15 is G or the allele of its complementary base is C, the allele of the 488th base of SEQ ID NO: 15 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than that of the case where the allele of the complementary base is T, or the development of a cerebral aneurysm can be diagnosed.
본 발명의 일 실시예에 따르면, 상기 서열번호 15의 678번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우가 상기 서열번호 15의 678번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우보다 뇌동맥류의 발병 위험이 높다고 예측하거나 뇌동맥류의 발병을 진단할 수 있다.According to an embodiment of the present invention, when the allele of the 678th base of SEQ ID NO: 15 is G or the allele of its complementary base is C, the allele of the 678th base of SEQ ID NO: 15 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than that of the case where the allele of the complementary base is T, or the development of a cerebral aneurysm can be diagnosed.
본 발명의 일 실시예에 따르면, 상기 서열번호 15의 488번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C이고, 상기 서열번호 15의 678번째 염기의 대립형질이 G이거나 그의 상보적인 염기의 대립형질이 C인 경우가 상기 서열번호 15의 488번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T이고, 상기 서열번호 15의 678번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우보다 뇌동맥류의 발병 위험이 높다고 예측하거나 뇌동맥류의 발병을 진단할 수 있다.According to an embodiment of the present invention, the allele of the 488th base of SEQ ID NO: 15 is G or the allele of its complementary base is C, and the allele of the 678th base of SEQ ID NO: 15 is G or its complementary When the allele of the base base is C, the allele of the 488th base of SEQ ID NO: 15 is A or the allele of the complementary base is T, and the allele of the 678th base of SEQ ID NO: 15 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than that of the case where the allele of the complementary base is T, or the development of a cerebral aneurysm can be diagnosed.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물은 SOX17(SRY-box 17) 유전자 중의 서열번호 38의 서열의 326번째 염기(rs1072737)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.According to one embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 326th base (rs1072737) of the sequence of SEQ ID NO: 38 in the SOX17 (SRY-box 17) gene. Or it may be to further include a complementary polynucleotide thereof, but is not limited thereto.
본 발명의 일 실시예에 따르면, 상기 서열번호 38의 326번째 염기의 대립형질이 C이거나 그의 상보적인 염기의 대립형질이 G인 경우가 상기 서열번호 38의 326번째 염기의 대립형질이 A이거나 그의 상보적인 염기의 대립형질이 T인 경우보다 뇌동맥류의 발병 위험이 높다고 예측할 수 있다. According to an embodiment of the present invention, when the allele of the 326th base of SEQ ID NO: 38 is C or the allele of its complementary base is G, the allele of the 326th base of SEQ ID NO: 38 is A or its It can be predicted that the risk of developing a cerebral aneurysm is higher than when the allele of the complementary base is T.
본원의 일 구현예에 따른 상기 뇌동맥류 진단용 SNP 마커 조성물에 포함되는 SNP의 유전적 정보는 공지의 데이터 베이스에서 얻을 수 있으며, 그 예로 미국 국립생물정보센터 (National Center for Biotechnology Information; NCBI)의 GenBank 등이 있으나, 이에 제한되지 않는다.Genetic information of the SNP contained in the SNP marker composition for diagnosing a cerebral aneurysm according to an embodiment of the present application can be obtained from a known database, for example, GenBank of the National Center for Biotechnology Information (NCBI). And the like, but are not limited thereto.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물은 한국인 및 아시아인을 대상으로 뇌동맥류를 진단하는 데에 사용할 수 있으나, 이에 제한되는 것은 아니다.According to the exemplary embodiment of the present application, the SNP marker composition for diagnosing a cerebral aneurysm may be used to diagnose a cerebral aneurysm in Koreans and Asians, but is not limited thereto.
본원의 일 실시예에 따르면, 상기 뇌동맥류 진단용 SNP 마커 조성물에 포함되는 SNP는 전장유전체 관련분석을 통해 개발된 것으로서, 상기 SNP의 대립형질을 확인함으로써, 뇌동맥류를 간단하고 효율적으로 진단할 수 있다.According to an embodiment of the present application, the SNP contained in the SNP marker composition for diagnosing a cerebral aneurysm was developed through a full-length genome-related analysis, and by confirming the allele of the SNP, it is possible to diagnose a cerebral aneurysm simply and efficiently. .
본원 명세서 전체에서 사용되는 용어, "전장유전체 관련분석(Genome-wide association study; GWAS)"은 약 50만-200만개 단일염기다형성의 유전자형을 탐색하여 질병과의 연관성을 통계적으로 분석하는 방법을 일컫는 것으로서, 일본 이화학연구소의 Ozaki(2002) 그룹에서 최초로 시도된 연구 방법이다. 구체적으로, GWAS 연구는 환자와 건강한 사람의 DNA 또는 SNP를 비교 분석하는 방식으로 진행되며, 만약 질병을 갖고 있는 사람에게서 유전적 변이가 더 많이 발견된다면, 연구자들은 이 변이가 앓고 있는 질병과 '연관이 있다'고 본다. 현재, HapMap 프로젝트의 완성 및 마이크로어레이 기술의 급속한 발전으로, 유전자 다형성에 관한 전장유전체 스캔이 일상적인 작업이 되었고, 수백의 전장유전체 연관 분석이 성공적으로 수행되어, 심혈관 질환, 당뇨 등의 통상적인 질병과 관련된 다수의 공지되거나 신규한 유전자 변이체의 발견을 이끌고 있다. 또한, 이러한 기술은 다양한 질환의 진단과 관련된 유전자 다형성 식별에 대한 강력한 수단을 제공하고 있다.The term "genome-wide association study (GWAS)" used throughout the specification refers to a method of statistically analyzing the association with disease by searching for genotypes of about 500,000-2 million single nucleotide polymorphisms. As a result, it is the first research method attempted by the Ozaki (2002) group of the Japan Institute of Science and Chemistry. Specifically, GWAS research is conducted by comparing and analyzing the DNA or SNPs of patients and healthy people.If more genetic mutations are found in people with the disease, the researchers believe that the mutation is'related to the disease' I think there is. Currently, with the completion of the HapMap project and the rapid development of microarray technology, full-length genome scanning for gene polymorphism has become a routine task, and hundreds of full-length genetic association analyzes have been successfully performed, leading to common diseases such as cardiovascular disease and diabetes. It has led to the discovery of a number of known or novel genetic variants related to. In addition, these technologies provide a powerful means for the identification of genetic polymorphisms associated with the diagnosis of various diseases.
본원의 제 2 측면은, SPCS3 유전자의 SNP인 rs17688188를 검출 또는 증폭할 수 있는 제제를 포함하는, 뇌동맥류 진단용 조성물을 제공한다. 제1측면과 중복되는 내용은 제2측면의 뇌동맥류 진단용 조성물에도 공히 적용된다.The second aspect of the present application provides a composition for diagnosing a cerebral aneurysm, comprising an agent capable of detecting or amplifying rs17688188, which is a SNP of the SPCS3 gene. The content overlapping with the first aspect also applies to the composition for diagnosing a cerebral aneurysm of the second aspect.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 조성물은 1) GBA 유전자의 SNP인 rs75822236, 2) TCF24 유전자의 SNP인 rs112859779, 3) OLFML2A 유전자의 SNP인 rs79134766, 4) ARHGAP32 유전자의 SNP인 rs371331393, 5) CD163L1 유전자의 SNP인 rs138525217, 6) CUL4A 유전자의 SNP인 rs74115822, 7) LOC102724084 유전자의 SNP인 rs75861150, 8) LRRC3 유전자의 SNP인 rs116969723, 9) RNF144A 유전자의 SNP인 rs6741819, 10) FLJ45964 유전자의 SNP인 rs59626274, 11) LINGO2 유전자의 SNP인 rs56942085, 및 12) MINK1 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.According to one embodiment of the present application, the composition for diagnosing a cerebral aneurysm comprises 1) rs75822236, which is a SNP of the GBA gene, 2) rs112859779, which is a SNP of the TCF24 gene, 3) rs79134766, which is a SNP of the OLFML2A gene, 4) rs371331393, which is a SNP of the ARHGAP32 gene, 5) rs138525217, a SNP of the CD163L1 gene, 6) rs74115822, a SNP of the CUL4A gene, 7) rs75861150, a SNP of the LOC102724084 gene, 8) rs116969723, a SNP of the LRRC3 gene, 9) rs116969723, a SNP of the RNF144A gene, 10) of the FLJ45964 gene. SNPs rs59626274, 11) LINGO2 gene SNPs rs56942085, and 12) MINK1 gene SNPs rs72835045 may further include an agent capable of detecting or amplifying one or more SNPs selected from the group consisting of, but limited thereto. It does not become.
본원 명세서 전체에서 사용되는 용어, "SNP를 검출할 수 있는 제제”는 상기 SNP 마커 조성물에 포함된 SNP 마커 또는 SNP에 특이적으로 결합하여 인식할 수 있도록 하거나 상기 SNP를 검출하여 증폭시킬 수 있는 제제를 의미하고, “SNP 마커를 증폭할 수 있는 제제”는 상기 SNP 마커 조성물에 포함된 SNP 마커 또는 SNP의 복제를 반복하여 그 수를 증가시킬 수 있는 제제를 의미하며, 예를 들어 상기 SNP를 포함하는 폴리뉴클레오티드를 특이적으로 증폭할 수 있는 프라이머 또는 특이적으로 결합할 수 있는 프로브를 의미하는 것일 수 있으나, 이에 제한되는 것은 아니다.As used throughout the specification of the present application, the term "agent capable of detecting SNP" refers to an agent capable of specifically binding and recognizing the SNP marker or SNP contained in the SNP marker composition, or detecting and amplifying the SNP. Means, "an agent capable of amplifying a SNP marker" refers to an agent capable of increasing the number of SNP markers or SNPs contained in the SNP marker composition by repeating replication, for example, including the SNP It may refer to a primer capable of specifically amplifying the polynucleotide or a probe capable of specifically binding, but is not limited thereto.
상기 SNP 증폭에 사용되는 프라이머는, 적절한 버퍼 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도 하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드가 될 수 있는데, 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 통상 15 내지 30 뉴클레오티드이다. 짧은 프라이머 분자는 일반적으로 주형과 안정한 혼성체를 형성하기 위해서는 더 낮은 온도를 필요로 한다. 상기 프라이머 서열은 상기 SNP를 포함하는 폴리뉴클레오티드와 완전하게 상보적일 필요는 없으나, 상기 SNP를 포함하는 폴리뉴클레오티드와 혼성화 할 정도로 충분히 상보적이어야 한다.The primers used for the SNP amplification are under appropriate conditions (e.g., 4 different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) and a template-directed DNA synthesis under an appropriate temperature. It may be a single-stranded oligonucleotide that can serve as a starting point of, and the appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the polynucleotide containing the SNP, but must be sufficiently complementary to hybridize with the polynucleotide containing the SNP.
본원 명세서 전체에서 사용되는 용어 "프라이머"는, 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 염기 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 이때, PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다.The term "primer" as used throughout the present specification is a base sequence having a short free 3'hydroxyl group, which can form a base pair with a complementary template, and the template strand copy Refers to a short sequence that functions as a starting point for Primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. At this time, PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art.
상기 SNP 검출에 사용되는 프로브는 혼성화 프로브를 의미하는 것일 수 있으며, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 혼성화 조건은 대립형질 간의 혼성화 강도에 있어서 유의한 차이를 보여 대립형질 중 하나에만 혼성화되도록 충분히 엄격해야 한다. 이러한 본 발명의 프로브는 중앙 부위가 다형성 서열의 다형성 부위와 정렬하는 것이 바람직하다. 이에 따라 서로 다른 대립형질성 형태 간에 좋은 혼성화 차이를 유발할 수 있다. 상기 프로브는 대립형질을 검출하여 뇌동맥류를 진단하기 위한 마이크로어레이 등의 키트나 예측 방법 등에 사용될 수 있다. 중요한 프로브는 검출할 수 있도록 표지될 수 있으며, 예를 들면 방사선 동위원소, 형광 화합물, 바이오 발광 화합물, 화학 발광 화합물, 금속 킬레이트 또는 효소로 표지될 수 있다. 상기와 같은 프로브를 적당하게 표지하는 것은 당해 분야에서 널리 알려진 기술이며, 통상적인 방법을 통하여 수행할 수 있다.The probe used for SNP detection may refer to a hybridization probe, and refers to an oligonucleotide capable of sequence-specific binding to a complementary strand of a nucleic acid. Hybridization conditions should be sufficiently stringent so that only one of the alleles hybridizes to show a significant difference in hybridization strength between alleles. It is preferable that the central region of the probe of the present invention is aligned with the polymorphic region of the polymorphic sequence. Accordingly, a good hybridization difference between different allelic forms can be induced. The probe may be used in a kit such as a microarray or a prediction method for diagnosing cerebral aneurysms by detecting alleles. The probes of interest can be labeled to detect, for example, radioisotopes, fluorescent compounds, bioluminescent compounds, chemiluminescent compounds, metal chelates or enzymes. Appropriately labeling such a probe is a technique well known in the art, and can be performed through a conventional method.
본원의 일 구현예에 따르면, 상기 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 상기 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체 (예: 메틸 포스포네이트, 포스포트리에스테르,포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체 (예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.According to the exemplary embodiment of the present disclosure, the primer or probe may be chemically synthesized using a phosphoramidite solid support method, or other well-known method. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, e.g., uncharged linkers (e.g. methyl phosphonate, phosphotriester, phosphoro Amidates, carbamates, etc.) or to charged linkers (eg phosphorothioate, phosphorodithioate, etc.).
본원의 일 구현예에 따르면, 상기 SPCS3 유전자의 SNP인 rs17688188는 서열번호 11의 26번째 뉴클레오타이드를 포함하는 것일 수 있으며, 상기 rs17688188의 염기의 대립형질은 G 또는 A일 수 있다.According to one embodiment of the present application, rs17688188, which is the SNP of the SPCS3 gene, may include the 26th nucleotide of SEQ ID NO: 11, and the allele of the base of rs17688188 may be G or A.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 조성물은 LOX(lysyl oxidase) 유전자 중의 서열번호 14의 서열의 205번째 염기(rs2303656)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 서열번호 15의 서열의 488번째 염기(rs3900446)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 서열번호 15의 서열의 678번째 염기(rs763497)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드, 및 이들의 조합을 검출 또는 증폭할 수 있는 제제를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.According to one embodiment of the present application, the composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 205th base (rs2303656) of the sequence of SEQ ID NO: 14 in the LOX (lysyl oxidase) gene or a complementary thereof. Polynucleotide, a polynucleotide consisting of 10 or more consecutive bases including the 488th base (rs3900446) of the sequence of SEQ ID NO: 15, or a complementary polynucleotide thereof, comprising the 678th base of the sequence of SEQ ID NO: 15 (rs763497) A polynucleotide composed of 10 or more consecutive bases or a complementary polynucleotide thereof, and an agent capable of detecting or amplifying a combination thereof may be additionally included, but is not limited thereto.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 조성물은 SOX17(SRY-box 17) 유전자 중의 서열번호 38의 서열의 326번째 염기(rs1072737)를 포함하는 10개 이상의 연속 염기로 구성되는 폴리뉴클레오티드 또는 이의 상보적 폴리뉴클레오티드를 검출 또는 증폭할 수 있는 제제를 추가로 포함하는 것일 수 있으나, 이에 제한되는 것은 아니다.According to one embodiment of the present application, the composition for diagnosing a cerebral aneurysm is a polynucleotide consisting of 10 or more consecutive bases including the 326th base (rs1072737) of the sequence of SEQ ID NO: 38 in the SOX17 (SRY-box 17) gene, or It may further include an agent capable of detecting or amplifying the complementary polynucleotide, but is not limited thereto.
본원의 제 3 측면은, 상기 뇌동맥류 진단용 조성물을 포함하는, 뇌동맥류 진단용 키트를 제공한다. 제1측면 및 제2측면과 중복되는 내용은 제2측면의 뇌동맥류 진단용 키트에도 공히 적용된다.A third aspect of the present application provides a kit for diagnosing a cerebral aneurysm, including the composition for diagnosing a cerebral aneurysm. The content overlapping with the first side and the second side also applies to the second side of the cerebral aneurysm diagnosis kit.
본원의 일 구현예에 따르면, 상기 키트는 PCR 키트, RT-PCR 키트 또는 DNA 칩 키트일 수 있으나, 이에 제한되는 것은 아니다.According to one embodiment of the present application, the kit may be a PCR kit, an RT-PCR kit, or a DNA chip kit, but is not limited thereto.
본원의 일 구현예에 따르면, 상기 키트는 본원의 SNP, 폴리뉴클레오티드, cDNA 등뿐만 아니라 분석 방법에 적합한 다른 구성 성분 조성물, 용액 또는 장치가 포함될 수 있다.According to one embodiment of the present application, the kit may include SNP, polynucleotide, cDNA, etc. of the present application, as well as other constituent compositions, solutions, or devices suitable for analysis methods.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 PCT 키트는 PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. PCR 키트는, 상기 SNP 에 대한 특이적인 폴리뉴클레오티드, 프라이머 또는 프로브 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액 (pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드 (dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수 (DEPC-water) 및 멸균수 등을 포함할 수 있다.According to the exemplary embodiment of the present disclosure, the PCT kit for diagnosing a cerebral aneurysm may be a kit including essential elements necessary to perform PCR. PCR kits, in addition to the polynucleotides, primers or probes specific for the SNP, test tubes or other suitable containers, reaction buffers (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase. Enzymes such as, DNase, RNAse inhibitor, DEPC-water and sterile water may be included.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 DNA 칩 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있으며, DNA 칩 키트는 상기 SNP에 대한 특이적인 폴리뉴클레오티드, 프라이머 또는 프로브가 부착되어 있는 기판을 포함하고 기판은 정량 대조구 유전자 또는 그의 단편에 해당하는 핵산을 포함할 수 있다.According to one embodiment of the present application, the DNA chip kit for diagnosing a cerebral aneurysm may be a kit including essential elements necessary to perform a DNA chip, and the DNA chip kit includes a specific polynucleotide, primer, or probe for the  SNP. It includes a substrate to which it is attached, and the substrate may include a nucleic acid corresponding to a quantitative control gene or a fragment thereof.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단용 RT-PCR 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있으며, RT-PCR 키트는, 상기 SNP에 대한 특이적인 각각의 프라이머 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 디옥시뉴클레오타이드(dNTPs), 디디옥시뉴클레오타이드(ddNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다.According to one embodiment of the present application, the RT-PCR kit for diagnosing a cerebral aneurysm may be a kit including essential elements necessary to perform RT-PCR, and the RT-PCR kit is each primer specific for the SNP. In addition to test tubes or other suitable containers, reaction buffers (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), didioxynucleotides (ddNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterilized water, and the like may be included.
본원의 제 4 측면은, 개체로부터 분리된 생물학적 시료로부터, SPCS3 유전자의 SNP인 rs17688188의 대립형질을 결정하는 단계를 포함하는, 뇌동맥류 진단을 위한 정보 제공 방법을 제공한다. 제1측면 내지 제3측면과 중복되는 내용은 제4측면의 뇌동맥류 진단을 위한 정보 제공 방법에도 공히 적용된다.A fourth aspect of the present application provides a method of providing information for diagnosing a cerebral aneurysm, comprising determining an allele of rs17688188, an SNP of the SPCS3 gene, from a biological sample isolated from an individual. The content overlapping with the first to third aspects also applies to the method of providing information for diagnosing a cerebral aneurysm of the fourth aspect.
본원의 일 구현예에 따르면, 본원의 뇌동맥류 진단은 뇌동맥류 발병을 진단하거나, 뇌동맥류 발병 위험을 예측하거나 또는 뇌동맥류의 예후를 진단하는 것일 수 있으나, 이에 제한되는 것은 아니다.According to the exemplary embodiment of the present disclosure, the diagnosis of a cerebral aneurysm of the present application may be diagnosing the onset of a cerebral aneurysm, predicting the risk of developing a cerebral aneurysm, or diagnosing the prognosis of a cerebral aneurysm, but is not limited thereto.
본원 명세서 전체에서 사용되는 용어, "개체"는 뇌동맥류가 발병되거나 발병될 가능성이 있는 모든 생물체를 의미하며, 구체적인 예로, 마우스, 원숭이, 소, 돼지, 미니돼지, 가축, 인간 등을 포함하는 포유동물, 양식어류 등을 포함할 수 있으며, 이에 제한되는 것은 아니다.As used throughout the specification, the term "individual" refers to any organism that has or is likely to develop a cerebral aneurysm, and specific examples include mammals including mice, monkeys, cows, pigs, mini pigs, livestock, humans, etc. It may include animals, farmed fish, etc., but is not limited thereto.
본원 명세서 전체에서 사용되는 용어, "시료"는 뇌동맥류가 발병되거나 발병될 가능성이 있는 개체로부터 유래한 물질을 의미하며, 구체적으로 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액, 소변 등을 포함할 수 있으며, 이에 제한되는 것은 아니다. 또한, 이들 시료로부터 유전자 시료를 얻을 수 있으며, 유전자 시료는 핵산, 예를 들어, DNA, mRNA, 또는 mRNA로부터 합성되는 cDNA 등을 포함할 수 있으며, 이로부터 SNP의 염기 정보를 확인할 수 있는 한, 그 종류는 이에 제한되는 것은 아니다.As used throughout the specification, the term "sample" refers to a substance derived from an individual who develops or is likely to develop a cerebral aneurysm, and specifically, tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, urine It may include, but is not limited thereto. In addition, a gene sample may be obtained from these samples, and the gene sample may include a nucleic acid, for example, DNA, mRNA, or cDNA synthesized from mRNA, and as long as the base information of the SNP can be confirmed therefrom, The kind is not limited thereto.
본원의 일 구현예에 따르면, 상기 개체는 인간일 수 있으며, 구체적으로 한국인 또는 아시아인일 수 있으나, 이에 제한되는 것은 아니다.According to the exemplary embodiment of the present disclosure, the individual may be a human, and specifically, may be a Korean or Asian, but is not limited thereto.
본원의 일 구현예에 따르면, 상기 개체의 위험 예측 또는 진단을 수행하기 위해, 비유전적(non-genetic) 정보를 분석하는 단계를 더 포함하고, 상기 비유전적 정보는 성별, 연령, 고혈압, 당뇨, 고지혈증, 흡연, 동맥류의 가족력, 생화학적 척도 및 임상적 척도로 구성되는 군으로부터 선택되는 하나 이상일 수 있다.According to one embodiment of the present application, in order to perform risk prediction or diagnosis of the individual, further comprising the step of analyzing non-genetic information, wherein the non-genetic information is sex, age, hypertension, diabetes, It may be one or more selected from the group consisting of hyperlipidemia, smoking, family history of aneurysms, biochemical scales, and clinical scales.
본원의 일 구현예에 따르면, 상기 정보 제공 방법에서 SNP의 염기를 결정하는 단계는 SNP의 유전자형을 확인하는 단계를 의미하는 것일 수 있다. SNP의 유전자형을 확인하는 단계는, 시퀀싱 분석, 예를 들어, 자동염기서열분석기를 사용한 시퀀싱 분석, 파이로시퀀싱(pyrosequencing), 마이크로어레이에 의한 혼성화, PCR-RELP(restriction fragment length polymorphism)법, PCR-SSCP(single strand conformation polymorphism)법, PCR-SSO(specific sequence oligonucleotide)법, PCR-SSO법과 도트 하이브리드화법을 조합한 ASO(allele specific oligonucleotide) 하이브리드화법, TaqMan-PCR법, MALDI-TOF/MS법, RCA(rolling circle amplification)법, HRM(high resolution melting)법, 프라이머 신장법, 서던 블롯 하이브리드화법, 도트 하이브리드화법 등의 방법에 의하여 수행될 수 있다. 구체적으로, 본원의 정보 제공 방법에서 SNP의 염기를 결정하는 단계는, 예를 들어, 대상으로부터 얻은 시료로부터 분리한 핵산으로부터 SNP 부위를 포함하는 염기서열을 시퀀싱(sequencing)하고, SNP의 대립형질을 직접적으로 확인함으로써 수행될 수 있다. 염기서열의 시퀀싱은 당 업계에 공지된 방법을 통하여 수행될 수 있다. 예를들어, 염기서열의 시퀀싱은 개체로부터 얻은 시료로부터 분리한 핵산을 주형으로 하고, 각 SNP 부위를 포함하는 유전자 부위를 증폭할 수 있는 프라이머를 사용하여 PCR을 수행하는 단계, 및 상기 PCR 반응물을 제한효소 절단방법으로 그 서열을 확인하는 단계를 순차적으로 수행함으로써 이뤄질 수 있다.According to an exemplary embodiment of the present disclosure, determining the base of the SNP in the information providing method may mean a step of confirming the genotype of the SNP. The step of confirming the genotype of SNP includes sequencing analysis, e.g., sequencing analysis using an automatic sequencing analyzer, pyrosequencing, hybridization by microarray, PCR-RELP (restriction fragment length polymorphism) method, PCR -SSCP (single strand conformation polymorphism) method, PCR-SSO (specific sequence oligonucleotide) method, ASO (allele specific oligonucleotide) hybridization method combining PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF/MS method , Rolling circle amplification (RCA) method, high resolution melting (HRM) method, primer extension method, Southern blot hybridization method, dot hybridization method, and the like. Specifically, the step of determining the base of the SNP in the method for providing information of the present application includes, for example, sequencing a nucleotide sequence containing the SNP site from a nucleic acid isolated from a sample obtained from a subject, and determining the SNP allele. It can be done by checking directly. Sequencing of the nucleotide sequence may be performed through a method known in the art. For example, sequencing of the base sequence is performed using a nucleic acid isolated from a sample obtained from an individual as a template, and performing PCR using a primer capable of amplifying a gene site including each SNP site, and the PCR reaction product It can be accomplished by sequentially performing the step of confirming the sequence by the restriction enzyme cleavage method.
본원의 일 구현예에 따르면, 상기 SPCS3 유전자의 SNP인 rs17688188는 서열번호 11의 26번째 뉴클레오타이드를 포함하는 것일 수 있고, 상기 rs17688188의 대립형질이 A인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측하는 단계를 추가로 포함하는 것일 수 있다.According to one embodiment of the present application, rs17688188, which is the SNP of the SPCS3 gene, may include the 26th nucleotide of SEQ ID NO: 11, and when the allele of rs17688188 is A, it is diagnosed or onset as not developing a cerebral aneurysm. It may be to further include a step of predicting the risk at a low level.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 개체로부터 분리된 생물학적 시료로부터, 1) GBA 유전자의 SNP인 rs75822236, 2) TCF24 유전자의 SNP인 rs112859779, 3) OLFML2A 유전자의 SNP인 rs79134766, 4) ARHGAP32 유전자의 SNP인 rs371331393, 5) CD163L1 유전자의 SNP인 rs138525217, 6) CUL4A 유전자의 SNP인 rs74115822, 7) LOC102724084 유전자의 SNP인 rs75861150, 8) LRRC3 유전자의 SNP인 rs116969723, 9) RNF144A 유전자의 SNP인 rs6741819, 10) FLJ45964 유전자의 SNP인 rs59626274, 11) LINGO2 유전자의 SNP인 rs56942085, 및 12) MINK1 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP의 대립형질을 결정하는 단계를 추가로 포함하는 것일 수 있다.According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm is from a biological sample isolated from an individual, 1) rs75822236, which is the SNP of the GBA gene, 2) rs112859779, which is the SNP of the TCF24 gene, 3) the SNP of the OLFML2A gene. Phosphorus rs79134766, 4) rs371331393, a SNP of the ARHGAP32 gene, 5) rs138525217, a SNP of the CD163L1 gene, 6) rs74115822, a SNP of the CUL4A gene, 7) rs75861150, a SNP of the LOC102724084 gene, 8) rs116969723, a SNP of the LRRC3 gene. The step of determining the allele of one or more SNPs selected from the group consisting of rs6741819, 10) SNP of the FLJ45964 gene, rs59626274, 11) rs56942085, which is the SNP of the LINGO2 gene, and 12) rs72835045, the SNP of the MINK1 gene. It may be to further include.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 1) GBA 유전자의 SNP인 rs75822236의 대립형질이 C인 경우, 2) ARHGAP32 유전자의 SNP인 rs371331393의 대립형질이 G인 경우, 3) CD163L1 유전자의 SNP인 rs138525217의 대립형질이 C인 경우, 4) CUL4A 유전자의 SNP인 rs74115822의 대립형질이 G인 경우, 5) LINGO2 유전자의 SNP인 rs56942085의 대립형질이 G인 경우, 또는 이들 중 둘 이상의 조합인 경우, 뇌동맥류가 발병한 것으로 진단하거나 발병 위험을 높은 수준으로 예측하는 단계를 추가로 포함하는 것일 수 있다.According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm includes 1) when the allele of rs75822236, which is the SNP of the GBA gene, is C, 2) when the allele of rs371331393, which is the SNP of the ARHGAP32 gene, is G, 3) When the allele of rs138525217, the SNP of the CD163L1 gene is C, 4) When the allele of rs74115822, the SNP of the CUL4A gene, is G, 5) When the allele of rs56942085, the SNP of the LINGO2 gene is G, or these In the case of a combination of two or more of them, diagnosing the occurrence of a cerebral aneurysm or predicting the risk of developing a cerebral aneurysm may be further included.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 1) TCF24 유전자의 SNP인 rs112859779의 대립형질이 T인 경우, 2) OLFML2A 유전자의 SNP인 rs79134766의 대립형질이 A인 경우, 3) LOC102724084 유전자의 SNP인 rs75861150의 대립형질이 C인 경우, 4) LRRC3 유전자의 SNP인 rs116969723의 대립형질이 A인 경우, 5) RNF144A 유전자의 SNP인 rs6741819의 대립형질이 T인 경우, 6) FLJ45964 유전자의 SNP인 rs59626274의 대립형질이 T인 경우, 7) MINK1 유전자의 SNP인 rs72835045의 대립형질이 A인 경우, 또는 이들 중 둘 이상의 조합인 경우, 뇌동맥류가 발병하지 않은 것으로 진단하거나 발병 위험을 낮은 수준으로 예측하는 단계를 추가로 포함하는 것일 수 있다.According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm includes 1) when the allele of rs112859779, which is the SNP of the TCF24 gene, is T, 2) when the allele of rs79134766, which is the SNP of the OLFML2A gene, is A, 3) When the allele of rs75861150, the SNP of the LOC102724084 gene is C, 4) When the allele of rs116969723, the SNP of the LRRC3 gene, is A, 5) When the allele of rs6741819, the SNP of the RNF144A gene is T, 6) If the allele of rs59626274, the SNP of the FLJ45964 gene is T, 7) If the allele of the rs72835045, the SNP of the MINK1 gene, is A, or a combination of two or more of them, the diagnosis or risk of developing a cerebral aneurysm It may be to further include the step of predicting to a low level.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 개체로부터 분리된 생물학적 시료로부터, LOX 유전자 중의 서열번호 14의 서열의 205번째 염기(rs2303656), 서열번호 15의 서열의 488번째 염기(rs3900446), 서열번호 15의 서열의 678번째 염기(rs763497) 및 이들의 조합의 대립형질을 확인하는 단계를 추가로 포함하는 것일 수 있다.According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm is from a biological sample isolated from an individual, the 205th base of the sequence of SEQ ID NO: 14 (rs2303656) in the LOX gene, the 488th of the sequence of SEQ ID NO: 15 The base (rs3900446), the 678th base (rs763497) of the sequence of SEQ ID NO: 15, and the allele of a combination thereof may be further included.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법은 개체로부터 분리된 생물학적 시료로부터, SOX17 유전자 중의 서열번호 38의 서열의 326번째 염기(rs1072737)의 대립형질을 확인하는 단계를 추가로 포함하는 것일 수 있다.According to one embodiment of the present application, the method of providing information for diagnosing a cerebral aneurysm further includes the step of confirming the allele of the 326th base (rs1072737) of the sequence of SEQ ID NO: 38 in the SOX17 gene from a biological sample isolated from the individual. It may be included as.
본원의 일 구현예에 따르면, 상기 뇌동맥류 진단을 위한 정보 제공 방법에서상기 SNP 다형성의 결과들은 당업계에서 일반적으로 사용되는 통계학적 분석 방법을 이용하여 통계처리 할 수 있으며, 예를 들어, 스튜던트 t-검정(Student's t-test), 카이-스퀘어 검정(Chi-square test), 선형 회귀선 분석(linear regression line analysis), 다변량 로지스틱 회귀분석(multiple logistic regression analysis), 메타 분석(meta-analysis) 등을 통해 얻은 연속 변수(continuous variables), 절대 변수 (categorical variables), 대응비(odds ratio, OR) 및 95% 신뢰구간(confidence interval, CI) 등의 변수를 이용하여 분석할 수 있다.According to one embodiment of the present application, in the method for providing information for diagnosing a cerebral aneurysm, the results of the SNP polymorphism may be statistically processed using a statistical analysis method commonly used in the art, for example, Student t -Student's t-test, Chi-square test, linear regression line analysis, multiple logistic regression analysis, meta-analysis, etc. It can be analyzed using variables such as continuous variables, categorical variables, odds ratio (OR), and 95% confidence interval (CI).
본 발명의 뇌동맥류 진단용 SNP 마커 조성물, 뇌동맥류 진단용 조성물, 뇌동맥류 진단용 키트 및 뇌동맥류 진단을 위한 정보 제공 방법에 따르면, SPCS3 유전자 상의 단일염기다형성(SNP)을 한국인 또는 아시아인에서 뇌동맥류의 발병 위험 예측 또는 진단을 위한 마커로서 이용할 수 있다.According to the SNP marker composition for diagnosing cerebral aneurysm, the composition for diagnosing cerebral aneurysm, the kit for diagnosing cerebral aneurysm, and the method for providing information for diagnosing cerebral aneurysm of the present invention, single nucleotide polymorphism (SNP) on the SPCS3 gene is used to develop cerebral aneurysms in Koreans or Asians. It can be used as a marker for risk prediction or diagnosis.
<1. 13개의 뇌동맥류 진단용 SNP 마커 개발>
도 1은 GBA 유전자의 SNP를 이용한 뇌동맥류 진단 과정을 나타낸 도면이다.
도 2는 GWAS 결과를 맨하탄 플룻으로 나타낸 도면이다. 빨간선은 전장유전체 유의적 임계적 (P-value= 5 x 10-8)을 표시하는 것이다.
도 3은 ARHGAP32 유전자의 SNP인 rs371331393 변이체의 위치 ± 500kb에 대한 지역 플랏(regional plot)을 나타내는 도면으로서, 상기 도면은 250명의 뇌동맥류 환자 및 294명의 대조군(연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 조정)에서의 rs371331393와 뇌동맥류와의 연관성을 나타낸다. X축은 염색체 위치(Mb)를 나타내고, Y축은 P-값을 -log10로 변환한 수치를 나타낸다. 보라색 마름모는 본원의 GWAS에서 가장 유의미한 연관성을 나타내는 rs371331393 변이체를 나타내며(P = 9.3Х10-27), 회색원은 rs371331393 변이체의 500kb 내의 다른 SNP를 나타낸다.
도 4의 A는 RNF144A 유전자의 SNP인 rs6741819 변이체의 위치(± 500kb)에 대한 지역 플랏(regional plot)을 나타내는 도면으로서, 상기 도면은 250명의 뇌동맥류 환자 및 294명의 대조군(연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 조정)에서의 rs6741819와 뇌동맥류와의 연관성을 나타낸다. X축은 염색체 위치(Mb)를 나타내고, Y축은 P-값을 -log10로 변환한 수치를 나타낸다. 보라색 마름모는 본원의 GWAS에서의 rs6741819 변이체를 나타내며(P = 4.0Х10-14), 회색원은 rs6741819 변이체의 500kb 내의 다른 SNP를 나타낸다.
도 4의 B는 단일-세포 eQTL을 이용하여 부신 조직(n=175)에서의 rs6741819 변이체의 발현수준을 나타낸 도면이다. X 축은 유전자형을 나타내고, Y 축은 순위-표준화된 유전자 발현 수준을 나타낸다. 상기 변이체 유전자형의 참조형(Ref)/대립형(Alt) 대립형질은 메이저/마이너 대립형질과 동일하다.
도 4의 C는 TMOD1 유전자의 SNP인 rs1052270 변이체의 위치(± 500kb)에 대한 지역 플랏(regional plot)을 나타내는 도면으로서, 상기 도면은 250명의 뇌동맥류 환자 및 294명의 대조군(연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 조정)에서의 rs1052270와 뇌동맥류와의 연관성을 나타낸다. X축은 염색체 위치(Mb)를 나타내고, Y축은 P-값을 -log10로 변환한 수치를 나타낸다. 보라색 마름모는 본원의 GWAS에서의 rs1052270 변이체를 나타내며(P = 4.0Х10-14), 회색원은 rs1052270 변이체의 500kb 내의 다른 SNP를 나타낸다.
도 4의 D는 단일-세포 eQTL을 이용하여 고환 조직(n=225)에서의 rs1052270 변이체의 발현수준을 나타낸 도면이다. X 축은 유전자형을 나타내고, Y 축은 순위-표준화된 유전자 발현 수준을 나타낸다. 상기 변이체 유전자형의 참조형(Ref)/대립형(Alt) 대립형질은 메이저/마이너 대립형질과 동일하다.
도 5의 A는 EDNRA 유전자의 SNP인 rs6841581 변이체의 위치(± 500kb)에 대한 지역 플랏(regional plot)을 나타내는 도면으로서, 상기 도면은 250명의 뇌동맥류 환자 및 294명의 대조군(연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 조정)에서의 rs6741819와 뇌동맥류와의 연관성을 나타낸다. X축은 염색체 위치(Mb)를 나타내고, Y축은 P-값을 -log10로 변환한 수치를 나타낸다. 보라색 마름모는 본원의 GWAS에서의 rs6841581 변이체를 나타내며(P = 4.0Х10-14), 회색원은 rs6841581 변이체의 500kb 내의 다른 SNP를 나타낸다.
도 5의 B 및 C는 단일-세포 eQTL을 이용하여 식도(점막)(B) (358개 샘플, effect size = 0.38, p = 5.2Х10-12) 및 햇빛에 노출되지 않은 피부(치골상부)(C) (335개 샘플, effect size = 0.21, p = 1.2Х10-6)에서의 rs6841581 변이체의 발현수준을 나타낸 도면이다. X 축은 유전자형을 나타내고, Y 축은 순위-표준화된 유전자 발현 수준을 나타낸다. 상기 변이체 유전자형의 참조형(Ref)/대립형(Alt) 대립형질은 메이저/마이너 대립형질과 동일하다.
<2. LOX(Lysyl oxidase) 유전자의 SNP 이용한 뇌동맥류 진단>
도 6은 실시예 4에서의 뇌동맥류와 10개의 SNP와의 연관성 분석 결과를 나타낸다.
도 7은 실시예 4에서의 뇌동맥류와 10개의 SNP의 일배체형 연관성 분석 결과를 나타낸다.
<3. SOX17(SRY-box 17) 유전자의 SNP 이용한 뇌동맥류 진단>
도 8은 실시예 4에서의 뇌동맥류와 4개의 SNP와의 연관성 분석 결과를 나타낸다.
도 9는 실시예 4에서의 뇌동맥류 파열과 4개의 SNP의 연관성 분석 결과를 나타낸다.
<1. Development of 13 SNP markers for diagnosis of cerebral aneurysms>
1 is a diagram showing a procedure for diagnosing a cerebral aneurysm using SNP of the GBA gene.
2 is a diagram showing the GWAS results in a Manhattan flute. The red line indicates the significant critical (P-value= 5 x 10-8) of the full-length genome.
3 is a diagram showing a regional plot for the position ± 500 kb of the rs371331393 variant, which is a SNP of the ARHGAP32 gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, diabetes, hyperlipidemia, Smoking and coordinating four major factors) and rs371331393 in association with cerebral aneurysms. The X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log 10 . The purple rhombus represents the rs371331393 variant showing the most significant association in the present GWAS ( P = 9.3Х10 -27 ), and the gray circles represent other SNPs within 500kb of the rs371331393 variant.
4A is a diagram showing a regional plot for the location (± 500kb) of the rs6741819 variant, which is the SNP of the RNF144A gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, Rs6741819 in diabetes, hyperlipidemia, smoking, and coordinating four major factors) and cerebral aneurysms. The X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log 10 . The purple rhombus represents the rs6741819 variant in the present GWAS ( P = 4.0Х10 -14 ), and the gray circles represent other SNPs within 500 kb of the rs6741819 variant.
4B is a diagram showing the expression level of the rs6741819 variant in adrenal tissue (n=175) using single-cell eQTL. The X axis represents the genotype and the Y axis represents the rank-normalized gene expression level. The reference type (Ref)/allele (Alt) allele of the variant genotype is the same as the major/minor allele.
4C is a diagram showing a regional plot for the location (± 500kb) of the rs1052270 variant, the SNP of the TMOD1 gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, Diabetes mellitus, hyperlipidemia, smoking, and coordinating the four major factors) show an association of rs1052270 with cerebral aneurysms. The X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log 10 . The purple rhombus represents the rs1052270 variant in the present GWAS ( P = 4.0Х10 -14 ), and the gray circles represent other SNPs within 500 kb of the rs1052270 variant.
4D is a diagram showing the expression level of the rs1052270 variant in testicular tissue (n=225) using single-cell eQTL. The X axis represents the genotype and the Y axis represents the rank-normalized gene expression level. The reference type (Ref)/allele (Alt) allele of the variant genotype is the same as the major/minor allele.
5A is a diagram showing a regional plot for the location (± 500kb) of the rs6841581 variant, which is the SNP of the EDNRA gene, in which 250 patients with cerebral aneurysms and 294 controls (age, sex, hypertension, Rs6741819 in diabetes, hyperlipidemia, smoking, and coordinating four major factors) and cerebral aneurysms. The X-axis represents the chromosomal location (Mb), and the Y-axis represents the value obtained by converting the P-value to -log 10 . The purple rhombus represents the rs6841581 variant in the present GWAS ( P = 4.0Х10 -14 ), and the gray circles represent other SNPs within 500 kb of the rs6841581 variant.
5B and C show the esophagus (mucosa) (B) (358 samples, effect size = 0.38, p = 5.2Х10 -12 ) and the skin (upper pubic region) not exposed to sunlight using single-cell eQTL ( C) A diagram showing the expression level of the rs6841581 variant in (335 samples, effect size = 0.21, p = 1.2Х10 -6 ). The X axis represents the genotype and the Y axis represents the rank-normalized gene expression level. The reference type (Ref)/allele (Alt) allele of the variant genotype is the same as the major/minor allele.
<2. Cerebral aneurysm diagnosis using SNP of LOX (Lysyl oxidase) gene>
6 shows the results of analysis of the association between cerebral aneurysms and 10 SNPs in Example 4.
7 shows the results of analysis of the haplotype association between cerebral aneurysms and 10 SNPs in Example 4.
<3. Cerebral aneurysm diagnosis using SNP of SOX17 (SRY-box 17) gene>
8 shows the results of analysis of the association between a cerebral aneurysm and four SNPs in Example 4.
9 shows the results of analysis of the association between cerebral aneurysm rupture and four SNPs in Example 4.
이하 본원을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 발명을 예시적으로 설명하기 위한 것으로 본원의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.Hereinafter, the present application will be described in more detail through examples and experimental examples. However, these Examples and Experimental Examples are for illustrative purposes only, and the scope of the present application is not limited to these Examples and Experimental Examples.
<1. 13개의 뇌동맥류 진단용 SNP 마커 개발><1. Development of 13 SNP markers for diagnosis of cerebral aneurysms>
실시예 1: 실험군 및 대조군 수집Example 1: Experimental group and control group collection
본 발명을 수행하기 위한 코호트(cohort)는 춘천 성심병원 뇌졸중 데이터베이스(2015-2018)로부터 유래되었으며, 데이터베이스 수집을 위해, 출혈성 또는 허혈성 뇌졸중과 일치하는 임상적 진단 및 신경영상을 나타내는 환자를 모집했으며, GWAS 연구에서, 낭형(saccular) 및 산발성(sporadic) 뇌동맥류를 갖는 18세 이상의 환자를 분석하였다. 또한, 추형, 해부학, 외상성, 및 전염성 동맥류, 및 가족성 동맥류와 같은, 비낭형 동맥류는 제외하였다.The cohort for carrying out the present invention was derived from the Chuncheon Sacred Heart Hospital stroke database (2015-2018), and for database collection, patients showing clinical diagnosis and neuroimaging consistent with hemorrhagic or ischemic stroke were recruited, In the GWAS study, patients over 18 years of age with saccular and sporadic cerebral aneurysms were analyzed. In addition, non-cystic aneurysms, such as vertebral, anatomical, traumatic, and infectious aneurysms, and familial aneurysms were excluded.
대조군은 다음과 같은 기준을 만족시켰다: 1) 두통 진단 또는 건강 검진을 위해 전산화 단층 촬영 또는 자기 공명 혈관 조영술을 받은 환자, 2) 뇌동정맥기형, 두개내 출혈 또는 경색과 같은 신경질환이 수반되지 않음, 3) 가까운 친척에게서 뇌동맥류 또는 지주막하 출혈에 대한 가족력이 없음, 4) 파킨슨병 또는 알츠하이머병이 없음, 및 5) 18세 이상.The control group satisfied the following criteria: 1) Patients who underwent computed tomography or magnetic resonance angiography for headache diagnosis or health examination, and 2) no neurological disorders such as cerebral arteriovenous malformation, intracranial hemorrhage, or infarction. , 3) no family history of cerebral aneurysm or subarachnoid hemorrhage in close relatives, 4) no Parkinson's or Alzheimer's disease, and 5) over 18 years of age.
또한, 성별, 연령, 비파열 뇌동맥류 또는 지주막하 출혈과 같은 임상 증상, 고혈압, 당뇨, 고지혈증, 흡연, 동맥류의 가족력 등 여러 변수를 고려하여 의료 기록을 검토하였으며, 동맥류의 크기, 위치(전방 순환 또는 후방 순환), 및 수(단수 또는 복수)에 대한 혈관조영 변수를 검토하였다. 본 연구는 춘천 성심 병원의 임상 시험 위원회에 의해 승인되었다(No. 2016-3, 2017-9).In addition, the medical records were reviewed in consideration of various variables such as gender, age, clinical symptoms such as non-ruptured cerebral aneurysm or subarachnoid hemorrhage, high blood pressure, diabetes, hyperlipidemia, smoking, and family history of aneurysms, and the size and location of aneurysms (anterior circulation Or posterior circulation), and angiographic parameters for number (singular or plural) were reviewed. This study was approved by the Clinical Trial Committee of Chuncheon Sacred Heart Hospital (No. 2016-3, 2017-9).
실시예 2: 유전자형 분석(Genotyping) 및 샘플 품질 관리(sample quality control)Example 2: Genotyping and sample quality control
게놈 DNA는 HiGeneTM Genomic DNA Prep Kit (BIOFACT, 대전, 한국)를 이용하여 실험군 및 대조군의 말초혈액으로부터 수득하였다. 상기 샘플들의 유전자형 분석을 위해, 인간 게놈 version 19(build 37)을 기반으로 하고, 동남아시아 인구를 포괄하며, 5만개의 신규한 마커를 포함하는 75만개 SNP가 포함된 AxiomTM Asia Precision Medicine Research Array (PMRA) 키트 (Thermo Fisher Scientific, MA, USA)를 사용하였다. 작은 삽입/결실(indels)를 포함하는 798,148개의 변이 중 508,192개의 변이가 다음 기준의 품질 평가 검정을 통과하였고(유전자형 call rate = 95%, 마이너 대립유전자 빈도(MAF) = 0.01, 및 하디-바인버그 평형(HWE) p-값 = 1Х10-6), 통과된 변이를 이용하여 GWAS를 수행하였다. Genomic DNA was obtained from peripheral blood of the experimental group and the control group using the HiGene TM Genomic DNA Prep Kit (BIOFACT, Daejeon, Korea). For genotyping of the samples, AxiomTM Asia Precision Medicine Research Array (PMRA) containing 750,000 SNPs based on human genome version 19 (build 37), covering the Southeast Asian population, and containing 50,000 novel markers. ) Kit (Thermo Fisher Scientific, MA, USA) was used. Of the 798,148 variants including small indels, 508,192 variants passed the quality assessment test of the following criteria (genotype call rate = 95%, minor allele frequency (MAF) = 0.01, and Hardy-Weinberg Equilibrium (HWE) p-value = 1Х10 -6 ), GWAS was performed using the passed mutation.
실시예 3: 통계적 분석Example 3: Statistical Analysis
기술적 분석(Descriptive analysis)은 개별형 및 범주형 변수의 주체수(백분율)를 사용하여 표시되며, 평균은 표준 오류로 표시된다. 본 발명에서는 2가지 누락된 값을 제거한 후에, 250명의 뇌동맥류 환자 및 294명의 대조군에 대해 7개의 교란 인자(성별, 나이, 고혈압, 당뇨, 고질혈증, 흡연 및 4개의 주요 요인)를 갖는 다변량 기호 논리학 해석(multivariate logistic analysis)을 수행하였으며, 상기 분석은 STATA v11.2 (Stata Corp., TX, USA)을 이용하여 수행하였다. 또한 전장유전체 관련 분석은 상기 7개의 교란 인자를 조정한 후, 추가 유적적 효과 모델 하에서 뇌동맥류 감수성에 대한 후보 유전 변이를 확인하기 위해 수행하였으며, PLINK 1.9 프로그램(https://www.cog-genomics.org/plink/1.9/)을 이용하였다.Descriptive analysis is expressed using the number of subjects (percentages) of individual and categorical variables, and the mean is expressed as standard error. In the present invention, after removing the two missing values, a multivariate symbol having 7 confounding factors (gender, age, hypertension, diabetes, hyperlipemia, smoking and 4 major factors) for 250 cerebral aneurysms and 294 controls. A multivariate logistic analysis was performed, and the analysis was performed using STATA v11.2 (Stata Corp., TX, USA). In addition, full-length genome-related analysis was performed to identify candidate genetic mutations for cerebral aneurysm susceptibility under an additional loci effect model after adjusting the seven confounding factors, and the PLINK 1.9 program ( https://www.cog-genomics). .org/plink/1.9/ ) was used.
또한, GWAS에서의 잠재적인 유전적 신뢰성을 평가하기 위한 통계적 유의성(statistics power)을 산정하기 위해, 하기와 같은 가정에 근거하여, Genetic Power Calculator (http://pngu.mgh.harvard.edu/~purcell/gpc/)을 사용하였다: 5% 확률의 뇌동맥류 발병; 부가적 효과 모델(additive effect model)에서의 오즈비(odds-ratio, OR); D-prime 0.8; 1:1.18의 실험군-대조군 비율; 및 5Х10-8(전장유전체 유의 수준)의 타입 1 에러 비율.In addition, in order to calculate the statistical power for evaluating potential genetic reliability in GWAS, based on the following assumptions, the Genetic Power Calculator ( http://pngu.mgh.harvard.edu/~ purcell/gpc/ ) was used: 5% probability of developing cerebral aneurysm; Odds-ratio (OR) in the additive effect model; D-prime 0.8; A 1:1.18 experimental-control ratio; And a type 1 error rate of 5Х10 -8 (full-length significance level).
추가적으로, 차후의 분석에서 151명의 지주막하출혈 및 99명의 비파열성 뇌동맥류 환자 사이의 유전적 연관성을 평가하였으며, GWAS에서 전장유전체의 연관성을 나타내는 개별 변이체의 발현 수준에 대한 유전적 영향을 평가하기 위해, Genotype-Tissue Expression (GTEx v7) (https://gtexportal.org/home/)을 이용하여 단일 조직 발현 양적형질 유전자좌(expression quantitative trait loci, eQTL)를 분석하였다. 맨하탄 플룻(Manhattan plot) 및 지역 관련 플룻(regional association plot)은 각각 R 패키지 v3.4.0의 "qqman" 명령어(https://cran.r-project.org/web/packages/qqman) 및 LocusZoom v1.3 (http://locuszoom.org/)을 이용하였다.In addition, in a subsequent analysis, the genetic association between 151 patients with subarachnoid hemorrhage and 99 patients with non-ruptured cerebral aneurysm was evaluated, and to evaluate the genetic effect on the expression level of individual variants that show an association of the full-length genome in GWAS. , Genotype-Tissue Expression (GTEx v7) (https://gtexportal.org/home/) was used to analyze a single tissue expression quantitative trait loci (eQTL). The Manhattan plot and regional association plot are the " qqman " command ( https://cran.r-project.org/web/packages/qqman ) and LocusZoom v1 of the R package v3.4.0, respectively. 3 ( http://locuszoom.org/ ) was used.
실험예 1: 실험군 및 대조군의 구체적 특성 확인Experimental Example 1: Confirmation of specific characteristics of the experimental group and the control group
실시예 1에 기재된 기준으로 환자(실험군) 및 대조군(비환자)을 분류하였으며, 이의 특성은 하기 표 1에 기재되어 있다. 구체적으로, 546명 중, 250명은 뇌동맥류(intracranial aneurysm, IA) 환자로 분류되었고, 나머지 296명은 비환자(대조군)로 분류되었다. 상기 두 그룹간에 성별, 고혈압(Hypertension, HTN), 당뇨병(Diabetes mellitus, DM), 고지혈증(hyperlipidemia) 및 흡연에 따른 통계적 차이는 없었고, 대조군은 뇌동맥류 환자보다 젊었다(p < 0.001). 상기 뇌동맥류 환자 중 지주막하 출혈(subarachnoid hemorrhage, SAH) 및 비파열성 뇌동맥류(unruptured intracranial aneurysm, UIA)가 발생한 환자는 각각 151명(60.4%) 및 99명(39.6%)였다. 또한, 뇌동맥류 환자 중 대부분은 전방순환동맥류(Anterior-circulation aneurysms)였고(n=221, 88.4%), 상기 전방순환동맥류는 중대뇌동맥(middle cerebral artery)(n=71), 전교통동맥(anterior communicating artery) 또는 전대뇌동맥(anterior cerebral artery) (n=50), 내경동맥(internal carotid artery)(n=38) 및 후교통동맥(posterior communicating artery)(n=53)으로 나타났다.Patients (experimental group) and control group (non-patient) were classified according to the criteria described in Example 1, and their characteristics are shown in Table 1 below. Specifically, out of 546, 250 were classified as intracranial aneurysm (IA) patients, and the remaining 296 were classified as non-patients (control). There was no statistical difference according to sex, hypertension (HTN), diabetes (Diabetes mellitus, DM), hyperlipidemia, and smoking between the two groups, and the control group was younger than the cerebral aneurysm patients (p <0.001). Among the cerebral aneurysms, 151 (60.4%) and 99 (39.6%) patients with subarachnoid hemorrhage (SAH) and unruptured intracranial aneurysm (UIA) were respectively. In addition, most of the patients with cerebral aneurysms were anterior-circulation aneurysms (n=221, 88.4%), and the anterior circulatory aneurysms were middle cerebral artery (n=71), anterior-circulation aneurysms. communicating artery) or anterior cerebral artery (n=50), internal carotid artery (n=38), and posterior communicating artery (n=53).
Figure 112019034471036-pat00001
Figure 112019034471036-pat00001
* a: 표의 데이터는 환자의 수(%) 및 평균 ± 표준오차로 표현함* a: The data in the table are expressed as the number of patients (%) and the mean ± standard error.
* b: P 값은 다변량 논리학적 회귀 모델에서 평가됨.* b: P values are evaluated in a multivariate logical regression model.
* c: 주요 요소는 4개의 클러스터로 주요 요소 분석을 수행하여 추정됨.* c: The main elements are estimated by performing main element analysis with 4 clusters.
실험예 2: 전장유전체 연관분석(GWAS) 결과 분석Experimental Example 2: Full-length genetic association analysis (GWAS) result analysis
뇌동맥류 발병과 관련된 SNP 마커를 발굴하기 위해 하기와 같은 실험을 수행하였다.The following experiment was performed to discover SNP markers related to the onset of cerebral aneurysm.
먼저, 상기 실험예 1에서 확인한 실험군 및 대조군에서 교란 요인(나이, 성별, 고혈압, 당뇨, 고지혈증, 흡연) 및 4가지 주요 요소(principal components)를 조정한 후, 전장유전체 연관분석(genome-wide association study, GWAS)을 통해, p-값이 1Х10-5 미만의 암시적 연관성을 나타내는, 총 315개의 SNP(indel 포함)를 선별하였다(도 2). First, after adjusting the confounding factors (age, sex, hypertension, diabetes, hyperlipidemia, smoking) and four principal components in the experimental group and control group identified in Experimental Example 1, the whole-length genome-wide association study, GWAS), a total of 315 SNPs (including indels) with a p-value of less than 1Х10 -5 were selected (Fig. 2).
다음으로, 상기의 315개의 SNP 중 pairwise 연관불균형(linkage disequilibrium)이 0.8 미만인 SNP를 제거하였고, 전장유전체 유의적 임계적(genome-wide significance threshold)인 5 x 10-8 미만의 p-값을 나타내는 총 29개의 SNP를 선별하였다. 선별된 SNP의 구체적인 내용은 하기 표 2에 기재하였다.Next, among the 315 SNPs, SNPs with a pairwise linkage disequilibrium of less than 0.8 were removed, and a p-value of less than 5 x 10 -8 , a genome-wide significance threshold, was removed. A total of 29 SNPs were selected. Details of the selected SNP are shown in Table 2 below.
Figure 112019034471036-pat00002
Figure 112019034471036-pat00002
* L95, lower 95% confidence interval; OR, odds ratio; U95, upper 95% confidence interval.* L95, lower 95% confidence interval; OR, odds ratio; U95, upper 95% confidence interval.
* a: M/m, 주 대립형질(major allele type)/부 대립형질(minor allele type)* a: M/m, major allele type/minor allele type
* b: MAF, 실험군(왼쪽) 및 대조군(오른쪽)의 대립유전자형빈도(minor allele frequency)* b: MAF, minor allele frequency of the experimental group (left) and control group (right)
* c: OR, 95% 신뢰구간 및 P-값은 연령, 성별, 고혈압, 당뇨병, 고지혈증, 흡연 및 4가지 주요 요소를 보정한 후, 다변량 논리학적 회귀 분석에서 추정됨.* c: OR, 95% confidence interval and P-value were estimated from multivariate logical regression analysis after correcting for age, sex, hypertension, diabetes, hyperlipidemia, smoking and four major factors.
* d: 각 SNP의 통계적 유의성(power)은 웹-기반의 Genetic Power Calculator (http://zzz.bwh.harvard.edu/gpc/cc2.html)을 이용하여 추정되었고, 하기의 파라미터를 사용하였다: 5% 확률의 뇌동맥류 발병, 대조군에서의 MAF, 부가적 효과 모델에서의 OR, D-prime 0.8; 1:1.18의 실험군-대조군 비율(대조군 296명/실험군 250명 = 1.18), 및 5Х10-8(전장유전체 유의 수준)의 타입 1 에러 비율.* d: Statistical significance (power) of each SNP was estimated using the web-based Genetic Power Calculator ( http://zzz.bwh.harvard.edu/gpc/cc2.html ), and the following parameters were used. : 5% probability of developing cerebral aneurysm, MAF in control group, OR in additive effect model, D-prime 0.8; A 1:1.18 experimental-control ratio (296 control/250 experimental = 1.18), and a type 1 error ratio of 5Х10 -8 (full-length significance level).
* e: pairwise 연관 불균형(LD, r 2 < 0.8)에서 나타난 1개의 SNP: rs7964241 및 rs56168082 (r 2 =0.81); rs2440154 및 rs2289668 (r 2 = 1.0)* e: 1 SNP found in pairwise linkage disequilibrium (LD, r 2 <0.8): rs7964241 and rs56168082 ( r 2 =0.81); rs2440154 and rs2289668 ( r 2 = 1.0)
구체적으로, ARHGAP32 (11q24.3) 상에 위치하는 rs371331393가 뇌동맥류 형성에 있어서 가장 유의미한 연관성을 나타냈으며(OR = 43.57, 95% 신뢰구간 21.84-86.95; p = 9.3Х10-27) (도 3), GBA 유전자 상에 위치하는 rs75822236 SNP 또한 뇌동맥류 형성에 있어서 유의미한 연관성을 나타냈으며(OR = 161.46, 95% CI 53.86-483.60; p = 1.1 Х10-19), 상기 변이의 경우, 대조군에서의 "T" 대립형질은 뇌동맥류 환자에서의 "C" 대립형질에 비해 희귀했다(MAF = 0.01 vs 0.33). 또한, CD163L1 유전자 3' 비번역 부위(untranslated region, UTR) 상에 위치한 rs138525217 SNP에서의 "T" 대립형질은 드물게 나타나며, 큰 효과 크기(effect size)를 보여준다(MAF 실험군/대조군 = 0.31/0.01, OR = 75.98; p = 6.2Х10-23).Specifically, rs371331393 located on ARHGAP32 (11q24.3) showed the most significant association in the formation of a cerebral aneurysm (OR = 43.57, 95% confidence interval 21.84-86.95; p = 9.3Х10 -27 ) (Fig. 3) , Rs75822236 SNP located on the GBA gene also showed a significant association in the formation of cerebral aneurysms (OR = 161.46, 95% CI 53.86-483.60; p = 1.1 Х10 -19 ), and in the case of the mutation, "T" in the control group. "The allele was rare compared to the "C" allele in patients with cerebral aneurysms (MAF = 0.01 vs 0.33). In addition, the "T" allele in the rs138525217 SNP located on the 3'untranslated region (UTR) of the CD163L1 gene is rare and shows a large effect size (MAF experimental group/control = 0.31/0.01, OR = 75.98; p = 6.2Х10 -23 ).
또한, 추가적으로 4개의 SNP[rs75822236 (R535H, GBA, 1q22), rs112859779 (G141S, TCF24, 8q13.1), rs79134766 (A208T, OLFML2A, 9q33.3), rs3744644 (E639D, SCARF1, 17p13.3)] 및 추가적인 넌센스 SNP인 rs59626274 (stop-gained, FLJ45964, 2q37.3)은 서열상에 암호화된 단백질과 잠재적인 직접적 연관성이 있음을 확인하였다.In addition, four additional SNPs [rs75822236 (R535H, GBA , 1q22), rs112859779 (G141S, TCF24 , 8q13.1), rs79134766 (A208T, OLFML2A , 9q33.3), rs3744644 (E639D, SCARF1 , 17p13.3)] and An additional nonsense SNP, rs59626274 (stop-gained, FLJ45964 , 2q37.3), confirmed that there is a potential direct association with the protein encoded on the sequence.
결론적으로, 뇌동맥류 발병과 관련하여, GBA, TCF24, OLFML2A, ARHGAP32, CD163L1, CUL4A, LOC102724084, 및 LRRC3 유전자 상에 위치한 SNP는 0.8 이상의 통계적 유의성을 나타내며, RNF144A, FLJ45964 SPCS3, LINGO2, MINK1 유전자 상에 위치하는 SNP는 0.7 내지 0.8의 통계적 유의성을 나타내는 바, 상기 13개의 SNP를 이용하여 뇌동맥류의 발병 위험을 예측하거나 발병 여부를 진단하는 데 유용하게 이용할 수 있다.In conclusion, in relation to the onset of cerebral aneurysm, SNPs located on the GBA , TCF24 , OLFML2A , ARHGAP32 , CD163L1 , CUL4A , LOC102724084 , and LRRC3 genes show statistical significance of 0.8 or more, and RNF144A , FLJ45964 SPCS3 , LINGO2 , and MINK1 genes The located SNP has a statistical significance of 0.7 to 0.8, and the 13 SNPs can be used to predict the risk of developing a cerebral aneurysm or to diagnose the onset.
실험예 3: 단일-세포 eQTL 분석Experimental Example 3: Single-cell eQTL analysis
상기 실험예 2에서 선별한 SNP 마커의 조직에서의 발현여부를 확인하기 위해 하기와 같은 실험을 수행하였다.The following experiment was performed to confirm whether the SNP marker selected in Experimental Example 2 was expressed in tissues.
구체적으로, 45개의 인간 조직으로부터 얻은 70개 이상의 샘플을 이용한 단일-세포 eQTL(single-cell eQTL) 분석에서, 3개의 SNP가 발현상의 유의미한 차이를 나타냈다(p < 1Х10-5). 구체적으로, rs6741819 (RNF144A, 2p25.1; p = 4.0Х10-14)는 부신 조직에서 하향-조절되었고(175개 샘플, effect size = -0.36, p = 1.5Х10-6) (도 4A, B), rs1052270 (TMOD1. 9q22.33; p = 2.7Х10-8)는 고환 조직에서 상향-조절되었다(225개 샘플, effect size = 0.42, p = 8.6Х10-10) (도 4C, D).Specifically, in single-cell eQTL (eQTL) analysis using more than 70 samples obtained from 45 human tissues, 3 SNPs showed significant differences in expression (p <1Х10 -5 ). Specifically, rs6741819 ( RNF144A , 2p25.1; p = 4.0Х10 -14 ) was down-regulated in adrenal tissue (175 samples, effect size = -0.36, p = 1.5Х10 -6 ) (Fig. 4A, B) , rs1052270 ( TMOD1 . 9q22.33; p = 2.7Х10 -8 ) was up-regulated in testicular tissues (225 samples, effect size = 0.42, p = 8.6Х10 -10 ) (Fig. 4C, D).
또한, rs6841581 (EDNRA, 4q31.22; p = 6.5Х10-4)는 식도(점막) (358개 샘플, effect size = 0.38, p = 5.2Х10-12) 및 햇빛에 노출되지 않은 피부(치골상부) (335개 샘플, effect size = 0.21, p = 1.2Х10-6) 모두에서 상향-조절되었다(도 5).In addition, rs6841581 ( EDNRA , 4q31.22; p = 6.5Х10 -4 ) is the esophagus (mucous membrane) (358 samples, effect size = 0.38, p = 5.2Х10 -12 ) and skin that is not exposed to sunlight (superior pubis). (335 samples, effect size = 0.21, p = 1.2Х10 -6 ) was up-regulated in all (Fig. 5).
<2. LOX(Lysyl oxidase) 유전자의 SNP 이용한 뇌동맥류 진단><2. Cerebral aneurysm diagnosis using SNP of LOX (Lysyl oxidase) gene>
실시예 1. 연구 대상Example 1. Research subject
단일 기관에서 방사선학적으로 낭형(saccular shape)을 갖는 것으로 확인된 뇌동맥류 환자군 80명과, 환자군의 환자의 나이 및 성별과 매칭된 대조군 80명을 모집하였다. 상기 뇌동맥류에서, 방추형 또는 해부학 비낭성 동맥류 및 외상성 또는 전염성 동맥류는 제외하였다. 대조군은, 동정맥 기형, 두개내 출혈 또는 경색 등과 같은 다른 신경계 질환을 제외한, 두통 진단 또는 건강 검진을 위해 전산화 단층 촬영 또는 자기 공명 혈관 조영술을 받은, 매칭된 환자들로 구성하였다. 성별, 연령, 비파열 뇌동맥류 또는 지주막하 출혈과 같은 임상 증상, 고혈압, 당뇨, 고지혈증, 흡연, 동맥류의 가족력 등 여러 변수를 고려하여 의료 기록을 검토하였다. 동맥류의 크기, 위치(전방 순환 또는 후방 순환), 및 수(단수 또는 복수)에 대한 혈관조영 변수를 검토하였다. 본 연구는 춘천 성심 병원의 임상 시험 위원회에 의해 승인되었다(No. 2016-31).We recruited 80 patients with cerebral aneurysms, which were radiographically confirmed to have a saccular shape in a single institution, and 80 controls matched with the age and sex of the patients in the patient group. In the cerebral aneurysm, fusiform or anatomical non-cystic aneurysm and traumatic or infectious aneurysm were excluded. The control group consisted of matched patients who underwent computed tomography or magnetic resonance angiography for headache diagnosis or health examination, excluding other neurological disorders such as arteriovenous malformations, intracranial hemorrhage or infarction. The medical records were reviewed in consideration of various variables such as sex, age, clinical symptoms such as non-ruptured cerebral aneurysm or subarachnoid hemorrhage, hypertension, diabetes, hyperlipidemia, smoking, and family history of aneurysms. Angiographic parameters for the size, location (anterior or posterior circulation), and number (singular or plural) of aneurysms were reviewed. This study was approved by the Clinical Trial Committee of Chuncheon Sacred Heart Hospital (No. 2016-31).
검토 결과, 뇌동맥류 환자군에서, 여성의 수는 43명(53.8%)이었고, 평균 연령은 57.1 ± 12.9세였다. 지주막하 출혈 증상은 41명(51.3%)의 환자에게서 나타났다. 동맥류 위치와 관련하여, 전방순환동맥류(n = 73, 91.3%)가 다음과 같이 기록되었다: 내경동맥, n = 15; 전교통동맥 또는 전대뇌동맥, n = 21; 중간대뇌동맥, n = 25; 및 후교통동맥, n = 12. 단일 동맥류가 있는 환자는 75명(93.8%)이었으며, 지주막하 출혈의 가족력이 없는 환자는 없었다. 두 군간에 고혈압, 당뇨, 고지혈증 및 흡연의 발생률은 유의하게 다르지 않았다.As a result of the review, in the cerebral aneurysm patient group, the number of women was 43 (53.8%), and the average age was 57.1 ± 12.9 years. Symptoms of subarachnoid hemorrhage were found in 41 patients (51.3%). Regarding the aneurysm location, anterior circulatory aneurysm (n = 73, 91.3%) was recorded as follows: internal carotid artery, n = 15; Anterior or anterior cerebral artery, n = 21; Middle cerebral artery, n = 25; And posterior transit artery, n = 12. 75 patients (93.8%) had a single aneurysm, and no patients had a family history of subarachnoid hemorrhage. The incidence of hypertension, diabetes, hyperlipidemia, and smoking was not significantly different between the two groups.
실시예 2. 단일염기 다형성 선택 및 검사Example 2. Single base polymorphism selection and examination
LOX 유전자 상의 단일염기 다형성과 뇌동맥류 발병 가능성의 연관성을 조사하기 위하여, 대립형질에 대한 SNPinfo(https://snpinfo.niehs.nih.gov/)의 LD TAG SNP 셀렉션(TagSNP)로부터의 일본 및 중국(JPT+CHB) HapMap 데이터베이스(Phase II)에서 연관불균형(linkage disequilibrium, LD; r2 < 0.8)을 적용한 후, LOX 유전자의 5'-상류와 3'-하류 사이에 위치한 10개의 태그(tag) SNP를 선택하였다(서열번호 14 내지 서열번호 21 참조).To investigate the association between single-base polymorphism on the LOX gene and the likelihood of developing a cerebral aneurysm, Japan and China from the LD TAG SNP selection (TagSNP) of SNPinfo (https://snpinfo.niehs.nih.gov/) for alleles. (JPT+CHB) After applying linkage disequilibrium (LD; r 2 <0.8) in HapMap database (Phase II), 10 tags located between 5'-upstream and 3'-downstream of the LOX gene SNP was selected (see SEQ ID NO: 14 to SEQ ID NO: 21).
SNPSNP 서열order 서열번호Sequence number
rs2303656rs2303656 5'-TACGCATGATGTCCTGTGTAGCGAATGTCACAGCGCACAACATTGTTGGTATAGTCAGATTCAGGAACCAGGTAGCTGGGGTTTACACTGACCTGGGCAACACAAAGAGTTCCTCAGTATTTCTTTTTCCATAGGGCTACAATAAGGAAATTGTTAATGAGGACTTAGCTAAATCAAGCAGGGAAGGGATTTTAACTTAAGTAA [G/T] TGGTTAAACTCTGGAGACGTTATGGAAAGAGACTGCATATTTTCCCCTGAAGTTCTTTAAAATAAGACAGATTAGATTAGATTAGATTGTTTATAAATAGTTTGAGGATGTATAATTGCTTCCAATACCATGATTATTTAACATTTGAATCCAGAGAAGAGGGCCTATTGATCTGCAATATCAATATATGATATATTTTCAAAGGTCTTTACCTTTAGGATATAGTTTCCAGGTTTTACATCTGTAATATCAATCCACTGGCAGTCTATGTCTGCACCATAGGTATCATAACAGCCAGG-3' 5'-TACGCATGATGTCCTGTGTAGCGAATGTCACAGCGCACAACATTGTTGGTATAGTCAGATTCAGGAACCAGGTAGCTGGGGTTTACACTGACCTGGGCAACACAAAGAGTTCCTCAGTATTTCTTTTTCCATAGGGCTACAATAAGGAAATTGTTAATGAGGACTTAGCTAAATCAAGCAGGGAAGGGATTTTAACTTAAGTAA [G / T] TGGTTAAACTCTGGAGACGTTATGGAAAGAGACTGCATATTTTCCCCTGAAGTTCTTTAAAATAAGACAGATTAGATTAGATTAGATTGTTTATAAATAGTTTGAGGATGTATAATTGCTTCCAATACCATGATTATTTAACATTTGAATCCAGAGAAGAGGGCCTATTGATCTGCAATATCAATATATGATATATTTTCAAAGGTCTTTACCTTTAGGATATAGTTTCCAGGTTTTACATCTGTAATATCAATCCACTGGCAGTCTATGTCTGCACCATAGGTATCATAACAGCCAGG-3 ' 1414
rs3900446a
rs763497b
rs3900446 a and
rs763497 b
5'-GAGCATGCAACCTAAATCCCTCATATGCACAGTTCACAATGGGGTTCACGCTCATATGAGAATCTAATGCCATGATTGATCTGACAGGAAGCAAAGCTCAGGTGGTAATGTGAGGAAAGAGGATCTTGGTAAACATGCTATTGTAAGTTTAATGTCTCTACTCCCCTTCCGAGAACCCCATGTCTCCTTACTGGGAAACTTCAAGTCAAATGGTTTTAGGATTTACTGACAGAGGTTACTTGCTAGTATGAATTTGAGAAATTCATGGGAGGTACCTCACCAGGAACCCAAAAAATGGAATTTTTGACGTGGGGAGTGTCTGTAAATACAGATGAAGCTTCACTTGCTGGCCCACTGCTCACCTCCTGCTGTGCAGCCCAGTTCCTAACAGGGATGGTACTGGTCCGTGTCCTGGGGTTTGGGAACCACTGGTTTATTGAAAAGACATTCTGCTGGGTTGGTATGGAGCCCAAGTTATATTTGGGTT [A/G] aCACATTAGGGACTACTTCTTGTGATTTTGAGCCTAAATTATAATAAACTCTAGATATACACACCCTATGCCTATCAGAATAGTAATGAAGGGGTAAATGGCCCCCAACACAAGTGGCAATGGTTTTTGGAATAATACCAAAAGCCAACGAAATGTGATGGAGATTTACTGAAGCTAAGC [A/G] bTTAATTTTGGGGATAGGATGTTCTCGATGTAGGCCTAGATGTATGCAGCATCGTGTAAGGCTATCTATTAAAGAAGTCTAAAAAATTCACTTGTGATATTGAGTCATAAAGTTGGTTTTTAATCCATTCTCAACAGACTCTCAATTT-3' 5'-GAGCATGCAACCTAAATCCCTCATATGCACAGTTCACAATGGGGTTCACGCTCATATGAGAATCTAATGCCATGATTGATCTGACAGGAAGCAAAGCTCAGGTGGTAATGTGAGGAAAGAGGATCTTGGTAAACATGCTATTGTAAGTTTAATGTCTCTACTCCCCTTCCGAGAACCCCATGTCTCCTTACTGGGAAACTTCAAGTCAAATGGTTTTAGGATTTACTGACAGAGGTTACTTGCTAGTATGAATTTGAGAAATTCATGGGAGGTACCTCACCAGGAACCCAAAAAATGGAATTTTTGACGTGGGGAGTGTCTGTAAATACAGATGAAGCTTCACTTGCTGGCCCACTGCTCACCTCCTGCTGTGCAGCCCAGTTCCTAACAGGGATGGTACTGGTCCGTGTCCTGGGGTTTGGGAACCACTGGTTTATTGAAAAGACATTCTGCTGGGTTGGTATGGAGCCCAAGTTATATTTGGGTT [A / G] a CACATTAGGGACTACTTCTTGTGATTTTGAGCCTAAATTATAATAAACTCTAGATATACACACCCTATGCCTATCAGAATAGTAATGAAGGGGTAAATGGCCCCCAACACAAGTGGCAATGGTTTTTGGAATAATACCAAAAGCCAACGAAATGTGATGGAGATTTACTGAAGCTAAGC [A / G] b TTAATTTTGGGGATAGGATGTTCTCGATGTAGGCCTAGATGTATGCAGCATCGTGTAAGGCTATCTATTAAAGAAGTCTAAAAAATTCACTTGTGATATTGAGTCATAAAGTTGGTTTTTAATCCATTCTCAACAGACTCTCAATTT-3 ' 1515
rs10040971rs10040971 5'-TCTAGCTCAGGGCATCAACAAACAGTACAAAAATGAGAGTGCAAATGAATAAATAAATGGAGAATGGATGAATAAATTAAGGAATTATAAAAATTAAGAAAAAACTAATCTGTTTATTTAAGTGCAAATTATTTTAGCTTAAATTATAATGGTGTTCTGGCGGTGGGGGTCGGGGGTTGGTTCTACTATAACCAACTCCACACAATATGGGCCATAAAACCTGCCAGGTTTTCTGTGCTGTGGGCATGTTCAGAAGAATGTATGTGACTCTGTTTTTTCAGTGCTATCCTTTTGCTATCACAGGCTTCATCTATCTCTAA [T] GTTGTGACAACACTTGTAAAGCACAGTCTCTGCTTCTTTATGTAGAAAGTCCTGGGTTTTTGTATCAGGCAGAAATTTCTATTAATTATGAGATTCTAGTATAGCTCTGCTATACCTGTCTGTATGATCCAGTGGCACTGGTGGTTCTCCAGTGACAAAGCAAAGCTGATGAGTGTTGAGTATCATTCCAATGGAAATAGTATTCTCATTGTTGGGAAGGCATAACTCAAGTGGCATATGTAATTATAATCTAGCACCCAGCAACACTTGGGGAGGTAGTGC -3' 5'-TCTAGCTCAGGGCATCAACAAACAGTACAAAAATGAGAGTGCAAATGAATAAATAAATGGAGAATGGATGAATAAATTAAGGAATTATAAAAATTAAGAAAAAACTAATCTGTTTATTTAAGTGCAAATTATTTTAGCTTAAATTATAATGGTGTTCTGGCGGTGGGGGTCGGGGGTTGGTTCTACTATAACCAACTCCACACAATATGGGCCATAAAACCTGCCAGGTTTTCTGTGCTGTGGGCATGTTCAGAAGAATGTATGTGACTCTGTTTTTTCAGTGCTATCCTTTTGCTATCACAGGCTTCATCTATCTCTAA [T] GTTGTGACAACACTTGTAAAGCACAGTCTCTGCTTCTTTATGTAGAAAGTCCTGGGTTTTTGTATCAGGCAGAAATTTCTATTAATTATGAGATTCTAGTATAGCTCTGCTATACCTGTCTGTATGATCCAGTGGCACTGGTGGTTCTCCAGTGACAAAGCAAAGCTGATGAGTGTTGAGTATCATTCCAATGGAAATAGTATTCTCATTGTTGGGAAGGCATAACTCAAGTGGCATATGTAATTATAATCTAGCACCCAGCAACACTTGGGGAGGTAGTGC -3 ' 1616
rs17148773a 및 rs3792801b rs17148773 a and rs3792801 b 5'-AATAGGCAGAAACTGGACCAAAGCTAATCAATCAAATATTACTGTCTTTAAATGTGACCATAGATCTTCATGTAAGGAAGTGAAAATTCACTTATTCAAATCATAAACTACCAATTTCCAAACAGTAAATTCTGTGAGGAGAAAAAAAAAAACTTACATAGTATCTTATAACTGAAAGAAGCCTCAGAGTCACCTGGTC [C] aGTACATTTTGTTTCAGTGAGGAAAATGAAGGAGAGAGGGTACATTAACAGCACATACCTATTCAACTATTTACTGGGTGGCTTTTACACATCAACAGAATGCTCTTAAATATCTGGCAGGAAAAGCAATCAGTGAACTGATACATGATATGTCTTCAGAGTCACACTCACTGCTGCTTACACAGCCACCAGACTGACCTGATGGCCTTAGGCAAGTTACACTTCCTGCTCAAAAAGCTTCAGCCTCCCACTGCCTCCAGAATAAATTTTAGCCTGCTCTTCAGGGCTGTCTTCCATCTGGCTCAACTTACTTTTCCATCCTTTTTGTCCAACTCGTAACTCCACAAAATT [C] bATGCTTTAGCCAAACTAGAAGACTTGTTTTTCCAAACATGCCCTGCAGTTTCCTCCTGCCATGCAAGTTGCCTGTGACGTTGACTTGCCCTGGGCTTCCTTTCCTTAATGCTCCCCGGTGCATTCCCCAGACTTCAAGGCTCAA-3' 5'-AATAGGCAGAAACTGGACCAAAGCTAATCAATCAAATATTACTGTCTTTAAATGTGACCATAGATCTTCATGTAAGGAAGTGAAAATTCACTTATTCAAATCATAAACTACCAATTTCCAAACAGTAAATTCTGTGAGGAGAAAAAAAAAAACTTACATAGTATCTTATAACTGAAAGAAGCCTCAGAGTCACCTGGTC [C] a GTACATTTTGTTTCAGTGAGGAAAATGAAGGAGAGAGGGTACATTAACAGCACATACCTATTCAACTATTTACTGGGTGGCTTTTACACATCAACAGAATGCTCTTAAATATCTGGCAGGAAAAGCAATCAGTGAACTGATACATGATATGTCTTCAGAGTCACACTCACTGCTGCTTACACAGCCACCAGACTGACCTGATGGCCTTAGGCAAGTTACACTTCCTGCTCAAAAAGCTTCAGCCTCCCACTGCCTCCAGAATAAATTTTAGCCTGCTCTTCAGGGCTGTCTTCCATCTGGCTCAACTTACTTTTCCATCCTTTTTGTCCAACTCGTAACTCCACAAAATT [C] b ATGCTTTAGCCAAACTAGAAGACTTGTTTTTCCAAACATGCCCTGCAGTTTCCTCCTGCCATGCAAGTTGCCTGTGACGTTGACTTGCCCTGGGCTTCCTTTCCTTAATGCTCCCCGGTGCATTCCCCAGACTTCAAGGCTCAA-3 ' 1717
rs10519694rs10519694 5'-CTACATGAGGGGCTATTATCTCCATTTTATAGATGAGAAAACTAAGGCACACTAAGATCAAATAACTTACCCAAGGGTATCCAGCCTAGTAAGTGGCTAAGCTGGTTTTGAGTTTAGGTAATCAAGGTCCAGAGTCCCTGTTCTTAACTACCCCACTATACTCTCTCTCATACAGTCACTGAAATATGACATATTTTGTTGAAGGGGTAAATGCATGACTAAATTGATGAATGCCACATCACTCCACTTGCTAAAATATTCACATCAATAAGTAAATGAATG [C] CTTCTACAGGCTGGGAGGAGAAAAATATAACAAATACAATCCTTGCTTTTAAGAATGTTATAGTCTAGAGAAGTTTCCTCAGATTGGAGTCTGTAGGTATATTCTTGATTCCATTAGTTCTTCACAAAAAGTTTTAACTTGTATTTTTATTCTAATAGTAATTTAAATTCAAAGTACATGCTAGATTCATTTTAACTCAATACTGCCATTCAATTCTAGCAACCAATATTGCTTTGCTGTTTAAGATCACTTTGGTCACCCAAGAG-3' 5'-CTACATGAGGGGCTATTATCTCCATTTTATAGATGAGAAAACTAAGGCACACTAAGATCAAATAACTTACCCAAGGGTATCCAGCCTAGTAAGTGGCTAAGCTGGTTTTGAGTTTAGGTAATCAAGGTCCAGAGTCCCTGTTCTTAACTACCCCACTATACTCTCTCTCATACAGTCACTGAAATATGACATATTTTGTTGAAGGGGTAAATGCATGACTAAATTGATGAATGCCACATCACTCCACTTGCTAAAATATTCACATCAATAAGTAAATGAATG [C] CTTCTACAGGCTGGGAGGAGAAAAATATAACAAATACAATCCTTGCTTTTAAGAATGTTATAGTCTAGAGAAGTTTCCTCAGATTGGAGTCTGTAGGTATATTCTTGATTCCATTAGTTCTTCACAAAAAGTTTTAACTTGTATTTTTATTCTAATAGTAATTTAAATTCAAAGTACATGCTAGATTCATTTTAACTCAATACTGCCATTCAATTCTAGCAACCAATATTGCTTTGCTGTTTAAGATCACTTTGGTCACCCAAGAG- 3 ' 1818
rs1800449rs1800449 5'- CCGGGACTGCAAAGCAATGTGAAAAGGAAGCAGGAGGGGCCAGACGCGCGGTTTGCACTGGATTCCAGGGCTGCCACTGCAGGCGCGTGGGGGAGGGATCGGATCTGCGAGGACCGGGGCCCGCCGCGCCCAGGCAGCCACGTCGAGAAGCCACATAGCTGGGGACCAGGTGCACGGGTGCTTCCAGCGGACTTGGGGGTACTTACCGTACTGGAAGTAGCCAGTGCCGTATCCGGGCCGGTACCTGCCCCCAGGTCTGGGCCTTTCATAAGTATCGTAGTAGTTGTAATAAGGGTTGTCGTCAGAGTACTTGTAGGGGTTGTAAGGGTCGTCGCCCACCATGCCGTCCACGCGGCTGGGCGGC [C] GCAGGTTACTGAGCGCAGGAACTTCTCCCGGCGCTGTCTGGTTCTCCGCGCGCGAGGCGCCAGCTTCGCGGGCTCTAGATGTCGAGTAGCCAGCTTGGAACCAGTGACGGGCGGTGGGCCTGGGGCGGCCAGCGGTGACTCCAGATGAGCCGGCCGTCCGCGTTCGCGCCGCGGCGGTGCGGTTGTCGCGGATCAGCAGGATCGGAGTGCGGGGCTGCTGGGCGGAGGCGTTGGCTGCACCAGGGACGGCGGCGCCCGGGTCCCGGCGGCGCTGAGGCTGGTACTGTGAGCCCAGGCTCAGCAAGCTGAACACCTGCCCGTTGTTCTCCCATTGGATCTGC-3' 5'- CCGGGACTGCAAAGCAATGTGAAAAGGAAGCAGGAGGGGCCAGACGCGCGGTTTGCACTGGATTCCAGGGCTGCCACTGCAGGCGCGTGGGGGAGGGATCGGATCTGCGAGGACCGGGGCCCGCCGCGCCCAGGCAGCCACGTCGAGAAGCCACATAGCTGGGGACCAGGTGCACGGGTGCTTCCAGCGGACTTGGGGGTACTTACCGTACTGGAAGTAGCCAGTGCCGTATCCGGGCCGGTACCTGCCCCCAGGTCTGGGCCTTTCATAAGTATCGTAGTAGTTGTAATAAGGGTTGTCGTCAGAGTACTTGTAGGGGTTGTAAGGGTCGTCGCCCACCATGCCGTCCACGCGGCTGGGCGGC [C] GCAGGTTACTGAGCGCAGGAACTTCTCCCGGCGCTGTCTGGTTCTCCGCGCGCGAGGCGCCAGCTTCGCGGGCTCTAGATGTCGAGTAGCCAGCTTGGAACCAGTGACGGGCGGTGGGCCTGGGGCGGCCAGCGGTGACTCCAGATGAGCCGGCCGTCCGCGTTCGCGCCGCGGCGGTGCGGTTGTCGCGGATCAGCAGGATCGGAGTGCGGGGCTGCTGGGCGGAGGCGTTGGCTGCACCAGGGACGGCGGCGCCCGGGTCCCGGCGGCGCTGAGGCTGGTACTGTGAGCCCAGGCTCAGCAAGCTGAACACCTGCCCGTTGTTCTCCCATTGGATCTGC-3 ' 1919
rs2956540rs2956540 5'- GATCTGGGCGGGAGTCAAATTATAATGTCCTTTTACAAATTAGGGTTTCATATGGAAATACTGACATAGATTTTAACTGACACGCATTTTCCAATGATAAAACATGCAAACTGCTTAGTTCAGCACTACTTTAAAAAAATCCATCCAAACAACATCTGACATCAATTATACTGTAGATTTAAATATATATGTGTGGAGAAAGAAATGGTGTCCTTCTGCTCTTATTTGCATTATTAAAAGAGGCAACTTTTTAAAGTGCTTTTAAAGAAACTTATTTTTCCTCCATTTGCTAACC [G] CAACCACTATTCTATTTTCAGCATAAAACAGAAGGAAGGAATGGTTTCACAGGTGAAAAAACAGAGATATCTTTTTTTACAGTTATTTACTAAGCCGGTTAAGGAATACAGAATGGGTGCATATGTTGTCAACCATTCAGACTTTTTCAGAGAGTAAATTTTTGTTCTTCATTGTGGACTGTAACAAGGACCCACACTGACCTGTGATC-3' 5'- GATCTGGGCGGGAGTCAAATTATAATGTCCTTTTACAAATTAGGGTTTCATATGGAAATACTGACATAGATTTTAACTGACACGCATTTTCCAATGATAAAACATGCAAACTGCTTAGTTCAGCACTACTTTAAAAAAATCCATCCAAACAACATCTGACATCAATTATACTGTAGATTTAAATATATATGTGTGGAGAAAGAAATGGTGTCCTTCTGCTCTTATTTGCATTATTAAAAGAGGCAACTTTTTAAAGTGCTTTTAAAGAAACTTATTTTTCCTCCATTTGCTAACC [G] CAACCACTATTCTATTTTCAGCATAAAACAGAAGGAAGGAATGGTTTCACAGGTGAAAAAACAGAGATATCTTTTTTTACAGTTATTTACTAAGCCGGTTAAGGAATACAGAATGGGTGCATATGTTGTCAACCATTCAGACTTTTTCAGAGAGTAAATTTTTGTTCTTCATTGTGGACTGTAACAAGGACCCACACTGACCTGTGATC-3 ' 2020
rs3853401rs3853401 5'- CTACCCTTTGTCACACATGCTAATGAAAAGCTTAGTTGATTTTCACTCTCCTTCATTTCCTCTAAAATCTCTCTGGCTTAGGACTCTGTCAGCTGAAAAACAAACATGTGGCTACCACATTTGGGGACAATACAGTGTTTGCAAGCCCTGCGGGAGATAATCTAGCCACACATTGTGTTCCCTGTTCAATAACAAAACTATTATTCACAAAATTGGAGAAACCATAGTTCCTTTCCACTCAAATCTGAGATGATAATGATGATGACAATAATAATAATAAGCCACGGCTACATCAAGATACAAACAGCTTTTTTTGCTTTGATAAGATCCACAGCTGATTTCACTTTTGACCATGAGATTTTCTTCTC [G] TGAACAATTCTGCAGTATGTGCCATAAGAGAAGGGAAGGAATGTTGCTAATTCTTTTTTTGAGTTTCTAGCCCATCAATATCAAATCTTTAAATGGCAATGTCTGGCCCATTGGCCAAGAAATGAAAGTTGTTGTAATGCTATGTTCCTGGTATTTGTTAAATACATTTATTTTTGTAGGACATTTCACATAAATGGAAAACAGAAAGCCGAAACCATAAAGCAGGGCCTCTGAATTGCAGAAGCCAGAACAGTAATGCCACATTCAAAGCAATCAGGTTCAAGTGTAAATTCTTTTGTTTGAGGCTCAAGAAGCTCATACAAAGCTTG-3' 5'- CTACCCTTTGTCACACATGCTAATGAAAAGCTTAGTTGATTTTCACTCTCCTTCATTTCCTCTAAAATCTCTCTGGCTTAGGACTCTGTCAGCTGAAAAACAAACATGTGGCTACCACATTTGGGGACAATACAGTGTTTGCAAGCCCTGCGGGAGATAATCTAGCCACACATTGTGTTCCCTGTTCAATAACAAAACTATTATTCACAAAATTGGAGAAACCATAGTTCCTTTCCACTCAAATCTGAGATGATAATGATGATGACAATAATAATAATAAGCCACGGCTACATCAAGATACAAACAGCTTTTTTTGCTTTGATAAGATCCACAGCTGATTTCACTTTTGACCATGAGATTTTCTTCTC [G] TGAACAATTCTGCAGTATGTGCCATAAGAGAAGGGAAGGAATGTTGCTAATTCTTTTTTTGAGTTTCTAGCCCATCAATATCAAATCTTTAAATGGCAATGTCTGGCCCATTGGCCAAGAAATGAAAGTTGTTGTAATGCTATGTTCCTGGTATTTGTTAAATACATTTATTTTTGTAGGACATTTCACATAAATGGAAAACAGAAAGCCGAAACCATAAAGCAGGGCCTCTGAATTGCAGAAGCCAGAACAGTAATGCCACATTCAAAGCAATCAGGTTCAAGTGTAAATTCTTTTGTTTGAGGCTCAAGAAGCTCATACAAAGCTTG-3 ' 2121
10개의 태그 SNP의 유전자형 분석(genotyping)을 위해, HiGeneTM Genomic DNA 프렙 키트(BIOFACT, 대전, 한국)를 이용하여, 피험자 160명의 말초 혈액으로부터 게놈 DNA를 추출하였다. 10개의 SNP 프라이머는 프라이머-3 v.0.4.0 프로그램(http://bioinfo.ut.ee/primer3-0.4.0/)을 사용하여 설계되었으며, 설계된 프라이머는 하기 표 4에 나타내었다.For genotyping of 10 tag SNPs, genomic DNA was extracted from peripheral blood of 160 subjects using a HiGene TM Genomic DNA preparation kit (BIOFACT, Daejeon, Korea). Ten SNP primers were designed using the Primer-3 v.0.4.0 program (http://bioinfo.ut.ee/primer3-0.4.0/), and the designed primers are shown in Table 4 below.
SNPSNP 프라이머primer 서열order 서열번호Sequence number
rs2303656rs2303656 정방향
역방향
Forward direction
Reverse
5'-CGCATGATGTCCTGTGTAGC-3'
5'-TGGCTGTTATGATACCTATGGTG-3'
5'-CGCATGATGTCCTGTGTAGC-3'
5'-TGGCTGTTATGATACCTATGGTG-3'
22
23
22
23
rs3900446, rs763497rs3900446, rs763497 정방향
역방향
Forward direction
Reverse
5'-CATGCAACCTAAATCCCTCAT-3'
5'-TTGAGAGTCTGTTGAGAATGGA-3'
5'-CATGCAACCTAAATCCCTCAT-3'
5'-TTGAGAGTCTGTTGAGAATGGA-3'
24
25
24
25
rs10040971rs10040971 정방향
역방향
Forward direction
Reverse
5'-AGCTCAGGGCATCAACAAAC-3'
5'-CTACCTCCCCAAGTGTTGCT-3'
5'-AGCTCAGGGCATCAACAAAC-3'
5'-CTACCTCCCCAAGTGTTGCT-3'
26
27
26
27
rs17148773, rs3792801rs17148773, rs3792801 정방향
역방향
Forward direction
Reverse
5'-AGGCAGAAACTGGACCAAAG-3'
5'-AGCCTTGAAGTCTGGGGAAT-3'
5'-AGGCAGAAACTGGACCAAAG-3'
5'-AGCCTTGAAGTCTGGGGAAT-3'
28
29
28
29
rs10519694rs10519694 정방향
역방향
Forward direction
Reverse
5'-CATGAGGGGCTATTATCTCCA-3'
5'-TTGGGTGACCAAAGTGATCTT-3'
5'-CATGAGGGGCTATTATCTCCA-3'
5'-TTGGGTGACCAAAGTGATCTT-3'
30
31
30
31
rs1800449rs1800449 정방향
역방향
Forward direction
Reverse
5'-GGACTGCAAAGCAATGTGAA-3'
5'-GATCCAATGGGAGAACAACG-3'
5'-GGACTGCAAAGCAATGTGAA-3'
5'-GATCCAATGGGAGAACAACG-3'
32
33
32
33
rs2956540rs2956540 정방향
역방향
Forward direction
Reverse
5'-CTGGGCGGGAGTCAAATTAT-3'
5'-CACAGGTCAGTGTGGGTCCT-3'
5'-CTGGGCGGGAGTCAAATTAT-3'
5'-CACAGGTCAGTGTGGGTCCT-3'
34
35
34
35
rs3853401rs3853401 정방향
역방향
Forward direction
Reverse
5'-CCCTTTGTCACACATGCTAATG-3'
5'-GCTTTGTATGAGCTTCTTGAGC-3'
5'-CCCTTTGTCACACATGCTAATG-3'
5'-GCTTTGTATGAGCTTCTTGAGC-3'
36
37
36
37
상기 표 4의 프라이머와 SolgTM 2X Taq PCR Pre-Mix(Solgent, 대전, 한국)를 이용하여 중합효소 연쇄반응(PCR)을 수행하였다. 예비 변성은 95℃에서 5분간 수행되었고, 95℃에서 30초간 변성, 63℃에서 30초간 어닐링, 72℃에서 1분간 연장, 및 72℃에서 5분간 최종연장이 34사이클 수행되었다. 1.5% 아가로스 겔 전기 영동에 의해 증폭된 단편을 확인하고, SolgTM PCR 정제 키트(SolGent, 대전, 한국)로 정제한 후, ABI PRISM 3730XL 분석기(Applied Biosystems, 캘리포니아, USA)에 의해 각 서열을 분석하였다.Polymerase chain reaction (PCR) was performed using the primers of Table 4 and Solg TM 2X Taq PCR Pre-Mix (Solgent, Daejeon, Korea). Preliminary denaturation was performed at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 63°C for 30 seconds, extension at 72°C for 1 minute, and final extension at 72°C for 5 minutes were performed for 34 cycles. After confirming the fragment amplified by 1.5% agarose gel electrophoresis, and purified with Solg TM PCR purification kit (SolGent, Daejeon, Korea), each sequence was analyzed by ABI PRISM 3730XL analyzer (Applied Biosystems, California, USA). Analyzed.
실시예 3. 통계 분석Example 3. Statistical Analysis
크러스칼-왈리스(Kruskal-Wallis) 검정을 수행하여, 뇌동맥류 환자 80명 및 대조군 80명 사이의 비유전적 인자에 대한 차이를 평가했다. 피셔 정확검정은, 교차비(OR)를 추정하기 위해, 뇌동맥류와 LOX 유전자 근처 또는 LOX 유전자 상에 위치하는 10개의 SNP 사이의 대립 관계를 평가하기 위해 수행되었다.The Kruskal-Wallis test was performed to evaluate the difference in non-genetic factors between 80 patients with cerebral aneurysms and 80 controls. Fisher's exact test was performed to estimate the antagonistic relationship between a cerebral aneurysm and 10 SNPs located near or on the LOX gene to estimate the odds ratio (OR).
후속 분석에서, 동맥류 파열에 따른 뇌동맥류 형성에의 LOX 유전자의 유전적 영향을 분석했다. 또한, h-1의 자유도(h는 SNP의 수에 따라 슬라이딩 윈도우에서 모든 가능한 일배체형의 수)를 포함하는, 점근선 카이-제곱 통계를 통해 일배체형-특이적 연관 분석을 사용한 옴니버스 검정을 수행하어 뇌동맥류와의 유의한 일배체형 연관성을 검정하였다. 상기 검정에서 10개의 SNP를 사용하여 가능한 조합의 0.01 미만의 마이너 일배체형 빈도(MHF)를 갖는 일배체형 구조를 제외하였다. In a subsequent analysis, the genetic effect of the LOX gene on the formation of a cerebral aneurysm following aneurysm rupture was analyzed. In addition, an omnibus test using haplotype-specific association analysis was performed through asymptotic chi-square statistics, including h-1 degrees of freedom (h is the number of all possible haplotypes in the sliding window depending on the number of SNPs). We tested for significant haplotype association with cerebral aneurysms. In this assay, 10 SNPs were used to exclude haplotype structures with minor haplotype frequencies (MHF) of less than 0.01 of possible combinations.
단일 SNP 및 일배체형 연관에서 각각 0.01 및 0.001의 다중 비교 보정 및 암시적 유효 p값을 시험한 후, 본페로니(Bonferroni)-보정된 유의한 p값을 0.005 미만 및 2.0 x 10-4 미만으로 적용하였다. 기술 및 단변수 분석은 STATA 소프트웨어 v.11.2(Stata Corp., College Station, 텍사스, 미국)에 의해 수행되었다. 유전자형 분류율(genotyping call rate, GCR), 마이너 대립유전자 빈도(MAF), 하디-바인버그 평형(Hardy Weinberg equilibrium, HWE) p값 및 쌍별 LD(pairwise LD)를 평가하기 위해, Haploview v.4.2 (https://www.broadinstitute.org /haploview/haploview)를 사용하여 10개의 SNP에 대한 품질 관리 검정을 수행하였다. 유전자형 및 일배체형 연관성을 PLINK 프로그램 v.1.07(http://zzz.bwh.harvard.edu/plink/)을 사용하여 분석하였다.After testing multiple comparison corrections and implicitly effective p values of 0.01 and 0.001, respectively, in single SNP and haplotype associations, Bonferroni-corrected significant p values were less than 0.005 and less than 2.0 x 10 -4 . Applied. Descriptive and univariate analysis was performed by STATA software v.11.2 (Stata Corp., College Station, Texas, USA). To evaluate genotyping call rate (GCR), minor allele frequency (MAF), Hardy Weinberg equilibrium (HWE) p-value, and pairwise LD (LD), Haploview v.4.2 ( https://www.broadinstitute.org /haploview/haploview) was used to perform quality control assays for 10 SNPs. Genotype and haplotype associations were analyzed using the PLINK program v.1.07 (http://zzz.bwh.harvard.edu/plink/).
실시예 4. 단일염기 다형성과 뇌동맥류와의 유전적 연관성의 검토Example 4. Examination of genetic association between monobasic polymorphism and cerebral aneurysm
상기 실시예 2에서 선택된 10개의 모든 SNP는, 품질 관리 검정 후, 완전한 유전자형 분류율(GCR), 마이너 대립유전자 빈도(MAF)는 0.01 초과, 하디-바인버그 평형(HWE) p값은 0.05 초과, 쌍별 연관불균형(LD)은 0.8 초과였다. All the 10 SNPs selected in Example 2, after quality control assay, had a complete genotype classification rate (GCR), a minor allele frequency (MAF) greater than 0.01, and a Hardy-Weinberg equilibrium (HWE) p value greater than 0.05, Pairwise linkage disequilibrium (LD) was greater than 0.8.
10개의 SNP 중 3개의 SNP(rs2303656, rs3900446 및 rs763497)는 뇌동맥류와 통계적으로 유의한 연관성을 보였다(p < 0.05)(도 6). 2개의 SNP(rs2303656 및 rs3900446)는 본페로니-보정된 유의 수준(p < 0.005)에 도달했다. rs3900446의 C 대립 유전자는 뇌동맥류의 위험이 증가하면서 가장 유의미하고 강한 연관성을 보였다(OR = 20.15, p = 4.8 Υ 10-5). 반대로, rs2303656의 A 대립 유전자는 뇌동맥류에서 보호 효과가 있었고, 환자군에서는 빈번하게 관찰되지 않았다(p = 8.2 Υ 10-4). rs763497의 G 대립 유전자는 증가된 뇌동맥류 위험과의 연관성을 보여 주었다(OR = 2.26, p = 0.009). 그러나, 이후의 분석에서 뇌동맥류를 가진 80명의 환자 중 뇌동맥류 파열과 연관된 SNP는 없었다(p > 0.05).Three of the 10 SNPs (rs2303656, rs3900446, and rs763497) showed a statistically significant association with cerebral aneurysms (p <0.05) (Fig. 6). Two SNPs (rs2303656 and rs3900446) reached Bonferroni-corrected levels of significance (p <0.005). The C allele of rs3900446 showed the most significant and strong association with an increased risk of cerebral aneurysm (OR = 20.15, p = 4.8 Υ 10 -5 ). In contrast, the A allele of rs2303656 had a protective effect in cerebral aneurysms, and was not frequently observed in the patient group (p = 8.2 Υ 10 -4 ). The G allele of rs763497 was associated with an increased risk of cerebral aneurysm (OR = 2.26, p = 0.009). However, no SNP was associated with rupture of a cerebral aneurysm among 80 patients with a cerebral aneurysm in a later analysis (p> 0.05).
일배체형 연관성에 대한 옴니버스 검정에서, 45개의 슬라이딩 윈도우(SNP 세트)에서 전체 247개 일배체형 구조 중 136개는 0.05 미만의 점근선 p값을 보였으며, 17개의 일배체형은 뇌동맥류와 암시적 연관성을 보였다(점근선 p < 0.001, 도 7). 10개의 SNP 일배체형 조합 중 rs3900446과 rs763497의 CG 조합은 단일 SNP 분석(MHF = 0.113, 점근선 p = 1.3 Υ 10-5)에서 유의한 연관성을 보였다.In the omnibus test for haplotype association, 136 out of a total of 247 haplotype structures in 45 sliding windows (SNP sets) showed asymptotic p values of less than 0.05, and 17 haplotypes had an implicit association with cerebral aneurysms. Was seen (asymptotic line p <0.001, Fig. 7). Among the 10 SNP haplotype combinations, the CG combination of rs3900446 and rs763497 was significantly associated in a single SNP analysis (MHF = 0.113, asymptote p = 1.3 Υ 10 -5 ).
단일 SNP 분석에서 6개의 SNP(rs10040971, rs17148773, rs3792801, rs10519694, rs2956540 및 rs1800449)가 독립적으로 연관되어 있지는 않았지만, 이들 SNP를 rs2303656, rs3900446 또는 rs763497과 조합한 일배체형 구조는 일배체형 분석에서 유의했다(6.5Υ10-4<p<7.5Υ10-4).Although the six SNPs (rs10040971, rs17148773, rs3792801, rs10519694, rs2956540 and rs1800449) were not independently associated in the single SNP analysis, the haplotype structure in which these SNPs were combined with rs2303656, rs3900446 or rs763497 was significant in the haplotype analysis ( 6.5Υ10 -4 <p<7.5Υ10 -4 ).
<3. SOX17(SRY-box 17) 유전자의 SNP 이용한 뇌동맥류 진단><3. Cerebral aneurysm diagnosis using SNP of SOX17 (SRY-box 17) gene>
실시예 1. 연구 대상Example 1. Research subject
단일 기관(춘천 성심 병원)에서 방사선학적으로 낭형(saccular shape)을 갖는 것으로 확인된 뇌동맥류 환자군 187명과, 환자군의 환자의 나이 및 성별과 매칭된 대조군 372명을 모집하였다(환자군 및 대조군의 비율은 1:2임). 상기 뇌동맥류에서, 방추형 또는 해부학 비낭성 동맥류 및 외상성 또는 전염성 동맥류는 제외하였다. 대조군은, 동정맥 기형, 두개내 출혈 또는 경색 등과 같은 다른 신경계 질환을 제외한, 두통 진단 또는 건강 검진을 위해 전산화 단층 촬영 또는 자기 공명 혈관 조영술을 받은, 매칭된 환자들로 구성하였다. 성별, 연령, 비파열 뇌동맥류 또는 지주막하 출혈과 같은 임상 증상, 고혈압, 당뇨, 고지혈증, 흡연, 동맥류의 가족력 등 여러 변수를 고려하여 의료 기록을 검토하였다. 동맥류의 크기, 위치(전방 순환 또는 후방 순환), 및 수(단수 또는 복수)에 대한 혈관조영 변수를 검토하였다. 본 연구는 춘천 성심 병원의 임상 시험 위원회에 의해 승인되었다(No. 2017-9).In a single institution (Chuncheon Sacred Heart Hospital), 187 patients with a cerebral aneurysm confirmed to have a saccular shape radiologically and 372 controls matched with the age and sex of the patients in the patient group were recruited (the ratio of the patient group and the control group was 1:2). In the cerebral aneurysm, fusiform or anatomical non-cystic aneurysm and traumatic or infectious aneurysm were excluded. The control group consisted of matched patients who underwent computed tomography or magnetic resonance angiography for headache diagnosis or health examination, excluding other neurological disorders such as arteriovenous malformations, intracranial hemorrhage or infarction. The medical records were reviewed in consideration of various variables such as sex, age, clinical symptoms such as non-ruptured cerebral aneurysm or subarachnoid hemorrhage, hypertension, diabetes, hyperlipidemia, smoking, and family history of aneurysms. Angiographic parameters for the size, location (anterior or posterior circulation), and number (singular or plural) of aneurysms were reviewed. This study was approved by the Clinical Trial Committee of Chuncheon Sacred Heart Hospital (No. 2017-9).
검토 결과, 뇌동맥류 환자군 및 대조군에서, 여성의 수는 각각 108명(57.8%) 및 212명(57.9%)이었고, 평균 연령은 각각 58.2 ± 11.5세 및 56.9 ± 14.2세였다(P = 0.305). 고혈압, 당뇨, 고지혈증 및 흡연 상태를 포함하는 다른 요인들은 두 군 간에 크게 다르지 않았다. 지주막하 출혈 증상은 95명(50.8%)의 환자에게서 나타났다. 동맥류 위치와 관련하여, 전방순환동맥류(n = 167; 89.3%)가 다음과 같이 기록되었다: 내경동맥, n = 34; 전교통동맥 또는 전대뇌동맥, n = 39; 중간대뇌동맥, n = 56; 및 후교통동맥, n = 38. 본 코호트에서 뇌동맥류의 가족력은 언급되지 않았다.As a result of the review, in the cerebral aneurysm patient group and the control group, the number of women was 108 (57.8%) and 212 (57.9%), respectively, and the mean age was 58.2 ± 11.5 years and 56.9 ± 14.2 years, respectively (P = 0.305). Other factors including hypertension, diabetes, hyperlipidemia and smoking status did not differ significantly between the two groups. Symptoms of subarachnoid hemorrhage occurred in 95 (50.8%) patients. Regarding aneurysm location, anterior circulatory aneurysm (n = 167; 89.3%) was recorded as follows: internal carotid artery, n = 34; Anterior or anterior cerebral artery, n = 39; Middle cerebral artery, n = 56; And posterior transit artery, n = 38. No family history of cerebral aneurysms was noted in this cohort.
실시예 2. 단일염기 다형성 선택 및 검사Example 2. Single base polymorphism selection and examination
SOX17 유전자 상의 단일염기 다형성과 뇌동맥류 발병 가능성의 연관성을 조사하기 위하여, 동아시아인 및 유럽인 조성 집단으로 구성된 이전의 GWAS로부터 이전에 보고된 SNP 5개(rs1072737, rs1504749, rs10958409, rs12541742 및 rs9298506)를 선택하였다(표 5의 서열번호 38 내지 서열번호 42 참조).To investigate the association between single-base polymorphism on the SOX17 gene and the likelihood of developing cerebral aneurysms, five previously reported SNPs (rs1072737, rs1504749, rs10958409, rs12541742 and rs9298506) were selected from the previous GWAS consisting of East Asian and European composition groups (See SEQ ID NO: 38 to SEQ ID NO: 42 in Table 5).
SNPSNP 서열order 서열번호Sequence number
rs1072737rs1072737 5'- GACATGGTTTTGCCATGTTGGCCCGGCTGGTATCAAACTCCTGGCCTCAGGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTATAGGCGTGAGCCACCGTGGCTTAACCTAAACTTCTAGATATGAAAACTATAATGTCTGAGGTGAAAAATAGACTGGAGGAAGAAAAAGGCAGATTGGACATTGTAGAAGAAAGGCGAGATCAGTGAAATTAAAAGTGTGGCAATGAAAACTACCCAAAATAAAACACGCAGAAAATAAAATTCCAAAAAATGAAAAAGCATAAGTGATATGTGGGATAGTTTCAGTGGCCTAATAC [A/C] TGAGTAACTGGAGTCCCTGAAGAAGAAAGACTGAAAAATATATTTTTAGAAATAATGGCTGAAAAATTTCCAAACTTAGTGAAGCTATAAACCTACAGATCTAAGCTCAATGAACACCAAGAAAAATAAACATGAAAATAACTACCCCAAATTACAGCATAAGTTACTAAAAAACAATGACAAAGAGAAAAATCTGACAGCCAGAAAATATACCCGTATTACATCCAGAGAAACAAAGATAAGGCTG-3' 5'- GACATGGTTTTGCCATGTTGGCCCGGCTGGTATCAAACTCCTGGCCTCAGGTGATCCACCTGCCTCGGCCTCCCAAAGTGCTGGGATTATAGGCGTGAGCCACCGTGGCTTAACCTAAACTTCTAGATATGAAAACTATAATGTCTGAGGTGAAAAATAGACTGGAGGAAGAAAAAGGCAGATTGGACATTGTAGAAGAAAGGCGAGATCAGTGAAATTAAAAGTGTGGCAATGAAAACTACCCAAAATAAAACACGCAGAAAATAAAATTCCAAAAAATGAAAAAGCATAAGTGATATGTGGGATAGTTTCAGTGGCCTAATAC [A / C] TGAGTAACTGGAGTCCCTGAAGAAGAAAGACTGAAAAATATATTTTTAGAAATAATGGCTGAAAAATTTCCAAACTTAGTGAAGCTATAAACCTACAGATCTAAGCTCAATGAACACCAAGAAAAATAAACATGAAAATAACTACCCCAAATTACAGCATAAGTTACTAAAAAACAATGACAAAGAGAAAAATCTGACAGCCAGAAAATATACCCGTATTACATCCAGAGAAACAAAGATAAGGCTG -3 ' 3838
rs1504749rs1504749 5'-CGTGCTGGCAAACTTGAAATCTGATGAACCCACTACCTTCACTACACTCACTGTCTGGTCTCTCTCAGGTAGCTGAGGACTGAGAAACACCCCAGCCAGGCAGGTTGGGGTCACTATAAATTCACAGTCACCAACCACACATGGTGCTCTGTTTGGCTGGCCATCTCATTATACCTGTCTGACTTGCTTACTGTCCTGCCCTCCGAAAAAGCTTTTCAAACACTATCTCCTTCTGCCTCAAATGT [A] TCACCTCCCCCTCAATGACTTTGCTTCATATGTGACACAAAGAAATGTTAATACCAGCCAAGACCTTCCTCAACTTCCGGCCAGCAAATCTGGAACACAAGCTGCATCTGTCCTGGTTTGCCTCTTCTCTCTTCTCGTTACAGTAGAGTAGCCATTCCTCTTCTAAAAAACACTGATCTCCCATCCTGCTCTGGACATTAAAGTACTGAGAAGTGGTTTTGTGTTCCCAGCAATATGGGAGTCATTGG-3' 5'-CGTGCTGGCAAACTTGAAATCTGATGAACCCACTACCTTCACTACACTCACTGTCTGGTCTCTCTCAGGTAGCTGAGGACTGAGAAACACCCCAGCCAGGCAGGTTGGGGTCACTATAAATTCACAGTCACCAACCACACATGGTGCTCTGTTTGGCTGGCCATCTCATTATACCTGTCTGACTTGCTTACTGTCCTGCCCTCCGAAAAAGCTTTTCAAACACTATCTCCTTCTGCCTCAAATGT [A] TCACCTCCCCCTCAATGACTTTGCTTCATATGTGACACAAAGAAATGTTAATACCAGCCAAGACCTTCCTCAACTTCCGGCCAGCAAATCTGGAACACAAGCTGCATCTGTCCTGGTTTGCCTCTTCTCTCTTCTCGTTACAGTAGAGTAGCCATTCCTCTTCTAAAAAACACTGATCTCCCATCCTGCTCTGGACATTAAAGTACTGAGAAGTGGTTTTGTGTTCCCAGCAATATGGGAGTCATTGG- 3 ' 3939
rs10958409rs10958409 5'-AAGTGATCCACCCACCTGAGCCTCCCAAAGTTCTGGGATTACAGGCTTGAGCCACTGCGCCCAGCTATAACCTTCACGTTCAAAGCACTCTCCCATCTATTATTAAGGCCTCTGAGAAAATCTCCTTTTTATATATATTCTCAAGTCAGAATTATTAGTCTCCATCTTTCATCTTAGTCTTCTTCAAATACCAAACTCTTTACTAAGCAGTTAGACACAAGTAGTTTCACCAGTTCTATCACTCAAATACGGTTTCATAAGTTCTGCCTAGTGATTGCCCATCAGAGGGGATATGGATTT [G] TGGGCAGGAAATAGAATAGAAACCTAACTCTAACTCTTCTGTGAAATGTAGTGTTTAGGTTAATATTCTTCCTTAACTGCCATCTGCTTTTTTTTGTTTGTTTAACACTTTGTCCAAATCTCTCAAACCTTACACCGCAGAATCATGGA-3' 5'-AAGTGATCCACCCACCTGAGCCTCCCAAAGTTCTGGGATTACAGGCTTGAGCCACTGCGCCCAGCTATAACCTTCACGTTCAAAGCACTCTCCCATCTATTATTAAGGCCTCTGAGAAAATCTCCTTTTTATATATATTCTCAAGTCAGAATTATTAGTCTCCATCTTTCATCTTAGTCTTCTTCAAATACCAAACTCTTTACTAAGCAGTTAGACACAAGTAGTTTCACCAGTTCTATCACTCAAATACGGTTTCATAAGTTCTGCCTAGTGATTGCCCATCAGAGGGGATATGGATTT [G] TGGGCAGGAAATAGAATAGAAACCTAACTCTAACTCTTCTGTGAAATGTAGTGTTTAGGTTAATATTCTTCCTTAACTGCCATCTGCTTTTTTTTGTTTGTTTAACACTTTGTCCAAATCTCTCAAACCTTACACCGCAGAATCATGGA- 3 ' 4040
rs12541742rs12541742 5'-GCTTTCATGGTGTGGGCTAAGGACGAGCGCAAGCGGCTGGCGCAGCAGAATCCAGACCTGCACAACGCCGAGTTGAGCAAGATGCTGGGTGAGTCCGAGTCGCAGACCCAGGCGGCCGGGCGCGCTGGCGCGAATCGCTAGGCCGATTTCTTAAACCCCAAACTGTTCTTTGCGAGCCTGACGCCCAAAACCAGGGGTGTGTAGCGGCCACGTCCTTTCTTAAGGCTCTGGGTTCC [C] TTCCCGCTTCCCGCCCTCCGACCCTCCAAAGCAGCTTTCCGCCTTGCTCTCCGGCTCCCGGATTCCCCAGGTGGCCGGGGGCGCGGGTCCAACGGCTCTGGGAAGGCGACTTCCCGGCACCTCCGGGCGGCGCGAGAGCACCCTTGGCCCTGAACTGGGCCGGTTGTGTCCATCCCTCGACCCCTTCCCTAGTTAGGTGTCCTTTTCTGTTTTTCGAACGACCGGGTGATGGGTGAGCGGAAAGCCGCTTCCAGGAGACCAAAAGAAAGGGGTGCCTTTAGAGGACGGGTGTTCCCCAAGGGCTCGGACTCAGGAGTCCCAGATCTCCCTC-3' 5'-GCTTTCATGGTGTGGGCTAAGGACGAGCGCAAGCGGCTGGCGCAGCAGAATCCAGACCTGCACAACGCCGAGTTGAGCAAGATGCTGGGTGAGTCCGAGTCGCAGACCCAGGCGGCCGGGCGCGCTGGCGCGAATCGCTAGGCCGATTTCTTAAACCCCAAACTGTTCTTTGCGAGCCTGACGCCCAAAACCAGGGGTGTGTAGCGGCCACGTCCTTTCTTAAGGCTCTGGGTTCC [C] TTCCCGCTTCCCGCCCTCCGACCCTCCAAAGCAGCTTTCCGCCTTGCTCTCCGGCTCCCGGATTCCCCAGGTGGCCGGGGGCGCGGGTCCAACGGCTCTGGGAAGGCGACTTCCCGGCACCTCCGGGCGGCGCGAGAGCACCCTTGGCCCTGAACTGGGCCGGTTGTGTCCATCCCTCGACCCCTTCCCTAGTTAGGTGTCCTTTTCTGTTTTTCGAACGACCGGGTGATGGGTGAGCGGAAAGCCGCTTCCAGGAGACCAAAAGAAAGGGGTGCCTTTAGAGGACGGGTGTTCCCCAAGGGCTCGGACTCAGGAGTCCCAGATCTCCCTC- 3 ' 4141
rs9298506rs9298506 5'- AGGTGTACCAACCCCAGACACTGGCAGAACGCTCTCTTTATGTAAGACCTCAAAATCTTACTGGTTGGTGTCTGCTGACTTGTTTTTCTCTGTTATCTTGCCTGTCTGCAGTGACAAATTCAGTGCAGCTCTAACTCATGTGGACAGGGAGGAAATGATTCTAGGATTGAGGACTTAAGGGTGTCTGGAAGAGAAGAGAATTGTTTTGTTTTGTTTTGTTTTGTTAGTTGTTGTTTTCCTCAGACAGGACCTTGTCA [A] CGCTTTCAAATATGTAGGCTGTTTGCTGTTTCCTTTATGTTGGTCCCTGAGAAGGATCTGCCCTTCTACCCTGTTTCCCTGGGGGGTGTGGACAGAGCCTTTGTCTTTGGGGAAGGGGGTCATCTTGGGAAAAGGAGAACAGGGCATCCTGAGGACCTGCTCCGTCTAAGGAGAGAAAGCCGAACAGATGGCAGCTGCCACGCAGAGGGCACTTTGTAGGAACTCTGGCTGGAGCAGGCTTCCTGCGCTCCAATGCCAAATCCTTCCCTTC-3' 5'- AGGTGTACCAACCCCAGACACTGGCAGAACGCTCTCTTTATGTAAGACCTCAAAATCTTACTGGTTGGTGTCTGCTGACTTGTTTTTCTCTGTTATCTTGCCTGTCTGCAGTGACAAATTCAGTGCAGCTCTAACTCATGTGGACAGGGAGGAAATGATTCTAGGATTGAGGACTTAAGGGTGTCTGGAAGAGAAGAGAATTGTTTTGTTTTGTTTTGTTTTGTTAGTTGTTGTTTTCCTCAGACAGGACCTTGTCA [A] CGCTTTCAAATATGTAGGCTGTTTGCTGTTTCCTTTATGTTGGTCCCTGAGAAGGATCTGCCCTTCTACCCTGTTTCCCTGGGGGGTGTGGACAGAGCCTTTGTCTTTGGGGAAGGGGGTCATCTTGGGAAAAGGAGAACAGGGCATCCTGAGGACCTGCTCCGTCTAAGGAGAGAAAGCCGAACAGATGGCAGCTGCCACGCAGAGGGCACTTTGTAGGAACTCTGGCTGGAGCAGGCTTCCTGCGCTCCAATGCCAAATCCTTCCCTTC-3 ' 4242
5개의 SNP의 유전자형 분석(genotyping)을 위해, HiGeneTM Genomic DNA 프렙 키트(BIOFACT, 대전, 한국)를 이용하여, 피험자 559명의 말초 혈액으로부터 게놈 DNA를 추출하였다. 5개의 SNP 프라이머는 프라이머-3 v.0.4.0 프로그램(http://bioinfo.ut.ee/primer3-0.4.0/)을 사용하여 설계되었으며, 설계된 프라이머는 하기 표 6에 나타내었다.For genotyping of five SNPs, genomic DNA was extracted from peripheral blood of 559 subjects using a HiGene TM Genomic DNA preparation kit (BIOFACT, Daejeon, Korea). Five SNP primers were designed using the Primer-3 v.0.4.0 program (http://bioinfo.ut.ee/primer3-0.4.0/), and the designed primers are shown in Table 6 below.
SNPSNP 프라이머primer 서열order 서열번호Sequence number
rs1072737rs1072737 정방향
역방향
Forward direction
Reverse
5'-GACATGGTTTTGCCATGTTG-3'
5'-CAGCCTTATCTTTGTTTCTCTGG-3'
5'-GACATGGTTTTGCCATGTTG-3'
5'-CAGCCTTATCTTTGTTTCTCTGG-3'
43
44
43
44
rs1504749rs1504749 정방향
역방향
Forward direction
Reverse
5'-CGTGCTGGCAAACTTGAAAT-3'
5'-CCAATGACTCCCATATTGCTG-3'
5'-CGTGCTGGCAAACTTGAAAT-3'
5'-CCAATGACTCCCATATTGCTG-3'
45
46
45
46
rs10958409rs10958409 정방향
역방향
Forward direction
Reverse
5'-AAGTGATCCACCCACCTGAG-3'
5'-TCCATGATTCTGCGGTGTAA-3'
5'-AAGTGATCCACCCACCTGAG-3'
5'-TCCATGATTCTGCGGTGTAA-3'
47
48
47
48
rs12541742rs12541742 정방향
역방향
Forward direction
Reverse
5'-GCTTTCATGGTGTGGGCTA-3'
5'-GAGGGAGATCTGGGACTCCT-3'
5'-GCTTTCATGGTGTGGGCTA-3'
5'-GAGGGAGATCTGGGACTCCT-3'
49
50
49
50
rs9298506rs9298506 정방향
역방향
Forward direction
Reverse
5'-AGGTGTACCAACCCCAGACA-3'
5'-GAAGGGAAGGATTTGGCATT-3'
5'-AGGTGTACCAACCCCAGACA-3'
5'-GAAGGGAAGGATTTGGCATT-3'
51
52
51
52
상기 표 6의 프라이머와 SolgTM 2X Taq PCR Pre-Mix(Solgent, 대전, 한국)를 이용하여 중합효소 연쇄반응(PCR)을 수행하였다. 예비 변성은 95℃에서 5분간 수행되었고, 95℃에서 30초간 변성, 63℃에서 30초간 어닐링, 72℃에서 1분간 연장, 및 72℃에서 5분간 최종연장이 34사이클 수행되었다. 1.5% 아가로스 겔 전기 영동에 의해 증폭된 단편을 확인하고, SolgTM PCR 정제 키트(SolGent, 대전, 한국)로 정제한 후, ABI PRISM 3730XL 분석기(Applied Biosystems, 캘리포니아, USA)에 의해 각 서열을 분석하였다.Polymerase chain reaction (PCR) was performed using the primers of Table 6 and Solg TM 2X Taq PCR Pre-Mix (Solgent, Daejeon, Korea). Preliminary denaturation was performed at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 63°C for 30 seconds, extension at 72°C for 1 minute, and final extension at 72°C for 5 minutes were performed for 34 cycles. After confirming the fragment amplified by 1.5% agarose gel electrophoresis, and purified with Solg TM PCR purification kit (SolGent, Daejeon, Korea), each sequence was analyzed by ABI PRISM 3730XL analyzer (Applied Biosystems, California, USA). Analyzed.
실시예 3. 통계 분석Example 3. Statistical Analysis
연령, 성별, 고혈압, 당뇨, 고지혈증 및 흡연에 대한 뇌동맥류 환자군 187명과 대조군 372명과의 차이를 평가하기 위해 단변량 로지스틱 회귀 분석(Univariate logistic regression analysis)을 수행했다. 일반화된 선형 모델은 추가적 효과 상속 모델 하에서 뇌동맥류와 SOX17 유전자 다형성 사이의 유전 연관성을 평가하기 위해 수행되어 95% 신뢰구간(CI)과 대응비(OR)를 추정했다. 후속 분석에서 우리는 동맥류 파열에 따른 뇌동맥류 형성에 대한 SOX17의 유전적 효과를 분석했다. 설명적 및 단변량 분석을 Stata II.2(StataCorp LLC, College Station, 텍사스, 미국)를 사용하여 수행하였다. 유전자형 분류율(genotyping call rate, GCR), 마이너 대립유전자 빈도(MAF), 하디-바인버그 평형(Hardy Weinberg equilibrium, HWE) p값 및 쌍별 LD(pairwise LD)를 평가하기 위해, Haploview 4.2(https://www.broadinstitute.org/haploview/haploview)를 사용하여 SOX17 유전자 근처 또는 SOX17 유전자 상에 위치한 5개의 SNP에 대한 품질 관리 검정을 수행하였다. 유전자형 및 일배체형 연관성을 PLINK 프로그램 1.07(http://zzz.bwh.harvard.edu/plink/)을 사용하여 분석하였다.Univariate logistic regression analysis was performed to evaluate the difference between 187 patients with cerebral aneurysms and 372 controls for age, sex, hypertension, diabetes, hyperlipidemia, and smoking. A generalized linear model was performed to evaluate the genetic association between cerebral aneurysms and SOX17 gene polymorphism under an additional effect inheritance model to estimate a 95% confidence interval (CI) and correspondence ratio (OR). In a subsequent analysis, we analyzed the genetic effect of SOX17 on the formation of cerebral aneurysms following aneurysm rupture. Descriptive and univariate analyzes were performed using Stata II.2 (StataCorp LLC, College Station, Texas, USA). To evaluate genotyping call rate (GCR), minor allele frequency (MAF), Hardy Weinberg equilibrium (HWE) p-value, and pairwise LD (LD), Haploview 4.2 (https: //www.broadinstitute.org/haploview/haploview) was used to perform quality control assays for 5 SNPs located near or on the SOX17 gene. Genotype and haplotype associations were analyzed using the PLINK program 1.07 (http://zzz.bwh.harvard.edu/plink/).
실시예 4. 단일염기 다형성과 뇌동맥류와의 유전적 연관성의 검토Example 4. Examination of genetic association between monobasic polymorphism and cerebral aneurysm
품질 관리 검정 후, 상기 실시예 2에서 선택된 5개의 SNP 중 4개는 완전한 유전자형 분류율(GCR), 마이너 대립유전자 빈도(MAF)는 10% 초과, 하디-바인버그 평형(HWE) P값은 0.05 초과, 쌍별 연관불균형(LD)은 0.8 초과였다. SOX17 유전자의 인트론 영역에 위치한 rs12541742를 하디-바인버그 평형(HWE) 때문에 본 연관성 시험에서 제외하였다.After quality control assay, 4 out of the 5 SNPs selected in Example 2 had a complete genotype classification rate (GCR), a minor allele frequency (MAF) greater than 10%, and a Hardy-Weinberg equilibrium (HWE) P value of 0.05. The excess, pairwise linkage disequilibrium (LD) was greater than 0.8. Rs12541742, located in the intron region of the SOX17 gene, was excluded from this association test due to the Hardy-Weinberg equilibrium (HWE).
4개의 SNP 중 오직 1개의 SNP, 즉 SOX17 유전자의 5'-비번역 영역(5'-UTR)으로부터 약 41kb의 상류 영역에 위치한 rs1072737의 마이너 C 대립유전자만이 뇌동맥류와 통계적으로 유의한 연관성을 보였다(OR = 0.69, 95% CI = 0.49-0. 96, P = 0.03) (도 8). 이 변종은 유럽인 조상 집단을 포함하는 디전 연구와 비교하여 반대 효과 크기를 나타냈다(각각, OR = 0.69 및 OR = 1.02). 후속 분석에서 4개의 SNP 중 뇌동맥류 파열과 관련된 SNP는 없었다(P > 0.2, 도 9).Of the four SNPs, only one SNP, that is, the minor C allele of rs1072737 located approximately 41 kb upstream from the 5'-untranslated region (5'-UTR) of the SOX17 gene, had a statistically significant association with cerebral aneurysms. (OR = 0.69, 95% CI = 0.49-0.96, P = 0.03) (Fig. 8). This variant exhibited opposite effect sizes compared to the Dijon study involving the European ancestral population (OR = 0.69 and OR = 1.02, respectively). In the subsequent analysis, there was no SNP associated with cerebral aneurysm rupture among the 4 SNPs (P> 0.2, Fig. 9).
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.From the above description, those skilled in the art to which the present invention pertains will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts are included in the scope of the present invention.
<110> Industry Academic Cooperation Foundation, Hallym University <120> SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene <130> 11 <160> 52 <170> KoPatentIn 3.0 <210> 1 <211> 51 <212> DNA <213> Homo sapiens <400> 1 ccttgagtat ctgctccatc actggygacg ccacaggtag gtgtgaatgg a 51 <210> 2 <211> 51 <212> DNA <213> Homo sapiens <400> 2 tgcttcagaa actgaccagt agcacygatg tacaatcttg atcgcatggg c 51 <210> 3 <211> 51 <212> DNA <213> Homo sapiens <400> 3 cctccagctg ctgcagaagg atgccrccgc cgcccctgcc acccctgcca c 51 <210> 4 <211> 51 <212> DNA <213> Homo sapiens <400> 4 ttgtggttca gtcttaaaga ttcttrcccg gatgcagcat attttactcc a 51 <210> 5 <211> 51 <212> DNA <213> Homo sapiens <400> 5 ttcacaagtc ggacatctgt atatcytagg aggagacaag gccatagaag a 51 <210> 6 <211> 51 <212> DNA <213> Homo sapiens <400> 6 gaatccacgt tgaaaaatct gtccarggct cacccagtat caacaatagt g 51 <210> 7 <211> 51 <212> DNA <213> Homo sapiens <400> 7 atatctttct gtgcctttat ttattytgca tatgttaaaa gtggatgagg c 51 <210> 8 <211> 51 <212> DNA <213> Homo sapiens <400> 8 ttcaggaggt ccccgaggac atcccrgcca acaccgtgct cctgaagctc g 51 <210> 9 <211> 51 <212> DNA <213> Homo sapiens <400> 9 tattgaacag atagaacaaa cgggcygcgc tgcccacacc accgcttctc t 51 <210> 10 <211> 51 <212> DNA <213> Homo sapiens <400> 10 gaggcccgag aaccaggcac gccgaygaca gcacacttcc agcctgagag c 51 <210> 11 <211> 51 <212> DNA <213> Homo sapiens <400> 11 acagagaaaa tgtgggaggc aatacrgtga cagtggtgta attaaaatgt t 51 <210> 12 <211> 51 <212> DNA <213> Homo sapiens <400> 12 aagttttgac tattctactg gcctgrattt atctaacttg tgttgtactt t 51 <210> 13 <211> 51 <212> DNA <213> Homo sapiens <400> 13 ctcagtctca gggggactgg gaagarggaa ggacaaaagg atggtggccc t 51 <210> 14 <211> 504 <212> DNA <213> Homo sapiens <400> 14 tacgcatgat gtcctgtgta gcgaatgtca cagcgcacaa cattgttggt atagtcagat 60 tcaggaacca ggtagctggg gtttacactg acctgggcaa cacaaagagt tcctcagtat 120 ttctttttcc atagggctac aataaggaaa ttgttaatga ggacttagct aaatcaagca 180 gggaagggat tttaacttaa gtaagtggtt aaactctgga gacgttatgg aaagagactg 240 catattttcc cctgaagttc tttaaaataa gacagattag attagattag attgtttata 300 aatagtttga ggatgtataa ttgcttccaa taccatgatt atttaacatt tgaatccaga 360 gaagagggcc tattgatctg caatatcaat atatgatata ttttcaaagg tctttacctt 420 taggatatag tttccaggtt ttacatctgt aatatcaatc cactggcagt ctatgtctgc 480 accataggta tcataacagc cagg 504 <210> 15 <211> 815 <212> DNA <213> Homo sapiens <400> 15 gagcatgcaa cctaaatccc tcatatgcac agttcacaat ggggttcacg ctcatatgag 60 aatctaatgc catgattgat ctgacaggaa gcaaagctca ggtggtaatg tgaggaaaga 120 ggatcttggt aaacatgcta ttgtaagttt aatgtctcta ctccccttcc gagaacccca 180 tgtctcctta ctgggaaact tcaagtcaaa tggttttagg atttactgac agaggttact 240 tgctagtatg aatttgagaa attcatggga ggtacctcac caggaaccca aaaaatggaa 300 tttttgacgt ggggagtgtc tgtaaataca gatgaagctt cacttgctgg cccactgctc 360 acctcctgct gtgcagccca gttcctaaca gggatggtac tggtccgtgt cctggggttt 420 gggaaccact ggtttattga aaagacattc tgctgggttg gtatggagcc caagttatat 480 ttgggttaca cattagggac tacttcttgt gattttgagc ctaaattata ataaactcta 540 gatatacaca ccctatgcct atcagaatag taatgaaggg gtaaatggcc cccaacacaa 600 gtggcaatgg tttttggaat aataccaaaa gccaacgaaa tgtgatggag atttactgaa 660 gctaagcatt aattttgggg ataggatgtt ctcgatgtag gcctagatgt atgcagcatc 720 gtgtaaggct atctattaaa gaagtctaaa aaattcactt gtgatattga gtcataaagt 780 tggtttttaa tccattctca acagactctc aattt 815 <210> 16 <211> 603 <212> DNA <213> Homo sapiens <400> 16 tctagctcag ggcatcaaca aacagtacaa aaatgagagt gcaaatgaat aaataaatgg 60 agaatggatg aataaattaa ggaattataa aaattaagaa aaaactaatc tgtttattta 120 agtgcaaatt attttagctt aaattataat ggtgttctgg cggtgggggt cgggggttgg 180 ttctactata accaactcca cacaatatgg gccataaaac ctgccaggtt ttctgtgctg 240 tgggcatgtt cagaagaatg tatgtgactc tgttttttca gtgctatcct tttgctatca 300 caggcttcat ctatctctaa tgttgtgaca acacttgtaa agcacagtct ctgcttcttt 360 atgtagaaag tcctgggttt ttgtatcagg cagaaatttc tattaattat gagattctag 420 tatagctctg ctatacctgt ctgtatgatc cagtggcact ggtggttctc cagtgacaaa 480 gcaaagctga tgagtgttga gtatcattcc aatggaaata gtattctcat tgttgggaag 540 gcataactca agtggcatat gtaattataa tctagcaccc agcaacactt ggggaggtag 600 tgc 603 <210> 17 <211> 696 <212> DNA <213> Homo sapiens <400> 17 aataggcaga aactggacca aagctaatca atcaaatatt actgtcttta aatgtgacca 60 tagatcttca tgtaaggaag tgaaaattca cttattcaaa tcataaacta ccaatttcca 120 aacagtaaat tctgtgagga gaaaaaaaaa aacttacata gtatcttata actgaaagaa 180 gcctcagagt cacctggtcc gtacattttg tttcagtgag gaaaatgaag gagagagggt 240 acattaacag cacataccta ttcaactatt tactgggtgg cttttacaca tcaacagaat 300 gctcttaaat atctggcagg aaaagcaatc agtgaactga tacatgatat gtcttcagag 360 tcacactcac tgctgcttac acagccacca gactgacctg atggccttag gcaagttaca 420 cttcctgctc aaaaagcttc agcctcccac tgcctccaga ataaatttta gcctgctctt 480 cagggctgtc ttccatctgg ctcaacttac ttttccatcc tttttgtcca actcgtaact 540 ccacaaaatt cbatgcttta gccaaactag aagacttgtt tttccaaaca tgccctgcag 600 tttcctcctg ccatgcaagt tgcctgtgac gttgacttgc cctgggcttc ctttccttaa 660 tgctccccgg tgcattcccc agacttcaag gctcaa 696 <210> 18 <211> 549 <212> DNA <213> Homo sapiens <400> 18 ctacatgagg ggctattatc tccattttat agatgagaaa actaaggcac actaagatca 60 aataacttac ccaagggtat ccagcctagt aagtggctaa gctggttttg agtttaggta 120 atcaaggtcc agagtccctg ttcttaacta ccccactata ctctctctca tacagtcact 180 gaaatatgac atattttgtt gaaggggtaa atgcatgact aaattgatga atgccacatc 240 actccacttg ctaaaatatt cacatcaata agtaaatgaa tgccttctac aggctgggag 300 gagaaaaata taacaaatac aatccttgct tttaagaatg ttatagtcta gagaagtttc 360 ctcagattgg agtctgtagg tatattcttg attccattag ttcttcacaa aaagttttaa 420 cttgtatttt tattctaata gtaatttaaa ttcaaagtac atgctagatt cattttaact 480 caatactgcc attcaattct agcaaccaat attgctttgc tgtttaagat cactttggtc 540 acccaagag 549 <210> 19 <211> 706 <212> DNA <213> Homo sapiens <400> 19 ccgggactgc aaagcaatgt gaaaaggaag caggaggggc cagacgcgcg gtttgcactg 60 gattccaggg ctgccactgc aggcgcgtgg gggagggatc ggatctgcga ggaccggggc 120 ccgccgcgcc caggcagcca cgtcgagaag ccacatagct ggggaccagg tgcacgggtg 180 cttccagcgg acttgggggt acttaccgta ctggaagtag ccagtgccgt atccgggccg 240 gtacctgccc ccaggtctgg gcctttcata agtatcgtag tagttgtaat aagggttgtc 300 gtcagagtac ttgtaggggt tgtaagggtc gtcgcccacc atgccgtcca cgcggctggg 360 cggccgcagg ttactgagcg caggaacttc tcccggcgct gtctggttct ccgcgcgcga 420 ggcgccagct tcgcgggctc tagatgtcga gtagccagct tggaaccagt gacgggcggt 480 gggcctgggg cggccagcgg tgactccaga tgagccggcc gtccgcgttc gcgccgcggc 540 ggtgcggttg tcgcggatca gcaggatcgg agtgcggggc tgctgggcgg aggcgttggc 600 tgcaccaggg acggcggcgc ccgggtcccg gcggcgctga ggctggtact gtgagcccag 660 gctcagcaag ctgaacacct gcccgttgtt ctcccattgg atctgc 706 <210> 20 <211> 505 <212> DNA <213> Homo sapiens <400> 20 gatctgggcg ggagtcaaat tataatgtcc ttttacaaat tagggtttca tatggaaata 60 ctgacataga ttttaactga cacgcatttt ccaatgataa aacatgcaaa ctgcttagtt 120 cagcactact ttaaaaaaat ccatccaaac aacatctgac atcaattata ctgtagattt 180 aaatatatat gtgtggagaa agaaatggtg tccttctgct cttatttgca ttattaaaag 240 aggcaacttt ttaaagtgct tttaaagaaa cttatttttc ctccatttgc taaccgcaac 300 cactattcta ttttcagcat aaaacagaag gaaggaatgg tttcacaggt gaaaaaacag 360 agatatcttt ttttacagtt atttactaag ccggttaagg aatacagaat gggtgcatat 420 gttgtcaacc attcagactt tttcagagag taaatttttg ttcttcattg tggactgtaa 480 caaggaccca cactgacctg tgatc 505 <210> 21 <211> 698 <212> DNA <213> Homo sapiens <400> 21 ctaccctttg tcacacatgc taatgaaaag cttagttgat tttcactctc cttcatttcc 60 tctaaaatct ctctggctta ggactctgtc agctgaaaaa caaacatgtg gctaccacat 120 ttggggacaa tacagtgttt gcaagccctg cgggagataa tctagccaca cattgtgttc 180 cctgttcaat aacaaaacta ttattcacaa aattggagaa accatagttc ctttccactc 240 aaatctgaga tgataatgat gatgacaata ataataataa gccacggcta catcaagata 300 caaacagctt tttttgcttt gataagatcc acagctgatt tcacttttga ccatgagatt 360 ttcttctcgt gaacaattct gcagtatgtg ccataagaga agggaaggaa tgttgctaat 420 tctttttttg agtttctagc ccatcaatat caaatcttta aatggcaatg tctggcccat 480 tggccaagaa atgaaagttg ttgtaatgct atgttcctgg tatttgttaa atacatttat 540 ttttgtagga catttcacat aaatggaaaa cagaaagccg aaaccataaa gcagggcctc 600 tgaattgcag aagccagaac agtaatgcca cattcaaagc aatcaggttc aagtgtaaat 660 tcttttgttt gaggctcaag aagctcatac aaagcttg 698 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 22 cgcatgatgt cctgtgtagc 20 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 23 tggctgttat gatacctatg gtg 23 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 24 catgcaacct aaatccctca t 21 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 25 ttgagagtct gttgagaatg ga 22 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 26 agctcagggc atcaacaaac 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 27 ctacctcccc aagtgttgct 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 28 aggcagaaac tggaccaaag 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 29 agccttgaag tctggggaat 20 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 30 catgaggggc tattatctcc a 21 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 31 ttgggtgacc aaagtgatct t 21 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 32 ggactgcaaa gcaatgtgaa 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 33 gatccaatgg gagaacaacg 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 34 ctgggcggga gtcaaattat 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 35 cacaggtcag tgtgggtcct 20 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 36 ccctttgtca cacatgctaa tg 22 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 37 gctttgtatg agcttcttga gc 22 <210> 38 <211> 573 <212> DNA <213> Homo sapiens <400> 38 gacatggttt tgccatgttg gcccggctgg tatcaaactc ctggcctcag gtgatccacc 60 tgcctcggcc tcccaaagtg ctgggattat aggcgtgagc caccgtggct taacctaaac 120 ttctagatat gaaaactata atgtctgagg tgaaaaatag actggaggaa gaaaaaggca 180 gattggacat tgtagaagaa aggcgagatc agtgaaatta aaagtgtggc aatgaaaact 240 acccaaaata aaacacgcag aaaataaaat tccaaaaaat gaaaaagcat aagtgatatg 300 tgggatagtt tcagtggcct aatacatgag taactggagt ccctgaagaa gaaagactga 360 aaaatatatt tttagaaata atggctgaaa aatttccaaa cttagtgaag ctataaacct 420 acagatctaa gctcaatgaa caccaagaaa aataaacatg aaaataacta ccccaaatta 480 cagcataagt tactaaaaaa caatgacaaa gagaaaaatc tgacagccag aaaatatacc 540 cgtattacat ccagagaaac aaagataagg ctg 573 <210> 39 <211> 494 <212> DNA <213> Homo sapiens <400> 39 cgtgctggca aacttgaaat ctgatgaacc cactaccttc actacactca ctgtctggtc 60 tctctcaggt agctgaggac tgagaaacac cccagccagg caggttgggg tcactataaa 120 ttcacagtca ccaaccacac atggtgctct gtttggctgg ccatctcatt atacctgtct 180 gacttgctta ctgtcctgcc ctccgaaaaa gcttttcaaa cactatctcc ttctgcctca 240 aatgtatcac ctccccctca atgactttgc ttcatatgtg acacaaagaa atgttaatac 300 cagccaagac cttcctcaac ttccggccag caaatctgga acacaagctg catctgtcct 360 ggtttgcctc ttctctcttc tcgttacagt agagtagcca ttcctcttct aaaaaacact 420 gatctcccat cctgctctgg acattaaagt actgagaagt ggttttgtgt tcccagcaat 480 atgggagtca ttgg 494 <210> 40 <211> 450 <212> DNA <213> Homo sapiens <400> 40 aagtgatcca cccacctgag cctcccaaag ttctgggatt acaggcttga gccactgcgc 60 ccagctataa ccttcacgtt caaagcactc tcccatctat tattaaggcc tctgagaaaa 120 tctccttttt atatatattc tcaagtcaga attattagtc tccatctttc atcttagtct 180 tcttcaaata ccaaactctt tactaagcag ttagacacaa gtagtttcac cagttctatc 240 actcaaatac ggtttcataa gttctgccta gtgattgccc atcagagggg atatggattt 300 gtgggcagga aatagaatag aaacctaact ctaactcttc tgtgaaatgt agtgtttagg 360 ttaatattct tccttaactg ccatctgctt ttttttgttt gtttaacact ttgtccaaat 420 ctctcaaacc ttacaccgca gaatcatgga 450 <210> 41 <211> 568 <212> DNA <213> Homo sapiens <400> 41 gctttcatgg tgtgggctaa ggacgagcgc aagcggctgg cgcagcagaa tccagacctg 60 cacaacgccg agttgagcaa gatgctgggt gagtccgagt cgcagaccca ggcggccggg 120 cgcgctggcg cgaatcgcta ggccgatttc ttaaacccca aactgttctt tgcgagcctg 180 acgcccaaaa ccaggggtgt gtagcggcca cgtcctttct taaggctctg ggttcccttc 240 ccgcttcccg ccctccgacc ctccaaagca gctttccgcc ttgctctccg gctcccggat 300 tccccaggtg gccgggggcg cgggtccaac ggctctggga aggcgacttc ccggcacctc 360 cgggcggcgc gagagcaccc ttggccctga actgggccgg ttgtgtccat ccctcgaccc 420 cttccctagt taggtgtcct tttctgtttt tcgaacgacc gggtgatggg tgagcggaaa 480 gccgcttcca ggagaccaaa agaaaggggt gcctttagag gacgggtgtt ccccaagggc 540 tcggactcag gagtcccaga tctccctc 568 <210> 42 <211> 529 <212> DNA <213> Homo sapiens <400> 42 aggtgtacca accccagaca ctggcagaac gctctcttta tgtaagacct caaaatctta 60 ctggttggtg tctgctgact tgtttttctc tgttatcttg cctgtctgca gtgacaaatt 120 cagtgcagct ctaactcatg tggacaggga ggaaatgatt ctaggattga ggacttaagg 180 gtgtctggaa gagaagagaa ttgttttgtt ttgttttgtt ttgttagttg ttgttttcct 240 cagacaggac cttgtcaacg ctttcaaata tgtaggctgt ttgctgtttc ctttatgttg 300 gtccctgaga aggatctgcc cttctaccct gtttccctgg ggggtgtgga cagagccttt 360 gtctttgggg aagggggtca tcttgggaaa aggagaacag ggcatcctga ggacctgctc 420 cgtctaagga gagaaagccg aacagatggc agctgccacg cagagggcac tttgtaggaa 480 ctctggctgg agcaggcttc ctgcgctcca atgccaaatc cttcccttc 529 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 43 gacatggttt tgccatgttg 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 44 cagccttatc tttgtttctc tgg 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 45 cgtgctggca aacttgaaat 20 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 46 ccaatgactc ccatattgct g 21 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 47 aagtgatcca cccacctgag 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 48 tccatgattc tgcggtgtaa 20 <210> 49 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 49 gctttcatgg tgtgggcta 19 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 50 gagggagatc tgggactcct 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 51 aggtgtacca accccagaca 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 52 gaagggaagg atttggcatt 20 <110> Industry Academic Cooperation Foundation, Hallym University <120> SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene <130> 11 <160> 52 <170> KoPatentIn 3.0 <210> 1 <211> 51 <212> DNA <213> Homo sapiens <400> 1 ccttgagtat ctgctccatc actggygacg ccacaggtag gtgtgaatgg a 51 <210> 2 <211> 51 <212> DNA <213> Homo sapiens <400> 2 tgcttcagaa actgaccagt agcacygatg tacaatcttg atcgcatggg c 51 <210> 3 <211> 51 <212> DNA <213> Homo sapiens <400> 3 cctccagctg ctgcagaagg atgccrccgc cgcccctgcc acccctgcca c 51 <210> 4 <211> 51 <212> DNA <213> Homo sapiens <400> 4 ttgtggttca gtcttaaaga ttcttrcccg gatgcagcat attttactcc a 51 <210> 5 <211> 51 <212> DNA <213> Homo sapiens <400> 5 ttcacaagtc ggacatctgt atatcytagg aggagacaag gccatagaag a 51 <210> 6 <211> 51 <212> DNA <213> Homo sapiens <400> 6 gaatccacgt tgaaaaatct gtccarggct cacccagtat caacaatagt g 51 <210> 7 <211> 51 <212> DNA <213> Homo sapiens <400> 7 atatctttct gtgcctttat ttattytgca tatgttaaaa gtggatgagg c 51 <210> 8 <211> 51 <212> DNA <213> Homo sapiens <400> 8 ttcaggaggt ccccgaggac atcccrgcca acaccgtgct cctgaagctc g 51 <210> 9 <211> 51 <212> DNA <213> Homo sapiens <400> 9 tattgaacag atagaacaaa cgggcygcgc tgcccacacc accgcttctc t 51 <210> 10 <211> 51 <212> DNA <213> Homo sapiens <400> 10 gaggcccgag aaccaggcac gccgaygaca gcacacttcc agcctgagag c 51 <210> 11 <211> 51 <212> DNA <213> Homo sapiens <400> 11 acagagaaaa tgtgggaggc aatacrgtga cagtggtgta attaaaatgt t 51 <210> 12 <211> 51 <212> DNA <213> Homo sapiens <400> 12 aagttttgac tattctactg gcctgrattt atctaacttg tgttgtactt t 51 <210> 13 <211> 51 <212> DNA <213> Homo sapiens <400> 13 ctcagtctca gggggactgg gaagarggaa ggacaaaagg atggtggccc t 51 <210> 14 <211> 504 <212> DNA <213> Homo sapiens <400> 14 tacgcatgat gtcctgtgta gcgaatgtca cagcgcacaa cattgttggt atagtcagat 60 tcaggaacca ggtagctggg gtttacactg acctgggcaa cacaaagagt tcctcagtat 120 ttctttttcc atagggctac aataaggaaa ttgttaatga ggacttagct aaatcaagca 180 gggaagggat tttaacttaa gtaagtggtt aaactctgga gacgttatgg aaagagactg 240 catattttcc cctgaagttc tttaaaataa gacagattag attagattag attgtttata 300 aatagtttga ggatgtataa ttgcttccaa taccatgatt atttaacatt tgaatccaga 360 gaagagggcc tattgatctg caatatcaat atatgatata ttttcaaagg tctttacctt 420 taggatatag tttccaggtt ttacatctgt aatatcaatc cactggcagt ctatgtctgc 480 accataggta tcataacagc cagg 504 <210> 15 <211> 815 <212> DNA <213> Homo sapiens <400> 15 gagcatgcaa cctaaatccc tcatatgcac agttcacaat ggggttcacg ctcatatgag 60 aatctaatgc catgattgat ctgacaggaa gcaaagctca ggtggtaatg tgaggaaaga 120 ggatcttggt aaacatgcta ttgtaagttt aatgtctcta ctccccttcc gagaacccca 180 tgtctcctta ctgggaaact tcaagtcaaa tggttttagg atttactgac agaggttact 240 tgctagtatg aatttgagaa attcatggga ggtacctcac caggaaccca aaaaatggaa 300 tttttgacgt ggggagtgtc tgtaaataca gatgaagctt cacttgctgg cccactgctc 360 acctcctgct gtgcagccca gttcctaaca gggatggtac tggtccgtgt cctggggttt 420 gggaaccact ggtttattga aaagacattc tgctgggttg gtatggagcc caagttatat 480 ttgggttaca cattagggac tacttcttgt gattttgagc ctaaattata ataaactcta 540 gatatacaca ccctatgcct atcagaatag taatgaaggg gtaaatggcc cccaacacaa 600 gtggcaatgg tttttggaat aataccaaaa gccaacgaaa tgtgatggag atttactgaa 660 gctaagcatt aattttgggg ataggatgtt ctcgatgtag gcctagatgt atgcagcatc 720 gtgtaaggct atctattaaa gaagtctaaa aaattcactt gtgatattga gtcataaagt 780 tggtttttaa tccattctca acagactctc aattt 815 <210> 16 <211> 603 <212> DNA <213> Homo sapiens <400> 16 tctagctcag ggcatcaaca aacagtacaa aaatgagagt gcaaatgaat aaataaatgg 60 agaatggatg aataaattaa ggaattataa aaattaagaa aaaactaatc tgtttattta 120 agtgcaaatt attttagctt aaattataat ggtgttctgg cggtgggggt cgggggttgg 180 ttctactata accaactcca cacaatatgg gccataaaac ctgccaggtt ttctgtgctg 240 tgggcatgtt cagaagaatg tatgtgactc tgttttttca gtgctatcct tttgctatca 300 caggcttcat ctatctctaa tgttgtgaca acacttgtaa agcacagtct ctgcttcttt 360 atgtagaaag tcctgggttt ttgtatcagg cagaaatttc tattaattat gagattctag 420 tatagctctg ctatacctgt ctgtatgatc cagtggcact ggtggttctc cagtgacaaa 480 gcaaagctga tgagtgttga gtatcattcc aatggaaata gtattctcat tgttgggaag 540 gcataactca agtggcatat gtaattataa tctagcaccc agcaacactt ggggaggtag 600 tgc 603 <210> 17 <211> 696 <212> DNA <213> Homo sapiens <400> 17 aataggcaga aactggacca aagctaatca atcaaatatt actgtcttta aatgtgacca 60 tagatcttca tgtaaggaag tgaaaattca cttattcaaa tcataaacta ccaatttcca 120 aacagtaaat tctgtgagga gaaaaaaaaa aacttacata gtatcttata actgaaagaa 180 gcctcagagt cacctggtcc gtacattttg tttcagtgag gaaaatgaag gagagagggt 240 acattaacag cacataccta ttcaactatt tactgggtgg cttttacaca tcaacagaat 300 gctcttaaat atctggcagg aaaagcaatc agtgaactga tacatgatat gtcttcagag 360 tcacactcac tgctgcttac acagccacca gactgacctg atggccttag gcaagttaca 420 cttcctgctc aaaaagcttc agcctcccac tgcctccaga ataaatttta gcctgctctt 480 cagggctgtc ttccatctgg ctcaacttac ttttccatcc tttttgtcca actcgtaact 540 ccacaaaatt cbatgcttta gccaaactag aagacttgtt tttccaaaca tgccctgcag 600 tttcctcctg ccatgcaagt tgcctgtgac gttgacttgc cctgggcttc ctttccttaa 660 tgctccccgg tgcattcccc agacttcaag gctcaa 696 <210> 18 <211> 549 <212> DNA <213> Homo sapiens <400> 18 ctacatgagg ggctattatc tccattttat agatgagaaa actaaggcac actaagatca 60 aataacttac ccaagggtat ccagcctagt aagtggctaa gctggttttg agtttaggta 120 atcaaggtcc agagtccctg ttcttaacta ccccactata ctctctctca tacagtcact 180 gaaatatgac atattttgtt gaaggggtaa atgcatgact aaattgatga atgccacatc 240 actccacttg ctaaaatatt cacatcaata agtaaatgaa tgccttctac aggctgggag 300 gagaaaaata taacaaatac aatccttgct tttaagaatg ttatagtcta gagaagtttc 360 ctcagattgg agtctgtagg tatattcttg attccattag ttcttcacaa aaagttttaa 420 cttgtatttt tattctaata gtaatttaaa ttcaaagtac atgctagatt cattttaact 480 caatactgcc attcaattct agcaaccaat attgctttgc tgtttaagat cactttggtc 540 acccaagag 549 <210> 19 <211> 706 <212> DNA <213> Homo sapiens <400> 19 ccgggactgc aaagcaatgt gaaaaggaag caggaggggc cagacgcgcg gtttgcactg 60 gattccaggg ctgccactgc aggcgcgtgg gggagggatc ggatctgcga ggaccggggc 120 ccgccgcgcc caggcagcca cgtcgagaag ccacatagct ggggaccagg tgcacgggtg 180 cttccagcgg acttgggggt acttaccgta ctggaagtag ccagtgccgt atccgggccg 240 gtacctgccc ccaggtctgg gcctttcata agtatcgtag tagttgtaat aagggttgtc 300 gtcagagtac ttgtaggggt tgtaagggtc gtcgcccacc atgccgtcca cgcggctggg 360 cggccgcagg ttactgagcg caggaacttc tcccggcgct gtctggttct ccgcgcgcga 420 ggcgccagct tcgcgggctc tagatgtcga gtagccagct tggaaccagt gacgggcggt 480 gggcctgggg cggccagcgg tgactccaga tgagccggcc gtccgcgttc gcgccgcggc 540 ggtgcggttg tcgcggatca gcaggatcgg agtgcggggc tgctgggcgg aggcgttggc 600 tgcaccaggg acggcggcgc ccgggtcccg gcggcgctga ggctggtact gtgagcccag 660 gctcagcaag ctgaacacct gcccgttgtt ctcccattgg atctgc 706 <210> 20 <211> 505 <212> DNA <213> Homo sapiens <400> 20 gatctgggcg ggagtcaaat tataatgtcc ttttacaaat tagggtttca tatggaaata 60 ctgacataga ttttaactga cacgcatttt ccaatgataa aacatgcaaa ctgcttagtt 120 cagcactact ttaaaaaaat ccatccaaac aacatctgac atcaattata ctgtagattt 180 aaatatatat gtgtggagaa agaaatggtg tccttctgct cttatttgca ttattaaaag 240 aggcaacttt ttaaagtgct tttaaagaaa cttatttttc ctccatttgc taaccgcaac 300 cactattcta ttttcagcat aaaacagaag gaaggaatgg tttcacaggt gaaaaaacag 360 agatatcttt ttttacagtt atttactaag ccggttaagg aatacagaat gggtgcatat 420 gttgtcaacc attcagactt tttcagagag taaatttttg ttcttcattg tggactgtaa 480 caaggaccca cactgacctg tgatc 505 <210> 21 <211> 698 <212> DNA <213> Homo sapiens <400> 21 ctaccctttg tcacacatgc taatgaaaag cttagttgat tttcactctc cttcatttcc 60 tctaaaatct ctctggctta ggactctgtc agctgaaaaa caaacatgtg gctaccacat 120 ttggggacaa tacagtgttt gcaagccctg cgggagataa tctagccaca cattgtgttc 180 cctgttcaat aacaaaacta ttattcacaa aattggagaa accatagttc ctttccactc 240 aaatctgaga tgataatgat gatgacaata ataataataa gccacggcta catcaagata 300 caaacagctt tttttgcttt gataagatcc acagctgatt tcacttttga ccatgagatt 360 ttcttctcgt gaacaattct gcagtatgtg ccataagaga agggaaggaa tgttgctaat 420 tctttttttg agtttctagc ccatcaatat caaatcttta aatggcaatg tctggcccat 480 tggccaagaa atgaaagttg ttgtaatgct atgttcctgg tatttgttaa atacatttat 540 ttttgtagga catttcacat aaatggaaaa cagaaagccg aaaccataaa gcagggcctc 600 tgaattgcag aagccagaac agtaatgcca cattcaaagc aatcaggttc aagtgtaaat 660 tcttttgttt gaggctcaag aagctcatac aaagcttg 698 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 22 cgcatgatgt cctgtgtagc 20 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 23 tggctgttat gatacctatg gtg 23 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 24 catgcaacct aaatccctca t 21 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 25 ttgagagtct gttgagaatg ga 22 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 26 agctcagggc atcaacaaac 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 27 ctacctcccc aagtgttgct 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 28 aggcagaaac tggaccaaag 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 29 agccttgaag tctggggaat 20 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 30 catgaggggc tattatctcc a 21 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 31 ttgggtgacc aaagtgatct t 21 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 32 ggactgcaaa gcaatgtgaa 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 33 gatccaatgg gagaacaacg 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 34 ctgggcggga gtcaaattat 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 35 cacaggtcag tgtgggtcct 20 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 36 ccctttgtca cacatgctaa tg 22 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 37 gctttgtatg agcttcttga gc 22 <210> 38 <211> 573 <212> DNA <213> Homo sapiens <400> 38 gacatggttt tgccatgttg gcccggctgg tatcaaactc ctggcctcag gtgatccacc 60 tgcctcggcc tcccaaagtg ctgggattat aggcgtgagc caccgtggct taacctaaac 120 ttctagatat gaaaactata atgtctgagg tgaaaaatag actggaggaa gaaaaaggca 180 gattggacat tgtagaagaa aggcgagatc agtgaaatta aaagtgtggc aatgaaaact 240 acccaaaata aaacacgcag aaaataaaat tccaaaaaat gaaaaagcat aagtgatatg 300 tgggatagtt tcagtggcct aatacatgag taactggagt ccctgaagaa gaaagactga 360 aaaatatatt tttagaaata atggctgaaa aatttccaaa cttagtgaag ctataaacct 420 acagatctaa gctcaatgaa caccaagaaa aataaacatg aaaataacta ccccaaatta 480 cagcataagt tactaaaaaa caatgacaaa gagaaaaatc tgacagccag aaaatatacc 540 cgtattacat ccagagaaac aaagataagg ctg 573 <210> 39 <211> 494 <212> DNA <213> Homo sapiens <400> 39 cgtgctggca aacttgaaat ctgatgaacc cactaccttc actacactca ctgtctggtc 60 tctctcaggt agctgaggac tgagaaacac cccagccagg caggttgggg tcactataaa 120 ttcacagtca ccaaccacac atggtgctct gtttggctgg ccatctcatt atacctgtct 180 gacttgctta ctgtcctgcc ctccgaaaaa gcttttcaaa cactatctcc ttctgcctca 240 aatgtatcac ctccccctca atgactttgc ttcatatgtg acacaaagaa atgttaatac 300 cagccaagac cttcctcaac ttccggccag caaatctgga acacaagctg catctgtcct 360 ggtttgcctc ttctctcttc tcgttacagt agagtagcca ttcctcttct aaaaaacact 420 gatctcccat cctgctctgg acattaaagt actgagaagt ggttttgtgt tcccagcaat 480 atgggagtca ttgg 494 <210> 40 <211> 450 <212> DNA <213> Homo sapiens <400> 40 aagtgatcca cccacctgag cctcccaaag ttctgggatt acaggcttga gccactgcgc 60 ccagctataa ccttcacgtt caaagcactc tcccatctat tattaaggcc tctgagaaaa 120 tctccttttt atatatattc tcaagtcaga attattagtc tccatctttc atcttagtct 180 tcttcaaata ccaaactctt tactaagcag ttagacacaa gtagtttcac cagttctatc 240 actcaaatac ggtttcataa gttctgccta gtgattgccc atcagagggg atatggattt 300 gtgggcagga aatagaatag aaacctaact ctaactcttc tgtgaaatgt agtgtttagg 360 ttaatattct tccttaactg ccatctgctt ttttttgttt gtttaacact ttgtccaaat 420 ctctcaaacc ttacaccgca gaatcatgga 450 <210> 41 <211> 568 <212> DNA <213> Homo sapiens <400> 41 gctttcatgg tgtgggctaa ggacgagcgc aagcggctgg cgcagcagaa tccagacctg 60 cacaacgccg agttgagcaa gatgctgggt gagtccgagt cgcagaccca ggcggccggg 120 cgcgctggcg cgaatcgcta ggccgatttc ttaaacccca aactgttctt tgcgagcctg 180 acgcccaaaa ccaggggtgt gtagcggcca cgtcctttct taaggctctg ggttcccttc 240 ccgcttcccg ccctccgacc ctccaaagca gctttccgcc ttgctctccg gctcccggat 300 tccccaggtg gccgggggcg cgggtccaac ggctctggga aggcgacttc ccggcacctc 360 cgggcggcgc gagagcaccc ttggccctga actgggccgg ttgtgtccat ccctcgaccc 420 cttccctagt taggtgtcct tttctgtttt tcgaacgacc gggtgatggg tgagcggaaa 480 gccgcttcca ggagaccaaa agaaaggggt gcctttagag gacgggtgtt ccccaagggc 540 tcggactcag gagtcccaga tctccctc 568 <210> 42 <211> 529 <212> DNA <213> Homo sapiens <400> 42 aggtgtacca accccagaca ctggcagaac gctctcttta tgtaagacct caaaatctta 60 ctggttggtg tctgctgact tgtttttctc tgttatcttg cctgtctgca gtgacaaatt 120 cagtgcagct ctaactcatg tggacaggga ggaaatgatt ctaggattga ggacttaagg 180 gtgtctggaa gagaagagaa ttgttttgtt ttgttttgtt ttgttagttg ttgttttcct 240 cagacaggac cttgtcaacg ctttcaaata tgtaggctgt ttgctgtttc ctttatgttg 300 gtccctgaga aggatctgcc cttctaccct gtttccctgg ggggtgtgga cagagccttt 360 gtctttgggg aagggggtca tcttgggaaa aggagaacag ggcatcctga ggacctgctc 420 cgtctaagga gagaaagccg aacagatggc agctgccacg cagagggcac tttgtaggaa 480 ctctggctgg agcaggcttc ctgcgctcca atgccaaatc cttcccttc 529 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 43 gacatggttt tgccatgttg 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 44 cagccttatc tttgtttctc tgg 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 45 cgtgctggca aacttgaaat 20 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 46 ccaatgactc ccatattgct g 21 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 47 aagtgatcca cccacctgag 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 48 tccatgattc tgcggtgtaa 20 <210> 49 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 49 gctttcatgg tgtgggcta 19 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 50 gagggagatc tgggactcct 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Fwd) <400> 51 aggtgtacca accccagaca 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer (Rev) <400> 52 gaagggaagg atttggcatt 20

Claims (11)

  1. SPCS3(Signal Peptidase Complex Subunit 3) 유전자의 단일염기다형성(single nucleotide polymorphism, SNP)인 rs17688188을 포함하는, 뇌동맥류 진단용 SNP 마커 조성물.
    SPCS3 (Signal Peptidase Complex Subunit 3) comprising a single nucleotide polymorphism (single nucleotide polymorphism, SNP) of the rs17688188, SNP marker composition for cerebral aneurysm diagnosis.
  2. 제1항에 있어서,
    상기 SPCS3 유전자의 SNP인 rs17688188는 서열번호 11의 26번째 뉴클레오타이드를 포함하는 것인, 뇌동맥류 진단용 SNP 마커 조성물.
    The method of claim 1,
    The SNP of the SPCS3 gene, rs17688188, which comprises the 26th nucleotide of SEQ ID NO: 11, SNP marker composition for cerebral aneurysm diagnosis.
  3. 제1항에 있어서, 상기 조성물은
    1) GBA(Glucocerebrosidase) 유전자의 SNP인 rs75822236,
    2) TCF24(transcription factor 24) 유전자의 SNP인 rs112859779,
    3) OLFML2A(Olfactomedin Like 2A) 유전자의 SNP인 rs79134766,
    4) ARHGAP32(Rho GTPase Activating Protein 32) 유전자의 SNP인 rs371331393,
    5) CD163L1(CD163 Molecule Like 1) 유전자의 SNP인 rs138525217,
    6) CUL4A(cullin 4A) 유전자의 SNP인 rs74115822,
    7) LOC102724084 유전자의 SNP인 rs75861150,
    8) LRRC3(Leucine rich repeat containing 3) 유전자의 SNP인 rs116969723,
    9) RNF144A(Ring Finger Protein 144A) 유전자의 SNP인 rs6741819,
    10) FLJ45964 유전자의 SNP인 rs59626274,
    11) LINGO2(Leucine Rich Repeat And Ig Domain Containing 2) 유전자의 SNP인 rs56942085, 및
    12) MINK1(misshapen/Nck-interacting kinase(NIK)-related kinase 1) 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP를 추가로 포함하는 것인, 뇌동맥류 진단용 SNP 마커 조성물.
    The method of claim 1, wherein the composition is
    1) GBA (Glucocerebrosidase) SNP of rs75822236,
    2) rs112859779, the SNP of the TCF24 (transcription factor 24) gene,
    3) rs79134766, the SNP of the OLFML2A (Olfactomedin Like 2A) gene,
    4) rs371331393, a SNP of the ARHGAP32 (Rho GTPase Activating Protein 32) gene,
    5) rs138525217, the SNP of the CD163L1 (CD163 Molecule Like 1) gene,
    6) rs74115822, which is the SNP of the CUL4A (cullin 4A) gene,
    7) rs75861150, a SNP of the LOC102724084 gene,
    8) rs116969723, a SNP of the LRRC3 (Leucine rich repeat containing 3) gene,
    9) RNF144A (Ring Finger Protein 144A) gene SNP, rs6741819,
    10) rs59626274, a SNP of the FLJ45964 gene,
    11) LINGO2 (Leucine Rich Repeat And Ig Domain Containing 2) gene SNP rs56942085, and
    12) MINK1 (misshapen/Nck-interacting kinase (NIK)-related kinase 1) SNP of the gene, which further comprises one or more SNPs selected from the group consisting of rs72835045, a SNP marker composition for cerebral aneurysm diagnosis.
  4. SPCS3 유전자의 SNP인 rs17688188를 검출 또는 증폭할 수 있는 제제를 포함하는, 뇌동맥류 진단용 조성물.
    A composition for diagnosing a cerebral aneurysm, comprising an agent capable of detecting or amplifying the SNP of the SPCS3 gene, rs17688188.
  5. 제4항에 있어서, 상기 조성물은
    1) GBA 유전자의 SNP인 rs75822236,
    2) TCF24유전자의 SNP인 rs112859779,
    3) OLFML2A 유전자의 SNP인 rs79134766,
    4) ARHGAP32 유전자의 SNP인 rs371331393,
    5) CD163L1 유전자의 SNP인 rs138525217,
    6) CUL4A 유전자의 SNP인 rs74115822,
    7) LOC102724084 유전자의 SNP인 rs75861150,
    8) LRRC3 유전자의 SNP인 rs116969723,
    9) RNF144A 유전자의 SNP인 rs6741819,
    10) FLJ45964 유전자의 SNP인 rs59626274,
    11) LINGO2 유전자의 SNP인 rs56942085, 및
    12) MINK1 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP를 검출 또는 증폭할 수 있는 제제를 추가로 포함하는 것인, 뇌동맥류 진단용 조성물.
    The method of claim 4, wherein the composition is
    1) rs75822236, which is the SNP of the GBA gene,
    2) rs112859779, the SNP of the TCF24 gene,
    3) rs79134766, the SNP of the OLFML2A gene,
    4) rs371331393, a SNP of the ARHGAP32 gene,
    5) rs138525217, which is the SNP of the CD163L1 gene,
    6) rs74115822, a SNP of the CUL4A gene,
    7) rs75861150, a SNP of the LOC102724084 gene,
    8) rs116969723, a SNP of the LRRC3 gene,
    9) rs6741819, a SNP of the RNF144A gene,
    10) rs59626274, a SNP of the FLJ45964 gene,
    11) rs56942085, which is a SNP of the LINGO2 gene, and
    12) A composition for diagnosing a cerebral aneurysm further comprising an agent capable of detecting or amplifying one or more SNPs selected from the group consisting of rs72835045, which is a SNP of the MINK1 gene.
  6. 개체로부터 분리된 생물학적 시료로부터, SPCS3 유전자의 SNP인 rs17688188의 대립형질을 결정하는 단계를 포함하는, 뇌동맥류 진단을 위한 정보 제공 방법.
    A method for providing information for diagnosing a cerebral aneurysm comprising the step of determining an allele of rs17688188, a SNP of the SPCS3 gene, from a biological sample isolated from the individual.
  7. 제6항에 있어서,
    상기 방법은 SPCS3 유전자의 SNP인 rs17688188의 대립형질이 A인 경우, 뇌동맥류가 발병하지 않은 것으로 판별하거나 발병 위험을 낮은 수준으로 예측하는 단계를 추가로 포함하는 것인, 뇌동맥류 진단을 위한 정보 제공 방법.
    The method of claim 6,
    The method further comprises determining that the cerebral aneurysm has not occurred or predicting the risk of developing a cerebral aneurysm at a low level when the allele of rs17688188, the SNP of the SPCS3 gene is A, providing information for diagnosis of a cerebral aneurysm Way.
  8. 제6항에 있어서,
    상기 방법은 개체로부터 분리된 생물학적 시료로부터,
    1) GBA 유전자의 SNP인 rs75822236,
    2) TCF24 유전자의 SNP인 rs112859779,
    3) OLFML2A 유전자의 SNP인 rs79134766,
    4) ARHGAP32 유전자의 SNP인 rs371331393,
    5) CD163L1 유전자의 SNP인 rs138525217,
    6) CUL4A 유전자의 SNP인 rs74115822,
    7) LOC102724084 유전자의 SNP인 rs75861150,
    8) LRRC3 유전자의 SNP인 rs116969723,
    9) RNF144A 유전자의 SNP인 rs6741819,
    10) FLJ45964 유전자의 SNP인 rs59626274,
    11) LINGO2 유전자의 SNP인 rs56942085, 및
    12) MINK1 유전자의 SNP인 rs72835045로 이루어진 군에서 선택되는 하나 이상의 SNP의 대립형질을 결정하는 단계를 추가로 포함하는, 뇌동맥류 진단을 위한 정보 제공 방법.
    The method of claim 6,
    The method comprises from a biological sample isolated from an individual,
    1) rs75822236, which is the SNP of the GBA gene,
    2) rs112859779, a SNP of the TCF24 gene,
    3) rs79134766, the SNP of the OLFML2A gene,
    4) rs371331393, a SNP of the ARHGAP32 gene,
    5) rs138525217, which is the SNP of the CD163L1 gene,
    6) rs74115822, a SNP of the CUL4A gene,
    7) rs75861150, a SNP of the LOC102724084 gene,
    8) rs116969723, a SNP of the LRRC3 gene,
    9) rs6741819, a SNP of the RNF144A gene,
    10) rs59626274, a SNP of the FLJ45964 gene,
    11) rs56942085, which is a SNP of the LINGO2 gene, and
    12) A method for providing information for diagnosis of a cerebral aneurysm, further comprising the step of determining an allele of one or more SNPs selected from the group consisting of rs72835045, which is a SNP of the MINK1 gene.
  9. 제8항에 있어서, 상기 방법은
    1) GBA 유전자의 SNP인 rs75822236의 대립형질이 C인 경우,
    2) ARHGAP32 유전자의 SNP인 rs371331393의 대립형질이 G인 경우,
    3) CD163L1 유전자의 SNP인 rs138525217의 대립형질이 C인 경우,
    4) CUL4A 유전자의 SNP인 rs74115822의 대립형질이 G인 경우,
    5) LINGO2 유전자의 SNP인 rs56942085의 대립형질이 G인 경우, 또는 이들 중 둘 이상의 조합인 경우, 뇌동맥류가 발병한 것으로 판별하거나 발병 위험을 높은 수준으로 예측하는 단계를 추가로 포함하는 것인, 뇌동맥류 진단을 위한 정보 제공 방법.
    The method of claim 8, wherein the method
    1) When the allele of rs75822236, the SNP of the GBA gene, is C,
    2) When the allele of rs371331393, the SNP of the ARHGAP32 gene, is G,
    3) When the allele of rs138525217, which is the SNP of the CD163L1 gene, is C,
    4) When the allele of rs74115822, the SNP of the CUL4A gene, is G,
    5) When the allele of rs56942085, which is the SNP of the LINGO2 gene, is G, or a combination of two or more of them, it further comprises the step of determining that a cerebral aneurysm has occurred or predicting the risk of developing a high level, How to provide information for diagnosing a cerebral aneurysm.
  10. 제8항에 있어서, 상기 방법은
    1) TCF24 유전자의 SNP인 rs112859779의 대립형질이 T인 경우,
    2) OLFML2A 유전자의 SNP인 rs79134766의 대립형질이 A인 경우,
    3) LOC102724084 유전자의 SNP인 rs75861150의 대립형질이 C인 경우,
    4) LRRC3 유전자의 SNP인 rs116969723의 대립형질이 A인 경우,
    5) RNF144A 유전자의 SNP인 rs6741819의 대립형질이 T인 경우,
    6) FLJ45964 유전자의 SNP인 rs59626274의 대립형질이 T인 경우,
    7) MINK1 유전자의 SNP인 rs72835045의 대립형질이 A인 경우, 또는 이들 중 둘 이상의 조합인 경우, 뇌동맥류가 발병하지 않은 것으로 판별하거나 발병 위험을 낮은 수준으로 예측하는 단계를 추가로 포함하는 것인, 뇌동맥류 진단을 위한 정보 제공 방법.
    The method of claim 8, wherein the method
    1) When the allele of rs112859779, the SNP of the TCF24 gene, is T,
    2) When the allele of rs79134766, which is the SNP of the OLFML2A gene, is A,
    3) When the allele of rs75861150, the SNP of the LOC102724084 gene, is C,
    4) When the allele of rs116969723, the SNP of the LRRC3 gene, is A,
    5) When the allele of rs6741819, the SNP of the RNF144A gene, is T,
    6) When the allele of rs59626274, which is a SNP of the FLJ45964 gene, is T,
    7) When the allele of rs72835045, the SNP of the MINK1 gene, is A, or a combination of two or more of them, it further comprises the step of determining that the cerebral aneurysm has not occurred or predicting the risk of developing at a low level. , Method of providing information for diagnosis of cerebral aneurysm.
  11. 제6항에 있어서,
    상기 개체는 한국인 및 아시아인인 것인, 뇌동맥류 진단을 위한 정보 제공 방법.
    The method of claim 6,
    The individual is a Korean and Asian, the method of providing information for diagnosing a cerebral aneurysm.
KR1020190039250A 2019-04-03 2019-04-03 SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene KR102158723B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190039250A KR102158723B1 (en) 2019-04-03 2019-04-03 SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190039250A KR102158723B1 (en) 2019-04-03 2019-04-03 SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene

Publications (1)

Publication Number Publication Date
KR102158723B1 true KR102158723B1 (en) 2020-09-22

Family

ID=72706875

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190039250A KR102158723B1 (en) 2019-04-03 2019-04-03 SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene

Country Status (1)

Country Link
KR (1) KR102158723B1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101211280B1 (en) * 2010-03-26 2012-12-11 가톨릭대학교 산학협력단 Novel markers for diagnosing brain disease caused by brain injury and use thereof
KR101412649B1 (en) * 2012-01-27 2014-07-01 가천대학교 산학협력단 Biomarker Indicative of Reduce or Alleviation of Symptom of Brain Injury
KR20170134203A (en) 2016-05-27 2017-12-06 (주) 메디젠휴먼케어 A system and apparatus for disease-related genomic analysis using SNP
KR101974786B1 (en) * 2018-08-17 2019-05-31 (주)제이엘케이인스펙션 Method and system for predicting severity and prognosis using characteristics of cerebral aneurysm lesions
KR102009838B1 (en) * 2018-03-19 2019-08-12 한림대학교 산학협력단 Information providing method for predicting risk of development of cerebral aneurysm or diagnosing same

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101211280B1 (en) * 2010-03-26 2012-12-11 가톨릭대학교 산학협력단 Novel markers for diagnosing brain disease caused by brain injury and use thereof
KR101412649B1 (en) * 2012-01-27 2014-07-01 가천대학교 산학협력단 Biomarker Indicative of Reduce or Alleviation of Symptom of Brain Injury
KR20170134203A (en) 2016-05-27 2017-12-06 (주) 메디젠휴먼케어 A system and apparatus for disease-related genomic analysis using SNP
KR102009838B1 (en) * 2018-03-19 2019-08-12 한림대학교 산학협력단 Information providing method for predicting risk of development of cerebral aneurysm or diagnosing same
KR101974786B1 (en) * 2018-08-17 2019-05-31 (주)제이엘케이인스펙션 Method and system for predicting severity and prognosis using characteristics of cerebral aneurysm lesions

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Journal of Clinical Medicine (2019.02.25.) 8:275* *
NCBI, dbSNP, Submitted SNP(ss) Details: ss1924274502 (2015.10.16.)* *
World Neurosurgery (2018) 110:e823-e829 *
Yonsei Medical Journal (2017) 58(5):1006-1011 *

Similar Documents

Publication Publication Date Title
KR102009838B1 (en) Information providing method for predicting risk of development of cerebral aneurysm or diagnosing same
US20070065865A1 (en) Polymorphisms Associated with Coronary Artery Disease
US20100272713A1 (en) Genetic Markers Associated with Endometriosis and Use Thereof
US20090035768A1 (en) Method of Determining Predisposition to Scoliosis and Uses Thereof
EP2393939B1 (en) A snp marker of breast and ovarian cancer risk
KR20110034297A (en) Marker for diagnosing intrinsic atopic dermatitis and use thereof
KR102158719B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of LOC102724084 gene
KR102158723B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene
KR102158725B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of MINK1 gene
KR102158716B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of ARHGAP32 gene
KR102158713B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of GBA gene
KR102158721B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of RNF144A gene
KR102158715B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of OLFML2A gene
KR102158720B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of LRRC3 gene
KR102158717B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of CD163L1 gene
KR102158714B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of TCF24 gene
KR102158722B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of FLJ45964 gene
KR102158724B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of LINGO2 gene
KR102158718B1 (en) SNP marker for diagnosis of intracranial aneurysm comprising SNP of CUL4A gene
US20200087728A1 (en) Genetic markers associated with endometriosis and use thereof
US20100003691A1 (en) Genetic Markers Associated with Degenerative Disc Disease and Uses Thereof
WO2017079551A1 (en) Methods for diagnosis and prognosis of venous thrombosis
JP2006296270A (en) Method for detecting diathesis of type 2 diabetes by prkaa2 gene polymorphism
KR102181563B1 (en) Single nucleotide polymorphism marker for diagnosing precocious puberty or prognosising treatment of precocious puberty, and use thereof
WO2015037681A1 (en) Test method for evaluating the risk of anti-thyroid drug-induced agranulocytosis, and evaluation kit

Legal Events

Date Code Title Description
GRNT Written decision to grant